Recombinant c-reactive protein

Abstract

To improve accuracy of immunoassay in a CRP high concentration region, in immunoassay using a latex regent.SOLUTION: Provided is a recombinant C-reactive protein produced by genetic recombination, in which 55% or more of N-termini of the C-reactive protein are pyroglutamylated.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a C-reactive protein (hereinafter also referred to as "CRP") produced by recombinant gene technology and its uses. More specifically, the present invention relates to a recombinant CRP in which the N-terminal structure of CRP has been modified, a calibrator and a control serum using the recombinant CRP, and a method for quantifying CRP by antibody-antigen reaction. [Background technology]

[0002] CRP is a protein that reacts with the C-polysaccharide of the pneumococcus capsule and is also known as a representative inflammation marker because it is a type of acute phase protein. In infectious and inflammatory diseases, the blood concentration of CRP increases significantly and decreases rapidly as the condition improves, so the quantitative determination of CRP is an indicator for judging the severity of various diseases and observing the progress of treatment. The CRP concentration in the blood of healthy people is generally 0.3 mg / dL or less, but in patients with inflammation or inflammatory diseases, it increases rapidly by several hundred to several thousand times in a short period of time. For this reason, it is necessary to accurately measure CRP in a wide range of concentrations, from low to high, in samples.

[0003] In the field of clinical testing, there are methods that utilize antigen-antibody reactions to quantify CRP concentrations in blood, including enzyme immunoassay, luminescence immunoassay, latex turbidimetric immunoassay, and immunochromatography. Among these methods, latex turbidimetric immunoassay is particularly widely used in routine testing because it is easy to operate and can be automated using an analytical device. In latex turbidimetric immunoassay, blood CRP concentrations are quantified based on a calibration curve using calibrators with known concentrations, and the accuracy of the calibration curve is guaranteed by measuring control serum.

[0004] The above-mentioned calibrators and control serum use natural CRP purified from human body fluids such as ascites, but there is a risk that serum components other than CRP may be mixed in and affect the measurement of blood CRP concentration. In addition, since human body fluids, which are the biological raw material, are handled in the isolation and purification stages of CRP, there is a risk of secondary pathogenic infection, and there are also issues with safety in production. Furthermore, the CRP content in human body fluids varies, which is a problem from the perspective of stable supply. On the other hand, recombinant CRP using microorganisms, etc., does not use human body fluids as a raw material, so there is no risk of contamination with human-derived serum components or secondary infection, and if a stable expression system for recombinant proteins can be constructed using genetic engineering technology, the target protein can be stably supplied.

[0005] Concerning the expression of recombinant CRP by microorganisms, successful cases have already been reported in Escherichia coli, yeast, etc. (Patent Document 1, Non-Patent Document 1). However, in measuring the concentration of recombinant CRP by latex immunoturbidimetry, there was a problem that the measured value was lower than the actual CRP concentration in the high CRP concentration range. Therefore, in order to use recombinant CRP as a diagnostic drug raw material for calibrators, control serum, etc., it is necessary to improve the accuracy of measurement in the high CRP concentration range.

[0006] Many proteins undergo chemical or structural changes due to post-translational modification. One of the post-translational modifications is pyroglutamylation, in which the carboxyl group and amino group of glutamine or glutamic acid undergo an intramolecular condensation reaction to convert them to pyroglutamic acid. Animals and plants possess many pyroglutamyl peptides modified by pyroglutamylation, including proteins such as β-amyloid, collagen, and IgG2. CRP is also a pyroglutamyl peptide. However, it has been reported that recombinant CRP contains both those whose N-terminus remains glutamine and those whose N-terminus has been converted to pyroglutamylic acid (Non-Patent Document 2). The relationship between such an N-terminal structure of CRP and the antibody-antigen reaction in latex immunoturbidimetry has not been reported so far. [Prior art documents] [Patent documents]

[0007] Patent Document 1: JP 2000-14388 A [Non-patent literature]

[0008] Non-patent document 1: TOSHIO TANAKA et al., BIOCHEM BIOPHYS RES COMMUN., 295(2002), p163-166 Non-patent literature 2: Clinical Testing, Vol. 46, No. 9, p973-981 (September 2002) Summary of the Invention [Problem to be solved by the invention]

[0009] An object of the present invention is to improve the accuracy of measurement in the high CRP concentration range, particularly when using latex immunoturbidimetric assay. [Means for solving the problem]

[0010] In view of the above circumstances, the present inventors have conducted extensive research and found a method for overcoming the above problems by converting the N-terminal structure of recombinant CRP. Specifically, the inventors found that it is possible to accurately measure CRP concentrations in high CRP concentration ranges by using recombinant CRP in which 55% or more of the total N-terminus is pyroglutamylated, as measured by intact MS, and thus completed the present invention.

