Oligonucleotide for controlling ATXN2 expression

Abstract

To provide an antisense oligonucleotide that controls ATXN2 both in vivo and in vitro.SOLUTION: Provided is an antisense oligonucleotide capable of adjusting expression of ATXN2 in a target cell. An oligonucleotide hybridizes to ATXN2 mRNA. Also provided is a pharmaceutical composition and a method for treating neurodegenerative diseases such as Spinocerebellar ataxia type 2 (SCA2), Amyotrophic lateral sclerosis (ALS), frontotemporal dementia with Alzheimer's pathology (FTD), parkinsonism, and a condition associated with TDP-43 proteinopathy by using an oligonucleotide conjugate and an oligonucleotide.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to oligonucleotides (oligomers) complementary to a nucleic acid encoding ataxin2 (ATXN2) that result in reduced expression of ATXN2, which is beneficial in a wide range of medical disorders, including neurodegenerative diseases, including spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's disease-like frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathy. [Background technology]

[0002] Expanded glutamine repeats in ataxin2 (ATXN2), caused by 31 or more CAG repeats within the ATXN2 gene, cause the rare neurodegenerative disease spinocerebellar ataxia type 2 (SCA2). Furthermore, expanded CAG repeats are a genetic risk factor for amyotrophic lateral sclerosis (ALS) through an RNA-dependent interaction with TAR DNA-binding protein 43 (TDP-43). Other neurodegenerative diseases associated with TDP-43 proteinopathy include Alzheimer's disease (frontotemporal dementia) and parkinsonism. Recently, an ALS-associated mouse model, the TDP-43 transgenic mouse (TDP-43), has been developed. T / Tg ) were crossed with Atxn2-negative mice, resulting in a significant increase in lifespan and TDP-43 T / Tg Atxn2 - / In the same article, treatment with antisense oligonucleotides targeting ATXN2 improved motor function in mice (Becker et al. 2017 Nature 544:367-371). T / Tg Mice showed increased survival and improved athletic performance.

[0003] Antisense oligonucleotides targeting ATXN2 are also described in U.S. Patent No. 2017 / 175113, WO 2015 / 143246, and WO 2017 / 117496, with WO 2017 / 117496 specifically relating to the treatment of ALS. Scoles et al. (2017 Nature 544:362) evaluated the ability of antisense oligonucleotides to reduce ATXN2 in the cerebellum, demonstrating localization to Purkinje cells, indicating a potential treatment for SCA2. Summary of the Invention [Problem to be solved by the invention]

[0004] Object of the invention The present invention provides antisense oligonucleotides that regulate ATXN2 both in vivo and in vitro. The present invention has identified a specific target sequence in intron 9 of human ATXN2 pre-mRNA that can be targeted by antisense oligonucleotides to effectively inhibit ATXN2. Targeting positions 83118-83146 of SEQ ID NO: 1 is particularly advantageous in terms of reducing ATXN2 activity. The present invention also provides effective antisense oligonucleotide sequences and compounds capable of inhibiting ATXN2, as well as their use in treating diseases or disorders such as spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's disease-like frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathies. [Means for solving the problem]

[0005] The present invention relates to oligonucleotides that target nucleic acids encoding ATXN2, which are capable of regulating the expression of ATXN2, and to the use of the oligonucleotides to treat or prevent diseases associated with the function of ATXN2.

[0006] Thus, the present invention provides an oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% complementary, such as completely complementary, to a human ATXN2 target nucleic acid.

[0007] The present invention provides an oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% complementary, such as completely complementary, to an intron region of a human ATXN2 pre-mRNA target nucleic acid.

[0008] The present invention provides an oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% complementary, such as completely complementary, to the intron 9 region of a human ATXN2 pre-mRNA target nucleic acid.

[0009] The present invention provides an oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% complementary, such as completely complementary, to nucleotides 81429 to 83313 of SEQ ID NO:1.

[0010] The present invention provides an oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% complementary, such as completely complementary, to the nucleotides of SEQ ID NO:6.

[0011] The oligonucleotide may be an antisense oligonucleotide, advantageously having a gapmer design. Advantageously, the oligonucleotide is capable of inhibiting the expression of ATXN2 by cleavage of the target nucleic acid, for example by recruitment of RNase H1.

[0012] In a further aspect, the present invention provides a pharmaceutical composition comprising an oligonucleotide of the invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant.

[0013] In a further aspect, the present invention provides a method for in vivo or in vitro methods of regulating ATXN2 expression in target cells expressing ATXN2 by administering to said cells an effective amount of an oligonucleotide or composition of the present invention.

[0014] In a further aspect, the present invention provides a method for treating or preventing a disease, disorder, or dysfunction associated with the in vivo activity of ATXN2, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of the present invention to a subject suffering from or susceptible to said disease, disorder, or dysfunction.

[0015] In a further embodiment, the oligonucleotide or composition of the invention is used for the treatment or prevention of a neurodegenerative disease, such as a neurodegenerative disease selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathy.

[0016] In a further embodiment, the oligonucleotide or composition of the invention is used for the treatment or prevention of spinocerebellar ataxia type 2 (SCA2) or amyotrophic lateral sclerosis (ALS).

[0017] In some embodiments, the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.

[0018] In some embodiments, the antisense oligonucleotide is in the form of a pharmaceutically acceptable sodium salt.

[0019] In some embodiments, the antisense oligonucleotide is in the form of a pharmaceutically acceptable potassium salt.

[0020] The present invention provides a conjugate comprising an antisense oligonucleotide according to the present invention and at least one conjugate moiety covalently linked to the oligonucleotide. Alternatively stated, in some embodiments, the antisense oligonucleotide of the present invention is in the form of a conjugated oligonucleotide. In some embodiments, the oligonucleotide is not conjugated.

[0021] The present invention provides pharmaceutical compositions comprising an antisense oligonucleotide or conjugate of the invention and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0022] In some embodiments, the composition comprises a pharmaceutically acceptable diluent, such as sterile phosphate buffered saline.

[0023] In some embodiments, the antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent at a concentration of 50-300 μM solution, which can be phosphate-buffered saline.

[0024] In some embodiments, the antisense oligonucleotide is formulated in a pharmaceutically acceptable diluent at a concentration of 1-100 mg / mL, e.g., 2-30 or 2-50 mg / mL, or e.g., 4-30 mg / mL. The diluent can be phosphate buffered saline.

[0025] The present invention provides a method for regulating ATXN2 expression in target cells that express ATXN2, comprising administering an effective amount of an antisense oligonucleotide or conjugate or pharmaceutical composition of the present invention to the cells. In some embodiments, the method is an in vitro method. In some embodiments, the method is an in vivo method. In some embodiments, the cells are neuronal cells, such as cerebellar cells, such as Purkinje cells, or cortical cells.

[0026] The invention provides an oligonucleotide, a conjugate, or a pharmaceutical composition of the invention for use in medicine.

[0027] The present invention provides an oligonucleotide, conjugate, or pharmaceutical composition of the invention for use in the treatment of a disease selected from the group consisting of neurodegenerative diseases selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathy.

[0028] The present invention provides use of the oligonucleotide, conjugate, or pharmaceutical composition of the present invention for the preparation of a medicament for the treatment or prevention of a neurodegenerative disease, such as a disease selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), frontotemporal dementia with Alzheimer's disease (FTD), parkinsonism, and a condition involving TDP-43.

[0029] The present invention provides a method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide, conjugate, or pharmaceutical composition of the present invention to a subject suffering from or susceptible to the disease, wherein the disease is selected from the group consisting of neurodegenerative diseases selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathy.

[0030] In some embodiments, the disease is spinocerebellar ataxia type 2 (SCA2).

[0031] In some embodiments, the disease is amyotrophic lateral sclerosis (ALS).

[0032] For therapeutic uses, for example, preferably the subject is a human suffering from or susceptible to the disease in question.

[0033] In a further aspect, the present invention provides a pharmaceutical composition comprising an oligonucleotide of the invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant.

[0034] In a further aspect, the present invention provides a method for in vivo or in vitro methods of regulating ATXN2 expression in target cells expressing ATXN2 by administering to said cells an effective amount of an oligonucleotide or composition of the present invention.

[0035] In a further aspect, the present invention provides a method for treating or preventing a disease, disorder, or dysfunction associated with the in vivo activity of ATXN2, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of the present invention to a subject suffering from or susceptible to said disease, disorder, or dysfunction.

[0036] In a further aspect, the present invention provides a method for treating or preventing a disease, disorder, or dysfunction associated with the in vivo activity of ATXN2, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide targeting ATXN2, or its conjugate, or pharmaceutical composition, such as an antisense oligonucleotide of the present invention or an siRNA targeting ATXN2, to a subject suffering from or susceptible to the disease, disorder, or dysfunction, wherein at least the method comprises administering at least two consecutive doses of the oligonucleotide targeting ATXN2, wherein the time interval between the at least two consecutive doses is at least 2 weeks, for example, at least 3 weeks, for example, at least 4 weeks, for example, at least 1 month, for example, at least 6 weeks, for example, at least 8 weeks, for example, at least 2 months.Administration can therefore be carried out, for example, weekly, biweekly, monthly, or bimonthly.

[0037] In a further aspect, the present invention provides a method for treating or preventing a neurodegenerative disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide targeting ATXN2, or its conjugate or pharmaceutical composition, such as the antisense oligonucleotide of the present invention or the siRNA targeting ATXN2, to a subject suffering from or susceptible to the neurodegenerative disease, wherein at least the method comprises administering at least two consecutive doses of the oligonucleotide targeting ATXN2, wherein the time interval between the at least two consecutive doses is at least 2 weeks, for example, at least 3 weeks, for example, at least 4 weeks, for example, at least 1 month, for example, at least 6 weeks, for example, at least 8 weeks, for example, at least 2 months.The administration can therefore be carried out, for example, weekly, biweekly, monthly, or bimonthly. In a further aspect, the present invention provides an oligonucleotide targeting ATAXN2 for treating or preventing a neurodegenerative disease in a subject, wherein the oligonucleotide is for at least two consecutive administrations, and the time interval between the at least two consecutive doses is at least 2 weeks, such as at least 3 weeks, for example at least 4 weeks, such as at least 1 month, for example at least 6 weeks, for example at least 8 weeks, such as at least 2 months. Administration can therefore be carried out, for example, weekly, biweekly, monthly, or bimonthly.

[0038] In a further embodiment, the oligonucleotide or composition of the invention is used for the treatment or prevention of a neurodegenerative disease, such as a neurodegenerative disease selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathy.

[0039] In a further embodiment, the oligonucleotide or composition of the invention is used for the treatment or prevention of spinocerebellar ataxia type 2 (SCA2).

[0040] In a further embodiment, the oligonucleotide or composition of the invention is used for the treatment or prevention of amyotrophic lateral sclerosis (ALS). [Brief explanation of the drawings]

[0041] [Figure 1] Compound 7_1 (the nucleobase sequence is shown in SEQ ID NO: 7) [Figure 2] Compound 13_1 (the nucleobase sequence is shown in SEQ ID NO: 13) [Figure 3] Compound 17_1 (the nucleobase sequence is shown in SEQ ID NO: 17) [Figure 4] Compound 18_1 (the nucleobase sequence is shown in SEQ ID NO: 18) [Figure 5] Compound 15_4 (nucleobase sequence shown in SEQ ID NO: 15) The compound shown in Figures 1, 2, 3, and 4 is shown in protonated form. The S atom on the phosphorothioate linkage is protonated. It will be understood that the presence of a proton will vary depending on the acidity of the molecule's environment and the presence of alternative cations (e.g., when the oligonucleotide is in salt form). Protonated phosphorothioates exist in tautomeric forms. [Figure 6] Screening of over 1500 compounds targeting the human Ataxin2 pre-mRNA sequence in human cell lines. Compound 7_1 is shown as an open diamond. [Figure 7] SEQ ID NO: 6 of the hotspot region targeting only compound according to Figure 6. Compound 7_1 is shown as an open diamond. [Figure 8] In vitro potency changes of compounds 7_1 and 15_4 compared to compound ASO7. [Figure 9] In vivo mouse studies - comparison of knockdown (mRNA) of 11 selected compounds, compiled data from 3 experiments, Study 1 = filled circles, Study 2 = open circles, Study 3 = half filled and half open circles. [Figure 10]In vivo mouse study - knockdown at protein and mRNA levels and exposure to compound 7_1 in cortex, cerebellar regions. Protein data for cortex is shown. [Figure 11] In vivo mouse study - knockdown at protein and mRNA levels and exposure to compound 15_4 in cortex, cerebellar regions. Protein data for cortex is shown. [Figure 12] In vivo study in mice, time course (measured on day 7 only) following ICV administration of 150 μg of Compound 7_1 and Compound 15_4. [Figure 13] NHP in vivo PK / PD study—mRNA and protein expression in key tissues following administration of 4, 8, or 24 mg (compound 7_1), and 8 mg of compound 15_4, measured after 14 days of treatment. [Figure 14] NHP in vivo PK / PD study—mRNA and protein expression levels in key tissues following administration of 4, 8, or 24 mg (compound 7_1) and 8 mg of compound 15_4, measured 14 days after treatment. Data are presented to demonstrate the relative specific activity of the two compounds. DETAILED DESCRIPTION OF THE INVENTION

[0042] definition Oligonucleotides As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides, as generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are generally produced in laboratories by solid-phase chemical synthesis, followed by purification and isolation. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides, or their modification. The oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may comprise one or more modified nucleosides or nucleotides, such as, for example, 2' sugar-modified nucleosides.

[0043] antisense oligonucleotides The term "antisense oligonucleotide" used herein is defined as an oligonucleotide that can regulate the expression of target gene by hybridizing to target nucleic acid, particularly to the continuous sequence on target nucleic acid.Antisense oligonucleotide is not essentially double-stranded, and therefore is not siRNA or shRNA.Preferably, the antisense oligonucleotide of the present invention is single-stranded.It is understood that the single-stranded oligonucleotide of the present invention can form hairpin or intermolecular duplex structure (duplex between two molecules of the same oligonucleotide), as long as the degree of internal (intra) or mutual (inter) self-complementarity over the entire length of the oligonucleotide is less than 50%.

[0044] Advantageously, the single-stranded antisense oligonucleotides of the present invention do not contain RNA nucleosides (2'-OH unmodified ribose).

[0045] Advantageously, the oligonucleotides of the present invention comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides, and moreover, advantageously, the unmodified nucleosides are DNA nucleosides.

[0046] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of an oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence, such as an FG-F' gapmer region, and can optionally include a nucleotide linker region that can be used to attach additional nucleotides, e.g., functional groups, to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0047] RNAi agents The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interference agent," used interchangeably herein, refer to an agent containing RNA nucleosides and mediating targeted cleavage of RNA transcripts by the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA controls, e.g., inhibits, target nucleic acid expression in cells, e.g., cells within a subject, such as a mammalian subject. RNAi agents include single-stranded RNAi agents and double-stranded siRNAs, as well as short hairpin RNAs (shRNAs). The oligonucleotides of the present invention, or their consecutive nucleotide sequences, can be in the form of an RNAi agent or can form part of an RNAi agent, such as an siRNA or shRNA. In some embodiments of the present invention, the oligonucleotides of the present invention, or their consecutive nucleotide sequences, are RNAi agents, such as siRNAs.

[0048] siRNA The term "siRNA" refers to a small interfering ribonucleic acid (RNAi) agent, a type of double-stranded RNA molecule also known in the art as short interfering RNA or silencing RNA. siRNA typically comprises a sense strand (also called a passenger strand) and an antisense strand (also called a guide strand), each strand being 17-30 nucleotides long, typically 19-25 nucleosides long. The antisense strand is complementary, i.e., perfectly complementary, to a target nucleic acid (preferably a mature mRNA sequence), and the sense strand is complementary to the antisense strand, so that the sense and antisense strands form a duplex or duplex region. The siRNA strands can form a blunt-ended duplex, or advantageously, the 3' ends of the sense and antisense strands can form a 3' overhang of, for example, one, two, or three nucleosides. In some embodiments, both the sense and antisense strands have a second 3' overhang. The duplex region can therefore be, for example, 17 to 25 nucleotides in length, such as 21 to 23 nucleotides in length.

