Mitochondrial treatment of organs for transplantation

Isolated mitochondria from mammalian sources are used to improve cell, tissue, and organ function by enhancing mitochondrial activity and reducing injury and inflammation, addressing the need for exogenous mitochondria in transplantation and engineering.

JP2025186271APending Publication Date: 2025-12-23UNITED THERAPEUTICS CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025140799
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-06-18
Filing Date
2025-08-26
Publication Date
2025-12-23

AI Technical Summary

Technical Problem

There is a need for exogenous mitochondria that can improve the function and viability of cells, tissues, or organs, particularly in conditions of stress such as cold exposure and ischemia, and to enhance the efficacy of organ transplantation and organ engineering, while minimizing cellular injury and inflammation.

Method used

The use of mitochondria isolated from various mammalian sources, including pigs and humans, to treat human cells, tissues, or organs, either as xenogeneic, allogeneic, or autologous, delivered before, during, or after implantation or transplantation, or used in bioreactors to enhance engineered organ or tissue function.

Benefits of technology

Improves mitochondrial function, increases oxygen consumption and ATP synthesis, reduces injury and inflammation, and enhances the viability and function of cells, tissues, and organs under stress conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025186271000001_ABST
    Figure 2025186271000001_ABST
Patent Text Reader

Abstract

To provide methods and compositions relating to isolated mitochondria.SOLUTION: Cells, tissues, or organs can be treated with isolated mitochondria, such as porcine mitochondria, to improve mitochondrial function in the cell, tissue, or organ. The improvements to mitochondrial function include increased oxygen consumption and increased ATP synthesis. Such methods and compositions are useful for cell therapy; organ and tissue transplantation; organ and tissue engineering; and cold storage or shipment of harvested organs, tissues, and cells.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Patent Application No. 62 / 863,034, filed June 18, 2019.

[0002] The present disclosure relates to the use of mitochondria, such as isolated porcine mitochondria or isolated human mitochondria, to improve cell, tissue, and organ function, and to the therapeutic use of mitochondria. [Background technology]

[0003] Mitochondria are double-membrane-bound organelles in eukaryotic cells that play an important role in maintaining and preserving cellular homeostasis and function. For example, mitochondria provide cellular energy and play important roles in cell signaling, cell differentiation, cell apoptosis, cell cycle regulation, and cell proliferation. Normally, mitochondria provide more than 90% of the cellular ATP requirements.

[0004] Mitochondria consist of an outer mitochondrial membrane, an inner mitochondrial membrane, an intermembrane space between the outer and inner membranes, cristae spaces formed by folding of the inner membrane, a matrix space within the inner membrane, a mitochondrial-associated ER membrane (MAM), and an independent genome within the matrix, which shows substantial similarity to bacterial genomes. The outer mitochondrial membrane contains essential membrane proteins called porins (which allow low-molecular-weight molecules to diffuse freely across the membrane) as well as enzymes involved in various activities, such as fatty acid elongation, epinephrine oxidation, and tryptophan degradation. Disruption of the outer mitochondrial membrane results in leakage of mitochondrial proteins into the cytosol, which triggers apoptotic cell death. The inner mitochondrial membrane is a highly impermeable, protein-rich membrane containing ATP synthase, which performs the redox reactions of oxidative phosphorylation and generates ATP within the matrix.

[0005] Mitochondrial damage and loss of function are harmful to cells, tissues, or organs and are associated with both acquired and inherited human diseases, including cardiac dysfunction, heart failure, and autism. Mitochondrial dysfunction occurs through a variety of mechanisms, including genetic alterations in nuclear or mitochondrial genomic DNA, ischemia, environmental insults, pro-inflammatory cytokines, reactive oxygen species (ROS) generated by activated immune cells, and conditions associated with oxidative stress. See, for example, D. and R. Frye, Mol Psychiatry 2012, 17:389-401; Suematsu, N. et al., Circulation 2003, 107:1418-23; and Fernandez-Checa, J. et al., Am J Physiol. 1997, 273:G7-17 (each of which is incorporated herein by reference in its entirety). For example, it has been shown that ischemia reduces mitochondrial complex activity, oxygen consumption, oxidoreductase activity, fatty acid and glucose metabolism, and adenosine triphosphate (ATP) synthesis, and increases calcium accumulation.See, for example, Faulk, E. et al., Circulation 1995, 92:405-12; Black, K. et al., Physiol Genomics 2012, 44:1027-41; and Masuzawa, A. et al., Am J Physiol Heart Circ Physiol. 2013, 304:H966-82 (each of which is incorporated herein by reference in its entirety).Diseases caused by mitochondrial DNA mutations include Leber's hereditary optic neuropathy, MELAS syndrome, Kearns-Sayre syndrome, etc.

[0006] Because mitochondria play a key role in cellular metabolism, improving mitochondrial function can promote the viability and function of cells, tissues, and organs under stress conditions, such as cold exposure and ischemia. Transplantation of autologous mitochondria (i.e., mitochondria isolated from a patient's own body) has already been shown by McCully et al. (Mitochondrion 2017, 34:127-34, incorporated herein by reference in its entirety) to reduce myocardial injury caused by transient ischemia. However, there are currently no known approved treatments or therapies involving the treatment of cells, tissues, or organs with exogenous mitochondria, such as porcine mitochondria or exogenous human mitochondria (i.e., mitochondria isolated from a first human subject used to treat the cells, tissues, or organs of a second human subject). Summary of the Invention [Problem to be solved by the invention]

[0007] Thus, in the fields of cell therapy, transplantation, and organ / tissue engineering, there is a continuing need for exogenous mitochondria that can be obtained from readily available sources and that can improve the function and viability of cells, tissues, or organs. Such exogenous mitochondria would find utility in improving the efficacy and efficiency of organ transplantation and organ engineering, for example, improving lung function during ex vivo lung perfusion (EVLP). Such exogenous mitochondria would also find utility in minimizing cellular injury and inflammation associated with hypoxia and cold ischemia, for example, cellular injury and inflammation that occurs during cryopreservation or cryo-shipment of harvested organs, tissues, or cells. [Means for solving the problem]

[0008] (Summary of the Invention) The present disclosure relates to the use of mitochondria to improve cell, tissue, or organ function, and to therapeutic uses of mitochondria. Mitochondria can be isolated from any suitable source, including, but not limited to, cells or tissue obtained from a mammalian donor. Non-limiting examples of mammalian donors are humans, non-human primates, pigs, sheep, dogs, rabbits, mice, and rats. While the present disclosure often refers to the use of pig mitochondria, it should be understood that any suitable mitochondria can be used. That is, when the disclosure, other than the claims, refers to "pig mitochondria," it should be understood that the mitochondria can also be mitochondria from a human or other non-human source.

[0009] In some embodiments, the mitochondria are exogenous. In some embodiments, the exogenous mitochondria are xenogeneic with respect to the target cell, tissue, or organ. In some embodiments, the exogenous mitochondria are allogeneic with respect to the target cell, tissue, or organ. In some embodiments, the mitochondria are endogenous. In some embodiments, the mitochondria are autologous. In preferred embodiments, porcine mitochondria are used to treat human cells, tissues, or organs. In some embodiments, porcine mitochondria are isolated from a genetically engineered porcine subject for use in human organ transplantation. In other preferred embodiments, mitochondria isolated from a first human subject are used to treat human cells, tissues, or organs from a second human subject. In some embodiments, human mitochondria are isolated from a donor of cells, tissues, or organs intended for transplantation. In some embodiments, human mitochondria are isolated from a recipient of a cell, tissue, or organ transplant. In some embodiments, human mitochondria are isolated from the intended recipient of a cell, tissue, or organ transplant. In some embodiments, human mitochondria are allogeneic with respect to the intended recipient of a cell, tissue, or organ transplant. In some embodiments, the human mitochondria are autologous to the intended recipient of a cell, tissue, or organ transplant. In some embodiments, the cells, tissue, or organ intended for transplantation are treated with mitochondria that are allogeneic to the cells, tissue, or organ intended for transplantation. In some embodiments, the cells, tissue, or organ intended for transplantation are treated with mitochondria that are autologous to the cells, tissue, or organ intended for transplantation.

[0010] The present disclosure provides a method of organ transplantation, comprising delivering isolated mitochondria to an organ intended for transplantation. In another embodiment, the present disclosure provides a method of improving the performance of an implanted tissue or transplanted organ in a subject, comprising delivering isolated mitochondria to the tissue or organ before, during, or after implantation or transplantation of the tissue or organ, wherein the tissue or organ is a donor tissue, donor organ, engineered tissue, or engineered organ. In another embodiment, the present disclosure provides a method of improving lung function during ex vivo lung perfusion (EVLP), comprising: (i) delivering isolated mitochondria to the lung; and (ii) performing EVLP on the lung in a chamber or container by perfusing the lung with perfusion solution from a reservoir. In another embodiment, the disclosure provides a method for minimizing injury to an organ ex vivo from cold ischemia during transport, shipping, or storage, comprising delivering isolated mitochondria to the organ 0-24 hours before, during, or 0-24 hours after cold ischemia, wherein cells of the organ treated with isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding cells of the organ not treated with isolated mitochondria, and the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

[0011] In another embodiment, the disclosure provides a method for improving the function of an engineered organ or tissue, comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; (ii) growing the organ or tissue scaffold in a bioreactor, chamber, or container with proliferating cells to produce the engineered organ or tissue; and (iii) delivering isolated mitochondria to the engineered organ or tissue. In another embodiment, the disclosure provides a method for improving the function of an engineered organ or tissue, comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; and (ii) growing the organ or tissue scaffold in a bioreactor, chamber, or container with proliferating cells that have been treated with isolated mitochondria to produce the engineered organ or tissue. In another embodiment, the present disclosure provides a method for improving the function of an engineered organ or tissue, the method comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; (ii) injecting isolated mitochondria into the organ or tissue scaffold; and (iii) growing the organ or tissue scaffold in a bioreactor, chamber, or container with growing cells to produce the engineered organ or tissue.

[0012] In another embodiment, the disclosure provides a method for improving the function of an engineered lung, the method comprising: (i) repopulating a decellularized scaffold lung in a bioreactor, chamber, or container with repopulating cells to produce an engineered lung, and (ii) delivering isolated mitochondria to the engineered lung. In another embodiment, the disclosure provides a method for improving the function of an engineered lung, the method comprising: (i) delivering isolated mitochondria to the repopulating cells, and (ii) repopulating a decellularized scaffold lung in a bioreactor, chamber, or container with repopulating cells that have been treated with isolated mitochondria to produce an engineered lung.

[0013] In another embodiment, the present disclosure provides a method for improving the function of an engineered kidney, the method comprising: (i) repopulating a decellularized scaffold kidney in a bioreactor, chamber, or container with repopulating cells to produce an engineered kidney, and (ii) delivering isolated mitochondria to the engineered kidney. In another embodiment, the present disclosure provides a method for improving the function of an engineered kidney, the method comprising: (i) delivering isolated mitochondria to the repopulating cells, and (ii) repopulating a decellularized scaffold kidney in a bioreactor, chamber, or container with repopulating cells treated with isolated mitochondria to produce an engineered kidney.

[0014] In another embodiment, the present disclosure provides a method for treating a pulmonary disease or disorder in a subject in need thereof, or for improving the function of a donor's lung before or after transplantation, the method comprising administering to the lungs of the subject or donor a pharmaceutical composition comprising mesenchymal stem cells or endothelial progenitor cells pretreated with isolated mitochondria, or extracellular vesicles isolated from said mesenchymal stem cells or endothelial progenitor cells. In another embodiment, the present disclosure provides a method for treating a pulmonary disease or disorder in a subject in need thereof, or for improving the function of a donor's lung before or after transplantation, the method comprising administering to the lungs of the subject or donor (A) mesenchymal stem cells or endothelial progenitor cells, or extracellular vesicles isolated from mesenchymal stem cells or endothelial progenitor cells, and (B) isolated mitochondria, wherein (A) and (B) are contained in a single pharmaceutical composition or two separate pharmaceutical compositions. In another embodiment, the present disclosure provides a method for treating a pulmonary disease or disorder in a subject in need thereof, the method comprising: (i) administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria, and (ii) administering a therapeutically effective amount of an agent for treating the pulmonary disease or disorder, wherein the composition is administered to the subject before, simultaneously with, or after administration of the agent for treating the pulmonary disease or disorder. In another embodiment, the present disclosure provides a method for treating pulmonary hypertension in a subject in need thereof, the method comprising: (i) administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria, and (ii) administering a therapeutically effective amount of treprostinil, wherein the composition is administered to the subject before, simultaneously with, or after administration of treprostinil.

[0015] In another embodiment, the present disclosure provides a method for treating a disease or disorder in a subject in need thereof or for improving donor lung function before or after transplantation, the method comprising: (i) administering to the subject's or donor's lungs a therapeutically effective amount of a composition comprising isolated mitochondria, and (ii) administering to the subject's or donor's lungs a therapeutically effective amount of UNEX-42, wherein the composition is administered to the subject's or donor's lungs before, simultaneously with, or after administration of UNEX-42. In another embodiment, the present disclosure provides a method for treating a pulmonary disease or disorder in a subject in need thereof or for improving donor lung function before or after transplantation, the method comprising: (i) administering to the subject's or donor's lungs a therapeutically effective amount of a composition comprising isolated mitochondria, and (ii) administering to the subject's or donor's lungs a therapeutically effective amount of an antioxidant, wherein the composition is administered to the subject's or donor's lungs before, simultaneously with, or after administration of the antioxidant. In another embodiment, the present disclosure provides a method for treating an acute exacerbation of a pulmonary disease or disorder in a subject, comprising administering to the subject an effective amount of a composition comprising isolated mitochondria for rescue therapy. In another embodiment, the present disclosure provides a method for treating acute kidney injury in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria. In another embodiment, the present disclosure provides a method for treating a subject undergoing cardiac arrest or resuscitation, comprising administering to the subject an effective amount of a composition comprising isolated mitochondria to facilitate the subject's transport to a medical facility or medical care.

[0016] In another embodiment, the present disclosure provides a method for preserving tissue or organs for transport and transplantation, comprising delivering isolated mitochondria to the tissue or organ intended for transport and transplantation, wherein the tissue or organ is obtained from a deceased donor. In another embodiment, the present disclosure provides a method for preserving a limb or other body part lost by traumatic amputation, comprising delivering isolated mitochondria to the limb or other body part after traumatic amputation of the limb or other body part.