[0011] Specific embodiments of the present invention are as follows. Item 1. A recombinant C-reactive protein produced by genetic recombination, in which 55% or more of the N-terminus of the C-reactive protein is pyroglutamylated. Item 2. The recombinant C-reactive protein according to Item 1, wherein 65% or more of the N-terminus of the C-reactive protein is pyroglutamylated. Item 3. The recombinant C-reactive protein according to Item 1, wherein 75% or more of the N-terminus of the C-reactive protein is pyroglutamylated. Item 4. The recombinant C-reactive protein according to Item 1, wherein 85% or more of the N-terminus of the C-reactive protein is pyroglutamylated. Item 5. The recombinant C-reactive protein according to any one of items 1 to 4, wherein the recombinant C-reactive protein is a bacterial recombinant protein. Item 6. The recombinant C-reactive protein according to Item 5, wherein the bacterium is Escherichia coli. Item 7. A recombinant C-reactive protein according to any one of items 1 to 6, wherein the C-reactive protein is of human origin. Item 8. A recombinant C-reactive protein according to any one of items 1 to 7, wherein the C-reactive protein consists of any one of the following polypeptides (a) to (c): (a) a polypeptide as set forth in SEQ ID NO: 1 or SEQ ID NO: 2 (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against anti-C-reactive protein antibodies. (c) a polypeptide having an amino acid sequence that is 90% or more identical to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against anti-C-reactive protein antibodies. Item 9. A calibrator comprising the C-reactive protein according to any one of items 1 to 8. Item 10. A control serum containing C-reactive protein according to any one of items 1 to 8. Item 11. A method for quantifying C-reactive protein in a sample using a calibrator containing C-reactive protein according to Item 9. Item 12. A method for quantifying C-reactive protein in a sample using a control serum containing C-reactive protein according to Item 10. Item 13. A method for quantifying C-reactive protein in a sample according to Item 11 or 12, by latex immunoturbidimetric assay using latex particles to which anti-C-reactive protein antibodies are immobilized. Effect of the Invention

[0012] The recombinant CRP of the present invention can improve the accuracy of measurement in the high CRP concentration range by latex immunoturbidimetry, and is useful as a diagnostic drug raw material used for control serum or calibrator. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 shows the results of SDS-PAGE of recombinant CRP1 in Example 3. [Diagram 2] FIG. 1 shows the results of SDS-PAGE of recombinant CRP2 in Example 3. [Diagram 3] FIG. 13 shows the results of comparative studies of the enlarged spectra of average decavalent ions of various CRP1s at LC / MS elution times of 1.7 to 2.0 minutes in Example 5. [Figure 4] FIG. 13 shows the results of comparative studies of the enlarged spectra of average decavalent ions of various CRP2s at LC / MS elution times of 1.7 to 2.0 minutes in Example 5. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] (C-reactive protein polypeptide) The recombinant CRP of the present invention includes CRP derived from mammals such as humans, dogs, cats, mice, rats, rabbits, goats, etc. Among them, CRP derived from humans, dogs, or cats is more preferable, and CRP derived from humans is particularly preferable.

[0015] One embodiment of the present invention is a CRP comprising any one of the following polypeptides (a) to (c): (a) A polypeptide as set forth in SEQ ID NO:1 or SEQ ID NO:2. (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues have been substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against anti-C-reactive protein antibodies. (c) A polypeptide consisting of an amino acid sequence having an identity of 90% or more to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against anti-C-reactive protein antibody.

[0016] In the above polypeptide (a), SEQ ID NO: 1 or SEQ ID NO: 2 is the amino acid sequence of mature CRP consisting of 206 amino acids. When the recombinant CRP of the present invention is expressed extracellularly in a gram-negative bacterium or the like, an appropriate secretion signal suited to the host may be imparted, and in that case, the full-length amino acid sequence consists of 227 amino acids as shown in SEQ ID NO: 3 or SEQ ID NO: 4. Among these, the 206 amino acids from position 22 to position 227 correspond to the mature CRP of SEQ ID NO: 1 or SEQ ID NO: 2, and the amino acid sequence from methionine to position 21 is the amino acid sequence of the secretion signal. When the recombinant CRP of the present invention is expressed intracellularly, the secretion signal may be deleted.

[0017] The recombinant CRP of the present invention is not limited to the above (a), but may be any of the following: (b) a polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody; or (c) a polypeptide consisting of an amino acid sequence having an identity of 90% or more to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against an anti-C-reactive protein antibody; may be also possible.

[0018] In the above polypeptide (b), the lower limit of "several" is 2. The upper limit is not limited as long as the antigenicity against anti-C-reactive protein antibody is maintained, but it is necessary to be within a range that does not significantly impair the three-dimensional structure of the protein of amino acid residues or the antigenicity against anti-C-reactive protein antibody. For example, the number is a number corresponding to less than 20% of all amino acids, preferably a number corresponding to less than 15%, more preferably a number corresponding to less than 10%, even more preferably a number corresponding to less than 5%, and even more preferably a number corresponding to less than 1%. In other words, the number is, for example, 41 or less, preferably 31 or less, more preferably 21 or less, even more preferably 10 or less, even more preferably 5 or less, even more preferably 4 or less, and even more preferably 3 or less.