[0049] Once inside the cell, the antisense strand is incorporated into the RISC complex, which mediates targeted degradation or target inhibition of the target nucleic acid. siRNA typically contains modified nucleosides in addition to RNA nucleosides. Alternatively, in some embodiments, all nucleotides in the siRNA strand can be modified (sense). 2'-sugar-modified nucleosides, such as LNA (see, for example, WO2004083430, WO2007085485), 2'-fluoro, 2'-O-methyl, or 2'-O-methoxyethyl, can be incorporated into siRNA. In some embodiments, the passenger strand of siRNA can be discontinuous (see, for example, WO2007107162). Incorporation of thermolabile nucleotides in the seed region of the antisense strand of siRNA has been reported to be useful for reducing the off-target activity of siRNA (see, for example, WO18098328).

[0050] In some embodiments, dsRNA agent, such as the siRNA of the present invention, comprises at least one modified nucleotide.In some embodiments, substantially all of the nucleotides of sense strand comprise modification; substantially all of the nucleotides of antisense strand comprise modification, or substantially all of the nucleotides of sense strand and substantially all of the nucleotides of antisense strand comprise modification.In yet another embodiment, all of the nucleotides of sense strand comprise modification; all of the nucleotides of antisense strand comprise modification; or all of the nucleotides of sense strand and all of the nucleotides of antisense strand comprise modification.

[0051] In some embodiments, the modified nucleotide is Deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl Modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked Nucleotides, unlocked nucleotides, conformationally restricted nucleotides, restricted ethyl Nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified Nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxyl-modified nucleotides, 2'-methoxyethyl Modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, Can be independently selected from the group consisting of phosphoramidate, non-natural base-containing nucleotide, non-bonded nucleotide, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, phosphorothioate group-containing nucleotide, methylphosphonate group-containing nucleotide, 5*-phosphonate-containing nucleotide, 5'-phosphate mimic-containing nucleotide, glycol-modified nucleotide, and 2-O-(N-methylacetamide) modified nucleotide, and combinations thereof.Suitable siRNA comprises 5' phosphate group or 5' phosphate mimic at the 5' end of antisense strand.In some embodiments, the 5' end of antisense strand is RNA nucleoside.

[0052] In one embodiment, the dsRNA agent comprises at least one phosphorothioate, or Further comprising a methylphosphonate internucleotide linkage.

[0053] Phosphorothioate or methylphosphonate internucleotide linkages The phosphorothioate or methylphosphonate internucleotide linkages can be at the 3'-end of one or both strands (e.g., the antisense strand; or the sense strand), or can be at the 5'-end of one or both strands (e.g., the antisense strand; or the sense strand), or can be at the 5'- and 3'-ends of one or both strands (e.g., the antisense strand; or the sense strand). In some embodiments, the remaining internucleoside linkages are phosphodiester linkages.

[0054] The dsRNA agent can further comprise a ligand, hi some embodiments, the ligand is conjugated to the 3' end of the sense strand.

[0055] For biodistribution, the siRNA can be, for example, conjugated to a targeting ligand and / or formulated within lipid nanoparticles.

[0056] Another aspect of the present invention relates to pharmaceutical compositions comprising dsRNA, such as siRNA molecules, suitable for therapeutic use, and methods for inhibiting target gene expression by administering dsRNA, such as siRNA, molecules of the invention, for example, to treat various disease conditions disclosed herein.

[0057] nucleotide Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides.Naturally, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a nucleic acid base moiety, and one or more phosphate groups (not present in nucleosides).Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0058] Modified Nucleosides As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified by the introduction of one or more modifications to the sugar moiety or (nucleic acid) base moiety, compared to an equivalent DNA or RNA nucleoside. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used interchangeably with the term "nucleoside analog" or modified "unit" or modified "monomer." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides with modifications in the base region of DNA or RNA nucleosides are still generally referred to as DNA or RNA if they are capable of Watson-Crick base pairing.

[0059] Modified internucleoside linkages The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently links two nucleosides to each other, as understood by those skilled in the art. Thus, the oligonucleotides of the present invention may contain modified internucleoside linkages. In some embodiments, modified internucleoside linkages increase the nuclease resistance of the oligonucleotide compared to phosphodiester linkages. In the case of naturally occurring oligonucleotides, the internucleoside linkages contain phosphate groups that form phosphodiester bonds between adjacent nucleosides. Modified internucleoside linkages are particularly useful for stabilizing oligonucleotides for in vivo use and may serve to protect against nuclease cleavage in regions of DNA or RNA nucleosides of the oligonucleotides of the present invention, such as the gap region G of gapmer oligonucleotides, and regions F and F' of modified nucleosides.

[0060] In one embodiment, the oligonucleotide contains one or more internucleoside linkages modified from natural phosphodiester. In some embodiments, at least 50% of the internucleoside linkages in the oligonucleotide, or in a contiguous nucleotide sequence thereof, are modified. For example, at least 60%, at least 70%, at least 75%, at least 80%, or at least 90% of the internucleoside linkages in the oligonucleotide, or in a contiguous nucleotide sequence thereof, are modified. In some embodiments, all of the internucleoside linkages in the oligonucleotide, or in a contiguous nucleotide sequence thereof, are modified. It will be appreciated that in some embodiments, the nucleoside linking the oligonucleotide of the present invention to a non-nucleotide functional group, e.g., a conjugate, can be phosphodiester. In some embodiments, all of the internucleoside linkages in the oligonucleotide, or in a contiguous nucleotide sequence thereof, are nuclease-resistant internucleoside linkages.

[0061] It is advantageous to use phosphorothioate internucleoside linkages with the oligonucleotides of the present invention.

[0062] Phosphorothioate internucleoside bond is particularly useful due to its nuclease resistance, favorable pharmacokinetics and ease of manufacture.In some embodiments, at least 50% of the internucleoside bond in the oligonucleotide or its continuous nucleotide sequence is phosphorothioate.For example, at least 60%, for example at least 70%, for example at least 75%, for example at least 80%, or for example at least 90% of the internucleoside bond in the oligonucleotide or its continuous nucleotide sequence is phosphorothioate.In some embodiments, all of the internucleoside bond in the oligonucleotide or its continuous nucleotide sequence is phosphorothioate.

[0063] Advantageously, all of the internucleoside linkages of the consecutive nucleotide sequence of the oligonucleotide are phosphorothioate, or all of the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0064] As disclosed in EP 2 742 135, it is recognized that antisense oligonucleotides can contain other internucleoside linkages (other than phosphodiester and phosphorothioate), e.g., alkylphosphonate / methylphosphonate internucleosides, which, according to EP 2 742 135, can be tolerated within, for example, DNA phosphorothioate gap regions otherwise.

[0065] Nucleic acid bases The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds during nucleic acid hybridization.In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization.In this context, "nucleobase" refers to both naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, and non-naturally occurring variants.Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, vol. 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1.

[0066] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0067] Nucleobase moieties are represented by the letter code of each corresponding nucleobase, for example, A, T, G, C, or U, and each letter can optionally contain a modified nucleobase of equivalent function.For example, in the exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine.Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides can be used.

[0068] Modified Oligonucleotides The term modified oligonucleotide describes an oligonucleotide containing one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric" oligonucleotide is a term used in the literature to describe oligonucleotides having modified nucleosides.

[0069] Complementarity The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may contain nucleosides with modified nucleobases, for example, 5-methylcytosine is often used instead of cytosine, and therefore the term "complementarity" will be understood to encompass Watson-Crick base pairing between unmodified and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research vol. 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0070] As used herein, the term "% complementarity" refers to the percentage of nucleotides in a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an oligonucleotide) that span the contiguous nucleotide sequence that are complementary to a reference sequence (e.g., a target sequence or sequence motif). The percentage of complementarity is therefore calculated by counting the number of aligned nucleobases that are complementary (in Watson-Crick base pairs) between two sequences (when aligning the 5'-3' of the target sequence with the 3'-5' of the oligonucleotide sequence), dividing this number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleobases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not allowed in calculating the % complementarity of a contiguous nucleotide sequence. It will be understood that in measuring complementarity, chemical modifications of nucleobases are disregarded so long as the functional ability of the nucleobases to form Watson-Crick base pairs is maintained (e.g., 5'-methylcytosine is considered identical to cytosine for purposes of calculating percent identity).

[0071] The term "fully complementary" refers to 100% complementarity.

[0072] The following are examples of oligonucleotides that are perfectly complementary to the target sequence:

[0073] Below is an example of an oligonucleotide (SEQ ID NO: 15) that is perfectly complementary to the target sequence (SEQ ID NO: 6).

[0074] 5'ttaaggaggttaaagtaaaatgtgaattt3' (SEQ ID NO: 6) 3'ctccaatttcattttacact5' (SEQ ID NO: 15)

[0075] identity The term "identity" as used herein refers to the percentage (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence of an oligonucleotide (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif) across the contiguous nucleotide sequence. The percentage of identity is therefore calculated by counting the number of aligned nucleotides that are identical (matched) between two sequences (the contiguous nucleotide sequence of the compound of the present invention and the reference sequence), dividing this number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, the percentage of identity = (match × 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in calculating the percentage identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of nucleobases are ignored as long as the nucleobase retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating percent identity).

[0076] Hybridization As used herein, the term "hybridizing" or "hybridize" should be understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the binding between two nucleic acid strands is the strength of hybridization. This is often measured by the melting temperature (T), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. m ) Under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° more accurately represents binding affinity, ΔG° = -RTln(K d ) to calculate the dissociation constant (K d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous concentration of 1M, pH 7, and temperature of 37°C. The hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and the ΔG° for the spontaneous reaction is less than 0. ΔG° can be experimentally measured using isothermal titration calorimetry (ITC), for example, as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art will be aware that commercially available devices are available for measuring ΔG°. ΔG° can also be estimated numerically by using the model most closely related to that described in Santa Lucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, using appropriately derived thermodynamic parameters as described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To potentially modulate their intended nucleic acid targets through hybridization, oligonucleotides of the present invention hybridize to target nucleic acids with estimated ΔG° values ​​of less than -10 kcal for oligonucleotides 10-30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard-state Gibbs free energy ΔG°. The oligonucleotides may hybridize to the target nucleic acid with an estimated ΔG° value in the range of less than -10 kcal, for example, less than -15 kcal, for example, less than -20 kcal, and for example, less than -25 kcal for oligonucleotides 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to the target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, for example, -12 to -40, for example, -15 to -30 kcal, or -16 to -27 kcal, for example, -18 to -25 kcal.

[0077] target nucleic acid According to the present invention, the target nucleic acid is the nucleic acid encoding mammalian ATXN2, and can be, for example, gene, RNA, mRNA, and pre-mRNA, mature mRNA, or cDNA sequence.Therefore, the target can be referred to as ATXN2 target nucleic acid.The oligonucleotide of the present invention can be, for example, the target exon region of mammalian ATXN2, or can be, for example, the target intron region in ATXN2 pre-mRNA (see Table 1).

[0078] [Table 1]

[0079] Preferably, the target nucleic acid encodes an ATXN2 protein, particularly a mammalian ATXN2, such as human ATXN2 (see, eg, Tables 2 and 3), which provides mRNA and pre-mRNA sequences for human, monkey, rat, and pig ATXN2.

[0080] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and 5, or naturally occurring variants thereof (eg, sequences encoding mammalian Ataxin2 proteins).

[0081] When the oligonucleotides of the invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or synthetic nucleic acid derived from DNA or RNA.

[0082] For in vivo or in vitro use, the oligonucleotide of the present invention can typically inhibit the expression of ATXN2 target nucleic acid in cells that express ATXN2 target nucleic acid.The continuous sequence of nucleobases of the oligonucleotide of the present invention is typically complementary to ATXN2 target nucleic acid, measured over the length of the oligonucleotide, except for one or two mismatches if necessary, and optionally excluding a nucleotide-based linker region that can connect the oligonucleotide to any functional group, such as a conjugate, or other non-complementary terminal nucleotides.In some embodiments, the target nucleic acid can be RNA or DNA, for example, messenger RNA such as mature mRNA or pre-mRNA.

[0083] In some embodiments, the target nucleic acid is RNA or DNA encoding a mammalian Ataxin2 protein, such as human ATXN2, e.g., a human ATXN2 mRNA sequence, such as that disclosed in SEQ ID NO: 1. Further information regarding exemplary target nucleic acids is provided in Tables 2 and 3.

[0084] [Table 2]

[0085] [Table 3]

[0086] Target sequence As used herein, the term "target sequence" refers to a sequence of nucleotides present in a target nucleic acid, which comprises a nucleobase sequence complementary to an oligonucleotide of the present invention. In some embodiments, the target sequence consists of a region on the target nucleic acid having a nucleobase sequence complementary to the contiguous nucleotide sequence of an oligonucleotide of the present invention. This region of the target nucleic acid may be referred to interchangeably as a target nucleotide sequence, target sequence, or target region.

[0087] In some embodiments, the target sequence may be longer than the complementary sequence of a single oligonucleotide, e.g., represent a preferred region of some oligonucleotides of the present invention. Preferred regions of a target nucleic acid may also be referred to as "hotspots," which refer to target nucleotide sequences where one or more oligonucleotides can effectively reduce the target nucleic acid, e.g., reduce the target nucleic acid to at least 50% of the control (see, e.g., Figure 1). Hotspots are typically identified by scanning libraries of oligonucleotides, which are designed to cover most of the target nucleic acid. Hotspots are generally confirmed by additional oligonucleotide libraries that target the hotspots.

[0088] In some embodiments, the target sequence is a sequence selected from any region of Table 4 (R_1-R_2421). In particular, the target sequence may be any of R_1 to R_13, R_15 to R_874, R_876 to R_894, R_896 to R_902, R_906 to R_1151, R_1153 to R_1338, R_1341 to R_1420, R_1422 to R_1435, R_1437 to R_1465, R_1468 to R_1495, R_1499 to R_1542, R_1545 to R_1592, R1595 to R_1602, R_1604 to R_1643, R_1646 to R_1 869, R_1873 to R_1905, R_1907 to R_1921, R_1923 to R_1929, R_1931 to R_2145, R_2147 to R_2152, R_2155 to R_2236, R_2238 to R_2356, R_2358 to R_2370; R_2373 to R_2402, R_2404 to R_2407, R_2409 to R_2415, and R_2421.

[0089] [Table 4] TIFF2025179845000005.tif249170 TIFF2025179845000006.tif249170 TIFF2025179845000007.tif249170 TIFF2025179845000008.tif249170 TIFF2025179845000009.tif249170 TIFF2025179845000010.tif249170 TIFF2025179845000011.tif249170 TIFF2025179845000012.tif249170 TIFF2025179845000013.tif241165 TIFF2025179845000014.tif249170 TIFF2025179845000015.tif249170 TIFF2025179845000016.tif249170 TIFF2025179845000017.tif249170 TIFF2025179845000018.tif249170 TIFF2025179845000019.tif249170 TIFF2025179845000020.tif249170 TIFF2025179845000021.tif249170 TIFF2025179845000022.tif249170 TIFF2025179845000023.tif249170 TIFF2025179845000024.tif75170

[0090] In some embodiments, the target sequence is a sequence selected from any region of Table 5 (W1-W115). In particular, the target sequence may be any of W1;W4;W5;W6;W7;W8;W9;W10;W11;W12;W13;W14;W15;W16;W17;W18;W19;W20;W21;W22;W23;W24;W25;W26;W29;W33;W34;W35;W36;W37;W38;W39;W41;W42;W44;W45;W48;W49;W50;W54;W56;W57;W60;W61;W62;W63;W64; The region may be selected from one of the regions in the group consisting of W65;W67;W68;W69;W70;W71;W72;W73;W76;W77;W78;W80;W81;W82;W83;W84;W85;W86;W87;W88;W89;W90;W91;W92;W93;W95;W96;W97;W99;W100;W102;W104;W108;W110;W111;W114; and W115.