[0017] In another embodiment, the present disclosure provides a method of reducing inflammation in a subject in need thereof, comprising: (i) delivering isolated mitochondria to isolated hematopoietic cells from the subject; and (ii) administering the isolated mitochondria-treated hematopoietic cells to the subject.

[0018] In another embodiment, the present disclosure provides a method for improving cellular function of an isolated cell, comprising delivering isolated mitochondria to the isolated cell.

[0019] In another embodiment, the present disclosure provides a method for improving cell therapy in a subject in need thereof, the method comprising: (i) delivering isolated mitochondria to isolated cells in vitro; and (ii) administering the isolated mitochondria-treated cells to the subject.

[0020] In another embodiment, the present disclosure provides a method for improving the cryogenic transport, cryogenic shipping, or cryopreservation of isolated cells, comprising delivering isolated mitochondria to the isolated cells before, during, or after the cryogenic transport, cryogenic shipping, or cryopreservation, wherein the cells treated with the isolated mitochondria have at least a 5% improvement in viability compared to corresponding cells not treated with the isolated mitochondria. In another embodiment, the present disclosure provides a method for cryopreservation of isolated mitochondria, comprising freezing the isolated mitochondria in a freezing buffer containing a cryoprotectant. In another embodiment, the present disclosure provides a method for long-term storage of isolated mitochondria, comprising: (i) isolating mitochondria from cells or tissues; (ii) suspending the isolated mitochondria in a cryopreservation buffer; (iii) freezing the isolated mitochondria at a temperature of about -70°C to about -100°C; and (iv) maintaining the frozen isolated mitochondria at a temperature of about -70°C to about -100°C for 24 hours or more. The storage period can be at least 24 hours, at least 1 week, at least 4 weeks, at least 3 months, at least 6 months, at least 9 months, or at least 1 year.

[0021] In another embodiment, the present disclosure provides a method for detecting pig mitochondria in a human cell, tissue, or organ sample, comprising detecting the presence of a nucleic acid marker in a human cell, tissue, or organ sample in vitro or ex vivo, wherein the nucleic acid marker comprises a sequence of mitochondrial DNA or RNA, and the nucleic acid marker is present in pig mitochondria and absent in human mitochondria.

[0022] In another embodiment, the present disclosure provides a composition comprising human cells, wherein the cytosol of the human cells comprises exogenous mitochondria, and wherein the human cells of the composition have at least 5% improved mitochondrial function compared to corresponding human cells lacking exogenous mitochondria, and wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

[0023] Further objects and advantages of the present invention will become apparent from the following description. [Brief explanation of the drawings]

[0024] [Figure 1] We show that treatment of human pulmonary artery endothelial cells (HPAECs) with mitochondria isolated from pig hearts (i.e., porcine mitochondria) increases the oxygen consumption rate (OCR) after brief cold exposure. HPAECs were placed at 4°C for 6 h. They were then allowed to recover in normoxia at 37°C for 1 h in the presence of 20 μL of mitochondrial suspension (29 particles / cell in respiration buffer; "+MITO") or 20 μL of respiration buffer alone ("-MITO") and equilibrated for 10 min in a non-CO2 incubator. Next, a "mitochondrial stress test" was performed using a Seahorse apparatus with 10 μM oligomycin, 20 μM FCCP, and 5 μM rotenone / antimycin A (Rot / AA). Treatment with porcine mitochondria increased OCR in baseline (43.6% increase), oligomycin-treated HPAECs (204.9% increase), FCCP-treated HPAECs (8.4% increase), and Rot / AA-treated HPAECs (34.1% increase) compared with corresponding baseline, oligomycin-treated, FCCP-treated, or Rot / AA-treated "-MITO" HPAEC controls. Statistical analysis was performed by two-tailed t-test (*p<0.05; **p<0.01).

[0025] [Figure 2]We demonstrate that treatment of human pulmonary artery endothelial cells (HPAECs) with porcine mitochondria increases OCR after prolonged cold exposure. HPAECs were placed at 4°C for 12 hours. They were allowed to recover in normoxia at 37°C for 1 hour in the presence of 20 μL of mitochondrial suspension (172 particles / cell in respiration buffer; "+MITO") or 20 μL of respiration buffer alone ("-MITO") and then equilibrated for 50 minutes in a non-CO2 incubator. HPAECs were retested under non-CO2 conditions at 37°C using a Seahorse apparatus. Next, a "mitochondrial stress test" was performed using 10 μM oligomycin, 20 μM FCCP, and 5 μM rotenone / antimycin A (Rot / AA) in the Seahorse apparatus. Treatment with porcine mitochondria increased OCR in baseline (32.4% increase), oligomycin-treated HPAECs (51.9% increase), FCCP-treated HPAECs (9.5% increase), and Rot / AA-treated HPAECs (45.2% increase) compared with corresponding baseline, oligomycin-treated, FCCP-treated, or Rot / AA-treated "-MITO" HPAEC controls. Statistical analysis performed was a two-tailed t-test (**p<0.01).

[0026] [Figure 3]HPAECs exposed to cold stress were shown to incorporate porcine mitochondria. Porcine mitochondria were administered to HPAECs undergoing cold stress. In the cold-recovery group, HPAECs under cold stress incorporated porcine mitochondria in a dose-dependent manner, with maximum expression of porcine MtND5 reaching 1,666 particles / cell. In cold-recovery conditions, maximum expression of porcine MtND5 was achieved at 24 hours, with a 26,201% increase in porcine MtND5 observed compared to untreated cold-recovery controls. In cold-exposed conditions, maximum expression of porcine MtND5 was achieved at 72 hours, with a 301,932% increase in MtND5 observed compared to untreated cold-exposed controls. The statistical analysis performed was one-way ANOVA (*P<0.05, compared with normoxia at 24 h; #P<0.05, compared with normoxia at 48 h; +P<0.05, compared with normoxia at 72 h; $P<0.05, compared with cold control at 24 h; ^P<0.05, compared with cold control at 48 h; &P<0.05, compared with cold control at 72 h).

[0027] [Figure 4] These results demonstrate that human mitochondrial DNA transcription in HPAECs exposed to cold stress is largely unaffected by treatment with porcine mitochondria. Untreated control HPAECs under cold-recovery conditions showed a 55% increase in human MtND5 expression compared to normothermic controls. This increase was mitigated by treatment with porcine mitochondria, with 1 particle / cell showing a 3.8% decrease in expression compared to untreated normothermic HPAECs and a 33% decrease in expression compared to untreated cold-recovery controls. In the cold-exposed group, maximum expression of human MtND5 was achieved at 72 hours, but this increase was not significantly affected by treatment with porcine mitochondria. The statistical analysis performed was one-way ANOVA (*P<0.05, compared with normoxia at 24 h; #P<0.05, compared with normoxia at 48 h; +P<0.05, compared with normoxia at 72 h; $P<0.05, compared with cold control at 24 h; ^P<0.05, compared with cold control at 48 h; &P<0.05, compared with cold control at 72 h).

[0028] [Figure 5] We show that treatment of HPAECs with porcine mitochondria reduces NF-κB expression at 24 hours during cold recovery. Under cold recovery conditions, untreated control HPAECs showed an 83% increase in NF-κB gene expression at 24 hours compared to normothermic controls. Treatment with porcine mitochondria tended to reduce NF-κB expression, with 1 particle / cell showing a 22% decrease compared to untreated cold-recovered control HPAECs. Under cold exposure conditions, HPAECs treated with porcine mitochondria showed a slight increase in NF-κB expression at 24 hours, but this increase was not statistically significant. The statistical analysis performed was one-way ANOVA (*P<0.05, compared with normoxia at 24 h; #P<0.05, compared with normoxia at 48 h; +P<0.05, compared with normoxia at 72 h; $P<0.05, compared with cold control at 24 h; ^P<0.05, compared with cold control at 48 h; &P<0.05, compared with cold control at 72 h).

[0029] [Figure 6]We demonstrate that treatment of HPAECs with porcine mitochondria reduces Toll-like receptor-9 (TLR-9) expression after 24 hours of cold recovery. HPAECs were treated and cultured under cold recovery or cold exposure conditions and harvested at 24, 48, or 72 hours. Under cold recovery conditions, untreated control HPAECs showed a 101% increase in TLR-9 expression at 24 hours compared to normothermic controls. Treatment with porcine mitochondria tended to reduce TLR-9 expression compared to untreated cold-recovery control HPAECs, with 166 particles / cell showing a 37% decrease compared to untreated cold-recovery control HPAECs. Under cold exposure conditions, maximum TLR-9 expression occurred in HPAECs treated with 1 particle / cell, with a 60% increase in TLR-9 expression observed compared to untreated cold-exposed control HPAECs. The statistical analysis performed was one-way ANOVA (*P<0.05, compared with normoxia at 24 h; #P<0.05, compared with normoxia at 48 h; +P<0.05, compared with normoxia at 72 h; $P<0.05, compared with cold control at 24 h; ^P<0.05, compared with cold control at 48 h; &P<0.05, compared with cold control at 72 h).

[0030] [Figure 7] We demonstrate that treatment of HPAECs with porcine mitochondria affects heme oxygenase-1 (HO-1) expression during 24 hours of cold exposure. Treatment with porcine mitochondria increased HO-1 expression during cold exposure. Treatment with porcine mitochondria had the greatest effect at 16 particles / cell, resulting in a 24% increase in HO-1 expression compared to untreated cold-exposed control HPAECs (a 242% increase compared to untreated normoxia control HPAECs). Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to cold control at 24 hours; ^P<0.05, compared to cold control at 48 hours; &P<0.05, compared to cold control at 72 hours).

[0031] [Figure 8]We demonstrate that treatment of HPAECs with porcine mitochondria reduces macrophage colony-stimulating factor (M-CSF) secretion under hypoxic conditions. Treatment with porcine mitochondria had the greatest effect at 3 particles / cell, resulting in a 65% reduction in M-CSF secretion at 48 hours compared to untreated, hypoxic control HPAECs. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0032] [Figure 9] We demonstrate that treatment of HPAECs with porcine mitochondria reduces macrophage inflammatory protein-1β (MIP-1β) secretion under hypoxic conditions. Treatment with porcine mitochondria was most effective at reducing MIP-1β secretion at 3 particles / cell, resulting in a 73% reduction in MIP-1β secretion at 48 hours compared to untreated, hypoxic control HPAECs. Decreased efficacy was observed at 3.68+ particles / cell. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0033] [Figure 10]We demonstrate that treatment of HPAECs with porcine mitochondria reduces platelet-derived growth factor-BB (PDGF-BB) secretion under hypoxic conditions. Treatment with porcine mitochondria was maximally effective at reducing PDGF-BB secretion at 36 particles / cell, resulting in a 69% reduction in PDGF-BB secretion at 48 hours compared to untreated, hypoxic control HPAECs. A decrease in efficacy was observed at 3,687 particles / cell. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0034] [Figure 11] These results demonstrate that treatment of HPAECs with porcine mitochondria reduces RANTES (CCL5) secretion under hypoxic conditions. Treatment with porcine mitochondria was maximally effective at reducing RANTES secretion at 0.3 particles / cell, resulting in a 59% reduction in RANTES secretion at 48 hours compared to untreated, hypoxic control HPAECs. A decrease in efficacy was observed at 3,687 particles / cell. Statistical analysis was performed by one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0035] [Figure 12]These results demonstrate that treatment of HPAECs with porcine mitochondria reduces intercellular adhesion molecule-1 (ICAM-1) secretion under hypoxic conditions. Treatment with porcine mitochondria was maximally effective at reducing ICAM-1 secretion at 0.3 particles / cell, resulting in an 82% reduction in ICAM-1 secretion at 48 hours compared to untreated, hypoxic control HPAECs. A decrease in efficacy was observed at 3,687 particles / cell. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0036] [Figure 13] We demonstrate that treatment of HPAECs with porcine mitochondria reduces brain-derived neurotrophic factor (BDNF) secretion under hypoxic conditions. Treatment with porcine mitochondria was most effective at reducing BDNF secretion at 3 particles / cell, resulting in an 85% reduction in BDNF secretion at 48 hours compared to untreated, hypoxic control HPAECs. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0037] [Figure 14]We demonstrate that treatment of HPAECs with porcine mitochondria reduces interleukin-1β (IL-1β) secretion under hypoxic conditions. Treatment with porcine mitochondria was most effective at reducing IL-1β secretion at 368 particles / cell, resulting in a 70% reduction in IL-1β secretion at 48 hours compared to untreated, hypoxic control HPAECs. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0038] [Figure 15] We demonstrate that treatment of HPAECs with porcine mitochondria reduces growth / differentiation factor 15 (GDF15) secretion under hypoxic conditions. Treatment with porcine mitochondria was most effective at reducing GDF15 secretion at 3 particles / cell, resulting in a 70% reduction in GDF15 secretion at 48 hours compared to untreated, hypoxic control HPAECs. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0039] [Figure 16]We demonstrate that treatment of HPAECs with porcine mitochondria reduces interleukin-6 (IL-6) secretion under hypoxic conditions. Treatment with porcine mitochondria was most effective at reducing IL-6 secretion at 368 particles / cell, resulting in a 70% reduction in IL-6 secretion at 48 hours compared to untreated, hypoxic control HPAECs. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0040] [Figure 17] We demonstrate that treatment of HPAECs with porcine mitochondria reduces transforming growth factor-β1 (TGF-β1) secretion under hypoxic conditions. Treatment with porcine mitochondria was most effective at reducing TGF-β1 secretion at 36 particles / cell, resulting in a 95% reduction in TGF-β1 secretion at 48 hours compared to untreated, hypoxic control HPAECs. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxic control at 24 hours; ^P<0.05, compared to hypoxic control at 48 hours; &P<0.05, compared to hypoxic control at 72 hours).