[0019] The polypeptide of (c) above preferably has an identity of 80% or more with the amino acid sequence of (a) above, and this identity is preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 98% or more, and more preferably 99% or more.

[0020] The identity of amino acid sequences can be calculated using an analytical tool that is commercially available or available via an electric communication line (Internet). In the present invention, the identity is calculated by selecting blastp on the BLAST website, which is a homology search program published by the National Center for Biotechnology Information (NCBI), and using default (initial setting) parameters.

[0021] Whether or not a certain polypeptide has antigenicity against anti-C-reactive protein antibodies can be determined by determining whether or not a latex particle agglutination reaction occurs and the CRP concentration can be measured in the "Method for measuring C-reactive protein concentration" described below.

[0022] A modified protein having antigenicity against anti-C-reactive protein antibodies and its gene can be obtained by modifying the base sequence encoding the amino acid set forth in SEQ ID NO: 1 or SEQ ID NO: 2 using a commercially available kit such as Transformer Mutagenesis Kit (Clonetech), EXOIII / Mung Bean Deletion Kit (Stratagene), QuickChange Site Directed Mutagenesis Kit (Stratagene), or KOD-Plus-Mutagenesis Kit (Toyobo) or a PCR method. The antigenicity of the protein encoded by the obtained gene can be confirmed, for example, by introducing the obtained gene into Escherichia coli to prepare a transformant, culturing the transformant to produce a protein, and measuring the transformant, the cell lysate of the transformant, or the purified protein by the "Method for measuring the concentration of C-reactive protein" described below.

[0023] (C-reactive protein DNA) The DNA encoding the recombinant CRP of the present invention includes DNA encoding CRP derived from mammals such as humans, dogs, cats, mice, rats, rabbits, goats, etc. Among these, DNA encoding CRP derived from humans, dogs, or cats is more preferable, and DNA encoding CRP derived from humans is further preferable.

[0024] One embodiment of the present invention is a CRP comprising any one of the following DNAs (d) to (f): (d) DNA encoding the amino acid sequence of any one of the above CRPs (a) to (c). (e) DNA consisting of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 (f) DNA consisting of a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6, and encoding a polypeptide having antigenicity against anti-C-reactive protein antibody. (g) DNA consisting of a nucleotide sequence having an identity of 80% or more with the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6 and encoding a polypeptide having antigenicity against anti-C-reactive protein antibody.

[0025] In the DNA of (d) above, the amino acid sequence of CRP of the present invention is the amino acid sequence of CRP shown in any one of (a) to (c) above. In the DNA of the present invention, when there are multiple codons corresponding to each amino acid in the amino acid sequence, there is no particular limitation on the selection. Specifically, an example is (e) DNA consisting of the base sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6.

[0026] In addition, when a secretory signal sequence is to be added as described above, it is preferable to use the DNA shown in SEQ ID NO: 7 or SEQ ID NO: 8. In SEQ ID NO: 7 or SEQ ID NO: 8, the 206 amino acids from positions 22 to 227 in the full-length CRP shown in the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4 above encode mature CRP and the portion from methionine to position 21 corresponding to the secretory signal.

[0027] In addition, the DNA of the present invention is not limited to the above. (f) a DNA encoding a polypeptide having an antigenicity against an anti-C-reactive protein antibody, comprising a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6, or (g) DNA that consists of a nucleotide sequence having an identity of 80% or more with the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6 and encodes a polypeptide having antigenicity against an anti-C-reactive protein antibody; may be also possible.

[0028] Furthermore, when the DNA encoding the CRP of the present invention is introduced into a host other than the origin organism, such as Escherichia coli, to express the CRP of the present invention, the base sequence may be modified to match the codon usage of the host organism in order to improve expression efficiency.

[0029] In the DNA of (f) above, the lower limit of "several" is 2. The upper limit is not limited as long as the antigenicity of the polypeptide encoded by the DNA against anti-C-reactive protein antibody is maintained, but it is necessary to be within a range that does not significantly impair the three-dimensional structure of the protein of the amino acid residues or the antigenicity against anti-C-reactive protein antibody. For example, it is a number corresponding to less than 20% of the total amino acids of the polypeptide before modification, preferably a number corresponding to less than 15%, more preferably a number corresponding to less than 10%, even more preferably a number corresponding to less than 5%, and even more preferably a number corresponding to less than 1%. In other words, the number is, for example, 124 or less (the number of bases corresponding to 20% of the total amino acids), preferably 93 or less (15%), more preferably 62 or less (10%), more preferably 31 or less (5%), more preferably 20 or less, more preferably 15 or less, more preferably 10 or less, more preferably 5 or less, more preferably 4 or less, and even more preferably 3 or less.