[0091] [Table 5] TIFF2025179845000026.tif153165

[0092] In some embodiments, the target sequence is a sequence selected from any of the regions in Table 6 (S1-S46). In particular, the target sequence can be selected from one of the regions in the group of regions consisting of S1, S2, S3, S5, S6, S9, S10, S11, S12, S14, S15, S16, S19, S21, S22, S25, S26, S27, S28, S29, S30, S31, S33, S36, S41, S43, S45, and S46.

[0093] In one embodiment, the target sequence is the sequence of region W54 or S19.

[0094] [Table 6]

[0095] In one embodiment of the invention, the target sequence is [Table 7] is selected from the group consisting of:

[0096] In one embodiment of the present invention, the target sequence is selected from the group consisting of R_274, R_893, R_895, R_1496, R_1992, and R_2420.

[0097] In one embodiment of the invention, the target sequence is [Table 8] is selected from the group consisting of:

[0098] In one embodiment of the invention, the target sequence is [Table 9] is selected from the group consisting of:

[0099] In some embodiments, the target sequence is a sequence selected from human ATXN2 mRNA introns 1, 3, 5, 9, 10, 11, 1, 18, 20, or 21 (see Table 1 above), such as from introns 1, 3, 9, or 18.

[0100] In some embodiments, the target sequence is a sequence selected from human ATXN2 mRNA exons 4, 5, or 25 (see Table 1 above), such as from exon 25.

[0101] In some embodiments, the target sequence is a sequence selected from the intron 4 / exon 5, or exon 9 / intron 10, human ATXN2 mRNA exon / intron expansion regions.

[0102] In one embodiment of the present invention, the target sequence is SEQ ID NO:6.

[0103] The oligonucleotides of the invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, eg, a target sequence described herein.

[0104] The target sequence to which the oligonucleotide is complementary or hybridizes generally comprises a contiguous nucleic acid base sequence of at least 10 nucleotides, the contiguous nucleotide sequence being 10 to 400 nucleotides, for example, 10 to 150, for example, 10 to 100, for example, 10 to 60, for example, 10 to 50 nucleotides, for example, 12 to 40 nucleotides, for example, 12 to 30, for example, 14 to 30 nucleotides, for example, 14 to 25, for example, 15 to 25 nucleotides, for example, 15 to 18 contiguous nucleotides.

[0105] target cell As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell, such as a monkey cell or a human cell.

[0106] In some embodiments, the target cells can be Purkinje neurons, such as Purkinje cells. Other target cells of interest are motor neurons, such as upper and lower motor neurons.

[0107] For in vitro evaluation, target cells can be established cell lines such as A431 or U2-OS cells. Alternatively, motor neurons derived from human induced pluripotent stem cells (iPCS) (see, for example, Sances et al. 2016 Nat Neurosci. 19(4):542-553) or Purkinje cells derived from iPCS (Wang et al. 2015 Scientific Reports 5:9232) can be used for in vitro screening.

[0108] In a preferred embodiment, the target cell expresses ATXN2 mRNA, such as ATXN2 pre-mRNA or ATXN2 mature mRNA. The polyA tail of ATXN2 mRNA is typically ignored for antisense oligonucleotide targeting.

[0109] Naturally occurring variants The term "naturally occurring variants" refers to variants of the ATXN2 gene or transcript that originate from the same locus as the target nucleic acid, but may differ due to, for example, the degeneracy of the genetic code, which causes multiple codons to code for the same amino acid, or alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants.Based on the presence of a sufficiently complementary sequence to the oligonucleotide, the oligonucleotide of the present invention can therefore target the target nucleic acid and its naturally occurring variants.

[0110] In some embodiments, the naturally occurring variant has at least 95%, e.g., at least 98% or at least 99% homology to a mammalian ATXN2 target nucleic acid, e.g., a target nucleic acid selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the naturally occurring variant has at least 99% homology to the human ATXN2 target nucleic acid of SEQ ID NO: 1.

[0111] Regulation of expression The term "modulation of expression" as used herein should be understood as a general term for the ability of an oligonucleotide to change the amount of ATXN2 compared to the amount of ATXN2 before administration of the oligonucleotide. Alternatively, modulation of expression can be determined by reference to a control experiment. A control is generally understood to be an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock).

[0112] One type of regulation is the ability of oligonucleotide to inhibit, down-regulate, reduce, suppress, remove, stop, block, prevent, decrease, reduce, avoid or terminate the expression of ATXN2, for example, by mRNA degradation or blocking transcription.Another type of regulation is the ability of oligonucleotide to restore, increase or enhance the expression of ATXN2, for example, by repairing splice site or preventing splicing, or by removing or blocking inhibitory mechanisms such as microRNA suppression.The antisense oligonucleotide of the present invention can advantageously inhibit the expression of mammalian ATXN2, for example, human ATXN2.

[0113] High-affinity modified nucleosides High affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, e.g., increase the melting temperature (T m The high affinity modified nucleosides of the present invention preferably provide an increase in melting temperature of +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C per modified nucleoside. Many high affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0114] sugar modification Oligomers of the invention may include one or more nucleosides having modified sugar moieties, ie, modifications in the sugar moiety as compared to the ribose sugar moiety found in DNA and RNA.

[0115] A number of nucleosides with modifications of the ribose sugar moiety have been created, primarily for the purpose of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0116] Such modifications include those in which the ribose ring structure has been modified, for example, by replacing it with a hexose ring (HNA) or bicyclic ring (typically having a biradical bridge between the C2 and C4 carbons of the ribose ring (LNA)), or an unlinked ribose ring (e.g., UNA), which typically lacks a bond between the C2 and C3 carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety has been replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs), or morpholino nucleic acids.

[0117] Sugar modifications also include modifications by changing the substituents on the ribose ring to groups other than hydrogen or to the 2'-OH group naturally occurring in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions.

[0118] 2' sugar-modified nucleosides A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or that contains a 2' linked biradical that can form a bridge between the 2' carbon and the second carbon of the ribose ring, e.g., LNA (2'-4' biradical bridge).

[0119] In fact, much attention has been paid to the development of 2'-substituted nucleosides, and many 2'-sugar-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides.For example, 2'-modified nucleosides can provide oligonucleotides with improved binding affinity and / or increased nuclease resistance.Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavy and Damha, Chemistry and Biology 2012, 19, 937. Below is a description of some 2'-substituted modified nucleosides. [ka]

[0120] In the context of the present invention, 2'-substituted sugar modified nucleosides do not include 2'-bridged nucleosides, such as LNA.

[0121] Locked nucleic acid nucleosides (LNA nucleosides) An "LNA nucleoside" is a 2'-modified nucleoside containing a biradical (also referred to as a "2'-4' bridge") linking the C2' and C4' ends of the ribose sugar ring of the nucleoside, which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). Locking the ribose conformation is associated with improved hybridization affinity (duplex stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0122] Non-limiting, exemplary LNA nucleosides are those described in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 0900 71, 2009 / 006478, 2011 / 156202, 2008 / 154401, 2009 / 067647, 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0123] Further non-limiting exemplary LNA nucleosides are disclosed in Scheme 1.

[0124] Scheme 1: [ka]

[0125] Particular LNA nucleosides are β-D-oxy-LNA, 6′-methyl-β-D-oxy LNA, such as (S)-6′-methyl-β-D-oxy-LNA (ScET) and ENA.

[0126] A particularly advantageous LNA is β-D-oxy-LNA.

[0127] The compounds described herein may contain several asymmetric centers and may exist as optically pure enantiomers, mixtures of enantiomers, e.g., racemates, mixtures of diastereoisomers, diastereoisomeric racemates or mixtures of diastereoisomeric racemates.

[0128] The term "asymmetric carbon atom" means a carbon atom that has four different substituents. According to the Cahn-Ingold-Prelog rules, the asymmetric carbon atom can be of the "R" or "S" configuration.

[0129] pharmaceutically acceptable salts The term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of the free base or free acid, without being biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resins. Compounds of formula (I) can also exist in the form of zwitterions. Particularly preferred pharmaceutically acceptable salts of compounds of formula (I) are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0130] protecting group The term "protecting group," alone or in combination, means a group that selectively blocks a reactive site of a multifunctional compound so that a chemical reaction can occur selectively at an otherwise unprotected reactive site. The protecting group can be removed. Exemplary protecting groups are amino-, carboxy-, or hydroxy-protecting groups.

[0131] Nuclease-mediated degradation Nuclease-mediated degradation refers to an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.

[0132] In some embodiments, oligonucleotides can function by nuclease-mediated degradation of target nucleic acids, where the oligonucleotides of the invention can recruit nucleases, particularly endoribonucleases (RNases), such as nucleases and endonucleases, preferably RNase H. Examples of oligonucleotide designs that operate by a nuclease-mediated mechanism are oligonucleotides that typically include a region of at least five or six consecutive DNA nucleosides, flanked at one or both ends by affinity-enhancing nucleosides, such as gapmers, headmers, and tailmers.

[0133] RNase H activity and recruitment The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when it forms a duplex with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered capable of recruiting RNase H when provided with a complementary target nucleic acid if it has an activity, measured in pmol / l / min, of at least 5%, e.g., at least 10% or more than 20%, of the initial rate determined using an oligonucleotide with the same base sequence as the modified oligonucleotide being tested but containing only DNA monomers and with phosphorothioate linkages between all monomers of the oligonucleotide, and using the methodology provided in Examples 91-95 of WO 01 / 23613 (incorporated herein by reference). Recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland, for use in measuring RNase H activity.

[0134] Gapmar The antisense oligonucleotide of the present invention, or its contiguous nucleotide sequence, can be a gapmer, also known as a gapmer oligonucleotide or gapmer design. Antisense gapmers are typically used to inhibit target nucleic acids through RNase-mediated degradation. Gapmer oligonucleotides contain at least three distinct structural regions: a 5'-flank, a gap, and a 3'-flank, FG-F', in a 5'->3' orientation. The "gap" region (G) contains a stretch of contiguous DNA nucleotides that allows the oligonucleotide to recruit RNase H. The gap region is flanked by a 5'-flank region (F) containing one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides, and a 3'-flank region (F') containing one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides. The one or more sugar-modified nucleosides in regions F and F' enhance the affinity of the oligonucleotide for the target nucleic acid (i.e., it is an affinity-enhancing sugar-modified nucleoside). In some embodiments, one or more sugar-modified nucleosides of regions F and F' are 2' sugar-modified nucleosides, eg, high affinity 2' sugar modifications, independently selected from LNA and 2'-MOE.

[0135] In a gapmer design, the 5'- and 3'-most nucleosides of the gap region are DNA nucleosides, each flanked by a 5' (F) or 3' (F') sugar-modified nucleoside. Flanks may be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region, i.e., the 5'-terminus of a 5' flank and the 3'-terminus of a 3' flank.

[0136] The region FG-F' forms a contiguous nucleotide sequence.An antisense oligonucleotide of the invention, or a contiguous nucleotide sequence thereof, may comprise a gapmer region of the formula FG-F'.

[0137] The total length of the gapmer designed FG-F' may be, for example, 12 to 32 nucleosides, for example, 13 to 24, for example, 14 to 22 nucleosides, for example, 14 to 17, for example, 16 to 18 nucleosides.

[0138] By way of example, a gapmer oligonucleotide of the invention can be represented by the following formula: F 1~8 -G 6~16 -F' 1~8 ,for example F 1~8 -G 8~16 -F' 2~8 However, the total length of the gapmer region is at least 12, for example at least 14, nucleotides in length.

[0139] In one embodiment of the present invention, the antisense oligonucleotide, or its consecutive nucleotide sequence, consists of or comprises a gapmer of the formula 5'-FG-F'-3', wherein regions F and F' independently comprise or consist of 1 to 8, for example, 2 to 6, for example, 3 to 4, 2'-sugar-modified nucleosides, and wherein there is at least one 2'-sugar-modified nucleoside located at the 3'-end of region F (adjacent to the DNA nucleosides of region G), and there is at least one 2'-sugar-modified nucleoside located at the 5'-end of region F' (adjacent to the DNA nucleosides of region G), and G is a region of 6 to 16 nucleosides capable of recruiting RNase H, such as 6 to 16 DNA nucleosides, for example, 10 to 15 consecutive DNA nucleosides, for example, 10 to 14 consecutive DNA nucleotides, for example, 11 to 15 consecutive DNA nucleotides, for example, 13 to 15 consecutive DNA nucleotides.

[0140] LNA gapmers An LNA gapmer is a gapmer in which either one or both of regions F and F' comprises or consists of LNA nucleosides. A β-D-oxy gapmer is a gapmer in which either one or both of regions F and F' comprises or consists of β-D-oxy LNA nucleosides.

[0141] In some embodiments, the LNA gapmer has the formula: [LNA] 1-~5 -[Area G]-[LNA] 1~5 and region G is as defined in the definition of gapmer region G.

[0142] MOE Gapmar An MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, an MOE gapmer has the design [MOE] 1~8 -[Area G]-[MOE] 1~8 , e.g. [MOE] 2~7 -[Area G] 5~16 -[MOE] 2~7 , e.g. [MOE] 3~6 -[Area G]-[MOE] 3~6 and region G is as defined in the gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0143] Mixed Wing Gappa A mixed-wing gapmer is an LNA gapmer in which one or both of regions F and F' comprise 2'-substituted nucleosides, e.g., MOE nucleosides, independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units. In some embodiments in which at least one of regions F and F', or both of regions F and F', comprise at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments in which at least one of regions F and F', or both of regions F and F', comprise at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further comprise one or more DNA nucleosides.

[0144] Mixed wing gapper designs are disclosed in WO 2008 / 049085 and WO 2012 / 109395.

[0145] Alternating Flank Gap Mar The flanking regions can contain both LNA and DNA nucleosides and are referred to as "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleosides. Gapmers containing such alternating flanks are referred to as "alternating flank gapmers." An "alternating flank gapmer" is therefore an LNA gapmer oligonucleotide in which at least one of the flanks (F or F') contains DNA in addition to LNA nucleosides. In some embodiments, region F or F', or both regions F and F', contain both LNA and DNA nucleosides. In such embodiments, flanking region F or F', or both F and F', contain at least three nucleosides, and the 5'-most and 3'-most nucleosides of the F and / or F' regions are LNA nucleosides.

[0146] The alternating flanking regions can include up to three DNA nucleosides, for example, one to two, or one, or two, or three consecutive DNA nucleosides.

[0147] Region D' or D" in the oligonucleotide Oligonucleotides of the invention, in some embodiments, can comprise or consist of a contiguous nucleotide sequence of the oligonucleotide that is complementary to a target nucleic acid, e.g., a gapmer FG-F', as well as additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0148] The addition of region D' or D" can be used to link a contiguous nucleotide sequence, e.g., a gapmer, to a conjugate moiety or other functional group. When used to link a conjugate moiety to a conjugate moiety, it can serve as a biocleavable linker. Alternatively, it can be used to provide exonuclease protection or to facilitate synthesis or manufacturing. Regions D' and D" are linked to the 5' end of region F or the 3' end of region F', respectively, and have the following formula: D'-FG-F', FG-F'-D" or

[0149] A D'-FG-F'-D" design can be generated, where FG-F' is the gapmer portion of the oligonucleotide and regions D' or D" constitute separate portions of the oligonucleotide.

[0150] Regions D' or D" independently comprise or consist of 1, 2, 3, 4, or 5 additional nucleotides and may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides but are, for example, DNA or RNA or base-modified versions thereof. The D' and D" regions can serve as nuclease-sensitive biocleavable linkers (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as regions D' and D" are disclosed in WO 2014 / 076195, which include, by way of example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in WO 2015 / 113922, where they have been used to join multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0151] In one embodiment, the oligonucleotide of the present invention comprises regions D' and / or D" in addition to the contiguous nucleotide sequence that constitutes the gapmer. In some embodiments, the oligonucleotides of the invention can be represented by the following formula: FG-F'; especially F 1~8 -G 6~16 -F' 2~8 D'-FG-F', especially D'1~3 -F 1~8 -G 6~16 -F' 2~8 FG-F'-D”, especially F 1~8 -G 6~16 -F' 2~8 -D” 1~3 D'-FG-F'-D'', especially D' 1~3 -F 1~8 -G 6~16 -F' 2~8 -D” 1~3

[0152] In some embodiments, the internucleoside linkage located between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside linkage located between region F' and region D" is a phosphodiester bond.