[0041] [Figure 18]We demonstrate that HPAECs exposed to hypoxic stress incorporate porcine mitochondria. For the hypoxia-recovery group, HPAECs were cultured in normoxia for 24 hours, followed by 24 hours of hypoxia (1% O2), and then treated with porcine mitochondria. After treatment with porcine mitochondria, the hypoxia-recovery cells were returned to normoxia. Hypoxia-recovery HPAECs were harvested after 24, 28, or 72 hours of culture in normoxia. For the hypoxia-exposed group, HPAECs were cultured in normoxia for 48 hours, treated with porcine mitochondria, and immediately placed in hypoxia (1% O2). Hypoxia-exposed HPAECs were harvested after 24, 28, or 72 hours of hypoxic exposure. As determined using a probe specific for porcine MtND5, HPAECs under hypoxic stress incorporate porcine mitochondria in a dose-dependent manner, with maximum expression of porcine MtND5 reaching 1,666 particles / cell. Under hypoxia-recovery conditions, maximum expression of porcine MtND5 was achieved at 48 hours, with a 4,655% increase in porcine mtND5 observed compared to untreated hypoxia-recovery controls. Under hypoxia-exposed conditions, maximum expression was achieved at 24 hours, with a 26,680% increase in porcine mtND5 observed compared to untreated hypoxia-exposed controls. Statistical analysis was performed using one-way ANOVA (*P<0.05, compared to normoxia at 24 hours; #P<0.05, compared to normoxia at 48 hours; +P<0.05, compared to normoxia at 72 hours; $P<0.05, compared to hypoxia control at 24 hours; ^P<0.05, compared to hypoxia control at 48 hours; &P<0.05, compared to hypoxia control at 72 hours).

[0042] [Figure 19]This study demonstrates that human mitochondrial DNA transcription in HPAECs exposed to hypoxic stress is largely unaffected by treatment with porcine mitochondria. As determined using a probe specific for human MtND5, maximum expression of human MtND5 occurs at 72 hours in both the hypoxia-recovery and hypoxia-exposed groups. The time point at which treatment with porcine mitochondria appears to be affected is 24 hours. In the hypoxia-recovery group, human MtND5 expression tended to decrease in HPAECs treated with porcine mitochondria, with 1 particle / cell showing a 33% decrease in expression at 24 hours compared to untreated hypoxia-exposed controls. In the hypoxia-exposed group, human MtND5 expression tended to increase in HPAECs treated with porcine mitochondria, with 1,666 particles / cell resulting in a 36% increase at 24 hours compared to untreated hypoxia-exposed cells. The statistical analysis performed was one-way ANOVA (*P<0.05, compared with normoxia at 24 h; #P<0.05, compared with normoxia at 48 h; +P<0.05, compared with normoxia at 72 h; $P<0.05, compared with hypoxia control at 24 h; ^P<0.05, compared with hypoxia control at 48 h; &P<0.05, compared with hypoxia control at 72 h).

[0043] [Figure 20]These results demonstrate that treatment of HPAECs with porcine mitochondria reduces TLR-9 expression during hypoxia recovery but increases it during hypoxia exposure at 24 hours. In both the hypoxia recovery and hypoxia exposure groups, maximum TLR-9 expression occurs at 24 hours. In the hypoxia recovery group, TLR-9 expression tended to decrease in HPAECs treated with porcine mitochondria, with 1 particle / cell showing a 38% decrease in expression at 24 hours compared to untreated hypoxia controls. In the hypoxia exposure group, TLR9 expression tended to increase in HPAECs treated with porcine mitochondria, with 1,666 particles / cell resulting in a 32% increase at 24 hours compared to untreated hypoxia-exposed cells. The statistical analysis performed was one-way ANOVA (*P<0.05, compared with normoxia at 24 h; #P<0.05, compared with normoxia at 48 h; +P<0.05, compared with normoxia at 72 h; $P<0.05, compared with hypoxia control at 24 h; ^P<0.05, compared with hypoxia control at 48 h; &P<0.05, compared with hypoxia control at 72 h).

[0044] [Figure 21-1]We show that treatment of hypoxic HPAECs with porcine mitochondria reduces the mRNA expression of interleukin-8 (IL-8; CXCL8), IL-6, BH3-interacting domain death agonist (BID), human MtND1, and human mitochondrial cytochrome B (Mt-CyB). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing IL-8 expression at 3,687 particles / cell, resulting in a 58% reduction in IL-8 expression compared to untreated hypoxic controls (Figure 21A). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing IL-6 expression at 3 particles / cell, resulting in a 30% reduction in IL-6 expression compared to untreated hypoxic controls (Figure 21B). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing BID expression at 36 particles / cell, resulting in a 30% reduction in BID expression compared to untreated hypoxic controls (Figure 21C). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing human MtND1 expression at 3 particles / cell, resulting in a 57% reduction in MtND1 expression compared to untreated hypoxic controls (Figure 21D). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing human Mt-CyB expression at 0.3 particles / cell, resulting in a 57% reduction in Mt-CyB expression compared to untreated hypoxic controls (Figure 21E). Statistical analysis was performed by one-way ANOVA (*P<0.05 compared to normoxia at 24 h; $P<0.05 compared to hypoxic controls at 24 h).

[0045] [Figure 21-2]We show that treatment of hypoxic HPAECs with porcine mitochondria reduces the mRNA expression of interleukin-8 (IL-8; CXCL8), IL-6, BH3-interacting domain death agonist (BID), human MtND1, and human mitochondrial cytochrome B (Mt-CyB). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing IL-8 expression at 3,687 particles / cell, resulting in a 58% reduction in IL-8 expression compared to untreated hypoxic controls (Figure 21A). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing IL-6 expression at 3 particles / cell, resulting in a 30% reduction in IL-6 expression compared to untreated hypoxic controls (Figure 21B). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing BID expression at 36 particles / cell, resulting in a 30% reduction in BID expression compared to untreated hypoxic controls (Figure 21C). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing human MtND1 expression at 3 particles / cell, resulting in a 57% reduction in MtND1 expression compared to untreated hypoxic controls (Figure 21D). Treatment of hypoxic HPAECs with porcine mitochondria was maximally effective at reducing human Mt-CyB expression at 0.3 particles / cell, resulting in a 57% reduction in Mt-CyB expression compared to untreated hypoxic controls (Figure 21E). Statistical analysis was performed by one-way ANOVA (*P<0.05 compared to normoxia at 24 h; $P<0.05 compared to hypoxic controls at 24 h).

[0046] [Figure 22]Treatment of human endothelial cells with porcine mitochondria reduces hypoxia-induced cell proliferation, as indicated by a decrease in the total cellular protein content of mitochondria-treated HPAECs. HPAECs were treated with 0, 5, 6, or 7 porcine mitochondria per cell and exposed to hypoxia for 24 hours. After 24 hours of exposure to hypoxia, the total cellular protein content of each sample was measured by bicinchoninic acid (BCA) assay of HPAEC lysates. Statistical analysis was performed by one-way ANOVA (*P<0.05 compared to control HPAECs not treated with porcine mitochondria).

[0047] [Figure 23] We show that treatment of human alveolar epithelial type II (AT2) cells with porcine mitochondria improved the nucleic acid content of AT2 cells. AT2 cells were seeded directly from cryopreservation with or without porcine mitochondria and incubated overnight in a standard incubator. After overnight incubation, the nucleic acid content of AT2 cells treated with porcine mitochondria increased by 23% compared to untreated AT2 cell controls.

[0048] [Figure 24] Mitochondrial activity of isolated porcine mitochondria at various concentrations in a respiration buffer containing adenosine diphosphate (ADP) is shown.

[0049] [Figure 25] We show that porcine mitochondria retain mitochondrial activity after cryopreservation at -80°C. Mitochondrial activity decreased over time at 4°C, but storage at -80°C resulted in the retention of approximately 40% of OCR (mitochondrial activity). Storage in trehalose improved OCR, retaining approximately 60% of the original OCR rate.

[0050] [Figure 26]Figure 26 shows that porcine mitochondria treatment improves the function of isolated cadaveric pig lungs during ex vivo lung perfusion (EVLP). Compared to right lung controls, isolated porcine mitochondria injected into the left lung increased proliferating cell nuclear antigen (PCNA)-positive cells in the lower lung (Figure 26A), upper lung (Figure 26B), and middle lung (Figure 26C), as measured by histological examination. Porcine mitochondria treatment had the greatest effect in the lower lung at 24 hours (Figure 26A), with a 50% improvement observed in porcine mitochondria-treated cells compared to controls (arrow).

[0051] [Figure 27] We demonstrate that porcine mitochondrial treatment improves tidal volume (Figure 27A) and dynamic compression (Figure 27B) parameters in isolated porcine cadaveric lungs undergoing EVLP. Isolated porcine mitochondria were infused into isolated porcine cadaveric lungs undergoing EVLP, and perfusion was turned off for 10 minutes while the lungs continued to inflate. Tidal volume (ml) and dynamic compression (TV / (PIP-PEEP)) were measured 10 minutes, 1 hour, and 4 hours after infusion (TV = tidal volume; PIP = peak inspiratory pressure; PEEP = positive end-expiratory pressure). Baseline tidal volume and dynamic compression represent the tidal volume and dynamic compression before infusion, respectively. Compared to baseline, a 30% improvement in tidal volume and a 40% increase in dynamic compression are observed 10 minutes after infusion.

[0052] [Figure 28]Figure 28 shows that after infusion of isolated porcine mitochondria into isolated cadaveric pig lungs during EVLP, there was an immediate and progressive decrease in media glucose, and circulating ammonium also decreased by 17% 1 hour after infusion. Isolated cadaveric pig lungs during EVLP were infused with isolated porcine mitochondria 24 minutes after the start of EVLP and maintained in EVLP for approximately 20 hours. Glucose (g / L) in the circulating media was quantified using BioPat (Figure 28A) and Nova (Figure 28B), and circulating ammonium (NH4+; mmol / L) was quantified using Nova (Figure 28C). Initial Nova glucose and ammonium levels represent Nova glucose and ammonium levels at time 0 after EVLP. Baseline Nova glucose and ammonium levels represent Nova glucose and ammonium levels immediately prior to infusion of porcine mitochondria.

[0053] [Figure 29] Figure 29A shows that injection of isolated porcine mitochondria into cadaveric pig lungs undergoing EVLP ("+Mito") increases tidal volume (mL / kg; Figure 29A) and gas exchange (ΔPO2 / FiO2; Figure 29B) compared to cadaveric pig lungs undergoing EVLP injected with respiratory buffer ("Control").

[0054] [Figure 30] Figure 30A shows that injection of isolated porcine mitochondria into cadaveric pig lungs undergoing EVLP ("+MITO") reduces the amount of circulating lactate (mg / ml; Figure 30A) and increases the glucose / lactate ratio (Figure 30B) compared to cadaveric pig lungs undergoing EVLP injected with respiratory buffer ("Control").

[0055] [Figure 31]Figure 31 shows that injection of isolated porcine mitochondria ("+MITO") into the lungs of cadaveric pigs undergoing EVLP reduces the percentage of apoptotic cells (%TUNEL; Figure 31A) and increases the expression of the cell adhesion molecule CD31 (Figure 31B) compared to lungs of cadaveric pigs undergoing EVLP injected with respiratory buffer ("Control"). The percentage of apoptotic cells was determined by TUNEL assay of tissue biopsies taken from the lungs of cadaveric pigs during EVLP. CD31 expression was determined by immunofluorescence staining of the tissue biopsies using an anti-CD31 antibody.

[0056] [Figure 32]We demonstrate that the health and function of isolated mitochondria can be rapidly assessed by measuring changes in mitochondrial size and complexity, mitochondrial permeability transition pore (mPTP) opening, or mitochondrial respiration. The size and complexity of healthy and injured mitochondria were measured using flow cytometry. Compared to healthy mitochondria, injured mitochondria were larger and less complex, indicating a mitochondrial swelling phenotype (Figure 32A). mPTP opening was assessed using flow cytometry by measuring green fluorescent (FITC) emission of mitochondria stained with calcein acetoxymethyl (AM). Mitochondria were considered to have regulated mPTP if they retained calcein AM and resulted in FITC staining. Mitochondria were considered to have dysregulated, continuous mPTP opening if they were unable to retain calcein AM and FITC staining was reduced. Compared to healthy mitochondria, injured mitochondria exhibited significantly reduced FITC emission due to their inability to retain calcein AM (Figure 32B). To assess mitochondrial respiration, the respiratory control ratio (RCR) was determined using a Seahorse apparatus. RCR was calculated from the oxygen consumption rate (OCR) during ADP-stimulated respiration (RCR) and uncoupled respiration (RCRmax). The OCR ratio was calculated by dividing the OCR in each of these two states by the basal OCR. Maximal respiration was achieved by injecting the mitochondrial protonophore uncoupler BAM15. Compared to healthy mitochondria, injured mitochondria dramatically reduced both ADP-stimulated and uncoupled respiration rates (Figure 32C).

[0057] [Figure 33]We demonstrate that the health and function of isolated mitochondria can be rapidly assessed by measuring mitochondrial membrane potential or mitochondrial membrane permeability. Changes in mitochondrial membrane potential were assessed by flow cytometry using the JC-1 assay. Mitochondrial depolarization is indicated by a decrease in the red:green fluorescence intensity ratio or a decrease in the signal intensity of the phycoerythrin (PE) channel. Compared to healthy mitochondria, injured mitochondria exhibited a decreased red:green ratio and significantly reduced PE emission (Figure 33A). Mitochondrial permeability was measured by flow cytometry using SYTOX Green nucleic acid stain, which readily penetrates membrane-damaged mitochondria. Damaged mitochondria stained with SYTOX Green exhibited higher FITC signal intensity than undamaged mitochondria stained with SYTOX Green. Compared to healthy mitochondria, injured mitochondria exhibited increased FITC emission (Figure 33B).