[0030] In the DNA of (g) above, the identity with the base sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 is preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more.

[0031] The identity of the base sequence can be calculated using an analytical tool that is commercially available or available via an electric communication line (Internet). In the present invention, the identity is calculated by selecting blastn on the website of BLAST, which is a homology search program published by the National Center for Biotechnology Information (NCBI), and using default (initial setting) parameters.

[0032] Whether or not a certain DNA encodes a polypeptide having antigenicity against anti-C-reactive protein antibody can be determined by incorporating the DNA into a commercially available expression vector, expressing it in an appropriate host, and determining whether the antigenicity of the resulting polypeptide against anti-C-reactive protein antibody undergoes a latex particle agglutination reaction in the "Method for measuring C-reactive protein concentration" described below, thereby enabling measurement of CRP concentration.

[0033] (Method of producing C-reactive protein) Another embodiment of the present invention is a vector incorporating the above DNA, a transformant containing the vector, or a method for producing recombinant CRP comprising culturing the transformant. The recombinant CRP of the present invention can be easily produced by inserting the gene into an appropriate vector to prepare a recombinant vector, transforming an appropriate host cell with the recombinant vector to prepare a transformant, and culturing the transformant.

[0034] The vector is not particularly limited as long as it can maintain replication or autonomously grow in various host cells of prokaryotic cells and / or eukaryotic cells, and includes plasmid vectors, phage vectors, virus vectors, etc. The preparation of the recombinant vector is not particularly limited, and may be carried out according to a conventional method, for example, by linking the gene of the CRP of the present invention to these vectors using appropriate restriction enzymes and ligase, or, if necessary, a linker or adapter DNA. In addition, if the gene fragment is amplified and prepared using a DNA polymerase that adds a single base to the amplified end, such as Taq DNA polymerase, it can be connected to the vector by TA cloning.

[0035] The host cell is not particularly limited as long as a recombinant expression system is established, but preferably includes microorganisms such as Escherichia coli, Bacillus subtilis, actinomycetes, Aspergillus oryzae, and yeast, as well as insect cells, animal cells, and higher plants. More preferably, microorganisms are used, and particularly preferably, Escherichia coli (e.g., K12 strain, B strain, etc.). The preparation of the transformant is not particularly limited, but may be carried out according to a conventional method. When the host is Escherichia coli, Escherichia coli C600, Escherichia coli HB101, Escherichia coli DH5α, Escherichia coli JM109, Escherichia coli BL21, etc. are used, and examples of the vector include pBR322, pUC19, pBluescript, pQE, and pET. When the host is a yeast, suitable examples include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida utilis, and Pichia pastoris. Examples of vectors include pAUR101, pAUR224, and pYE32. When the host is a filamentous fungus, examples include Aspergillus oryzae and Aspergillus niger.

[0036] When the obtained transformant is cultured for a certain period of time under appropriate culture conditions depending on the host cell, the recombinant CRP of the present invention is expressed by the incorporated gene and accumulates in the transformant.

[0037] The recombinant CRP of the present invention accumulated in the transformant can be used unpurified, but it is preferable to use the purified form. The purification method is not particularly limited, but for example, the transformant or its culture after culture is homogenized in an appropriate buffer, and a cell extract is obtained by ultrasonication, surfactant treatment, etc., and the cell extract can be appropriately combined with a separation technique commonly used for separating and purifying proteins. Examples of such separation techniques include, but are not limited to, methods that utilize differences in solubility such as salting out and solvent precipitation, methods that utilize differences in molecular weight such as dialysis, ultrafiltration, gel filtration, non-denaturing polyacrylamide gel electrophoresis (PAGE), and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), methods that utilize charges such as ion exchange chromatography and hydroxyapatite chromatography, methods that utilize specific affinity such as affinity chromatography using a phosphorylcholine-immobilized column, methods that utilize differences in hydrophobicity such as reversed-phase high performance liquid chromatography, and methods that utilize differences in isoelectric points such as isoelectric focusing. For example, a purified preparation can be obtained by separation and purification by gel filtration using Sephadex gel (GE Healthcare Biosciences) or column chromatography using DEAE Sepharose CL-6B (GE Healthcare Biosciences) or Octyl Sepharose CL-6B (GE Healthcare Biosciences).

[0038] (Method for N-Terminal Cyclization of C-Reactive Protein) The recombinant CRP of the present invention is a recombinant CRP in which 55% or more of the total N-terminus is pyroglutamylated, specifically, a recombinant CRP in which the N-terminal cyclization rate is calculated to be 55% or more.