[0153] Conjugates The term conjugate, as used herein, refers to an oligonucleotide covalently attached to a non-nucleotide moiety (the conjugate moiety or region C or third region).

[0154] Conjugation of the oligonucleotide of the present invention to one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotide, for example, by affecting the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide.In some embodiments, the conjugate moiety regulates or improves the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide.In particular, the conjugate can target the oligonucleotide to a specific organ, tissue, or cell type, thereby enhancing the effectiveness of the oligonucleotide in that organ, tissue, or cell type.At the same time, the conjugate can help reduce the activity of the oligonucleotide in non-target cell types, tissues, or organs (e.g., off-target activity or activity in non-target cell types, tissues, or organs).

[0155] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophile, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0156] In some embodiments, the conjugate is an antibody or antibody fragment with specific affinity for the transferrin receptor, e.g., as disclosed in WO 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide moiety is an antibody or antibody fragment, e.g., an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, particularly an antibody or antibody fragment that targets the transferrin receptor.

[0157] Linker Linkage or linker is the connection between two atoms that connects the target chemical group or segment to another chemical group or segment through one or more covalent bonds.The conjugate moiety can be attached to the oligonucleotide directly or through a linking moiety (for example, linker or tether).The linker serves to covalently link the third region, for example, the conjugate moiety (region C), to the oligonucleotide or continuous nucleotide sequence that is complementary to the first region, for example, the target nucleic acid (region A).

[0158] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally comprise a linker region (second region or region B and / or region Y) located between the oligonucleotide or consecutive nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

[0159] Region B refers to a biocleavable linker that comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in a mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions or agents, and salt concentrations similar to those found or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In preferred embodiments, the nuclease-susceptible linker comprises 1 to 10 nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably 2 to 6 nucleosides, and most preferably 2 to 4 linked nucleosides, containing at least two consecutive phosphodiester bonds, e.g., at least 3, or 4, or 5, consecutive phosphodiester bonds. Preferably, the nucleosides are DNA or RNA. Phosphodiester-containing biocleavable linkers are described in more detail in WO 2014 / 076195 (incorporated herein by reference) - see also region D' or D" therein.

[0160] Region Y refers to a linker that is not necessarily biocleavable but primarily serves to covalently attach the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). The region Y linker may comprise a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The oligonucleotide conjugates of the present invention can be constructed from the following local elements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group, including a C6-C12 aminoalkyl group. In a preferred embodiment, the linker (region Y) is a C6 aminoalkyl group.

[0161] treatment As used herein, the term "treatment" refers to both the treatment of an existing disease (e.g., a disease or disorder referred to herein) or the prevention of disease, i.e., prophylaxis. Thus, it will be recognized that the treatment referred to herein may, in some embodiments, be prophylactic.

[0162] In some embodiments, the treatment is administered to a patient who has been diagnosed with a neurological disease, such as a neurological disease selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), frontotemporal dementia with Alzheimer's disease (FTD), parkinsonism, and neurodegenerative diseases, including conditions associated with TDP-43 proteinopathy.

[0163] In some embodiments, the compounds of the invention are for use in the treatment of spinocerebellar ataxia type 2 (SCA2) or amyotrophic lateral sclerosis (ALS).

[0164] MODE FOR CARRYING OUT THE INVENTION Detailed Description of the Invention Oligonucleotides of the Invention The present invention relates to oligonucleotides capable of regulating ATXN2 expression, such as inhibiting (downregulating) ATXN2. Regulation is achieved by hybridizing to a target nucleic acid encoding Ataxin2. The target nucleic acid can be a mammalian ATXN2 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and 5.

[0165] The oligonucleotides of the present invention are antisense oligonucleotides targeting ATXN2. It is advantageous if the antisense oligonucleotide is complementary to a target sequence selected from one of the regions listed in Tables 4-6. In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as fully complementary, to a target sequence selected from R1 to R2421 (Table 4). In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as fully complementary, to a target sequence selected from W1 to W115 (Table 5). In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as fully complementary, to a target sequence selected from S1 to S46 (Table 6).

[0166] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as fully complementary, to an intron region of an ATAXN2 target nucleic acid sequence, such as a target sequence selected from i1 to i24 of SEQ ID NO: 1 (Table 1).

[0167] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as fully complementary, to intron 1, 3, 5, 9, 10, 11, 14, 18, 20, or 21 of human ATAXN2 pre-mRNA, such as i1, i3, i9, or i18 of SEQ ID NO: 1 (Table 1).

[0168] In embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as fully complementary, to exon 4, 5, or 25 of human ATAXN2 pre-mRNA, such as e25 of SEQ ID NO: 1 (Table 1).

[0169] In an embodiment, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, such as being completely complementary to the exon / intron expansion region of intron 4 / exon 5 or exon 9 / intron 10 of the human ATAXN2 pre-mRNA, such as in SEQ ID NO: 1.

[0170] In some embodiments, the antisense oligonucleotides of the present invention can modulate the expression of a target by inhibiting or downregulating it. Preferably, such modulation results in at least 20% inhibition compared to the normal expression level of the target, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% inhibition compared to the normal expression level of the target. In some embodiments, the oligonucleotides of the present invention can inhibit the expression level of ATXN2 mRNA by at least 60% or 70% in vitro after application of 25 μM of the oligonucleotide to A431 or U2-OS cells. In some embodiments, the compounds of the present invention can inhibit the expression level of ATXN2 protein by at least 50% in vitro after application of 5 μM of the oligonucleotide to A431 or U2-OS cells. Preferably, the Examples provide assays that can be used to measure ATXN2 mRNA or protein inhibition (e.g., Examples 1 and 2). Target modulation is caused by hybridization between the consecutive nucleotide sequences of the oligonucleotide and the target nucleic acid. In some embodiments, the oligonucleotide of the present invention comprises mismatch between the oligonucleotide and the target nucleic acid.Despite mismatch, hybridization to the target nucleic acid can still be sufficient to show the desired regulation of ATXN2 expression.The decrease in binding affinity resulting from mismatch can be advantageously compensated by increasing the number of nucleotides in the oligonucleotide and / or increasing the number of modified nucleosides, such as 2' sugar modified nucleosides, including LNA, present in the oligonucleotide sequence, which can increase the binding affinity to the target.

[0171] One embodiment described in the present application relates to an antisense oligonucleotide of 10-30 nucleotides in length, comprising a contiguous nucleotide sequence of 10-30 nucleotides in length that has at least 90% complementarity, such as 100% complementarity, to SEQ ID NO: 1. The contiguous nucleotide sequence is generally understood to be the same length as the antisense oligonucleotide or shorter.

[0172] In some embodiments, the oligonucleotide sequences or contiguous nucleotide sequences of the present invention are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the oligonucleotide sequences or contiguous nucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO:1 and SEQ ID NO:5. In some embodiments, the oligonucleotide sequences, contiguous nucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO:1, 2, and 3. In some embodiments, the oligonucleotide sequences, contiguous nucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO:1, 3, and 5. In some embodiments, the oligonucleotide sequences, contiguous nucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO:1, 2, 3, 4, and 5.

[0173] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary, such as 100% complementary, to a corresponding target sequence selected from any region (R_1 to R_2421) of Table 4. In particular, the target sequences are R_1 to R_13, R_15 to R_874, R_876 to R_894, R_896 to R_902, R_906 to R_1151, R_1153 to R_1338, R_1341 to R_1420, R_1422 to R_1435, R_1437 to R_1465, R_1468 to R_1495, R_1499 to R_1542, R_1545 to R_1592, R1595 to R_1602, R_1604 to R_1643, R_1646 to R_1 869, R_1873 to R_1905, R_1907 to R_1921, R_1923 to R_1929, R_1931 to R_2145, R_2147 to R_2152, R_2155 to R_2236, R_2238 to R_2356, R_2358 to R_2370; R_2373 to R_2402, R_2404 to R_2407, R_2409 to R_2415, and R_2421.

[0174] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary, such as 100% complementary, to a corresponding target sequence selected from any of the regions (R_1-R_2421) in Table 4. In particular, the target sequence can be selected from one of the regions in the group consisting of: R_274, R_560, R_596, R_716, R_893, R_895, R_903, R_905, R_1033, R_1421, R_1467, R_1496, R_1498, R_1537, R_1554, R_1690, R_1992, R_2185, and R_2420.

[0175] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary, such as 100% complementary, to a corresponding target sequence selected from any region (R_1 to R_2421) of Table 4. In particular, the target sequence can be selected from one of the regions in the group consisting of regions R_274, R_893, R_895, R_1496, R_1992, and R_2420.

[0176] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary, such as 100% complementary, to a corresponding target sequence, the target sequence being a sequence selected from any region (W1-W115) of Table 5. In particular, the target sequences are W1;W4;W5;W6;W7;W8;W9;W10;W11;W12;W13;W14;W15;W16;W17;W18;W19;W20;W21;W22;W23;W24;W25;W26;W29;W33;W34;W35;W36;W37;W38;W39;W41;W42;W44;W45;W48;W49;W50;W54;W56;W57;W60;W61;W62;W63;W64; The region may be selected from one of the regions in the group consisting of W65;W67;W68;W69;W70;W71;W72;W73;W76;W77;W78;W80;W81;W82;W83;W84;W85;W86;W87;W88;W89;W90;W91;W92;W93;W95;W96;W97;W99;W100;W102;W104;W108;W110;W111;W114; and W115.

[0177] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary, such as 100% complementary, to a corresponding target sequence. The target sequence is a sequence selected from any of the regions (S1-S46) in Table 5. In particular, the target sequence can be selected from one of the regions in the group consisting of S1, S2, S3, S5, S6, S9, S10, S11, S12, S14, S15, S16, S19, S21, S22, S25, S26, S27, S28, S29, S30, S31, S33, S36, S41, S43, S45, and S46.

[0178] In one embodiment, the oligonucleotide comprises or consists of a contiguous nucleotide sequence 10-22 nucleotides in length that is at least 90% complementary, such as 100% complementary, to the target sequence in region S19.

[0179] One aspect of the present invention relates to antisense oligonucleotides 10 to 30 nucleotides in length comprising a contiguous nucleotide sequence 10 to 22 nucleotides in length that is at least 90% complementary, such as 100% complementary, to SEQ ID NOs: 6, 1505, 1506, 1507, 1508, 1509, 1510, 1511, 1512, 1513, 1514, 1515, 1516, 1517, 1518, 1519, 1520, 1521, 1522, 1523, 1524, and 1525.

[0180] In some embodiments, the oligonucleotide comprises a contiguous sequence of 10 to 30, such as 10 to 22 nucleotides in length that is at least 90% complementary, such as at least 91%, for example at least 92%, such as at least 93%, for example at least 94%, such as at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, or 100% complementary to a region of a target nucleic acid or target sequence selected from the group consisting of SEQ ID NOs: 6, 1505, 1506, 1507, 1508, 1509, 1510, 1511, 1512, 1513, 1514, 1515, 1516, 1517, 1518, 1519, 1520, 1521, 1522, 1523, 1524, and 1525.

[0181] In some embodiments, the oligonucleotide comprises a contiguous sequence of 10 to 30, e.g., 10 to 22 nucleotides in length, that is at least 90% complementary, e.g., at least 91%, such as at least 92%, for example at least 93%, such as at least 94%, for example at least 95%, such as at least 96%, for example at least 97%, for example at least 98%, or 100% complementary to a region of a target nucleic acid or target sequence selected from the group consisting of SEQ ID NOs: 1505, 1509, 1510, 1516, 1522, and 1525.

[0182] It is advantageous if the oligonucleotide of the present invention, or its contiguous nucleotide sequence, is fully complementary (100% complementary) to the target sequence, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0183] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-22 nucleotides in length that is at least 90% complementary, such as fully (i.e., 100%) complementary, to the target nucleic acid region from positions 83118 to 83146 of SEQ ID NO:1, e.g., 83122 to 83143 of SEQ ID NO:1.

[0184] In some embodiments, the oligonucleotides of the invention comprise or consist of 10 to 30 nucleotides in length, such as 11 to 28, for example 10 to 22, for example 12 to 22, for example 14 to 20, for example 15 to 20, for example 16 to 18, for example 17 to 20, or 18 to 20 contiguous nucleotides in length. In a preferred embodiment, the oligonucleotides comprise or consist of 17 to 20 nucleotides in length.

[0185] In some embodiments, the oligonucleotide or its contiguous nucleotide sequence comprises or consists of 24 or fewer nucleotides, for example, 22 or fewer nucleotides, for example, 20 or fewer nucleotides, for example, 17, 18, 19, or 20 or fewer nucleotides. Any range provided herein should be understood to include the end points of the range. Thus, when an oligonucleotide is described as comprising 10 to 30 nucleotides, both 10 nucleotides and 30 nucleotides are included.

[0186] In some embodiments, the contiguous nucleotide sequence comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length. In preferred embodiments, the oligonucleotide comprises or consists of 17, 18, 19, or 20 nucleotides in length.

[0187] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from Table 7.

[0188] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 21; 22; 23; 24; 25; 26; 27; 28; 29; 30; 31; 32; 33; and 34 (Table 7: Materials and Methods section).

[0189] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30, e.g., 10 to 22, nucleotides in length having at least 90% complementarity, preferably 100% complementarity, to a sequence selected from the group consisting of SEQ ID NOs: 7, 13, 14, 15, 17, 18, 105, 154, 161, 162, 238, 385, 388, 391, 398, 399, 401, 401, 423, 468, 477, 534, 843, 844, 845, 847, 848, 849, 850, 851, 852, 853, 854, 906, 974, 1003, 1004, 1045, 1054, 1180, 1246, 1247, 1248, 1361, 1408, and 1504.

[0190] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30, e.g., 10 to 22, nucleotides in length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 7, 13, 14, 15, 17, 18, 105, 385, 388, 391, 1246, 1247, 1248, and 1504.

[0191] It will be understood that the consecutive nucleobase sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or affinity for the target nucleic acid.

[0192] The pattern in which modified nucleosides (such as high affinity modified nucleosides) are incorporated into an oligonucleotide sequence is commonly referred to as the oligonucleotide design.

[0193] The oligonucleotides of the invention are designed using modified nucleosides and DNA nucleosides. It is advantageous to use high affinity modified nucleosides.

[0194] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In one embodiment, the oligonucleotide comprises 1 to 10 modified nucleosides, e.g., 2 to 9 modified nucleosides, e.g., 3 to 8 modified nucleosides, e.g., 4 to 7 modified nucleosides, e.g., 6 or 7 modified nucleosides. Suitable modifications are described in the "Definitions" sections of "Modified Nucleosides," "High-Affinity Modified Nucleosides," "Sugar Modifications," "2' Sugar Modifications," and Locked Nucleic Acid (LNA).

[0195] In one embodiment, oligonucleotide comprises one or more sugar-modified nucleosides, for example, 2' sugar-modified nucleosides.Preferably, the oligonucleotide of the present invention comprises one or more 2' sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.It is advantageous if one or more of the modified nucleosides are locked nucleic acids (LNA).

[0196] In further embodiments, the oligonucleotide or consecutive nucleotide sequence contains at least one modified internucleoside linkage, for example, at least one phosphorothioate internucleoside linkage. Suitable internucleoside linkages are described in the "Definitions" section under "Modified Internucleoside Linkages." It is advantageous if at least 75%, for example, all, of the internucleoside linkages in the consecutive nucleotide sequence are phosphorothioate internucleoside linkages. In some embodiments, all internucleoside linkages in the consecutive sequence of the oligonucleotide are phosphorothioate linkages.

[0197] In some embodiments, the oligonucleotide of the present invention comprises at least one LNA nucleoside, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, e.g., 2 to 6 LNA nucleosides, e.g., 3 to 7 LNA nucleosides, 4 to 8 LNA nucleosides, or 3, 4, 5, 6, 7, or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides of the oligonucleotide are LNA nucleosides, e.g., 80%, e.g., 85%, e.g., 90% of the modified nucleosides. In still further embodiments, all modified nucleosides of the oligonucleotide are LNA nucleosides. In further embodiments, the oligonucleotide may comprise both β-D-oxy-LNA and one or more of the following LNA nucleosides: thio-LNA in either β-D or α-L conformation, amino-LNA, oxy-LNA, ScET, and / or ENA, or a combination thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. For nuclease stability of an oligonucleotide or contiguous nucleotide sequence, it is advantageous to have at least one LNA nucleoside at the 5'-end and at least two LNA nucleosides at the 3'-end of the nucleotide sequence.