[0058] [Figure 34-1]These results demonstrate that mitochondria retain mitochondrial function after cryopreservation at -80°C, as measured by mitochondrial size, complexity, mPTP opening, and respiration. Mitochondrial swelling was assessed using flow cytometry by measuring the size and complexity of mitochondria stored under non-preserved conditions (i.e., 4°C) or preserved conditions (i.e., -80°C). Mitochondria stored at 4°C almost immediately exhibited a swollen phenotype (i.e., increased size and decreased complexity), whereas mitochondria stored at -80°C maintained a normal phenotype comparable to freshly isolated mitochondria throughout the storage period (up to 7 months) (Figure 34A). Mitochondrial mPTP opening was assessed using flow cytometry by measuring the FITC emission of calcein AM-stained mitochondria stored under non-preserved or preserved conditions. Mitochondria were considered to have maintained mPTP if they retained calcein AM and exhibited FITC staining. Mitochondria were considered to have failed to maintain mPTP opening if they were unable to retain calcein AM and exhibited decreased FITC staining. Mitochondria stored at 4°C lost the ability to regulate mPTP opening, whereas mitochondria stored at -80°C maintained mPTP opening comparable to that of freshly isolated mitochondria throughout storage (up to 7 months) (Figure 34B). To assess mitochondrial respiration in mitochondria stored under non-storage or storage conditions, RCR was determined using a Seahorse apparatus. RCR was calculated from the ADP-stimulated RCR and the OCR during uncoupled respiration (RCRmax). The OCR in each of these two states was divided by the basal OCR to determine the OCR ratio. Maximal respiration was achieved by injecting the mitochondrial protonophore uncoupler BAM15. While the ADP-stimulated and uncoupled respiration rates of mitochondria stored at 4°C decreased over time, mitochondria stored at -80°C maintained ADP-stimulated (Figure 34C) and uncoupled (Figure 34D) respiration rates comparable to those of freshly isolated mitochondria throughout storage (up to 6 weeks).

[0059] [Figure 34-2]These results demonstrate that mitochondria retain mitochondrial function after cryopreservation at -80°C, as measured by mitochondrial size, complexity, mPTP opening, and respiration. Mitochondrial swelling was assessed using flow cytometry by measuring the size and complexity of mitochondria stored under non-preserved conditions (i.e., 4°C) or preserved conditions (i.e., -80°C). Mitochondria stored at 4°C almost immediately exhibited a swollen phenotype (i.e., increased size and decreased complexity), whereas mitochondria stored at -80°C maintained a normal phenotype comparable to freshly isolated mitochondria throughout the storage period (up to 7 months) (Figure 34A). Mitochondrial mPTP opening was assessed using flow cytometry by measuring the FITC emission of calcein AM-stained mitochondria stored under non-preserved or preserved conditions. Mitochondria were considered to have maintained mPTP if they retained calcein AM and exhibited FITC staining. Mitochondria were considered to have failed to maintain mPTP opening if they were unable to retain calcein AM and exhibited decreased FITC staining. Mitochondria stored at 4°C lost the ability to regulate mPTP opening, whereas mitochondria stored at -80°C maintained mPTP opening comparable to that of freshly isolated mitochondria throughout storage (up to 7 months) (Figure 34B). To assess mitochondrial respiration in mitochondria stored under non-storage or storage conditions, RCR was determined using a Seahorse apparatus. RCR was calculated from the ADP-stimulated RCR and the OCR during uncoupled respiration (RCRmax). The OCR in each of these two states was divided by the basal OCR to determine the OCR ratio. Maximal respiration was achieved by injecting the mitochondrial protonophore uncoupler BAM15. While the ADP-stimulated and uncoupled respiration rates of mitochondria stored at 4°C decreased over time, mitochondria stored at -80°C maintained ADP-stimulated (Figure 34C) and uncoupled (Figure 34D) respiration rates comparable to those of freshly isolated mitochondria throughout storage (up to 6 weeks).

[0060] [Figure 35] These results demonstrate that mitochondria retain mitochondrial function after cryopreservation at -80°C, as measured by mitochondrial membrane potential and mitochondrial membrane permeability. Changes in mitochondrial membrane potential of mitochondria stored under non-preserved conditions (i.e., at 4°C) or preserved conditions (i.e., at -80°C) were assessed by flow cytometry using the JC-1 assay. Mitochondrial depolarization is indicated by a decrease in the red:green fluorescence intensity ratio or a decrease in the signal intensity of the phycoerythrin (PE) channel. While mitochondria stored at 4°C showed a dramatic decrease in membrane potential, mitochondria stored at -80°C maintained a membrane potential comparable to that of freshly isolated mitochondria over time (up to 7 months) (Figure 35A). The permeability of mitochondria stored under non-preserved or preserved conditions was measured by flow cytometry using SYTOX Green nucleic acid stain, which readily penetrates membrane-damaged mitochondria. SYTOX Green-stained damaged mitochondria exhibit higher FITC signal intensity than non-SYTOX Green-stained undamaged mitochondria. Mitochondria stored at 4°C showed an immediate increase in FITC emission, whereas mitochondria stored at -80°C retained a membrane potential comparable to freshly isolated mitochondria throughout storage (up to 7 months) (Figure 35B).

[0061] [Figure 36]These results demonstrate that mitochondria retain mitochondrial function after cryopreservation at -80°C, as measured by their ability to reduce reactive oxygen species (ROS)-mediated chemokine secretion in HPAECs. HPAECs were cultured with 25 μM menadione with or without mitochondrial treatment. The mitochondria used in these experiments were stored either under non-preserved conditions (i.e., at 4°C) or preserved conditions (i.e., at -80°C). Chemokines in the medium of treated HPAECs were measured using a bead-based immunoassay. Mitochondria stored at 4°C rapidly lost their ability to regulate the secretion of IL-8 / CXCL8 (Figure 36A), MIG / CXCL9 (Figure 36B), MCP-1 / CCL2 (Figure 36C), and GROα / CXCL1 (Figure 36D), compared with mitochondria stored at -80°C, which retained their ability to reduce chemokine secretion.

[0062] [Figure 37] These results demonstrate that mitochondria stored at -80°C have the same overall morphology (Figure 37A) and average size (Figure 37B) as freshly isolated mitochondria. Mitochondria scored as class I had a condensed, normal (i.e., undamaged) state, represented by numerous narrow, pleomorphic cristae within a continuous, electron-dense matrix space. Mitochondria scored as class II were in a remodeled state characterized by reorganized cristae and matrix spaces. The emergence of the remodeled state correlated temporally with the redistribution and availability of cytochrome c from the intermembrane space. Mitochondria scored as class III were swollen and damaged. Class III mitochondria had intact membranes, but their cristae were degraded and clustered near the mitochondrial periphery. Mitochondria scored as class IV had swollen or ruptured terminals. Class IV mitochondria showed overall morphological disorganization, including asymmetric blebbing of the matrix. Mitochondria scored as "condensed matrix (CM)" had a condensed matrix without a marginal outer membrane.

[0063] [Figure 38] These results demonstrate that intact mitochondria are functional components of mitochondrial processing, as opposed to components released from mitochondria after storage at -80°C or components carried over from the isolation process. Mitochondrial and non-mitochondrial fractions were obtained by centrifugation from mitochondria stored at -80°C for 2 weeks. HPAECs were cultured with 25 μM menadione and volume-treated with either the mitochondrial or non-mitochondrial fraction. Volumes of 0.02%, 0.2%, 2%, and 20% correspond to 1 mitochondria / cell, 10 mitochondria / cell, 100 mitochondria / cell, and 1,000 mitochondria / cell, respectively. Analyzed parameters included secretion of the inflammatory chemokines IL-8 / CXCL8 (Figure 38A), MCP-1 / CCL-2 (Figure 38B), and GROα / CXCL-1 (Figure 38C), as well as lactate dehydrogenase release (Figure 38C), which indicates cellular injury. Only the mitochondrial fraction retained the ability to reduce chemokine secretion and LDH release.

[0064] [Figure 39-1]We demonstrate that porcine mitochondrial treatment improves in vivo renal function and recovery after acute kidney injury in an ischemia / reperfusion (I / R) mouse model. Acute I / R injury was achieved in adult mice by clamping the renal artery for 45 minutes followed by reperfusion. Mice were injected with mitochondria (0.01x or 0.1x) or vehicle control on day 1 of reperfusion. Blood urea nitrogen (BUN), an indicator of renal function, increased after I / R injury and tended to decrease on days 2 and 4 after mitochondrial (0.1x) injection (Figure 39A). The renal index, which is the percentage of mouse body weight occupied by the kidney, increased after I / R injury and decreased after mitochondrial injection (0.01x) (Figure 39B). Kidney injury molecule-1 (KIM1) is a marker of acute kidney injury. I / R injury increased KIM1 serum levels, whereas mitochondrial treatment reduced these levels in a dose-responsive manner (Figure 39C). Monocyte chemoattractant protein 1 (MCP1) is a pro-inflammatory cytokine associated with acute kidney injury. I / R injury increased serum MCP1 levels, whereas mitochondrial treatment reduced these levels in a dose-dependent manner (Figure 39D). C3a and C5a members of the complement system induce inflammatory mediators from both renal tubular epithelial cells and macrophages after hypoxia / reoxygenation. I / R injury increased serum levels of C3a (Figure 39E) and C5a (Figure 39F), whereas mitochondrial treatment reduced these levels in a dose-dependent manner (Figures 39E-F). Mitochondria used in these studies were stored at -80°C for approximately 1 month before injection. Statistical analysis was performed by one-way ANOVA (#P ≤ 0.05 compared to sham; *P ≤ 0.05 compared to model + vehicle).

[0065] [Figure 39-2]We demonstrate that porcine mitochondrial treatment improves in vivo renal function and recovery after acute kidney injury in an ischemia / reperfusion (I / R) mouse model. Acute I / R injury was achieved in adult mice by clamping the renal artery for 45 minutes followed by reperfusion. Mice were injected with mitochondria (0.01x or 0.1x) or vehicle control on day 1 of reperfusion. Blood urea nitrogen (BUN), an indicator of renal function, increased after I / R injury and tended to decrease on days 2 and 4 after mitochondrial (0.1x) injection (Figure 39A). The renal index, which is the percentage of mouse body weight occupied by the kidney, increased after I / R injury and decreased after mitochondrial injection (0.01x) (Figure 39B). Kidney injury molecule-1 (KIM1) is a marker of acute kidney injury. I / R injury increased KIM1 serum levels, whereas mitochondrial treatment reduced these levels in a dose-responsive manner (Figure 39C). Monocyte chemoattractant protein 1 (MCP1) is a pro-inflammatory cytokine associated with acute kidney injury. I / R injury increased serum MCP1 levels, whereas mitochondrial treatment reduced these levels in a dose-dependent manner (Figure 39D). C3a and C5a members of the complement system induce inflammatory mediators from both renal tubular epithelial cells and macrophages after hypoxia / reoxygenation. I / R injury increased serum levels of C3a (Figure 39E) and C5a (Figure 39F), whereas mitochondrial treatment reduced these levels in a dose-dependent manner (Figures 39E-F). Mitochondria used in these studies were stored at -80°C for approximately 1 month before injection. Statistical analysis was performed by one-way ANOVA (#P ≤ 0.05 compared to sham; *P ≤ 0.05 compared to model + vehicle).

[0066] [Figure 39-3]We demonstrate that porcine mitochondrial treatment improves in vivo renal function and recovery after acute kidney injury in an ischemia / reperfusion (I / R) mouse model. Acute I / R injury was achieved in adult mice by clamping the renal artery for 45 minutes followed by reperfusion. Mice were injected with mitochondria (0.01x or 0.1x) or vehicle control on day 1 of reperfusion. Blood urea nitrogen (BUN), an indicator of renal function, increased after I / R injury and tended to decrease on days 2 and 4 after mitochondrial (0.1x) injection (Figure 39A). The renal index, which is the percentage of mouse body weight occupied by the kidney, increased after I / R injury and decreased after mitochondrial injection (0.01x) (Figure 39B). Kidney injury molecule-1 (KIM1) is a marker of acute kidney injury. I / R injury increased KIM1 serum levels, whereas mitochondrial treatment reduced these levels in a dose-responsive manner (Figure 39C). Monocyte chemoattractant protein 1 (MCP1) is a pro-inflammatory cytokine associated with acute kidney injury. I / R injury increased serum MCP1 levels, whereas mitochondrial treatment reduced these levels in a dose-dependent manner (Figure 39D). C3a and C5a members of the complement system induce inflammatory mediators from both renal tubular epithelial cells and macrophages after hypoxia / reoxygenation. I / R injury increased serum levels of C3a (Figure 39E) and C5a (Figure 39F), whereas mitochondrial treatment reduced these levels in a dose-dependent manner (Figures 39E-F). Mitochondria used in these studies were stored at -80°C for approximately 1 month before injection. Statistical analysis was performed by one-way ANOVA (#P ≤ 0.05 compared to sham; *P ≤ 0.05 compared to model + vehicle).

[0067] [Figure 40]These results demonstrate that porcine mitochondrial treatment improved the expression of gap junction markers and reduced DNA oxidation in isolated porcine cadaver lungs placed in EVLP after cold ischemic injury. EVLP was performed on isolated porcine cadaver lungs after approximately 20 hours of cold ischemia. Mitochondrial treatment improved the expression of gap junction markers, junctional adhesion molecule 1 (JAM1) (Figure 40A) and CD31 (Figure 40B), in EVLP at 1 hour in the upper lobe and at 4 hours in the distal portion of the caudal lobe, proximal portion of the caudal lobe, and upper lobe. 8-Hydroxy-2'-deoxyguanosine (8-OHdG) is a marker of ROS-induced DNA oxidation. Mitochondrial treatment reduced the expression of 8-OHdG in lung tissue during EVLP at 1 hour in the upper lobe and at 4 hours in the distal portion of the caudal lobe, proximal portion of the caudal lobe, lower lobe, and upper lobe (Figure 40C). Protein expression was normalized to DAPI nuclear staining, and all data were normalized to baseline pre-EVLP tissue. Statistical analysis performed was a two-tailed T-test.

[0068] [Figure 41] These results show that porcine mitochondrial treatment reduced the expression or secretion of IL-6, IL-8, and interferon (IFN)-γ in isolated porcine cadaver lungs after cold ischemic injury. EVLP was performed on isolated porcine cadaver lungs after approximately 20 hours of cold ischemia. Mitochondrial treatment reduced circulating IL-6 in EVLP (Figure 41A) and reduced lung tissue lysate levels of IL-8 in the upper lobe after 1 hour of EVLP, and in the distal portion of the caudal lobe, the proximal portion of the caudal lobe, and the upper lobe after 4 hours of EVLP (Figure 41B).