[0039] In the present invention, the "N-terminal cyclization rate" is an index showing the ratio of recombinant CRP whose N-terminus is pyroglutamylated among recombinant CRP, and is calculated according to the "Method for measuring the N-terminal cyclization rate of C-reactive protein" described below. When measured by the "Method for measuring the N-terminal cyclization rate of C-reactive protein" described below, it is desirable that the N-terminal cyclization rate retains 55% or more of the recombinant CRP, preferably 60% or more, more preferably 65% ​​or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, and even more preferably 98% or more.

[0040] In the present invention, the "N-terminus" refers to the N-terminus of mature CRP from which the secretory signal sequence has been removed, and specifically refers to glutamine at position 1 in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 (or position 22 in SEQ ID NO: 3 or SEQ ID NO: 4), or pyroglutamic acid after intramolecular condensation reaction of glutamine at position 1. Glutamine at position 1 is converted to pyroglutamic acid by cyclization treatment.

[0041] In the present invention, the "cyclization treatment" refers to a treatment that promotes the conversion of CRP from the state in which the N-terminus is glutamine (hereinafter referred to as "uncyclized type") to the state in which the N-terminus is pyroglutamic acid (hereinafter referred to as "cyclized type"), and either an enzymatic or non-enzymatic method may be selected. An enzymatic method can be performed, for example, by reacting an enzyme such as glutaminyl cyclase at an appropriate temperature, but the enzyme and temperature conditions are not limited thereto. A non-enzymatic method requires setting the type of buffer, pH, treatment temperature, treatment time, CRP concentration, etc., but is not particularly limited as long as it is a condition that does not adversely affect CRP, uncyclized CRP, and cyclized CRP. An example is shown below.

[0042] Examples of the buffer solution used in the cyclization treatment include Good's buffer solutions such as acetate buffer, MES buffer, and PIPES buffer, phosphate buffer, Tris-HCl buffer, borate buffer, and glycine buffer. The pH condition is preferably in the range of pH 7 to pH 12, and more preferably pH 7 to pH 10. The temperature condition is preferably 4°C to 55°C, and more preferably 37°C to 50°C. The CRP concentration is preferably 0.1 mg / dL to 500 mg / dL, and more preferably 10 mg / dL to 300 mg / dL. The reaction time is preferably 30 minutes to 4 weeks, and more preferably 16 hours to 3 weeks.

[0043] (Method for measuring C-reactive protein concentration) In the present invention, the CRP concentration is measured under the following conditions. The method for measuring the CRP concentration is a method in which an antigen-antibody reaction occurs between latex particles to which anti-C-reactive protein antibodies are immobilized and CRP (a test substance) in a test sample, and the CRP concentration is measured from the degree of agglutination reaction of the latex particles. In the present invention, the term "CRP concentration" specifically means a value measured by the following method, unless otherwise specified.

[0044] <Reagents> Denka Seiken CRP Latex X2 "Seiken" R1 Reagent (Buffer Solution) · Denka Seiken Co., Ltd. CRP Latex X2 "Seiken" R2 Reagent (Latex (anti-human CRP polyclonal antibody (rabbit) bound latex) suspension) Denka Seiken CRPX2 standard solution H <Measurement sample> The measurement sample is a CRP solution, which is diluted with 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride; pH 7.5) as necessary before use. When preparing a specific CRP concentration, the dilution ratio is determined based on the protein concentration determined by the Bradford protein assay. <Measurement method> The above measurement sample, the above R1 reagent and the above R2 reagent are used under the following conditions to measure the CRP concentration (mg / dL) in the sample using a Hitachi 7180 automatic analyzer. The CRP concentration is calculated according to formula (I). Sample: 2.2μL R1 Reagent: 120μL R2 Reagent: 120μL Measurement method: 2-point end method (18-34) Main wavelength: 546nm Sub-wavelength: 800nm

[0045]

number

[0046] In the present invention, the method for determining whether the reactivity of recombinant CRP to a latex reagent in the high CRP concentration range has been improved is as follows: if the deviation between the CRP concentration value in the high CRP concentration range of natural human CRP measured by the above method and the CRP concentration value in the high CRP concentration range of various recombinant CRPs is 5% or less, the reactivity is determined to have been improved. In the present invention, the high CRP concentration range refers to a CRP concentration range of 10 to 30 mg / dL, but is not particularly limited thereto.

[0047] (Method for measuring the N-terminal cyclization rate of C-reactive protein) In the present invention, the N-terminal cyclization rate of recombinant CRP is measured under the following conditions. This measurement method involves measuring the decavalent ion intensity of the spectrum of uncyclized CRP and the spectrum of cyclized CRP by mass spectrometry, and calculating the ratio of uncyclized CRP to cyclized CRP from each ion intensity. In the present invention, the "spectrum of uncyclized CRP" refers to the spectrum corresponding to a molecular weight of 23045, and the "spectrum of cyclized CRP" refers to the spectrum corresponding to a molecular weight of 23027. In the present invention, the "N-terminal cyclization rate of CRP" specifically means a value measured by the following method, unless otherwise specified.