[0198] In one embodiment of the present invention, the oligonucleotides of the invention are capable of recruiting RNase H, such as human RNase H1.

[0199] In the present invention, advantageous structural designs are those described in the "Definitions" section, such as "gapmer," "LNA gapmer," "MOE gapmer," "mixed wing gapmer," and "alternating flank gapmer." Gapmer designs include gapmers with uniform flanks, mixed wing flanks, alternating flanks, and gap breaker designs. In the present invention, it is advantageous for the oligonucleotide of the present invention to be a gapmer having an FG-F' design, in which regions F and F' independently comprise 1 to 8 nucleosides (1 to 5 of which are 2'-sugar modified) and define the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H. In one embodiment, the G region consists of 6 to 16 consecutive DNA nucleosides. In a further embodiment, regions F and F' each comprise at least one LNA nucleoside.

[0200] Table 7 (Materials and Methods section) lists the preferred designs for each motif sequence.

[0201] In all cases, the FG-F' design can further include regions "D' and / or D"," as described in "Definitions" under "Region D' or D" of Oligonucleotides." In some embodiments, oligonucleotides of the invention have one, two, or three phosphodiester-linked nucleoside units, such as DNA units, at the 5' or 3' end of the gapmer region.

[0202] For some embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers: 7_1; 8_1; 9_1; 10_1; 11_1; 12_1; 13_1; 14_1; 15_1; 16_1; 17_1; 18_1; 19_1; 20_1; 21_1; 22_1; 23_1; 24_1; 25_1; 26_1; 27_1; 28_1; 29_1; 30_1; 31_1; 32_1; 33_1; and 34_1 (see Table 7 in the Materials and Methods section).

[0203] For certain embodiments of the invention, the oligonucleotides are selected from the group consisting of CMP numbers: 7_1, 13_1, 14_1, 14_2, 15_1, 16_1, 17_1, 18_1, 18_2, 105_1, 154_1, 161_1, 162_1, 238_1, 385_1, 388_1, 391_1, 398_1, 399_1, 401_1, 401_2, 423_1, 468_1, 477_1, 534_1, 843_1, 844_1, 845_1, 846_1, 847_1, 848_1, 849_1, 850_1, 851_1, 852_1, 853_1, 854_1, 855_1, 856_1, 857_1, 858_1, 859_1, 860_1, 861_1, 862_1, 863_1, 864_1, 865_1, 866_1, 867_1, 868_1, 869_1, 870_1, 871_1, 872_1, 873_1, 874_1, 875_1, 876_1, 877_1, 878_1, 879_1, 880_1, 881_1, 882_1, 883_1, 884_1, 885_1, 886_1, 887_1, 888_1, 8 1, 845_1, 847_1, 848_1, 849_1, 850_1, 851_1, 852_1, 853_1, 854_1, 906_1, 974_1, 1003_1, 1004_1, 1045_1, 1054_1, 1180_1, 1246_1, 1247_1, 1248_1, 1361_1, 1408_1, and 1504_1 (see Table 7).

[0204] Particularly advantageous antisense oligonucleotides in the context of the present invention are compounds selected from the group consisting of: [Table 10] Uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0205] The present invention provides a conjugate comprising an oligonucleotide or antisense oligonucleotide according to the present invention and at least one conjugate moiety covalently attached to the oligonucleotide. In some embodiments, the conjugate moiety is a conjugate that facilitates delivery across the blood-brain barrier, such as an antibody or antibody fragment that targets the transferrin receptor.

[0206] Manufacturing method In a further aspect, the present invention provides a method for producing an oligonucleotide of the present invention, comprising reacting nucleotide units to form covalently linked consecutive nucleotide units comprising the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al., 1987, Methods in Enzymology, vol. 154, pages 287-313). In a further embodiment, the method further comprises reacting the consecutive nucleotide sequence with a conjugating moiety (ligand) to covalently link the conjugated moiety to the oligonucleotide. In a further aspect, a method for producing a composition of the present invention is provided, comprising mixing an oligonucleotide or conjugated oligonucleotide of the present invention with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0207] Pharmaceutical salts The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to conventional acid or base addition salts formed from suitable non-toxic organic or inorganic acids or bases that retain the biological effectiveness and properties of the compounds of the present invention. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, as well as those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of pharmaceutical compounds into salts is a well-known technique among pharmacists to improve the physical and chemical stability, hygroscopicity, flowability, and solubility of the compounds. This is described, for example, in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, a pharmaceutically acceptable salt of the compound provided herein can be a sodium salt.

[0208] In a further aspect, the present invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide or conjugate thereof. In a preferred embodiment, the pharmaceutically acceptable salt is a sodium or potassium salt.

[0209] Pharmaceutical Composition In a further aspect, the present invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates, or salts thereof, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate-buffered saline. In some embodiments, the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50-300 μM solution.

[0210] Formulations suitable for use in the present invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of drug delivery methods, see, for example, Langer (Science 249:1527-1533, 1990). WO 2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers, and adjuvants (incorporated herein by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO 2007 / 031091.

[0211] The oligonucleotides or oligonucleotide conjugates of the present invention may be mixed with pharmaceutically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for preparing pharmaceutical compositions depend on many criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0212] These compositions may be sterilized by conventional sterilization techniques or sterile filtered. The resulting aqueous solutions may be packaged for immediate use or lyophilized, with the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparation will typically be 3 to 11, more preferably 5 to 9 or 6 to 8, and most preferably 7 to 8, e.g., 7 to 7.5. The resulting solid form compositions may be packaged in multiple single-dose units, such as a sealed package of tablets or capsules, each containing a fixed amount of the aforementioned agent or agents. The solid form compositions may also be packaged in flexible volume containers, such as squeezable tubes designed for topically applied creams or ointments.

[0213] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. Particularly with respect to oligonucleotide conjugates, once the prodrug is delivered to the site of action, e.g., a target cell, the conjugate moiety is cleaved from the oligonucleotide.

[0214] Purpose The oligonucleotides of the present invention can be utilized, for example, as research reagents for diagnostics, therapeutics, and prophylaxis.

[0215] In research, such oligonucleotides can be used to specifically regulate the synthesis of Ataxin2 protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating functional analysis of the target or evaluation of its usefulness as a target for therapeutic intervention. Typically, target regulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting a modulator of the gene or mRNA that produces the protein.

[0216] When the oligonucleotides of the invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or synthetic nucleic acid derived from DNA or RNA.

[0217] The present invention provides an in vivo or in vitro method for modulating ATXN2 expression in a target cell expressing ATXN2, said method comprising administering to said cell an effective amount of an oligonucleotide of the present invention.

[0218] In some embodiments, the target cell is a mammalian cell, particularly a human cell. The target cell may be an in vitro cell culture or an in vivo cell that forms part of mammalian tissue. In a preferred embodiment, the target cell is located in the brain or central nervous system, including the brainstem and spinal cord. In particular, cells in the cerebellum are relevant target cells, such as Purkinje neurons or Purkinje cells, especially in individuals affected by spinocerebellar ataxia type 2 (SCA2).

[0219] Other relevant target cells are motor neurons located in the cortex of the brain and the spinal cord. The upper motor neurons in the motor cortex and the lower motor neurons in the brainstem and spinal cord are target cells of the present invention. In particular, the motor neurons of individuals affected by amyotrophic lateral sclerosis (ALS) are relevant target cells.

[0220] In diagnostics, oligonucleotides can be used to detect and quantitate ATXN2 expression in cells and tissues by Northern blotting, in-situ hybridization or similar techniques.

[0221] For therapeutic purposes, the oligonucleotides can be administered to an animal or human suspected of having a disease or disorder that can be treated by modulating the expression of ATXN2.

[0222] The present invention provides a method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention.

[0223] The present invention also relates to an oligonucleotide, composition or conjugate as defined herein for use as a medicament.

[0224] The oligonucleotide, oligonucleotide conjugate or pharmaceutical composition according to the invention is typically administered in an effective amount.

[0225] The present invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disease referred to herein, or for a method of treatment of a disease referred to herein.

[0226] The diseases or disorders referred to herein are associated with the expression of ATXN2. In some embodiments, the diseases or disorders may be associated with mutations in the ATXN2 gene, such as an expanded CAG repeat region. The diseases or disorders may be associated with genes whose protein products are associated with or interact with ATXN2. In particular, in diseases associated with TDP-43 proteinopathy, reducing ATXN2 may have beneficial effects, for example, in amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), and parkinsonism.

[0227] The methods of the present invention are preferably used for the treatment or prevention of diseases caused by abnormal levels and / or activity of ATXN2.

[0228] The present invention further relates to the use of an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition as defined herein for the manufacture of a medicament for treating abnormal levels and / or activity of ATXN2.

[0229] In one embodiment, the present invention relates to an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition for use in the treatment of a disease or disorder selected from neurodegenerative diseases, including spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's disease, frontotemporal dementia (FTD), parkinsonism, and conditions involving TDP-43 proteinopathy. In particular, the use of the oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the present invention in the treatment of spinocerebellar ataxia type 2 (SCA2) or amyotrophic lateral sclerosis (ALS) is advantageous.

[0230] Administration The oligonucleotide or pharmaceutical composition of the present invention can be administered parenterally (intravenous, subcutaneous, intramuscular, intracerebral, intraventricular, intraocular, or intrathecal administration, etc.).

[0231] In some embodiments, administration is via intrathecal administration.

[0232] Advantageously, eg for the treatment of neurological disorders, the oligonucleotides or pharmaceutical compositions of the invention are administered intrathecally or intracranially, eg via intracerebral or intraventricular administration.

[0233] The present invention also provides the use of an oligonucleotide or conjugate thereof, such as a pharmaceutical salt or composition of the present invention, for the manufacture of a medicament in a dosage form for subcutaneous administration.

[0234] The present invention also provides the use of an oligonucleotide of the present invention or a conjugate thereof, such as a pharmaceutical salt or composition of the present invention, for the manufacture of a medicament in a dosage form for intrathecal administration.

[0235] The invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention, as described, for the manufacture of a medicament, wherein the medicament is in a form for intrathecal administration.

[0236] Combination therapy In some embodiments, the oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention is for use in combination therapy with another therapeutic agent, which may be, for example, a standard treatment for the disease or disorder described above.

[0237] Embodiment The following embodiments of the present invention may be used in combination with any other embodiment described herein.

[0238] 1. An antisense oligonucleotide of 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% complementary, such as 100% complementary, to any of the target sequences (R_1 to R_2421) in Table 4.

[0239] 2. The target sequence is in the group R_1 to R_13, R_15 to R_874, R_876 to R_894, R_896 to R_902, R_906 to R_1151, R_1153 to R_1338, R_1341 to R_1420, R_1422 to R_1435, R_1437 to R_1465, R_1468 to R_1495, R_1499 to R_1542, R_1545 to R_1592, R1595 to R_1602, R_1604 to R_1643, R_1646 to R_18 69, R_1873 to R_1905, R_1907 to R_1921, R_1923 to R_1929, R_1931 to R_2145, R_2147 to R_2152, R_2155 to R_2236, R_2238 to R_2356, R_2358 to R_2370; R_2373 to R_2402, R_2404 to R_2407, R_2409 to R_2415, and R_2421.

[0240] 3. The oligonucleotide of embodiment 1, wherein the target sequence is selected from one of the regions within the group R_274, R_560, R_596, R_716, R_893, R_895, R_903, R_905, R_1033, R_1421, R_1467, R_1496, R_1498, R_1537, R_1554, R_1690, R_1992, R_2185, and R_2420.

[0241] 4. The oligonucleotide of embodiment 1, wherein the target sequence is selected from one of the regions within the group R_274, R_893, R_895, R_1496, R_1992, and R_2420.

[0242] 5. The target sequence is selected from the group W1;W4;W5;W6;W7;W8;W9;W10;W11;W12;W13;W14;W15;W16;W17;W18;W19;W20;W21;W22;W23;W24;W25;W26;W29;W33;W34;W35;W36;W37;W38;W39;W41;W42;W44;W45;W48;W49;W50;W54;W56;W57;W60;W61;W62;W63;W64;W65;W6 7; W68; W69; W70; W71; W72; W73; W76; W77; W78; W80; W81; W82; W83; W84; W85; W86; W87; W88; W89; W90; W91; W92; W93; W95; W96; W97; W99; W100; W102; W104; W108; W110; W111; W114; and W115 (see Table 5).

[0243] 6. The oligonucleotide of embodiment 1, wherein the target sequence is selected from one of the regions within the group consisting of S1, S2, S3, S5, S6, S9, S10, S11, S12, S14, S15, S16, S19, S21, S22, S25, S26, S27, S28, S29, S30, S31, S33, S36, S41, S43, S45, and S46 (see Table 6).

[0244] 7. The oligonucleotide of embodiments 1-6, wherein the contiguous nucleotide sequence is complementary to a target sequence selected from the group consisting of SEQ ID NOs: 1526, 1527, 1528, 1529, 1530, 1531, 1532, 1533, 1534, 1535, 1536, 1537, 1538, 1539, 1540, 1541, 1542, 1543, and 1544.

[0245] 8. The oligonucleotide of embodiments 1-6, wherein the contiguous nucleotide sequence is complementary to a target sequence selected from the group consisting of SEQ ID NOs: 1526, 1530, 1531, 1537, 1542, and 1544.

[0246] 9. The oligonucleotide of embodiments 1-6, wherein the contiguous nucleotide sequence is complementary to a target sequence selected from the group consisting of SEQ ID NOs: 6, 1505, 1506, 1507, 1508, 1509, 1510, 1511, 1512, 1513, 1514, 1515, 1516, 1517, 1518, 1519, 1520, 1521, 1522, 1523, 1524, and 1525.

[0247] 10. The oligonucleotide of embodiments 1-6, wherein the contiguous nucleotide sequence is complementary to a target sequence selected from the group consisting of SEQ ID NOs: 6, 1505, 1509, 1510, 1516, 1522, and 1525.

[0248] 11. The antisense oligonucleotide of any one of embodiments 1 to 10, wherein the contiguous nucleotide sequence is complementary to positions 83118 to 83151 of SEQ ID NO:1.

[0249] 12. The oligonucleotide according to embodiments 1 to 6, wherein the contiguous nucleotide sequence is complementary to the target sequence of SEQ ID NO: 6.

[0250] 13. The antisense oligonucleotide of any one of embodiments 1 to 12, wherein the contiguous nucleotide sequence is complementary to positions 83122 to 83143 of SEQ ID NO:1.

[0251] 14. The oligonucleotide according to embodiments 1 to 13, wherein the antisense oligonucleotide is capable of regulating the expression of ATXN2, such as reducing the expression of ATXN2.

[0252] 15. The oligonucleotide of embodiments 1-14, wherein the antisense oligonucleotide is capable of hybridizing to a target sequence with a ΔG° of less than -10 kcal.

[0253] 16. The oligonucleotide according to embodiments 1 to 15, wherein the target nucleic acid in which the target sequence is located is RNA.

[0254] 17. The oligonucleotide of embodiment 16, wherein the RNA is mRNA.

[0255] 18. The oligonucleotide of embodiment 17, wherein the mRNA is pre-RNA or mature RNA.

[0256] 19. The oligonucleotide of embodiment 18, wherein the pre-mRNA is selected from SEQ ID NOs: 1, 2, 3, 4, or 5.

[0257] 20. The oligonucleotide according to embodiments 1 to 19, wherein the contiguous nucleotide sequence comprises or consists of at least 10 contiguous nucleotides, in particular 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 contiguous nucleotides.

[0258] 21. The oligonucleotide according to embodiments 1 to 20, wherein the contiguous nucleotide sequence comprises or consists of 10 to 22 nucleotides.

[0259] 22. The oligonucleotide according to embodiment 21, wherein the contiguous nucleotide sequence comprises or consists of 12 to 22 nucleotides.