[0069] [Figure 42]Figure 42 shows the effect of mitochondrial injection on pulmonary vascular resistance (PVR) during EVLP. PVR of isolated cadaveric pig lungs was measured during EVLP. Six lungs ("control") were treated with vehicle for a 3-hour EVLP period, and five lungs ("mitochondrial") were treated with mitochondria for a 3-hour EVLP period and were included in the analysis (Figure 42A). A single mitochondrial-treated lung is shown in Figure 42B, showing how mitochondrial injection appears visually over a 3-hour injection period. The dotted lines in Figures 42A and 42B represent the time of mitochondrial injection. The arrows in Figure 42B represent the time at which gas exchange was assessed. There was a recruitment event between each assessment. Statistical analysis was performed by one-way ANOVA (#P≦0.01 compared to control; *P≦0.05 compared to control).

[0070] [Figure 43] Pathways affected by mitochondrial processing in isolated cadaveric pig lungs placed in EVLP after cold ischemic injury are shown. Isolated cadaveric pig lungs were exposed to approximately 20 hours of cold ischemia, after which EVLP was performed on the lungs for 5 hours. Distal and proximal caudal lung tissue was collected from control buffer-injected or mitochondria-injected lungs and subjected to RNA sequencing. Compared to control samples, mitochondrial processing reduced inflammatory and apoptotic pathways.

[0071] [Figure 44-1]These results demonstrate that mitochondrial treatment reduces ROS-mediated oxidative byproducts and ROS-mediated chemokine secretion. HPAECs were cultured with 25 μM of the ROS inducer menadione for 5 hours, with or without mitochondrial treatment. The oxidative stress markers 4-hydroxynonenal (4-HNE) and 8-OHdG were measured in lysates from treated cells by competitive ELISA. Mitochondrial treatment effectively reduced the levels of 4-HNE adducts (Figure 44A) and 8-OHdG (Figure 44B) to normal (without menadione treatment) levels. Cell culture supernatants from treated cells were analyzed for the presence of secreted chemokines by flow cytometry. Mitochondrial treatment effectively reduced the secretion of IL-8 / CXCL8 (Figure 44C), MCP1 / CCL2 (Figure 44D), MIG / CXCL9 (Figure 44E), and GROα / CXCL1 to normal (without menadione treatment) levels. Mitochondria used in these experiments were stored at -80°C for 1 week before use. Statistical analysis was performed by one-way ANOVA (***P<0.0001 compared to untreated 25 μM menadione; ****P<0.0001 compared to untreated 25 μM menadione).

[0072] [Figure 44-2]These results demonstrate that mitochondrial treatment reduces ROS-mediated oxidative byproducts and ROS-mediated chemokine secretion. HPAECs were cultured with 25 μM of the ROS inducer menadione for 5 hours, with or without mitochondrial treatment. The oxidative stress markers 4-hydroxynonenal (4-HNE) and 8-OHdG were measured in lysates from treated cells by competitive ELISA. Mitochondrial treatment effectively reduced the levels of 4-HNE adducts (Figure 44A) and 8-OHdG (Figure 44B) to normal (without menadione treatment) levels. Cell culture supernatants from treated cells were analyzed for the presence of secreted chemokines by flow cytometry. Mitochondrial treatment effectively reduced the secretion of IL-8 / CXCL8 (Figure 44C), MCP1 / CCL2 (Figure 44D), MIG / CXCL9 (Figure 44E), and GROα / CXCL1 to normal (without menadione treatment) levels. Mitochondria used in these experiments were stored at -80°C for 1 week before use. Statistical analysis was performed by one-way ANOVA (***P<0.0001 compared to untreated 25 μM menadione; ****P<0.0001 compared to untreated 25 μM menadione).

[0073] [Figure 44-3]These results demonstrate that mitochondrial treatment reduces ROS-mediated oxidative byproducts and ROS-mediated chemokine secretion. HPAECs were cultured with 25 μM of the ROS inducer menadione for 5 hours, with or without mitochondrial treatment. The oxidative stress markers 4-hydroxynonenal (4-HNE) and 8-OHdG were measured in lysates from treated cells by competitive ELISA. Mitochondrial treatment effectively reduced the levels of 4-HNE adducts (Figure 44A) and 8-OHdG (Figure 44B) to normal (without menadione treatment) levels. Cell culture supernatants from treated cells were analyzed for the presence of secreted chemokines by flow cytometry. Mitochondrial treatment effectively reduced the secretion of IL-8 / CXCL8 (Figure 44C), MCP1 / CCL2 (Figure 44D), MIG / CXCL9 (Figure 44E), and GROα / CXCL1 to normal (without menadione treatment) levels. Mitochondria used in these experiments were stored at -80°C for 1 week before use. Statistical analysis was performed by one-way ANOVA (***P<0.0001 compared to untreated 25 μM menadione; ****P<0.0001 compared to untreated 25 μM menadione).

[0074] [Figure 45]We demonstrate that mitochondrial treatment attenuates ROS-mediated injury and improves viability of HPAECs subjected to cooling / rewarming injury. To replicate cooling / rewarming injury in a two-dimensional (2D) culture model, as shown in Figure 45A, HPAECs were cultured at 4°C for 24 hours (hypothermic conditions) and then rewarmed at 37°C for 4 hours (normothermic conditions). Treatment groups included HPAECs treated with mitochondria at the start of hypothermia treatment and HPAECs treated with mitochondria at the time of rewarming. After the 4-hour rewarming period, ROS-mediated injury was measured using a 4-HNE adduct competitive ELISA to quantify 4-HNE protein adducts in HPAEC lysates. The formation of 4-HNE adducts was highly sensitive to mitochondrial treatment, as even very low doses of mitochondria could have an effect (Figure 45B). Cell viability was also measured after the 4-hour rewarming period. Results are shown in Figure 45C as relative light units (RLU) normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Normal, unstressed HPAECs are represented by the dashed line (Figure 45C). Mitochondrial treatment increased cell viability by 2-3 fold compared to untreated HPAECs (Figure 45C).

[0075] [Figure 46-1]We demonstrate that mitochondrial treatment reduces necrosis in HPAECs subjected to cooling / rewarming injury. Cooling / rewarming injury was replicated using the 2D culture method shown in Figure 45A. Treatment groups included HPAECs treated with mitochondria at the start of hypothermia treatment and HPAECs treated with mitochondria at the time of rewarming. After a 4-hour rewarming period, necrotic cell death was measured using a cell-impermeable, fluorescent-enhancing DNA dye. Results are shown in Figure 46A as relative light units (RLU) normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). HPAECs treated with mitochondria showed a dose-dependent reduction in necrosis (Figure 46A). Necrotic cell death is characterized by phosphorylation of mixed lineage kinase domain-like pseudokinase (MLKL). HPAEC lysates harvested after the 4-hour rewarming period were analyzed using a sandwich ELISA to measure phospho-MLKL (pMLKL) and total MLKL. The results are shown in Figure 46B as optical density measured at a wavelength of 450 nm (OD450) normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondrial-treated HPAECs showed a dose-dependent decrease in pMLKL levels (Figure 46B). Total MLKL levels were unchanged (data not shown). High mobility group box (HMGB-1) is a ubiquitous nuclear protein passively released by cells undergoing necrosis. HMGB-1 released into HPAEC culture supernatants was measured by sandwich ELISA. The results shown in Figure 46C are normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondrial treatment reduced HMGB-1 release compared to untreated cells (Figure 46C). Lactate dehydrogenase (LDH) is a stable cytosolic enzyme released upon cell lysis. LDH released into HPAEC culture supernatants was measured in a 30-min coupled enzyme assay, converting a tetrazolium salt (INT) into a red formazan product.Results are shown in Figure 46D as optical density (OD490) measured at a wavelength of 490 nm normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondrial treatment reduced LDH release compared to untreated cells (Figure 46D). Normal, unstressed HPAEC controls are shown by dashed lines in Figures 46A, 46B, and 46D.

[0076] [Figure 46-2]We demonstrate that mitochondrial treatment reduces necrosis in HPAECs subjected to cooling / rewarming injury. Cooling / rewarming injury was replicated using the 2D culture method shown in Figure 45A. Treatment groups included HPAECs treated with mitochondria at the start of hypothermia treatment and HPAECs treated with mitochondria at the time of rewarming. After a 4-hour rewarming period, necrotic cell death was measured using a cell-impermeable, fluorescent-enhancing DNA dye. Results are shown in Figure 46A as relative light units (RLU) normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). HPAECs treated with mitochondria showed a dose-dependent reduction in necrosis (Figure 46A). Necrotic cell death is characterized by phosphorylation of mixed lineage kinase domain-like pseudokinase (MLKL). HPAEC lysates harvested after the 4-hour rewarming period were analyzed using a sandwich ELISA to measure phospho-MLKL (pMLKL) and total MLKL. The results are shown in Figure 46B as optical density measured at a wavelength of 450 nm (OD450) normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondrial-treated HPAECs showed a dose-dependent decrease in pMLKL levels (Figure 46B). Total MLKL levels were unchanged (data not shown). High mobility group box (HMGB-1) is a ubiquitous nuclear protein passively released by cells undergoing necrosis. HMGB-1 released into HPAEC culture supernatants was measured by sandwich ELISA. The results shown in Figure 46C are normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondrial treatment reduced HMGB-1 release compared to untreated cells (Figure 46C). Lactate dehydrogenase (LDH) is a stable cytosolic enzyme released upon cell lysis. LDH released into HPAEC culture supernatants was measured in a 30-min coupled enzyme assay, converting a tetrazolium salt (INT) into a red formazan product.Results are shown in Figure 46D as optical density (OD490) measured at a wavelength of 490 nm normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondrial treatment reduced LDH release compared to untreated cells (Figure 46D). Normal, unstressed HPAEC controls are shown by dashed lines in Figures 46A, 46B, and 46D.

[0077] [Figure 47] These results demonstrate that mitochondrial treatment increases total cellular ATP levels in HPAECs subjected to cooling / rewarming injury, which correlates with improved cell viability. Cooling / rewarming injury was replicated using the 2D culture method shown in Figure 45A. Treatment groups included HPAECs treated with mitochondria at the start of hypothermia treatment and HPAECs treated with mitochondria at the time of rewarming. After a 4-hour rewarming period, total cellular ATP levels were measured using a luminescent ATP detection assay. Results shown in Figure 47A are normalized to baseline (i.e., HPAECs exposed to cooling / rewarming without mitochondrial treatment). Mitochondria-treated HPAECs exhibited increased ATP concentrations compared to untreated cells. There was a positive correlation between increased ATP concentrations and cell viability (Figure 47B), and a negative correlation between increased ATP concentrations and necrosis (Figure 47C). Statistical analysis was performed using one-way ANOVA.

[0078] [Figure 48] These results demonstrate that mitochondrial treatment improves cell viability and reduces necrosis in lung homogenates. After 24 hours of cryopreservation, distal lung sections were harvested, enzymatically digested, and placed in normothermic (rewarmed) cell culture conditions. Mitochondrial treatment (500 particles / mg or 1,000 particles / mg) was based on wet tissue weight. Compared to untreated lung homogenates, mitochondrial treatment significantly improved cell viability (Figure 48A) and reduced necrosis (Figure 48B). Statistical analysis was performed by one-way ANOVA (****P<0.0001 compared to untreated).

[0079] [Figure 49] These results show that mitochondrial treatment reduces IL-6 and IFN-γ secretion by lung homogenates. After overnight storage at 4°C, lung tissue was homogenized, treated with increasing doses of mitochondria, and incubated overnight under standard culture conditions (37°C). IL-6 and IFN-γ were measured in lung homogenate lysates after overnight culture under standard conditions. Mitochondrial treatment reduced IL-6 and IFN-γ secretion compared with untreated control lung homogenates. Statistical analysis was performed by one-way ANOVA (*P≦0.05 compared to IFN-γ control; #P≦0.05 compared to IL-6 control). DETAILED DESCRIPTION OF THE INVENTION

[0080] (Detailed Description of the Invention) The present invention is illustrated by the following examples, without limiting the scope of the invention.

[0081] I. Definition To facilitate understanding of the present invention, several terms and phrases are defined below. Unless otherwise specified, terminology is used in accordance with conventional usage.

[0082] As used herein, the terms "about" and "approximately," when used to modify a numerical value or numerical range, indicate that deviations of 5% to 10% above and below that value or range are within the intended meaning of the stated value or range.

[0083] "Administering" (or any form of administration, e.g., "administered") means delivery of an effective amount of a composition as described herein to a subject. Exemplary routes of administration include, but are not limited to, injection (e.g., subcutaneous, intramuscular, intradermal, and intravenous), oral, dermal, and transdermal routes.

[0084] The terms "anoxic," "anoxic," and "anoxic state" can refer to a state in which the supply of oxygen to an organ, tissue, or cell is cut off. The terms "anoxic," "anoxic," and "anoxic state" can also refer to a substantially complete lack of oxygen in an organ, tissue, or cell, which, if prolonged, results in the death of the organ, tissue, or cell.

[0085] As used herein, the term "detection" refers to the quantitative or qualitative identification of a nucleotide, nucleic acid, or protein in a sample.

[0086] The term "differentiation" refers to any process by which an unspecialized ("uncommitted") or less specialized cell acquires the characteristics of a specialized cell, such as a nerve cell, muscle cell, or macrophage. A differentiated cell is one that has become more specialized ("committed") within a cellular lineage. The term committed, when applied to the process of differentiation, refers to a cell that has progressed in the differentiation pathway to a point where, under normal circumstances, it would continue to differentiate into a particular cell type or subset of cell types and, under normal circumstances, would be unable to differentiate into another cell type or revert to a less differentiated cell type.

[0087] The terms "exogenous" and "heterologous" are used interchangeably herein and include nucleic acids, proteins, or organelles (e.g., pig mitochondria) that are not normally present in prokaryotic or eukaryotic cells. These terms, when used with reference to a portion of a nucleic acid, indicate that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, nucleic acids are typically produced recombinantly, with two or more sequences from unrelated genes arranged to create a new functional nucleic acid (e.g., a promoter from one source and a coding region from another source). Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

[0088] The term "ex vivo" refers to conditions occurring outside of an organism and applied to cells, tissues, or other samples obtained from an organism.