[0048] <Measurement sample> The measurement sample is a CRP solution, which is used after being diluted with ultrapure water as needed. <Measurement method> Using the above measurement sample and an LC / MS apparatus under the following conditions, measure the spectra of uncyclized CRP and cyclized CRP in the sample. LC conditions Apparatus: ACQUITY UPLC manufactured by Waters Column: Mass PREP Micro Desalting Column 20μm, 2.1×5mm manufactured by Waters Mobile phase: A mixture of water / formic acid (1000:1), B mixture of IPA / ACN / methanol / formic acid (500:300:200:1) Column temperature: 50°C Injection volume: 5 μL MS conditions Apparatus: microOTOF manufactured by BRUKER DALTONICS Ionization method: ESI positive

[0049] <Calculation method for N-terminal cyclization rate> The ratio of uncyclized CRP to cyclized CRP is calculated using the intensity of each 10-valent ion in the average spectrum with an elution time of 1.7 to 2.0 minutes of each CRP spectrum obtained by the above measurement method. The "ratio" in the present invention refers to the ratio of the ion intensity of cyclized CRP when the total of the ion intensities of uncyclized CRP and cyclized CRP is 100, and is calculated by the following formula (II).

[0050]

Equation

[0051] Hereinafter, the present invention will be specifically described by way of examples. Note that the present invention is not particularly limited by the examples.

[0052] Example 1 Introduction of mutation and acquisition of transformant (1) Introduction of mutation The CRP gene was amplified using primers of SEQ ID NO: 9 and 10, using an artificial synthetic gene of SEQ ID NO: 7 or SEQ ID NO: 8, which is a combination of an alkaline phosphatase secretion signal sequence (ATGAAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCC) derived from Escherichia coli and a human-derived mature CRP sequence of SEQ ID NO: 5 or SEQ ID NO: 6, as a template. SEQ ID NO: 9 is a forward primer, and SEQ ID NO: 10 is a reverse primer. The primers have a restriction enzyme site NdeI or a restriction enzyme site BamHI added thereto, respectively. The amplified gene fragment, vector plasmid pBluescript KSN(+) cleaved with restriction enzymes NdeI and BamHI, and In-Fusion Reaction Mix (manufactured by Takara Bio) were added and incubated to construct a plasmid. In this way, recombinant plasmid pBKSN_CRP1 containing SEQ ID NO: 7 and recombinant plasmid pBKSN_CRP2 containing SEQ ID NO: 8, which were designed to express a large amount of CRP gene, were obtained.

[0053] (2) Obtaining transformants Using the plasmid constructed in (1), Escherichia coli JM109 strain competent cells (Toyobo) were transformed and cultured in SOC medium for 1 hr at 37°C, then spread on LB agar medium (containing 1.0% glucose and 50μg / mL ampicillin) to obtain the transformants as colonies. The transformant obtained by introducing pBKSN_CRP1 was named Escherichia coli JM109(pBKSN_CRP1). The transformant obtained by introducing pBKSN_CRP2 in the same manner as above was named Escherichia coli JM109(pBKSN_CRP2).

[0054] Example 2 Expression of CRP gene in Escherichia coli A colony of the transformant Escherichia coli JM109 (pBKSN_CRP1) obtained in Example 1 was inoculated into 5 mL of LB liquid medium (containing 1.0% glucose and 100 μg / mL ampicillin) sterilized in a test tube and cultured at 37° C. for 16 hours. The resulting culture solution was used as a seed culture solution and inoculated into 500 mL of LB liquid medium (containing 0.5% glycerol, 0.05% calcium chloride, 1 mM IPTG, and 50 μg / mL ampicillin) in ten 2 L Sakaguchi flasks, and cultured at 30° C. for 24 hours with a shaking speed of 180 rpm. After the culture was completed, the cells were collected by centrifugation and suspended in 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5), then disrupted using a French press (manufactured by Niro Soavi), and further centrifuged, and the supernatant was obtained as crude purified solution 1. In addition, crude purified solution 2 was also obtained from Escherichia coli JM109 (pBKSN_CRP2) by the same method as above.

[0055] Example 3 Purification of recombinant CRP The crudely purified solution 1 obtained in Example 2 was subjected to affinity purification using PierceTM p-Aminophenyl Phosphoryl Choline Agarose (manufactured by Thermo Scientific). The resin equilibrated with the buffer 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) used in Example 2 was mixed with the crudely purified solution to adsorb the resin, which was washed with the buffer and eluted with 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM EDTA 2 mM, pH 7.5) to obtain recombinant CRP solution 1. This solution was further replaced with the buffer 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) used in Example 2 while removing EDTA by hydrolysis and concentration using a hollow fiber membrane, and further concentrated to an appropriate concentration using a centrifugal ultrafiltration filter (manufactured by Merck) to obtain recombinant CRP1 with high purity. Figure 1 shows the results of SDS-PAGE performed on the obtained recombinant CRP1. As a result, we were successful in improving the purity to a level where impure proteins could not be detected by SDS-PAGE. Furthermore, highly pure recombinant CRP2 was obtained from crude purified solution 2 by the same method as above. Figure 2 shows the results of SDS-PAGE performed on the obtained CRP2. As with CRP1, we were successful in improving the purity to a level where impure proteins could not be detected by SDS-PAGE.