[0260] 23. The oligonucleotide according to embodiment 21, wherein the contiguous nucleotide sequence comprises or consists of 14 to 20 nucleotides.

[0261] 24. The oligonucleotide according to any one of embodiments 1 to 23, wherein the oligonucleotide comprises or consists of a length of 10 to 30 nucleotides.

[0262] 25. The oligonucleotide according to embodiment 24, wherein the oligonucleotide comprises or consists of a length of 12 to 22 nucleotides.

[0263] 26. The oligonucleotide according to embodiment 24 or 25, wherein the oligonucleotide comprises or consists of a length of 14 to 20 nucleotides.

[0264] 27. The oligonucleotide according to embodiments 1 to 26, wherein the oligonucleotide or the contiguous nucleotide sequence is single-stranded.

[0265] 28. The oligonucleotide according to embodiments 1 to 27, wherein the oligonucleotide is not an siRNA and is not self-complementary.

[0266] 29. The oligonucleotide of embodiments 1-28, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from Table 7.

[0267] 30. The oligonucleotide of embodiments 1 to 29, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 21; 22; 23; 24; 25; 26; 27; 28; 29; 30; 31; 32; 33; or 34.

[0268] 31. The oligonucleotide of embodiments 1-28, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from 7, 13, 14, 15, 17, 18, 105, 154, 161, 162, 238, 385, 388, 391, 398, 399, 401, 401, 423, 468, 477, 534, 843, 844, 845, 847, 848, 849, 850, 851, 852, 853, 854, 906, 974, 1003, 1004, 1045, 1054, 1180, 1246, 1247, 1248, 1361, 1408, and 1504.

[0269] 32. The oligonucleotide according to embodiments 1 to 29, wherein the contiguous nucleotide sequence has 0 to 3 mismatches compared to the complementary target nucleic acid.

[0270] 33. The oligonucleotide according to embodiment 32, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acid.

[0271] 34. The oligonucleotide according to embodiment 32, wherein the consecutive nucleotide sequence has two mismatches compared to the target nucleic acid.

[0272] 35. The oligonucleotide according to embodiment 32, wherein the contiguous nucleotide sequence is perfectly complementary to the target nucleic acid sequence.

[0273] 36. The oligonucleotide according to any one of embodiments 1 to 35, comprising one or more modified nucleosides.

[0274] 37. The oligonucleotide of embodiment 36, wherein one or more modified nucleosides are high-affinity modified nucleosides.

[0275] 38. The oligonucleotide of embodiment 36 or 37, wherein one or more modified nucleosides are 2' sugar-modified nucleosides.

[0276] 39. The oligonucleotide of embodiment 38, wherein one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA, and LNA nucleosides.

[0277] 40. The oligonucleotide of embodiment 38 or 39, wherein one or more 2' sugar-modified nucleosides are LNA nucleosides.

[0278] 41. The antisense oligonucleotide of embodiment 40, wherein the modified LNA nucleoside is selected from oxy-LNA, amino-LNA, thio-LNA, cET, and ENA.

[0279] 42. The antisense oligonucleotide of embodiment 40 or 41, wherein the modified LNA nucleoside is oxy-LNA having the following 2'-4' bridge: -O-CH2-.

[0280] 43. The antisense oligonucleotide of embodiment 42, wherein the oxy-LNA is β-D-oxy-LNA.

[0281] 44. The antisense oligonucleotide of embodiment 40 or 41, wherein the modified LNA nucleoside is cET having the following 2'-4' bridge: -O-CH(CH3)-.

[0282] 45. The antisense oligonucleotide of embodiment 44, wherein the cET is (S)cET, i.e. 6'(S)methyl-β-D-oxy-LNA.

[0283] 46. ​​The antisense oligonucleotide of embodiment 40 or 41, wherein the LNA is an ENA having the following 2'-4' bridge: -O-CH2-CH2-.

[0284] 47. The oligonucleotide according to any one of embodiments 1 to 46, wherein the oligonucleotide comprises at least one modified internucleoside linkage.

[0285] 48. The oligonucleotide according to embodiment 47, wherein the modified internucleoside linkages are nuclease resistant.

[0286] 49. The oligonucleotide according to embodiment 47 or 48, wherein at least 50% of the internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0287] 50. The oligonucleotide according to embodiment 47 or 48, wherein all of the internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0288] 51. The oligonucleotide according to embodiments 1 to 50, wherein the oligonucleotide is capable of recruiting RNaseH.

[0289] 52. The oligonucleotide according to embodiment 51, wherein the oligonucleotide or contiguous nucleotide sequence is a gapmer.

[0290] 53. The oligonucleotide of embodiment 52, wherein the gapmer has the formula 5'-FG-F'-3', wherein the F and F' wing regions independently comprise or consist of 1 to 8 2' sugar-modified nucleosides, and G is a region of 6 to 16 nucleosides that is capable of recruiting RNase H.

[0291] 54. The oligonucleotide of embodiment 53, wherein regions F and F' consist of identical LNA nucleosides.

[0292] 55. The oligonucleotide of embodiment 53 or 54, wherein all 2' sugar-modified nucleosides within regions F and F' are oxy-LNA nucleosides.

[0293] 56. The oligonucleotide of embodiment 53, wherein at least one of regions F or F' further comprises at least one 2'-modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, and 2'-fluoro-DNA.

[0294] 57. The oligonucleotide according to embodiments 53 to 56, wherein the RNase H-recruiting nucleosides in region G are independently selected from DNA, α-L-LNA, C4'-alkylated DNA, ANA, and 2'F-ANA and UNA.

[0295] 58. The oligonucleotide according to embodiment 57, wherein the nucleosides within region G are DNA and / or α-L-LNA nucleosides.

[0296] 59. The oligonucleotide of embodiment 57 or 58, wherein region G consists of at least 75% DNA nucleosides.

[0297] 60. The antisense oligonucleotide according to embodiments 57 to 59, wherein region G consists of 6 to 16 DNA nucleosides.

[0298] 61. An oligonucleotide according to embodiments 1 to 60, wherein the oligonucleotide is selected from CMP numbers 7_1; 8_1; 9_1; 10_1; 11_1; 12_1; 13_1; 14_1; 15_1; 16_1; 17_1; 18_1; 19_1; 20_1; 21_1; 22_1; 23_1; 24_1; 25_1; 26_1; 27_1; 28_1; 29_1; 30_1; 31_1; 32_1; 33_1; or 34_1.

[0299] 62. Oligonucleotides are CMP numbers 7_1, 13_1, 14_1, 14_2, 15_1, 16_1, 17_1, 18_1, 18_2, 105_1, 154_1, 161_1, 162_1, 238_1, 385_1, 388_1, 391_1, 398_1, 399_1, 401_1, 401_2, 423_1, 468_1, 477_1, 534_1, 843_1, 844_1, 845_1, 846_1, 847_1, 848_1, 849_1, 850_1, 851_1, 852_1, 853_1, 854_1, 855_1, 856_1, 857_1, 858_1, 859_1, 860_1, 861_1, 862_1, 863_1, 864_1, 865_1, 866_1, 867_1, 868_1, 869_1, 870_1, 871_1, 872_1, 873_1, 874_1, 875_1, 876_1, 877_1, 878_1, 879_1, 880_1, 881_1, 882_1, 883_1, 884_1, 885_1, 886_1, 887_1, 888_1, 889_1, 890_ 61. The oligonucleotide of embodiments 1 to 60, wherein the oligonucleotide is selected from: 5_1, 847_1, 848_1, 849_1, 850_1, 851_1, 852_1, 853_1, 854_1, 906_1, 974_1, 1003_1, 1004_1, 1045_1, 1054_1, 1180_1, 1246_1, 1247_1, 1248_1, 1361_1, 1408_1, or 1504_1.

[0300] 63. The oligonucleotide according to any one of embodiments 1 to 60, wherein the oligonucleotide is a compound selected from the group consisting of: [Table 11] Uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0301] 64. A conjugate comprising an oligonucleotide according to any one of embodiments 1 to 63 and at least one conjugate moiety covalently attached to said oligonucleotide.

[0302] 65. The oligonucleotide conjugate of embodiment 64, wherein the conjugate moiety is selected from a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin, a vitamin, a viral protein, or a combination thereof.

[0303] 66. The oligonucleotide conjugate of embodiment 64 or 65, wherein the conjugate facilitates delivery across the blood-brain barrier.

[0304] 67. The oligonucleotide conjugate of embodiment 66, wherein the conjugate is an antibody or antibody fragment that targets the transferrin receptor.

[0305] 68. A pharmaceutical composition comprising an oligonucleotide according to embodiments 1 to 63, or a conjugate according to embodiments 64 to 67, and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant.

[0306] 69. A method for making an oligonucleotide according to any one of embodiments 1 to 63, comprising reacting nucleotide units to form covalently linked consecutive nucleotides contained within the oligonucleotide.

[0307] 70. The method of embodiment 69, further comprising reacting the contiguous nucleotide sequence with a non-nucleotide conjugated moiety.

[0308] 71. A method for making the composition of embodiment 68, comprising mixing the oligonucleotide with a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant.

[0309] 72. An in vivo or in vitro method for modulating ATXN2 expression in target cells expressing ATXN2, comprising administering to said cells an effective amount of an oligonucleotide described in embodiments 1 to 63, or a conjugate described in embodiments 64 to 67, or a pharmaceutical composition described in embodiment 68.

[0310] 73. A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide according to embodiments 1 to 63, or a conjugate according to embodiments 64 to 67, or a pharmaceutical composition according to embodiment 68 to a subject suffering from or susceptible to said disease.

[0311] 74. An oligonucleotide according to embodiments 1 to 63, or a conjugate according to embodiments 64 to 67, or a pharmaceutical composition according to embodiment 68, for use as a medicament for the treatment or prevention of a disease in a subject.

[0312] 75. Use of an oligonucleotide of an oligonucleotide according to embodiments 1 to 63 or a conjugate according to embodiments 64 to 67 for the preparation of a medicament for the treatment or prevention of a disease in a subject.

[0313] 76. The method, oligonucleotide, or use according to embodiments 73 to 75, wherein the disease is associated with the in vivo activity of ATXN2.

[0314] 77. The method, oligonucleotide, or use according to embodiments 73 to 76, wherein the disease is associated with overexpression of ATXN2 and / or abnormal amounts of ATXN2.

[0315] 78. The method, oligonucleotide or use according to embodiment 77, wherein ATXN2 is reduced by at least 30%, or at least or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to expression without the oligonucleotide according to embodiments 1 to 63, or the conjugate according to embodiments 64 to 67, or the pharmaceutical composition according to embodiment 68.

[0316] 79. The method, oligonucleotide, or use according to embodiments 73 to 77, wherein the disease is selected from spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions involving TDP-43 proteinopathy.

[0317] 80. The method, oligonucleotide, or use according to embodiments 73 to 79, wherein the subject is a mammal.

[0318] 81. The method, oligonucleotide, or use according to embodiment 80, wherein the mammal is a human. [Example]

[0319] material and method Oligonucleotide motif sequences and oligonucleotide compounds

[0320] [Table 12] TIFF2025179845000036.tif248165 TIFF2025179845000037.tif248165 TIFF2025179845000038.tif248165 TIFF2025179845000039.tif248165 TIFF2025179845000040.tif248165 TIFF2025179845000041.tif248165 TIFF2025179845000042.tif248165 TIFF2025179845000043.tif248165 TIFF2025179845000044.tif248165 TIFF2025179845000045.tif248165 TIFF2025179845000046.tif248165 TIFF2025179845000047.tif248165 TIFF2025179845000048.tif248165 TIFF2025179845000049.tif248165 TIFF2025179845000050.tif248165 TIFF2025179845000051.tif248165 TIFF2025179845000052.tif248165 TIFF2025179845000053.tif248165 TIFF2025179845000054.tif248165 TIFF2025179845000055.tif248165 TIFF2025179845000056.tif248165 TIFF2025179845000057.tif248165 TIFF2025179845000058.tif248165 TIFF2025179845000059.tif248165 TIFF2025179845000060.tif248165 TIFF2025179845000061.tif242165 TIFF2025179845000062.tif248165 TIFF2025179845000063.tif158165

[0321] The motif sequence represents the consecutive sequence of nucleobases present in the oligonucleotide.

[0322] Design refers to a gapmer design "FG-F'", where each number represents the number of consecutive modified nucleosides, e.g., 2'-modified nucleosides (first number = 5'-flanking), followed by the number of DNA nucleosides (second number = gap region), followed by the number of modified nucleosides, e.g., 2'-modified nucleosides (third number = 3'-flanking), optionally preceded or followed by further repeat regions of DNA and LNA, which are not necessarily part of the contiguous nucleotide sequence complementary to the target nucleic acid.

[0323] The oligonucleotide compounds represent specific designs of motif sequences, where uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosines, all 5-methyl DNA cytosines are represented by "e", and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0324] Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art. Below are applicable protocols. The oligonucleotides of the present invention may have been produced by methods that differ slightly in terms of the equipment, support, and concentration used.

[0325] Oligonucleotides are synthesized on a uridine universal support using the phosphoramidite approach in Oligomaker 48 on a 1 μmol scale. At the end of synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia at 60 °C for 5–16 h. Oligonucleotides are purified by reverse-phase HPLC (RP-HPLC) or solid-phase extraction, characterized by UPLC, and molecular weights are further confirmed by ESI-MS.

[0326] Oligonucleotide extension: Coupling of β-cyanoethyl phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is carried out using a solution of 0.1 M 5'-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M). In the final cycle, a phosphoramidite bearing the desired modification, such as a C6 linker for attaching a conjugate group, or such a conjugate group, can be used. Thiolation to introduce phosphorothioate bonds is carried out using hydrogenated xanthan gum (0.01 M in acetonitrile / pyridine 9:1). Phosphodiester bonds can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those commonly used in oligonucleotide synthesis.

[0327] For post-solid-phase synthesis conjugation, commercially available C6 amino linker phosphoramidites can be used in the final cycle of solid-phase synthesis, and after deprotection and cleavage from the solid support, the amino-linked, deprotected oligonucleotide is isolated. The conjugate is introduced by activation of the functional group using standard synthetic methods.

[0328] Purification by RP-HPLC: The crude compound is purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10μ 150x10mm column. 0.1M ammonium acetate pH 8 and acetonitrile are used as buffers at a flow rate of 5mL / min. Collected fractions are lyophilized to yield the purified compound, typically as a white solid.

[0329] Shorthand: DCI 4,5-dicyanoimidazole DCM: dichloromethane DMF: dimethylformamide DMT: 4,4'-dimethoxytrityl THF tetrahydrofuran Bz: benzoyl Ibu: Isobutyryl RP-HPLC: reversed-phase high-performance liquid chromatography

[0330] T m Assay The oligonucleotide and RNA target (phosphate-linked, PO) duplexes were diluted to 3 mM in 500 ml of RNase-free water and diluted in 500 ml of 2xT m The duplex melting temperature (T m ) is measured on a Lambda 40 UV / VIS spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is increased from 20°C to 95°C and then decreased to 25°C, and the absorbance is recorded at 260 nm. The first derivative and both the melting and annealing maxima are used to calculate the duplex T m Evaluate.

[0331] cell line

[0332] [Table 13]

[0333] Example 1 Testing the in vitro efficacy of LNA oligonucleotides in A431, NCI-H23, and ARPE19 cell lines at 25 and 5 μM An oligonucleotide screen was performed in three human cell lines using the LNA oligonucleotides (CMP Nos. 7-35_1) in Table 7, which target the region from positions 83121 to 83144 in SEQ ID NO: 1. The human cell lines A341, NCI-H23, and ARPE19 were purchased from the vendors listed in Table 8 and maintained in a humidified incubator at 37°C with 5% CO2 as recommended by the supplier. For screening assays, cells were seeded into 96-multiwell plates in the medium recommended by the supplier (see Table 8 in the Materials and Methods section). The number of cells per well was optimized for each cell line (see Table 8 in the Materials and Methods section).

[0334] Cells were incubated for 0-24 hours with oligonucleotides (dissolved in PBS) at a concentration of 5 or 25 μM before addition, and harvested 3-4 days after oligonucleotide addition (incubation times for each cell line are shown in Table 8 in the Materials and Methods section).