[0089] As used herein, the terms "freeze-thaw" and "freeze-thaw cycling" refer to freezing the mitochondria of the present invention to a temperature below 0°C, maintaining the mitochondria at a temperature below 0°C for a specified period of time, and thawing the mitochondria to room temperature, body temperature, or any temperature above 0°C that allows the mitochondria to be administered according to the methods of the present invention. Each possibility represents a separate embodiment of the present invention. As used herein, the term "room temperature" refers to a temperature between 18°C ​​and 25°C. In another embodiment, mitochondria subjected to freeze-thaw cycles are frozen at a temperature of at least -70°C. In another embodiment, mitochondria subjected to freeze-thaw cycles are frozen at a temperature of at least -20°C. In another embodiment, mitochondria subjected to freeze-thaw cycles are frozen at a temperature of at least -4°C. In another embodiment, mitochondria subjected to freeze-thaw cycles are frozen at a temperature of at least 0°C. According to another embodiment, the freezing of mitochondria is gradual. According to some embodiments, the freezing of mitochondria is by flash freezing. As used herein, the term "flash freezing" refers to rapidly freezing mitochondria by exposing them to extremely low temperatures.

[0090] In another embodiment, mitochondria are frozen in a freezing buffer containing a cryoprotectant. In some embodiments, the cryoprotectant is a lipid, a protein, a sugar, a disaccharide, an oligosaccharide, a polysaccharide, or any combination thereof. In a preferred embodiment, the cryoprotectant is trehalose, sucrose, glycerol, PlasmaLyte, CryoStor, dimethyl sulfoxide (DMSO), glutamic acid, albumin, polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), or any combination thereof. Each possibility represents a separate embodiment of the present invention. In another embodiment, the concentration of the cryoprotectant in the freezing buffer is sufficient to act to maintain mitochondrial function. Without wishing to be bound by theory or mechanism, mitochondria frozen in a freezing buffer containing a sugar, disaccharide (e.g., sucrose, trehalose), oligosaccharide, or polysaccharide exhibit a similar or greater rate of oxygen consumption after thawing compared to control mitochondria that have not been subjected to a freeze-thaw cycle or that have been frozen in a freezing or isolation buffer that does not contain a sugar, disaccharide (e.g., sucrose, trehalose), oligosaccharide, or polysaccharide.

[0091] In some embodiments, the term "functional mitochondria" refers to mitochondria that consume oxygen. In other embodiments, functional mitochondria have an intact outer membrane. In some embodiments, functional mitochondria are intact mitochondria. In another embodiment, functional mitochondria consume oxygen at a rate that increases over time. In another embodiment, mitochondrial functionality is measured by oxygen consumption. In another embodiment, mitochondrial oxygen consumption can be measured by any method known in the art, including, but not limited to, MitoXpress fluorescent probe (Luxcel) and Seahorse assay. In some embodiments, functional mitochondria are mitochondria that exhibit an increased rate of oxygen consumption in the presence of ADP and a substrate, including, but not limited to, glutamate, malate, or succinate. Each possibility represents a separate embodiment of the present invention. In another embodiment, functional mitochondria are mitochondria that produce ATP. In another embodiment, functional mitochondria are mitochondria that can manufacture their own RNA and proteins and are self-replicating structures. In another embodiment, functional mitochondria produce mitochondrial ribosomes and mitochondrial tRNA molecules.

[0092] The term "gene" refers to a nucleic acid that encodes an RNA, for example, a nucleic acid sequence including, but not limited to, a structural gene that encodes a polypeptide.

[0093] The terms "hypoxia," "hypoxic," and "hypoxic state" refer to a condition in which an organ, tissue, or cell receives an inadequate supply of oxygen.

[0094] As used herein, the term "intact mitochondria" refers to mitochondria including outer and inner membranes, the intermembrane space, cristae (formed by the inner membrane), and the matrix. In another embodiment, intact mitochondria contain mitochondrial DNA. In another embodiment, intact mitochondria contain active respiratory chain complexes I-V embedded in the inner membrane. In another embodiment, intact mitochondria consume oxygen. According to another embodiment, mitochondrial membrane integrity can be determined by any method known in the art. In a non-limiting example, mitochondrial membrane integrity is measured using tetramethylrhodamine methyl ester (TMRM) or tetramethylrhodamine ethyl ester (TMRE) fluorescent probes. Each possibility represents a separate embodiment of the present invention. Mitochondria that exhibit bright TMRM or TMRE staining when viewed under a microscope have an intact outer mitochondrial membrane.

[0095] The term "ischemia" is defined as an inadequate blood supply to a particular organ, tissue, or cell. The result of reduced blood supply is an inadequate oxygen supply to the organ, tissue, or cell (hypoxia). Prolonged hypoxia can cause injury to the affected organ, tissue, or cell.

[0096] An "isolated" polypeptide, antibody, polynucleotide, vector, cell, or composition is a polypeptide, polynucleotide, vector, cell, or composition in a form not found in nature. Isolated polypeptides, polynucleotides, vectors, cells, or compositions include those that have been purified to the extent that they are no longer in a form in which they are found in nature. In some embodiments, an isolated polypeptide, polynucleotide, vector, cell, or composition is substantially pure.

[0097] As used herein, the term "isolated mitochondria" refers to mitochondria separated from other cellular components, where the weight of mitochondria is greater than 80% of the combined weight of mitochondria and other subcellular fractions. Preparation of isolated mitochondria may involve changes in buffer composition or additional washing steps, wash cycles, centrifugation cycles, and sonication cycles not required for the preparation of partially purified mitochondria. Without wishing to be bound by theory or mechanism, such additional steps and cycles may impair the function of isolated mitochondria. As used herein, mitochondria from a xenogeneic source refer to mitochondria derived from a different subject, from a different species than the subject being treated. As used herein, mitochondria of an autologous source refer to mitochondria derived from the same subject as the subject being treated. As used herein, mitochondria of an allogeneic source refer to mitochondria derived from the same species but from a different subject than the subject being treated.

[0098] As used herein, the term "mitochondrial membrane" refers to a mitochondrial membrane selected from the inner mitochondrial membrane, the outer mitochondrial membrane, or a combination thereof.

[0099] As used herein, the term "mitochondrial protein" refers to a protein derived from mitochondria, including mitochondrial proteins encoded by genomic DNA or mtDNA. As used herein, the term "cellular protein" refers to any protein derived from the cell or tissue in which mitochondria are produced.

[0100] The term "modulate" means that gene expression or levels of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits or peptides, or the activity of one or more protein subunits or peptides, is up-regulated or down-regulated such that said expression, levels, or activity is greater or less than that observed in the absence of the modulator. The term "modulate" includes "inhibit."

[0101] As used herein, the terms "normoxemic" and "normoxemia" refer to a state of normal levels of oxygen.

[0102] The terms "nucleotide sequence" and "nucleic acid sequence" refer to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequence, including, but not limited to, messenger RNA (mRNA), a DNA / RNA hybrid, or a synthetic nucleic acid. A nucleic acid can be single-stranded or partially or completely double-stranded (duplex). A double-stranded nucleic acid can be a homoduplex or a heteroduplex.

[0103] As used herein, the term "organ" refers to a part or structure of the body adapted for a specific function or functions. In certain embodiments, the organs are the lungs, liver, kidneys, heart, pancreas, and intestines, including the stomach and small intestine.

[0104] The term "pharmaceutically acceptable carrier or excipient," which may be used interchangeably with the term biologically compatible carrier or excipient, refers to reagents, cells, compounds, materials, compositions, and / or dosage forms that are not only compatible with cells and other agents being administered therapeutically, but are also suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic response, or other complications, within the scope of sound medical judgment or commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable carriers or excipients suitable for use in the present invention include liquids, semi-solid (e.g., gels), and solid materials (e.g., cell scaffolds and matrices, tubesheets, and other such materials known in the art and described in more detail herein). These semi-solid and solid materials are either designed to resist degradation in the body (non-biodegradable) or designed to degrade in the body (biodegradable, bioerodible). A biodegradable material may also be bioresorbable or bioabsorbable, i.e., it can be dissolved and absorbed by body fluids (water soluble implants are one example) or can be broken down and eventually eliminated from the body either by conversion to other materials or by degradation and elimination via natural pathways.

[0105] As used herein, the term "polynucleotide" refers to a polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). Polynucleotides are composed of the four bases adenine, cytosine, guanine, and thymine / uracil (uracil is used in RNA). A coding sequence from a nucleic acid indicates the sequence of the protein encoded by the nucleic acid. The term encompasses various modifications and analogs known in the art.

[0106] The terms "protein," "peptide," "polypeptide," and "amino acid sequence" are used interchangeably herein to refer to a polymer of amino acid residues of any length. The polymer can be linear or branched. The polymer can comprise modified amino acids or amino acid analogs and can be interrupted by chemical moieties other than amino acids. The term also includes amino acid polymers that are modified, either naturally or by intervention (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or other manipulation or modification, such as conjugation with a label or a biologically active moiety).

[0107] The term "recombinant" with respect to a nucleic acid or polypeptide refers to one having a sequence that is not found in nature or that is produced by the artificial combination of two or more naturally separated sequence segments. This artificial combination is often achieved by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acid, for example, by genetic engineering techniques. A recombinant polypeptide can also refer to a polypeptide produced using recombinant nucleic acid, including a recombinant nucleic acid that has been introduced into a host organism that is not the natural source of the polypeptide. The term "recombinant" when used with respect to a cell, virus, or vector indicates that the cell, virus, or vector has been modified by, or is the result of, laboratory methods. A recombinant cell, virus, or vector can include a cell, virus, or vector that has been modified by the introduction of a heterologous nucleic acid or protein or by the modification of a naturally occurring nucleic acid or protein. Thus, for example, a recombinant cell includes a cell that expresses a gene not found in the native (non-recombinant) form of the cell, or a cell that expresses a naturally occurring gene that is aberrantly expressed, under-expressed, or not expressed at all in nature.

[0108] The term "reperfusion" refers to the resumption of blood flow in a tissue or organ after a period of ischemia.

[0109] The term "sample" is used in its broadest sense. A sample suspected of containing nucleic acids may include cells, chromosomes isolated from cells (e.g., metaphase chromosomal spreads), genomic DNA, RNA, cDNA, etc.

[0110] The terms "stem cells" and "progenitor cells" as used herein refer to cells capable of self-renewal and pluripotency. Typically, stem cells and progenitor cells can regenerate damaged tissues. Stem cells and progenitor cells herein may be, but are not limited to, embryonic stem (ES) cells or tissue stem cells (also called tissue-specific stem cells or somatic stem cells). Any artificially produced cells (e.g., fused cells, reprogrammed cells, etc., as used herein) that can have the above-mentioned capabilities may be stem cells or progenitor cells. ES cells are pluripotent stem cells derived from early embryos.

[0111] The term "subject" as used herein includes any human or non-human animal. The term "non-human animal" includes, but is not limited to, vertebrates, such as non-human primates, sheep, dogs, cats, rabbits, ferrets, rodents (e.g., mice, rats, and guinea pigs), birds (e.g., chickens), amphibians, and reptiles. In preferred embodiments, the subject is a mammal, such as a non-human primate, sheep, dog, cat, rabbit, ferret, or rodent. In more preferred embodiments, the subject is a human. The terms "subject," "patient," and "individual" are used interchangeably herein.

[0112] The terms "transfection," "transduction," "transfecting," or "transducing" can be used interchangeably and are defined as the process of introducing a nucleic acid molecule or protein into a cell. Nucleic acids are introduced into cells using non-viral or viral-based methods. The nucleic acid molecule can be a sequence encoding an entire protein or a functional portion thereof. Typically, it is a nucleic acid vector containing elements necessary for protein expression (e.g., a promoter, a transcription initiation site, etc.). Non-viral transfection methods include suitable methods that do not use viral DNA or viral particles as a delivery system for introducing nucleic acid molecules into cells. Exemplary non-viral transfection methods include calcium phosphate transfection, liposome transfection, nucleofection, sonoporation, heat shock transfection, magnetofection, and electroporation. In the case of viral-based methods, any useful viral vector can be used in the methods described herein. Examples of viral vectors include, but are not limited to, retroviral, adenoviral, lentiviral, and adeno-associated viral vectors. In some embodiments, nucleic acid molecules are introduced into cells using adenoviral vectors according to standard procedures known in the art. The terms "transfection" or "transduction" also refer to the introduction of proteins into cells from the external environment. Protein transduction or transfection typically relies on the attachment of a peptide or protein capable of crossing the cell membrane to the protein of interest. See, for example, Ford, KG, et al., Gene Ther. 2001 Jan;8(1):1-4 and Prochiantz, A., Nat Methods. 2007 Feb;4(2):119-20.

[0113] As used herein, terms such as "treating," "treatment," "treat," or "treating" refer to an intervention or therapeutic measure that ameliorates the signs or symptoms of a disease, pathological condition, or disorder. As used herein, the terms "treating," "treatment," "treat," and "treating" in reference to a disease, disorder, pathological condition, or symptom also refer to an observable beneficial effect of treatment. A beneficial effect may be evidenced, for example, by: a delay in the onset of symptoms of the disease, condition, or disorder; a slowing of the progression of the disease, condition, or disorder; a reduction in the number of recurrences of the disease, condition, or disorder; an improvement in the overall health or well-being of the subject; or by other parameters known in the art specific to a particular disease, condition, or disorder. A prophylactic treatment is a treatment administered to a subject who does not show signs, or who shows only early signs, of a disease, condition, or disorder, with the intent of reducing the risk of developing the condition. A therapeutic treatment is a treatment administered to a subject after the onset of signs and symptoms of a disease, condition, or disorder.

[0114] The term "vector" refers to a construct capable of delivering and expressing one or more genes or sequences of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid vectors, cosmid vectors, phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.

[0115] As used in this disclosure and claims, the singular forms "a," "an," and "the" include the plural forms unless the context clearly dictates otherwise.

[0116] The terms "comprising," "including," "having," and the like, when used with respect to embodiments, are synonymous. Wherever an embodiment is described herein with the word "comprising," it is understood that similar in nature embodiments described with the phrase "consisting of" and / or "consisting essentially of" are also provided.

[0117] For purposes of description, a term in the form "A / B" or in the form "A and / or B" means (A), (B), or (A and B). For purposes of description, a phrase in the form "at least one of A, B, and C" means (A), (B), (C), (A and B), (A and C), (B and C), or (A, B, and C).