[0056] Example 4 N-Terminal Cyclization of Recombinant CRP The recombinant CRP1 obtained in Example 3 was heated at 37°C for 8 days to obtain a cyclized recombinant CRP1 in which the N-terminus of the recombinant CRP was cyclized by pyroglutamylation. The cyclization treatment was performed using the same buffer as in Example 2, 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5), and the CRP concentration was 300 mg / dL. In addition, a cyclized recombinant CRP2 was obtained from recombinant CRP2 in the same manner as above.

[0057] Example 5 Measurement of N-terminal cyclization rate The recombinant CRP1 and recombinant CRP2 obtained in Example 3, the cyclized recombinant CRP1 and cyclized recombinant CRP2 obtained in Example 4, and natural human CRP (Yashraj) as a positive control were prepared using ultrapure water to give a CRP concentration of 150 mg / dL, and the CRP solutions were measured under the LC / MS conditions described above (see Table 1). In the mass spectrum of each recombinant CRP1 sample, the average decavalent ion with an elution time of 1.7 to 2.0 minutes is shown enlarged in FIG. 3.

[0058] m / z 2305.45 shows the spectrum of uncyclized CRP, and m / z 2303.74 shows the spectrum of cyclized CRP. In the case of natural human CRP, the spectrum of cyclized CRP was prominent. On the other hand, in the case of the recombinant CRP1 obtained in Example 3, the spectrum of uncyclized CRP was higher than that of cyclized CRP. In contrast, in the case of the cyclized recombinant CRP1 obtained in Example 4, the spectrum of cyclized CRP was clearly higher than that of uncyclized CRP. It was shown that pyroglutamylation of CRP was promoted by the N-terminal cyclization treatment in Example 4. Similar results were also obtained in the case of recombinant CRP2 and cyclized recombinant CRP2, as shown in FIG. 4.

[0059] [Table 1]

[0060] In the recombinant CRP1 and recombinant CRP2 obtained in Example 3, the cyclized recombinant CRP1 and cyclized recombinant CRP2 obtained in Example 4, and native human CRP, the N-terminal cyclization rate of CRP was calculated from the ratio of the uncyclized CRP to the cyclized CRP from each ion intensity based on the 10-valent ion intensity of the spectrum of the uncyclized CRP and the spectrum of the cyclized CRP measured under the above-mentioned LC / MS conditions, using the above-mentioned formula (II). The N-terminal cyclization rates of the recombinant CRP1, the cyclized recombinant CRP1, and the native human CRP are shown in Table 2. The cyclized recombinant CRP1 obtained in Example 4 was obtained on the 1st, 3rd, 6th, and 8th days of heating, and the N-terminal cyclization rate was calculated using the above-mentioned formula (II). The N-terminal cyclization rates of the recombinant CRP2, the cyclized recombinant CRP2, and the native human CRP are shown in Table 3. The cyclized recombinant CRP2 obtained in Example 4 was obtained on the 1st, 3rd, 6th, and 8th days after heating, and the N-terminal cyclization rate was calculated using the above-mentioned formula (II).

[0061] In the case of natural human CRP, the N-terminal cyclization rate is 95%, which indicates that 95% of the total is cyclized CRP. On the other hand, in the case of recombinant CRP1 and recombinant CRP2 obtained in Example 3, the N-terminal cyclization rate is 40%, which indicates that cyclized CRP is present in less than half of the total. In contrast, the cyclized recombinant CRP1 and cyclized recombinant CRP2 obtained in Example 4 showed an N-terminal cyclization rate of 42% on the first day of heating, an N-terminal cyclization rate of 54% on the third day of heating, an N-terminal cyclization rate of 67% on the sixth day of heating, and an N-terminal cyclization rate of 78% on the eighth day of heating, indicating that the proportion of cyclized recombinant CRP tends to increase with the increase in heating time.