[0335] RNA was extracted using the Qiagen RNeasy 96 kit (74182) according to the manufacturer's instructions. cDNA synthesis and qPCR were performed using qScript XLT One-Step RT-qPCR ToughMix Low ROX, 95134-100 (Quanta Biosciences). Target transcript abundance was quantified using FAM-labeled TaqMan assays from Thermo Fisher Scientific in multiple reactions, along with a VIC-labeled GUSB control. TaqMan primer assays for target transcripts of interest, ATXN2 (Hs01002833_m1(FAM-MGB)), and the housekeeping gene GUSB (4326320E VIC-MGB probe). A technical duplex setup was used (n = 1 biological replicate).

[0336] Relative ATXN2 mRNA expression levels are shown in Table 9 as a percentage of the control (PBS-treated cells), i.e., the lower the value, the greater the inhibition.

[0337] [Table 14]

[0338] Example 2: In vitro EC50 and efficacy testing of selected compounds from Example 1 in A431, NCI-H23, U251, and U2-OS cell lines. The EC50 and potency (KD) of the oligonucleotides of Example 1 that exhibited less than 20% residual ATXN2 mRNA at 5 μM in NCI-H23 cells were measured using the assay described in Example 1 at the following oligonucleotide concentrations: 50, 15.81, 5.00, 1.58, 0.50, 0.16, 0.05, and 0.016 μM (half-log dilutions, 8 points from 50 μM) and n=1-2 biological replicates.

[0339] Table 8 in the Materials and Methods section lists the conditions for two additional cell lines. The TaqMan primer assays used for cell line U2-OS were ATXN2, Hs00268077_m1 (FAM-MGB), and housekeeping GAPDH, 4326137E (VIC-MGB). The TaqMan primers for the cell lines used in Example 1 were the same in this example.

[0340] EC50 values ​​were calculated using GraphPad Prism6, and the maximum reduction of ATXN2 mRNA (Max KD) at 50 μM is shown in the table as a percentage of the control (PBS-treated cells). Tables 10-13 show the results for each cell line.

[0341] [Table 15]

[0342] [Table 16]

[0343] [Table 17]

[0344] [Table 18]

[0345] Example 3 Testing the in vitro efficacy of LNA oligonucleotides in A431 and U2-OS cell lines at 0.5 μM Scanning libraries were generated and tested for efficacy in two human cell lines. The oligonucleotides used are listed in Table 7. Some of the oligonucleotides tested in Example 1 were also included in this example. The human cell lines A341 and U2-OS were purchased from the suppliers listed in Table 8 and maintained in a humidified incubator at 37°C with 5% CO2 as recommended by the supplier. For screening assays, cells were seeded into 96-multiwell plates in the medium recommended by the supplier (see Table 8 in the Materials and Methods section). The number of cells per well was optimized for each cell line (see Table 8 in the Materials and Methods section).

[0346] Cells were seeded immediately prior to the addition of oligonucleotides (dissolved in PBS) at a concentration of 0.5 μM (this was changed from the 24 hours described in Table 8). Cells were harvested 3 days after addition of oligonucleotides.

[0347] RNA was extracted using the Qiagen RNeasy 96 kit (74182) according to the manufacturer's instructions. cDNA synthesis and qPCR were performed using qScript XLT One-Step RT-qPCR ToughMix Low ROX, 95134-100 (Quanta Biosciences). Target transcript abundance was quantified using FAM-labeled TaqMan assays from Thermo Fisher Scientific in multiple reactions, along with VIC-labeled housekeeping gene controls. The TaqMan primer assays used were as follows: [Table 19]

[0348] A technical duplex setup was used (n = 1, biological replicate).

[0349] Relative ATXN2 mRNA expression levels are shown in Table 14 as a percentage of control (PBS-treated cells), i.e., the lower the value, the greater the inhibition.

[0350] [Table 20] TIFF2025179845000072.tif236165 TIFF2025179845000073.tif249165 TIFF2025179845000074.tif249165 TIFF2025179845000075.tif249165 TIFF2025179845000076.tif249165 TIFF2025179845000077.tif249165 TIFF2025179845000078.tif249165 TIFF2025179845000079.tif249165 TIFF2025179845000080.tif249165 TIFF2025179845000081.tif249165 TIFF2025179845000082.tif249165 TIFF2025179845000083.tif249165 TIFF2025179845000084.tif249165 TIFF2025179845000085.tif249165 TIFF2025179845000086.tif249165 TIFF2025179845000087.tif249165 TIFF2025179845000088.tif249165 TIFF2025179845000089.tif249165 TIFF2025179845000090.tif249165 TIFF2025179845000091.tif249165 TIFF2025179845000092.tif249165 TIFF2025179845000093.tif249165 TIFF2025179845000094.tif248165 TIFF2025179845000095.tif249165 TIFF2025179845000096.tif249165 TIFF2025179845000097.tif249165 TIFF2025179845000098.tif249165 TIFF2025179845000099.tif150165 The data in Table 14 are shown in Figure 1A (A431 cells) and B (U2-OS cells). Figure 2 shows good correlation between the screening results for the two cell lines.

[0351] Example 4 Identification of hotspot regions from measurements of ATXN2 mRNA levels in A431 and U2OS cell lines after treatment with 0.5 μM oligonucleotides The amount of ATXN2 mRNA in A431 and U2OS cell lines after treatment with each of the 1483 oligonucleotides listed in Table 7 was used to identify hotspot regions on the ATXN2 pre-mRNA as follows.

[0352] First, oligonucleotide hits that resulted in a greater than 50% reduction in either or both of the A431 and U2OS cell lines were identified, yielding 48 oligonucleotides.

[0353] Next, for each of these 48 hits, any additional oligonucleotides whose start position is within 10 nt of the hit are grouped together with the hit. Any groups containing one or more of the same oligonucleotides are combined into one group. This results in 21 different oligonucleotide groups. Each group contains one or more oligonucleotides that can reduce ATXN2 mRNA by at least 50%.

[0354] For each of the 21 groups, hotspot regions were identified as regions on the ATXN2 pre-mRNA that were covered by all of the oligonucleotides in the group and are shown in Table 15 below.

[0355] [Table 21]

[0356] Figure 1C shows the locations of hotspots as gray dots on the ATXN2 pre-mRNA, confirming that most of the hotspots are located in the intron regions of the target transcript (SEQ ID NO: 1).

[0357] Example 5 In vitro EC50 and efficacy testing of selected compounds from Example 3 in A431 and U2-OS cell lines The EC50 and potency (KD, amount of residual mRNA at 10 μM) of selected oligonucleotides from Example 3 were measured using the assay described in Example 3 at the following oligonucleotide concentrations: 10, 3.2, 1.0, 0.32, 0.10, 0.32, 0.010, and 0.032 μM (half-log dilutions, 8 points from 10 μM) and n=2 biological replicates.

[0358] Specifically, EC50 values ​​were estimated by fitting a four-parameter logistic model to the data using least squares. The model fit was constrained so that the minimum asymptote at high concentrations was greater than or equal to 0. Residual ATXN2 mRNA at 10 μM is shown in Table 16 as a % of control (PBS-treated cells).

[0359] [Table 22]

[0360] Example 6 Comparison of Compounds Targeting "Region 12" with Compounds Targeting Human AXTN2 in a Cross-Region Over 1500 LNA gapmer oligonucleotides were designed spanning the ATXN2 pre-mRNA sequence (SEQ ID NO: 1), and their in vitro potency at doses as low as 0.5 μM was evaluated in A431 and U2OS cells. The results are summarized in Figure 6. The data confirm that the hotspot region (SEQ ID NO: 6), represented as a solid circle, provides highly potent compounds. Figure 7 shows only selected hotspot region compounds.

[0361] Example 7 Testing the in vitro efficacy of LNA oligonucleotides in U2OS and A431 cell lines at 0.5 μM An oligonucleotide screen was performed in three human cell lines using the LNA oligonucleotides in Table 17, which also target the region from positions 83121 to 83144 of SEQ ID NO: 1, as described in the Examples above. Relative ATXN2 mRNA expression levels are shown in Table 17 as a percentage of the control (PBS-treated cells). The lower the value, the greater the inhibition.

[0362] [Table 23]

[0363] In the compounds, uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0364] Example 8: In vitro EC50 and efficacy testing of selected compounds Using the methodology described in Example 2, the EC50 of the compounds tested in Example 3 was determined using 10 mM as the starting concentration. The EC50 values ​​were calculated as follows:

[0365] [Table 24]

[0366] Example 9: Evaluation of selected compounds 7_1 and 15_4 compared to prior art compound ASO7 in mouse primary cortical neuron cells. Compound ASO7= gtggg atacaaattc taggc (SEQ ID NO: M), where the underlined bold letters represent 2'-O-MOE nucleosides, non-bold letters are DNA nucleosides, and all internucleoside linkages are phosphorothioate (as disclosed in Scholes et al., Nature volume 544, pages 362-366 (20 April 2017)).

[0367] Preparation of mouse primary cortical neuron cell cultures Primary cortical neuron cultures were prepared from 15-day-old mouse embryonic brains according to standard procedures. Briefly, culture dishes were coated with poly-L-lysine (50 μg / ml poly-L-lysine, 10 mM Na tetraborate, pH 8 buffer) for 2–3 hours in a humidified incubator at 37°C and 5% CO2. The dishes were washed with 1x PBS before use. Collected mouse embryonic brains were dissected and homogenized with a razor blade and immersed in 38 ml of dissection medium (HBSS, 0.01 M Hepes, penicillin / streptomycin). 2 ml of trypsin was added, and the cells were incubated for 30 minutes at 37°C. After incubation, 4 ml of trypsin stop solution was added, and the cells were centrifuged.

[0368] The cells were dispersed in 20 ml DMEM (+10% FBS) and passed through a syringe with a 13 g needle for further homogenization. This was followed by centrifugation at 500 rpm for 15 minutes. The supernatant was removed, and the cells were dispersed in DMEM (+10% FBS) and seeded into 96-well plates (0.1 x 10^6 cells / well in 100 μl). The neuronal cell cultures were ready for use immediately after seeding.

[0369] Screening of oligonucleotides in mouse primary cortical neuron cell cultures The next day, the medium was changed to growth medium (Gibco Neurobasal medium, B27 supernatant, Glutamax, penicillin-streptomycin) and 5 μM FdU in 96-well plates and incubated with the oligonucleotides at the desired concentrations for 6 days. RNA was isolated from the cells, and knockdown efficacy was measured by qPCR analysis. For one-step qPCR (cDNA synthesis and qPCR), each sample was run in duplicate with one ATXN2 probe set (IDT, Leuven, Belgium) (ATXN2_assay1, Mm.PT.58.7178341) run in duplex with either RPL4, Mm.PT.58.17609218, or RPS29, Mm.PT.58.21577577. To each reaction, 4 μL of previously diluted RNA, 0.5 μL of water, and 5.5 μL of TaqMan MasterMix were added. Plates were centrifuged and heat-closed at 90°C for 40 seconds, followed by a short incubation on ice, after which samples were analyzed using qPCR (50°C for 15 minutes and 90°C for 3 minutes, followed by 40 cycles of 95°C for 5 seconds and 60°C for 45 seconds).

[0370] Data were analyzed using the relative standard curve method, with each sample first normalized to the geometric mean of two housekeeping genes (RPL4 and RPS29) and then expressed as a percentage of untreated control animals. Compounds used: 7_1, 15_4, and ASO7

[0371] The results are shown in Figure 8.

[0372] Example 10: In vivo ICV mouse studies Animal care In vivo activity and tolerability of compounds were tested in C57BL / 6JBomTac female mice (16-23 g, Taconic Biosciences, Ejby, Denmark) housed 5-6 per cage. Animals were maintained in a colony room maintained at constant temperature (22 ± 2°C) and humidity (55 ± 10%) with 12 hours of light per day (lights on at 6:00 AM). All animals had free access to food and water throughout the study. All mouse procedures were approved by the Danish National Committee for Ethics in Animal Experiments.

[0373] Route of administration – intracerebroventricular injection Compounds were administered to mice via intracerebroventricular (ICV) injection. Prior to ICV administration, mice were weighed and euthanized with isoflurane or propofol (30 mg / kg). The stand was adjusted to allow for intracerebroventricular injection using a Hamilton microinjection needle with a 23-gauge needle fitted with an FEP catheter, penetrating the right lateral ventricle at the correct distance (3.9 mm) from the skin and skull. The scruff of the neck of the mouse to be injected was held with the thumb and index finger of one hand. Applying gentle yet firm pressure, the head was lifted upward, inserting the needle into the skull 1-2 mm to the right of the midline (mediolateral) and 1-2 mm beyond the eye. A bolus of test compound or vehicle was injected over 30 seconds at the previously determined infusion rate. To avoid backflow, the mouse was held in this position for an additional 5 seconds, after which it was carefully lowered downward and the needle was removed. This procedure did not require surgery or incision. The animal was placed under a heat lamp until it recovered from the procedure. Brain tissue (cortex and cerebellum), as well as liver and kidney cortex, were collected on dry ice 2 or 4 weeks after administration for drug concentration analysis, and ATXN2 mRNA and protein analysis.

[0374] Three independent experiments were performed with different groups of compounds as shown in the table below (Table 19). Compound 906_1 = TCCattaactactCTTT (Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.)

[0375] [Table 25]

[0376] Tolerability results: Acute toxicity was measured by monitoring animal behavior as described in WO 2016 / 126995 (see Example 9 of WO '995). Chronic toxicity was measured by monitoring the weight of each animal over the time course of the experiment, with a weight loss of more than 5% indicating chronic toxicity. Animals showing significant signs of toxicity were euthanized, and in some cases the experiment was terminated early (if a high percentage of animals showed signs of toxicity, all animals were euthanized).

[0377] Experiment 1 Compound 7_1: None of the animals showed signs of acute toxicity. One mouse showed weight loss during the experiment (27 days).

[0378] Compound 14_1: Two of the ten animals showed acute toxicity and had to be euthanized one day after dosing. Five of the remaining eight animals showed weight loss during the study (terminated on day 8).

[0379] Compound 15_1: One of ten animals showed acute toxicity and had to be euthanized one day after administration. Of the remaining eight animals, five showed weight loss during the study (ended on day 8).

[0380] Experiment 2 Compound ASO7 was acutely toxic in all 10 animals, with severe convulsions occurring within 30 minutes of administration, necessitating euthanasia 1 hour after administration.

[0381] Compound 906_1: Three of the ten animals showed acute toxicity and had to be euthanized one day after administration. Four of the remaining seven animals showed weight loss during the study (ended on day 12).

[0382] Compound 17_1: None of the animals showed signs of acute toxicity. Two of the ten animals showed weight loss during the experiment (29 days).

[0383] Compound 18_1: One of ten animals showed acute toxicity and was euthanized. Three of the remaining nine animals showed weight loss during the study (29 days).

[0384] Experiment 3 Compound 15_3: Two of the six animals showed acute toxicity and had to be euthanized one day after administration. Of the remaining four, two lost weight during the study (ended on day 15).

[0385] Compound 15_4: Two of the six animals showed acute toxicity and had to be euthanized one day after administration. None of the remaining four animals showed weight loss during the study (ended at 14 days).

[0386] Compound 14_3: One of six animals showed acute toxicity and had to be euthanized one day after administration. Of the remaining five, three lost weight during the study (ended on day 9).

[0387] Compound 14_2: Two of the six animals showed acute toxicity and had to be euthanized one day after administration. Of the remaining four, three lost weight during the study (ended on day 15).

[0388] Compound 15_2: Two of the six animals showed acute toxicity and had to be euthanized one day after administration. Of the remaining four, three lost weight during the study (ended on day 10).

[0389] Compound 15_5: All six animals showed acute toxicity and had to be euthanized one day after dosing.

[0390] Tissue homogenization for oligo content and ATXN2 mRNA analysis Mouse brain, liver, and kidney samples were homogenized in MagNA Pure LC RNA Isolation Tissue Lysis Buffer (Roche, Indianapolis, IN) using a Qiagen TissueLyzer II. The homogenate was incubated at room temperature for 30 minutes to ensure complete cell lysis. After cell lysis, the homogenate was centrifuged at 13,000 rpm for 3 minutes, and the supernatant was used for analysis. One half was set aside for biological analysis, and the other half was directly used for RNA extraction.