[0118] The description may use the terms "embodiment" or "embodiments," each of which may refer to one or more of the same or different embodiments.

[0119] II. Organ Transplantation Methods Disclosed herein are methods for organ transplantation, comprising delivering isolated mitochondria to an organ intended for transplantation. In some embodiments, the organ is derived from a human donor, allogeneic, xenogeneic, derived from a non-human donor (e.g., a pig), or is fully or partially engineered (e.g., a decellularized matrix from a pig kidney that has been recellularized for transplantation). In some embodiments, the method further comprises harvesting the organ from the donor. In some embodiments, the method further comprises transplanting the organ treated with the isolated mitochondria into a recipient. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the recipient. In some embodiments, the isolated mitochondria are isolated mitochondria that are autologous to the recipient. In a preferred embodiment, the organ intended for transplantation is harvested from a human donor. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the human donor. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the human donor. In a preferred embodiment, the organ intended for transplantation is engineered from a pig organ scaffold. In some embodiments, the isolated mitochondria are isolated porcine mitochondria.

[0120] In a preferred embodiment, the cells of an organ treated with isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to the cells of the corresponding organ that are not treated with isolated mitochondria. In some embodiments, the isolated mitochondria are delivered to the organ before harvesting the organ from the donor. In other embodiments, the isolated mitochondria are delivered to the organ after harvesting the organ from the donor. In a preferred embodiment, the organ is a human organ. In other embodiments, the organ is a pig organ for xenotransplantation into a recipient.

[0121] In a preferred embodiment, the organ is a lung. In a particularly preferred embodiment, the lung treated with isolated mitochondria is transplanted into a human recipient suffering from pulmonary hypertension. In a particularly preferred embodiment, the lung is a human lung. In some embodiments, the isolated mitochondria is delivered to the lung via the airway, via a vein, or via an artery.

[0122] In a preferred embodiment, the organ is a kidney. In a particularly preferred embodiment, the kidney treated with isolated mitochondria is transplanted into a human recipient suffering from renal disease or disorder. In a particularly preferred embodiment, the kidney is a human kidney. In some embodiments, the isolated mitochondria is delivered to the kidney via a vein or via an artery.

[0123] In some embodiments, organs, kidneys, or lungs treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding organs, kidneys, or lungs not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0124] In some embodiments, organs, kidneys, or lungs treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity compared to corresponding organs, kidneys, or lungs not treated with isolated mitochondria. In preferred embodiments, the reduced cytotoxicity is associated with a decrease in TLR9 expression, an alteration in heme oxygenase-1 (HO-1) expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the alteration in HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduction in cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with reduced expression of pro-apoptotic markers by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with reduced expression of Bax, Bid, Bad, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the reduction in cell apoptosis is associated with an increase in expression of Bcl-2 and / or Mcl-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0125] In some embodiments, organs, kidneys, or lungs treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding organs, kidneys, or lungs not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, GLUT, VDAC1, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0126] Also disclosed herein are methods for improving the performance of an implanted tissue or transplanted organ in a subject, the methods comprising delivering isolated mitochondria to the tissue or organ before, during, or after implantation or transplantation of the tissue or organ, wherein the tissue or organ is a donor tissue, donor organ, engineered tissue, or engineered organ. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the tissue or organ. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the tissue or organ. In a preferred embodiment, the tissue or organ is a human tissue or organ. In other embodiments, the tissue or organ is a porcine tissue or organ for xenotransplantation into a subject. In a preferred embodiment, the organ is a kidney. In a preferred embodiment, the organ is a lung. In a particularly preferred embodiment, the lung is a human lung. In some embodiments, the isolated mitochondria are delivered to the lung via the airway, via a vein, or via an artery. In a preferred embodiment, the tissue or organ is selected from the group consisting of a blood vessel, a ureter, a trachea, and a skin patch. In a preferred embodiment, the organ is a kidney. In a particularly preferred embodiment, the kidney is a human kidney. In some embodiments, the isolated mitochondria are delivered to the kidney via a vein or via an artery.

[0127] In preferred embodiments, cells of a tissue or organ treated with isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to cells of a corresponding tissue or organ not treated with isolated mitochondria.

[0128] In some embodiments, tissues or organs treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding tissues or organs not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0129] In some embodiments, tissues or organs treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity compared to corresponding tissues or organs not treated with isolated mitochondria. In preferred embodiments, the reduced cytotoxicity is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0130] In some embodiments, tissues or organs treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding tissues or organs not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0131] In some embodiments, the tissue or organ is produced by bioprinting. See, e.g., Murphy, SV and Atala, A., Nat Biotechnol. 2004, 32(8):773-85.

[0132] Non-limiting examples of improved mitochondrial function are an increase in oxygen consumption and / or an increase in adenosine triphosphate (ATP) synthesis by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%.

[0133] Non-limiting examples of routes of delivery of isolated mitochondria to an organ or tissue are delivery via the airways of the lungs, intravenous delivery, and intra-arterial delivery.

[0134] III. Methods of Improving Organ, Tissue, or Lung Function Disclosed herein are methods for improving the function of lungs subjected to ex vivo lung perfusion (EVLP), the methods comprising (i) delivering isolated mitochondria to the lungs and (ii) performing EVLP on the lungs in a chamber or container by perfusing the lungs with a perfusion solution from a reservoir. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the lungs. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the lungs. In preferred embodiments, lung cells treated with isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to corresponding lung cells not treated with isolated mitochondria. In some embodiments, lungs treated with isolated mitochondria have enhanced stability or maintenance of one or more EVLP parameters compared to corresponding lungs not treated with isolated mitochondria. In preferred embodiments, lungs treated with isolated mitochondria exhibit at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improvement in one or more EVLP parameters compared to corresponding lungs not treated with isolated mitochondria. In preferred embodiments, the lungs are human lungs.

[0135] In preferred embodiments, lungs treated with isolated mitochondria have improved expression of gap junction markers, reduced reactive oxygen species (ROS)-induced DNA oxidation, reduced production of ROS-mediated oxidative by-products, reduced ROS-mediated chemokine secretion, reduced levels of inflammatory cytokines, reduced apoptosis, or any combination thereof, compared to corresponding lungs not treated with isolated mitochondria. In some embodiments, gap junction markers include junctional adhesion molecule 1 (JAM1) and CD31. In some embodiments, inflammatory cytokines include IL-6, IL-8, and interferon gamma (IFN-γ). In some embodiments, ROS-mediated oxidative by-products include 4-hydroxynonenal (4-HNE) and 8-hydroxydeoxyguanosine (8-OHdG). In some embodiments, ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

[0136] In some embodiments, the method further comprises harvesting the lungs from the donor before performing EVLP, hi other embodiments, the method further comprises harvesting the lungs from the donor before performing EVLP and transplanting the lungs into a recipient after performing EVLP.

[0137] In some embodiments, the recipient is a human recipient suffering from a pulmonary disease or disorder. In some embodiments, the pulmonary disease or disorder is pulmonary hypertension, bronchopulmonary dysplasia (BPD), pulmonary fibrosis, asthma, sleep-disordered breathing, or chronic obstructive pulmonary disease (COPD). Non-limiting examples of pulmonary hypertension include pulmonary hypertension due to COPD, chronic thromboembolic pulmonary hypertension (CTEPH), pulmonary arterial hypertension (PAH), pulmonary veno-occlusive disease (PVOD), pulmonary capillary hemangiomatosis (PCH), persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with unknown or multifactorial mechanisms.

[0138] In some embodiments, the isolated mitochondria are delivered to the lung before performing EVLP. In other embodiments, the isolated mitochondria are delivered to the lung while performing EVLP. In some embodiments, the isolated mitochondria are delivered to the lung after performing EVLP. In some embodiments, the isolated mitochondria are delivered to the lung before harvesting the lung from the donor. In other embodiments, the isolated mitochondria are delivered to the lung after harvesting the lung from the donor. In some embodiments, the isolated mitochondria are delivered to the lung via the airway, via a vein, or via an artery before harvesting the lung from the donor. In other embodiments, the isolated mitochondria are delivered to the lung via the airway, via a vein, or via an artery after harvesting the lung from the donor.

[0139] In a preferred embodiment, the perfusion solution is introduced into the lungs via a cannulated pulmonary artery. In a preferred embodiment, the lungs are ventilated in a chamber or container via a cannulated trachea.

[0140] In preferred embodiments, lungs treated with isolated mitochondria have improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced production of ROS-mediated oxidative by-products, reduced ROS-mediated chemokine secretion, reduced levels of inflammatory cytokines, reduced apoptosis, or any combination thereof, compared to corresponding lungs not treated with isolated mitochondria. In some embodiments, the gap junction markers include JAM1 and CD31. In some embodiments, the inflammatory cytokines include IL-6, IL-8, and IFN-γ. In some embodiments, the ROS-mediated oxidative by-products include 4-HNE and 8-OHdG. In some embodiments, the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

[0141] In some embodiments, lungs treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding lungs not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0142] In some embodiments, lungs treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury compared to corresponding lungs not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0143] In some embodiments, lungs treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding lungs not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0144] Non-limiting examples of stable, maintained, or improved EVLP parameters include stable or maintained pulmonary artery pressure (PAP); improved or maintained tidal volume (TV); improved or maintained dynamic compliance (TV / (maximal inspiratory pressure (PIP)-positive end-expiratory pressure (PEEP))); increased glucose / lactose ratio; decreased histological measurements of cell death (e.g., decreased cell death measured by TUNEL assay); increased angiogenesis and gap junction formation; stable or improved (i.e., decreased) pulmonary vascular resistance (PVR); decreased lactate production; decreased ammonium production; improved minute ventilation; improved blood flow; decreased pulmonary edema; improved pulmonary elastance; and stable or improved gas exchange. Increased CD31 expression indicates angiogenesis and gap junction formation.

[0145] Non-limiting examples of perfusion solutions include Steen solution, Perfadex, low potassium dextran solution, whole blood, diluted blood, packed red blood cells (RBCs), plasma substitutes, one or more vasodilators, sodium bicarbonate, glucose, and any combination thereof.

[0146] Non-limiting examples of delivery of isolated mitochondria to the lung include delivery via the airways, delivery from a reservoir in a chamber or container, intravenous delivery, and intra-arterial delivery.

[0147] Also disclosed herein are methods for minimizing injury to ex vivo organs due to cold ischemia during transport, shipping, or storage, the methods comprising delivering isolated mitochondria to an organ 0-24 hours before, during, or 0-24 hours after cold ischemia, wherein cells of the organ treated with the isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to cells of a corresponding organ not treated with the isolated mitochondria, and the improved mitochondrial function is an increase in oxygen consumption rate and / or ATP synthesis of at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the organ. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the organ. In some embodiments, the method further comprises harvesting the organ from a donor. In some embodiments, the isolated mitochondria are delivered to the organ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours before cold ischemia. In other embodiments, the isolated mitochondria are delivered to the organ during cold ischemia. In other embodiments, the isolated mitochondria are delivered to the organ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours after cold ischemia. In a preferred embodiment, the organ is a human organ. In other embodiments, the organ is a porcine organ for xenotransplantation into a human subject.

[0148] In preferred embodiments, organs treated with isolated mitochondria have reduced production of ROS-mediated oxidative by-products, improved cell viability, reduced necrosis, reduced cell lysis, increased total cellular ATP levels, reduced secretion of inflammatory cytokines, or any combination thereof, compared to corresponding organs not treated with isolated mitochondria. In some embodiments, the inflammatory cytokines include IL-6, IL-8, and IFN-γ. In some embodiments, the ROS-mediated oxidative by-products include 4-HNE and 8-OHdG.

[0149] In a preferred embodiment, the organ treated with the isolated mitochondria is a kidney. In another preferred embodiment, the organ is a kidney, and the method further comprises transplanting the kidney treated with the isolated mitochondria into a human recipient suffering from a renal disease or disorder. In another preferred embodiment, the organ is a kidney, and the method further comprises harvesting the kidney from a donor. In another preferred embodiment, the organ is a kidney, and the method further comprises harvesting the kidney from a donor and transplanting the kidney treated with the isolated mitochondria into a human recipient suffering from a renal disease or disorder.

[0150] In a preferred embodiment, the organ is a lung, and the method further comprises performing EVLP on the lung in a chamber or container by perfusing the lung with perfusion solution from a reservoir. In another preferred embodiment, the organ is a lung, and the method comprises harvesting the lung from a donor and performing EVLP on the lung in a chamber or container by perfusing the lung with perfusion solution from a reservoir. In another preferred embodiment, the organ is a lung, and the method comprises harvesting the lung from a donor and performing EVLP on the lung in a chamber or container by perfusing the lung with perfusion solution from a reservoir, and transplanting the lung into a human recipient suffering from pulmonary hypertension. In a preferred embodiment, the lungs treated with isolated mitochondria exhibit enhanced stability or maintenance of one or more EVLP parameters compared to corresponding lungs not treated with isolated mitochondria. In particularly preferred embodiments, lungs treated with isolated mitochondria exhibit an improvement in one or more EVLP parameters by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to corresponding lungs not treated with isolated mitochondria, hi particularly preferred embodiments, the lungs are human lungs.

[0151] In some embodiments, the isolated mitochondria are delivered to the lung before performing EVLP. In other embodiments, the isolated mitochondria are delivered to the lung during EVLP. In other embodiments, the isolated mitochondria are delivered to the lung after performing EVLP. In some embodiments, the isolated mitochondria are delivered to the lung before harvesting the lung from the donor. In other embodiments, the isolated mitochondria are delivered to the lung after harvesting the lung from the donor.

[0152] In a preferred embodiment, the perfusion solution is introduced into the lungs via a cannulated pulmonary artery. In a preferred embodiment, the lungs are ventilated in a chamber or container via a cannulated trachea.