[0062] [Table 2]

[0063] [Table 3]

[0064] Example 6 Measurement of CRP concentration using a latex reagent Bovine serum albumin (Sigma) was diluted with ultrapure water to 0.1, 0.2, 0.4, and 0.75 mg / mL to prepare standard solutions. 600 μL of protein assay concentrated dye reagent (BioRad) and 2.4 mL of ultrapure water were added to 60 μL of each standard solution, and the absorbance at 595 nm was measured after standing at room temperature for 5 minutes. A calibration curve was created from the above-mentioned 595 nm absorbance measurement value and bovine serum albumin concentration. Recombinant CRP1 and recombinant CRP2 obtained in Example 3, cyclized recombinant CRP1 and cyclized recombinant CRP2 obtained in Example 4, and natural human CRP were placed in ultrapure water, diluted to an appropriate concentration, prepared with the same reagent and conditions as the standard solution, and the absorbance at 595 nm was measured. From the measured values ​​of various CRPs, the protein concentration was calculated from the above-mentioned calibration curve. Based on the above protein concentrations, CRP solutions were prepared by diluting with 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) to protein concentrations of 1 mg / dL, 5 mg / dL, 10 mg / dL, and 30 mg / dL.

[0065] The CRP concentration of each of the above CRP solutions was measured by combining the first and second reagents, using a buffer solution of CRP-Latex X2 manufactured by Denka Seiken Co., Ltd. as the first reagent and a suspension of anti-human CRP polyclonal antibody (rabbit)-bound latex as the second reagent, and measuring the formation of particle aggregates dependent on the CRP concentration using a Hitachi 7180-type automatic analyzer. Specifically, 120 μL of the first reagent was added to 2.2 μL of each of the above CRP solutions, and the mixture was heated at 37°C for 5 minutes, after which 120 μL of the second reagent was added and stirred. The change in absorbance (ΔmAbs) associated with the formation of aggregates over the next 5 minutes was measured at a main wavelength of 546 nm and a secondary wavelength of 800 nm.

[0066] Table 4 shows the relative values ​​at each concentration to the measured values ​​of recombinant CRP1 obtained in Example 3 and cyclized recombinant CRP1 obtained in Example 4 and the measured values ​​of native human CRP. Table 4 also shows the N-terminal cyclization rates of various CRPs calculated in Example 5. Table 5 shows the measured values ​​of recombinant CRP1 obtained in Example 3, cyclized recombinant CRP1 obtained in Example 4, and native human CRP. Similarly to the above, Table 6 shows the measured values ​​of recombinant CRP2 obtained in Example 3 and cyclized recombinant CRP2 obtained in Example 4, and the relative values ​​at each concentration to the measured values ​​of native human CRP. Table 6 also shows the N-terminal cyclization rates of various CRPs calculated in Example 5. Table 7 shows the measured values ​​of recombinant CRP2 obtained in Example 3, cyclized recombinant CRP2 obtained in Example 4, and native human CRP.

[0067] From Tables 4 and 6, it was confirmed that in recombinant CRP1 and recombinant CRP2 with N-terminal cyclization rates of 40% and 42%, the relative values ​​to the measured values ​​of natural human CRP at the points of 10 mg / dL and 30 mg / dL were 89 to 94%, which was a deviation of 6 to 11%. On the other hand, in cyclized recombinant CRP1 and cyclized recombinant CRP2 with N-terminal cyclization rates of 54%, 67%, and 78%, the relative values ​​to the measured values ​​of natural human CRP at the points of 10 mg / dL and 30 mg / dL were 95 to 104%, which was a deviation of 5% or less. This result shows that in cyclized recombinant CRP1 and cyclized recombinant CRP2 with N-terminal cyclization rates of 55% or more, the deviation from natural human CRP can be suppressed to within 5% even in the high CRP concentration range of 10 mg / dL and 30 mg / dL.

[0068] [Table 4]

[0069] [Table 5]

[0070] [Table 6]

[0071] [Table 7] [Industrial Applicability]

[0072] The CRP of the present invention is particularly useful in the fields of medicine and diagnosis as a diagnostic agent raw material used in latex reagents in which CRP has excellent reactivity in the high concentration range.

Claims

1. A method for measuring C-reactive protein in a sample, the method utilizing an antibody-antigen reaction between C-reactive protein having 65% or more of its N-terminus pyroglutamylated, the C-reactive protein being composed of any of the following polypeptides (a) to (c), and an anti-C-reactive protein antibody: (a) a polypeptide set forth in SEQ ID NO: 1 or SEQ ID NO: 2 (b) A polypeptide having an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against anti-C-reactive protein antibodies. (c) a polypeptide having an amino acid sequence having 90% or more identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against anti-C-reactive protein antibody.

2. 2. The method for measuring C-reactive protein in a specimen according to claim 1, wherein the amount of C-reactive protein is determined by latex turbidimetric immunoassay using latex particles to which anti-C-reactive protein antibodies are immobilized.

3. The method for measuring C-reactive protein in a sample according to claim 1 , comprising a step of detecting the same using an automatic analyzer.

4. 2. The method for measuring C-reactive protein in a sample according to claim 1, wherein 75% or more of the N-terminus of the C-reactive protein is pyroglutamylated.

5. 2. The method for measuring C-reactive protein in a sample according to claim 1, wherein 85% or more of the N-terminus of the C-reactive protein is pyroglutamylated.

Images