[0391] Oligo content analysis For biological analysis, samples were diluted 10-50 times for oligo content determination using a hybridization ELISA method. A biotinylated LNA capture probe and a digoxigenin-conjugated LNA detection probe (both 35 nM in 5x SSCT, each complementary to one end of the LNA oligonucleotide to be detected) were diluted with the diluted homogenate or the relevant standard, incubated for 30 minutes at room temperature, and added to a streptavidin-coated ELISA plate (Nunc catalog number 436014).

[0392] The plate was incubated for 1 hour at room temperature and washed with 2xSSCT (300 mM sodium chloride, 30 mM sodium citrate, and 0.05% v / v Tween-20, pH 7.0). Captured LNA duplexes were detected using an anti-DIG antibody conjugated with alkaline phosphatase (Roche Applied Science catalog number 11093274910) and an alkaline phosphatase substrate system (Blue Phos substrate, KPL product code: 50-88-00). The amount of oligo complex was measured as absorbance at 615 nm in a Biotek reader.

[0393] Data were normalized to tissue weight and expressed as nM of oligo.

[0394] Decrease in ATXN2 mRNA RNA was purified from 350 μL of supernatant using a MagNA Pure 96 instrument using the Cellular RNA Large Volume Kit (Roche, Indianapolis, IN). RNA samples were normalized to 2 ng / μL in RNase-free water and stored at -20°C until further use.

[0395] For one-step qPCR (cDNA synthesis and qPCR), each sample was run in duplicate using four probe sets (IDT, Leuven, Belgium) performed in duplex (RPL4, Mm.PT.58.17609218 and ATXN2_assay1, Mm.PT.58.7178341; and RPS29, Mm.PT.58.21577577 and ATXN2_assay2, Mm.PT.58.11673123). Each reaction contained 4 μL of previously diluted RNA, 0.5 μL of water, and 5.5 μL of TaqMan MasterMix. Plates were centrifuged and heat-closed at 90°C for 40 seconds, followed by a short incubation on ice, after which samples were analyzed using qPCR (50°C for 15 minutes and 90°C for 3 minutes, followed by 40 cycles of 95°C for 5 seconds and 60°C for 45 seconds).

[0396] Data were analyzed using the relative standard curve method, and each sample (geometric mean of two ATXN2 assays) was first normalized to the geometric mean of two housekeeping genes (RPL4 and RPS29) and then expressed as a percentage of untreated control animals.

[0397] Tissue homogenization for ATXN2 protein analysis Mouse brain samples were homogenized in RIPA buffer with 1% Halt™ Protease and Phosphatase Inhibitor (Thermo Fisher Scientific) using a Qiagen TissueLyzer II. The homogenate was incubated at 4°C for 30 minutes to ensure complete cell lysis. After cell lysis, the homogenate was centrifuged at 14,000 rcf for 10 minutes, and the supernatant was aliquoted into small volumes and stored at -20°C until further use.

[0398] ATXN2 protein reduction Samples were normalized to 0.05 mg / ml based on all protein measured using a BCA Kit (Thermo Fisher Scientific). ATXN2 protein reduction was measured using duplex (primary antibodies: Mouse Anti-Ataxin-2, 1:50, #611378, BD Bioscience, and Anti-HPRT, 1:100, #ab109021, Abcam; secondary antibodies: anti-mouse and anti-rabbit secondary antibodies, Protein Simple, San Jose, CA) and analyzed on a capillary Western immunoassay (WES) instrument (Protein Simple) according to the manufacturer's standard procedures.

[0399] Data were analyzed for relative abundance: ATXN2 expression for each sample was first normalized to a housekeeping protein (HPRT) and then expressed as a percentage of untreated control animals.

[0400] The results are shown in Figures 9 to 11.

[0401] Figure 9: Comparison of knockdown (mRNA) of 11 selected compounds, compiled data from 3 experiments, Study 1 = filled circles, Study 2 = open circles, Study 3 = half filled and half open circles.

[0402] Figure 10: Knockdown at the protein and mRNA levels and exposure to compound 7_1 in the cortex and cerebellar regions. Protein data for the cortex is shown.

[0403] Figure 11: Knockdown at the protein and mRNA levels and exposure to compound 15_4 in the cortex and cerebellar regions. Protein data for the cortex is shown.

[0404] Example 11: In vivo ICV mouse studies - duration of action A new study was launched to investigate the duration of action of compound 7_1. 15_4 was included at only one time point (7 days). The procedure was as described in Example 7 using the following protocol:

[0405] [Table 26]

[0406] The results of mRNA knockdown are shown in Figure 12, which demonstrates robust and potent knockdown of ATXN2 mRNA in both cortex and, specifically, cerebellar tissue for at least 56 days (maximal levels of efficacy were maintained between 7 and 56 days, indicating a duration of action significantly longer than 56 days). There appear to be some mice for which the treatment was less effective, and this may be related to the procedure over time as the mice are associated with the same individual.

[0407] Example 12: In vivo cynomolgus monkey studies subject The subjects were male and female cynomolgus monkeys weighing 2-4 kg at the start of treatment. Each monkey was implanted with a polyurethane catheter into the intrathecal space in the lumbar region. The proximal end of the catheter was connected to a subcutaneous access port to allow injection into the intrathecal space and withdrawal of CSF samples.

[0408] Cynomolgus monkeys were administered either saline, Compound No. 7_1, or Compound No. 15_4 (dissolved in saline at 0.33 ml / min in a volume of 1.0 ml followed by 1.5 ml of aCSF). The total infusion time was 4.5 minutes. See Table 21 for information on dose, duration, group size, and tissues. [Table 27]

[0409] CSF was collected from a lumbar access port by gravity flow, with a maximum of 0.8 ml of CSF per sample. CSF was centrifuged and the supernatant was stored at -80°C until analysis. Plasma obtained from an available vein was stored at -80°C until analysis.

[0410] Cynomolgus monkeys were euthanized with ketamine and isoflurane while receiving an appropriate volume of commercially available euthanasia solution. Autopsy tissue was obtained immediately afterward, and the brains were transferred to a cooled surface for dissection. All samples were collected using a clean removal technique, weighed, and frozen on dry ice for drug concentration and ATXN2 mRNA analysis.

[0411] Tolerability No clinical side effects were reported during the life phase. Histopathology revealed no concern for any of the compounds at the doses tested.

[0412] Tissue homogenization for oligo content and ATXN2 mRNA analysis See Example 7 - the same procedure was used.

[0413] Oligo content analysis For biological analysis, samples were diluted 50-100 times for oligo content determination using a hybridization ELISA method. A biotinylated LNA capture probe and a digoxigenin-conjugated LNA detection probe (both 35 nM in 5x SSCT, each complementary to one end of the LNA oligonucleotide to be detected) were diluted with the diluted homogenate or the relevant standard, incubated for 30 minutes at room temperature, and added to a streptavidin-coated ELISA plate (Nunc catalog number 436014).

[0414] The plate was incubated for 1 hour at room temperature and washed with 2xSSCT (300 mM sodium chloride, 30 mM sodium citrate, and 0.05% v / v Tween-20, pH 7.0). Captured LNA duplexes were detected using an anti-DIG antibody conjugated with alkaline phosphatase (Roche Applied Science catalog number 11093274910) and an alkaline phosphatase substrate system (Blue Phos substrate, KPL product code: 50-88-00). The amount of oligo complex was measured as absorbance at 615 nm in a Biotek reader.

[0415] Data were normalized to tissue weight and expressed as nM of oligo.

[0416] Decrease in ATXN2 mRNA RNA was purified from 350 μL of supernatant using a MagNA Pure 96 instrument using the Cellular RNA Large Volume Kit (Roche, Indianapolis, IN). RNA samples were normalized to 2 ng / μL in RNase-free water and stored at -20°C until further use.

[0417] For one-step qPCR (cDNA synthesis and qPCR), each sample was run in duplicate using four probe sets for ATXN2 (see Table 22) (IDT, Leuven, Belgium) run in singleplex, and four probe sets for different housekeeping genes (GAPDH, Mf04392546_g1, POLR3F, Mf02860939_m1, YWHAZ, Mf02920410_m1, and UBC, Mf02798368_m1) (Thermo Fisher Scientific).

[0418] [Table 28]

[0419] To each reaction, 4 μL of previously diluted RNA, 0.5 μL of water, and 5.5 μL of TaqMan MasterMix were added. Plates were centrifuged and heat-closed at 90°C for 40 seconds, followed by a short incubation on ice, after which samples were analyzed using qPCR (50°C for 15 minutes and 90°C for 3 minutes, followed by 40 cycles of 95°C for 5 seconds and 60°C for 45 seconds).

[0420] Data were analyzed using the relative standard curve method: each sample (average of four ATXN2 assays) was first normalized to the average of the three best-performing housekeeping genes for each tissue, as determined by the geNORM analysis described in Vandesompele et al., 2002, Genome Biology 2002, 3(7):research 0034.1-0034.11, and then expressed as a percentage of untreated control animals (see Figure 13).

[0421] Tissue homogenization for ATXN2 protein analysis Same as mouse studies ATXN2 protein reduction Cerebellar and cortex samples were normalized to 0.2 mg / ml based on total protein measured using a BCA Kit (Thermo Fisher Scientific). ATXN2 protein reduction was measured using duplex (primary antibodies: Mouse Anti-Ataxin-2, 1:50, #611378, BD Bioscience, and Anti-HPRT, 1:50, #ab109021, Abcam; secondary antibodies: anti-mouse and anti-rabbit secondary antibodies, Protein Simple, San Jose, CA) and analyzed using a capillary Western immunoassay (WES) instrument (Protein Simple) according to the manufacturer's standard procedures.

[0422] Data were analyzed for relative abundance: ATXN2 expression for each sample was first normalized to a housekeeping protein (HPRT) and then expressed as a percentage of untreated control animals.

[0423] The results are shown in Figures 13 and 14.

Claims

1. An antisense oligonucleotide 10 to 30 nucleotides in length comprising a contiguous nucleotide sequence 10 to 22 nucleotides in length that is at least 90% complementary, such as 100% complementary, to a sequence selected from the group consisting of SEQ ID NOs: 1516, 6, 1505, 1506, 1507, 1508, 1509, 1510, 1511, 1512, 1513, 1514, 1515, 1517, 1518, 1519, 1520, 1521, 1522, 1523, 1524, and 1525.

2. 2. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NOs: 7, 13, 14, 15, 17, 18, 105, 154, 161, 162, 238, 385, 388, 391, 398, 399, 401, 401, 423, 468, 477, 534, 843, 844, 845, 847, 848, 849, 850, 851, 852, 853, 854, 906, 974, 1003, 1004, 1045, 1054, 1180, 1246, 1247, 1248, 1361, 1408, and 1504; or at least 14 contiguous nucleotides thereof.

3. 3. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence is selected from the group consisting of SEQ ID NOs: 7, 13, 14, 15, 17, 18, 105, 385, 388, 391, 1246, 1247, 1248, and 1504; or at least 14 contiguous nucleotides thereof.

4. The antisense oligonucleotide according to any one of claims 1 to 3, wherein one or more nucleosides in the contiguous nucleotide sequence are 2' sugar-modified nucleosides.

5. 5. The antisense oligonucleotide of claim 4, wherein the one or more 2' sugar-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

6. The antisense oligonucleotide of any one of claims 4 to 5, wherein the one or more modified nucleosides are LNA nucleosides.

7. The antisense oligonucleotide of any one of claims 1 to 6, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

8. 8. The antisense oligonucleotide of claim 7, wherein all internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

9. The antisense oligonucleotide of any one of claims 1 to 8, wherein the oligonucleotide is capable of recruiting RNase H, such as human RNase H1.

10. 10. The antisense oligonucleotide of claim 9, wherein the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, consists of or comprises a gapmer of the formula 5'-FGF'-3'.

11. The antisense oligonucleotide according to claim 10, wherein the region G consists of 6 to 16 DNA nucleosides.

12. 12. The antisense oligonucleotide of claim 10 or 11, wherein regions F and F' each comprise at least one LNA nucleoside.

13. The antisense oligonucleotide is selected from the group consisting of CMP numbers 7_1, 13_1, 14_1, 14_2, 15_1, 16_1, 17_1, 18_1, 18_2, 105_1, 154_1, 161_1, 162_1, 238_1, 385_1, 388_1, 391_1, 398_1, 399_1, 401_1, 401_2, 423_1, 468_1, 477_1, 534_1, 843_1, 844_1, 845_1, and 847_1 , 848_1, 849_1, 850_1, 851_1, 852_1, 853_1, 854_1, 906_1, 974_1, 1003_1, 1004_1, 1045_1, 1054_1, 1180_1, 1246_1, 1247_1, 1248_1, 1361_1, 1408_1, and 1504_1.

14. the antisense oligonucleotide comprising: ATTTtactttaaccTCC SEQ ID NO: 7 CMP No. 7_1 TCAACattttactttaacCT SEQ ID NO: 13 CMP No. 13_1 TCAACattttactttAACC SEQ ID NO: 14 CMP No. 14_1 TCAcattttactttAACC SEQ ID NO: 14 CMP No. 14_2 TCAACattttactttaaccTC SEQ ID NO: 15 CMP No. 15_1 TTCAcattttacttTAAC SEQ ID NO: 17 CMP No. 17_1 TTCAcattttactttaACC SEQ ID NO: 18 CMP No. 18_1 TTCacattttactttAACC SEQ ID NO: 18 CMP No. 18_2 TCACttgacacaacTTC SEQ ID NO: 105 CMP No. 105_1 ACTTtttatacctcatCA SEQ ID NO: 385 CMP No. 385_1 TACTttttatacctcATC SEQ ID NO: 388 CMP No. 388_1 TTActttttataccTCAT SEQ ID NO: 391 CMP No. 391_1 TTCAcattttatactTTAA SEQ ID NO: 1246 CMP No. 1246_1 ATTCacattttatactTTAA SEQ ID NO: 1247 CMP No. 1247_1 ATTCacattttatacTTTA SEQ ID NO: 1248 CMP No. 1248_1, and TTTTattattattattatCTAC SEQ ID NO: 1504 CMP No. 1504_1 (capital letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages).

15. A conjugate comprising the antisense oligonucleotide of any one of claims 1 to 14 and at least one conjugate moiety covalently attached to said oligonucleotide.

16. A pharmaceutically acceptable salt of the antisense oligonucleotide according to any one of claims 1 to 14, or the conjugate according to claim 15.

17. A pharmaceutical composition comprising an antisense oligonucleotide according to claims 1 to 14, or a conjugate according to claim 15, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

18. An in vivo or in vitro method for modulating ATXN2 expression in a target cell expressing ATXN2, comprising administering to the cell an effective amount of an antisense oligonucleotide described in any one of claims 1 to 14, or a conjugate described in claim 15, or a pharmaceutical composition described in claim 16.

19. A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of any one of claims 1 to 14, or the conjugate of claim 15, or the pharmaceutical composition of claim 16 to a subject suffering from or susceptible to said disease.

20. 20. The method of claim 19, wherein the disease is selected from the group consisting of neurodegenerative diseases selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions associated with TDP-43 proteinopathy.

21. An oligonucleotide according to any one of claims 1 to 14, or a conjugate according to claim 15, or a pharmaceutical composition according to claim 16, for use in medicine.

22. 17. The oligonucleotide of any one of claims 1 to 14, or the conjugate of claim 15, or the pharmaceutical composition of claim 16, for use in the treatment or prevention of a neurodegenerative disease, such as a disease selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions involving TDP-43 proteinopathy.

23. 17. Use of an oligonucleotide according to claims 1 to 14, or a conjugate according to claim 15, or a pharmaceutical composition according to claim 16, for the preparation of a medicament for the treatment or prevention of a neurodegenerative disease, such as a disease selected from the group consisting of spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis (ALS), Alzheimer's frontotemporal dementia (FTD), parkinsonism, and conditions involving TDP-43 proteinopathy.

Images