[0153] In some embodiments, organs, kidneys, or lungs treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding organs, kidneys, or lungs not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0154] In some embodiments, organs, kidneys, or lungs treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury compared to corresponding organs, kidneys, or lungs not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0155] In some embodiments, organs, kidneys, or lungs treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding organs, kidneys, or lungs not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0156] Also disclosed herein are methods for improving the function of engineered organs or tissues, the methods comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; (ii) growing the organ or tissue scaffold with growing cells in a bioreactor, chamber, or container to produce an engineered organ or tissue; and (iii) delivering isolated mitochondria to the engineered organ or tissue. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered organ or tissue. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered organ or tissue. In preferred embodiments, cells of an engineered organ or tissue treated with isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to cells of a corresponding engineered organ that are not treated with isolated mitochondria. In particularly preferred embodiments, engineered organs or tissues treated with isolated mitochondria have one or more improved cellular, organ, or tissue functions compared to corresponding engineered organs or tissues not treated with isolated mitochondria, wherein the one or more improved cellular, organ, or tissue functions are increased cell adhesion to the scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced production of reactive oxygen species, or any combination thereof. In preferred embodiments, the engineered organ or tissue treated with isolated mitochondria is an engineered human organ or tissue.

[0157] In some embodiments, the engineered organ or tissue treated with isolated mitochondria is an engineered human kidney. In some embodiments, the engineered human organ or tissue treated with isolated mitochondria is an engineered human lung. In preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered lung not treated with isolated mitochondria. In particularly preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits enhanced stability or maintenance of PAP; TV; dynamic compliance; PVR; gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with isolated mitochondria. In preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits an improvement in one or more EVLP parameters by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to a corresponding engineered human lung not treated with isolated mitochondria. In particularly preferred embodiments, the improvement in one or more EVLP parameters is improved PAP; improved TV; improved dynamic compliance; increased glucose / lactose ratio; decreased histological measures of cell death; increased angiogenesis and gap junction formation; decreased PVR; decreased lactate production; decreased ammonium production; improved minute ventilation; improved blood flow; decreased pulmonary edema; improved pulmonary elastance; improved gas exchange; or any combination thereof.

[0158] In preferred embodiments, engineered human lungs treated with isolated mitochondria have improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced production of ROS-mediated oxidative by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to corresponding engineered human lungs not treated with isolated mitochondria. In some embodiments, the gap junction markers include JAM1 and CD31. In some embodiments, the inflammatory cytokines include IL-6, IL-8, and IFN-γ. In some embodiments, the ROS-mediated oxidative by-products include 4-HNE and 8-OHdG. In some embodiments, the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

[0159] In some embodiments, the isolated mitochondria are delivered to the engineered organ or tissue after the process of growing the organ or tissue scaffold. In other embodiments, the isolated mitochondria are delivered to the engineered organ or tissue during the process of growing the organ or tissue scaffold. In a preferred embodiment, the isolated mitochondria are delivered to the engineered organ or tissue together with the grown cells in a bioreactor, chamber, or container during the process of growing the organ or tissue scaffold.

[0160] In some embodiments, isolated mitochondria are injected into an organ or tissue scaffold prior to growing the organ or tissue scaffold in a bioreactor, chamber, or container.

[0161] In some embodiments, the organ or tissue scaffold is produced by bioprinting. In a preferred embodiment, the expanded cells and the artificial organ or tissue matrix are simultaneously bioprinted to produce the engineered organ or tissue. See, e.g., Murphy, SV and Atala, A., Nat Biotechnol. 2004, 32(8):773-85.

[0162] In some embodiments, engineered organs or tissues treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding engineered organs or tissues not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0163] In some embodiments, engineered organs or tissues treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity compared to corresponding engineered organs or tissues not treated with isolated mitochondria. In preferred embodiments, the reduced cytotoxicity is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0164] In some embodiments, engineered organs or tissues treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding engineered organs or tissues not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0165] Non-limiting examples of proliferating cells include epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), immune cells, mesenchymal cells, pericytes, and any combination thereof.

[0166] Non-limiting examples of delivery of isolated mitochondria to engineered organs and tissues are intravenous, intra-arterial, intratracheal, or perfusion, or delivery via the lymphatic system or bronchial circulation.

[0167] Also disclosed herein are methods for improving the function of engineered organs or tissues, the methods comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; and (ii) growing the organ or tissue scaffold in a bioreactor, chamber, or container with proliferating cells treated with isolated mitochondria to produce the engineered organ or tissue. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered organ or tissue. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered organ or tissue. In preferred embodiments, cells of an engineered organ or tissue treated with isolated mitochondria are associated with at least a 1%, or at least a 2%, or at least a 5%, or at least a 10%, or at least a 20%, or at least a 50%, or at least a 100% improvement in mitochondrial function compared to cells of a corresponding engineered organ that are not treated with isolated mitochondria. In particularly preferred embodiments, engineered organs or tissues treated with isolated mitochondria have one or more improved cellular, organ, or tissue functions compared to corresponding engineered organs or tissues not treated with isolated mitochondria, wherein the one or more improved cellular, organ, or tissue functions are increased cell adhesion to the scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced production of reactive oxygen species, or any combination thereof. In preferred embodiments, the engineered organ or tissue treated with isolated mitochondria is an engineered human organ or tissue.

[0168] In some embodiments, the engineered human organ or tissue treated with isolated mitochondria is an engineered human lung. In preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered lung not treated with isolated mitochondria. In particularly preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits enhanced stability or maintenance of PAP; TV; dynamic compliance; PVR; gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with isolated mitochondria. In preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits an improvement in one or more EVLP parameters by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to a corresponding engineered human lung not treated with isolated mitochondria. In particularly preferred embodiments, the improvement in one or more EVLP parameters is improved PAP; improved TV; improved dynamic compliance; increased glucose / lactose ratio; decreased histological measures of cell death; increased angiogenesis and gap junction formation; decreased PVR; decreased lactate production; decreased ammonium production; improved minute ventilation; improved blood flow; decreased pulmonary edema; improved pulmonary elastance; improved gas exchange; or any combination thereof.

[0169] In preferred embodiments, engineered human lungs treated with isolated mitochondria have improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced production of ROS-mediated oxidative by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to corresponding engineered human lungs not treated with isolated mitochondria. In some embodiments, the gap junction markers include JAM1 and CD31. In some embodiments, the inflammatory cytokines include IL-6, IL-8, and IFN-γ. In some embodiments, the ROS-mediated oxidative by-products include 4-HNE and 8-OHdG. In some embodiments, the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

[0170] In some embodiments, isolated mitochondria are injected into the organ or tissue scaffold prior to growing the organ or tissue scaffold in the bioreactor, chamber, or container.

[0171] In some embodiments, the organ or tissue scaffold is produced by bioprinting. In a preferred embodiment, the expanded cells and the artificial organ or tissue matrix are simultaneously bioprinted to produce the engineered organ or tissue. See, e.g., Murphy, SV and Atala, A., Nat Biotechnol. 2004, 32(8):773-85.

[0172] In some embodiments, engineered organs or tissues treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding engineered organs or tissues not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0173] In some embodiments, engineered organs or tissues treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity compared to corresponding engineered organs or tissues not treated with isolated mitochondria. In preferred embodiments, the reduced cytotoxicity is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0174] In some embodiments, engineered organs or tissues treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding engineered organs or tissues not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0175] Also disclosed herein are methods for improving the function of engineered organs or tissues, the methods comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; (ii) injecting isolated mitochondria into the organ or tissue scaffold; and (iii) growing the injected organ or tissue scaffold with growing cells in a bioreactor, chamber, or container to produce an engineered organ or tissue. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered organ or tissue. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered organ or tissue. In preferred embodiments, engineered lung cells have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to corresponding engineered lung cells not treated with isolated mitochondria. In particularly preferred embodiments, the engineered organ or tissue has improved one or more cellular, organ, or tissue functions compared to a corresponding engineered organ or tissue not treated with isolated mitochondria, wherein the one or more improved cellular, organ, or tissue functions are increased cell adhesion to the scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced production of reactive oxygen species, or any combination thereof. In preferred embodiments, the engineered organ or tissue is an engineered human organ or tissue.

[0176] In some embodiments, the engineered organ or tissue is an engineered human kidney. In some embodiments, the engineered human organ or tissue is an engineered human lung. In preferred embodiments, the engineered human lung exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered lung not treated with isolated mitochondria. In particularly preferred embodiments, the engineered human lung exhibits enhanced stability or maintenance of PAP; TV; dynamic compliance; PVR; gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with isolated mitochondria. In preferred embodiments, the engineered human lung exhibits at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improvement in one or more EVLP parameters compared to a corresponding engineered lung not treated with isolated mitochondria. In particularly preferred embodiments, the improvement in one or more EVLP parameters is improved PAP; improved TV; improved dynamic compliance; increased glucose / lactose ratio; decreased histological measures of cell death; increased angiogenesis and gap junction formation; decreased PVR; decreased lactate production; decreased ammonium production; improved minute ventilation; improved blood flow; decreased pulmonary edema; improved pulmonary elastance; improved gas exchange; or any combination thereof.

[0177] In preferred embodiments, engineered human lungs treated with isolated mitochondria have improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced production of ROS-mediated oxidative by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to corresponding engineered human lungs not treated with isolated mitochondria. In some embodiments, the gap junction markers include JAM1 and CD31. In some embodiments, the inflammatory cytokines include IL-6, IL-8, and IFN-γ. In some embodiments, the ROS-mediated oxidative by-products include 4-HNE and 8-OHdG. In some embodiments, the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

[0178] In some embodiments, the organ or tissue scaffold is produced by bioprinting. In a preferred embodiment, the expanded cells and the artificial organ or tissue matrix are simultaneously bioprinted to produce the engineered organ or tissue. See, e.g., Murphy, SV and Atala, A., Nat Biotechnol. 2004, 32(8):773-85.

[0179] In some embodiments, the engineered organ or tissue exhibits reduced inflammation and / or immune cell activation compared to a corresponding engineered organ or tissue not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0180] In some embodiments, the engineered organ or tissue has reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity compared to a corresponding engineered organ or tissue not treated with isolated mitochondria. In preferred embodiments, the reduced cytotoxicity is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cytotoxicity is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0181] In some embodiments, the engineered organ or tissue has increased glucose uptake and decreased lactate production compared to a corresponding engineered organ or tissue not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0182] Also disclosed herein are methods for improving the function of an engineered lung, the methods comprising: (i) repopulating a decellularized scaffold lung in a bioreactor, chamber, or container with repopulating cells to produce an engineered lung; and (ii) delivering isolated mitochondria to the engineered lung. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered lung. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered lung. In preferred embodiments, engineered lung cells treated with isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to corresponding engineered lung cells not treated with isolated mitochondria. In particularly preferred embodiments, the engineered lung treated with isolated mitochondria has one or more improved cellular, organ, or tissue functions compared to a corresponding engineered lung not treated with isolated mitochondria, wherein the one or more improved cellular, organ, or tissue functions are increased cell adhesion to the scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced production of reactive oxygen species, or any combination thereof. In preferred embodiments, the engineered lung is an engineered human lung.

[0183] In some embodiments, the isolated mitochondria are delivered to the engineered lung after the step of repopulating the decellularized scaffold lung. In other embodiments, the isolated mitochondria are delivered to the engineered lung during the step of repopulating the decellularized scaffold lung. In a preferred embodiment, the isolated mitochondria are delivered to the engineered lung together with the repopulating cells in a bioreactor, chamber, or container during the step of repopulating the decellularized scaffold lung. In a particularly preferred embodiment, the isolated mitochondria are delivered to the engineered lung via the airways, via a vein, or via an artery.

[0184] In some embodiments, the method further comprises performing EVLP on the engineered lung by perfusing the lung with perfusion solution from the engineered reservoir. In preferred embodiments, the engineered lung treated with isolated mitochondria exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding lung not treated with isolated mitochondria. In particularly preferred embodiments, the engineered human lung treated with isolated mitochondria exhibits enhanced stability or maintenance of PAP; TV; dynamic compliance; PVR; gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with isolated mitochondria. In preferred embodiments, the engineered lung treated with isolated mitochondria exhibits at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improvement in one or more EVLP parameters compared to a corresponding lung not treated with isolated mitochondria. In particularly preferred embodiments, the improvement in one or more EVLP parameters is an improvement in PAP; an improvement in TV; an improvement in dynamic compliance; an increase in glucose / lactose ratio; a decrease in histological measures of cell death; an increase in angiogenesis and gap junction formation; a decrease in PVR; a decrease in lactate production; a decrease in ammonium production; an improvement in minute ventilation; an improvement in blood flow; a decrease in pulmonary edema; an improvement in pulmonary elastance; an improvement in gas exchange; or any combination thereof. In some embodiments, isolated mitochondria are delivered to the engineered lung before performing EVLP. In other embodiments, isolated mitochondria are delivered to the engineered lung during EVLP. In some embodiments, isolated mitochondria are delivered to the engineered lung via the airway, via a vein, or via an artery. In other embodiments, isolated mitochondria are delivered to the engineered lung from a reservoir.

[0185] In some embodiments, a perfusion solution is introduced into the engineered lung via a cannulated pulmonary artery. Non-limiting examples of perfusion solutions include Steen's solution, Perfadex, low-potassium dextran solution, whole blood, diluted blood, packed red blood cells, plasma substitutes, one or more vasodilators, sodium bicarbonate, glucose, and any combination thereof. In some embodiments, the engineered lung is ventilated within a chamber or container via a cannulated trachea.

[0186] In some embodiments, engineered lungs treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding engineered lungs not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in the secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0187] In some embodiments, engineered lungs treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury compared to corresponding engineered lungs not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0188] In some embodiments, engineered lungs treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding engineered lungs not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0189] Non-limiting examples of repopulating cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), immune cells, mesenchymal cells, pericytes, and any combination thereof.

[0190] Also disclosed herein are methods for improving the function of an engineered lung, the methods comprising: (i) delivering isolated mitochondria to repopulating cells; and (ii) growing a decellularized scaffold lung in a bioreactor, chamber, or container with the repopulating cells treated with the isolated mitochondria to produce an engineered lung. Similarly, the methods can include repopulating the decellularized scaffold lung with cells treated with the isolated mitochondria before, during, after, or a combination thereof, after the cells are delivered to the decellularized scaffold. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered lung. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered lung. In preferred embodiments, engineered lung cells treated with isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to corresponding engineered lung cells not treated with isolated mitochondria. In particularly preferred embodiments, engineered lungs treated with isolated mitochondria have improved one or more cell, organ, or tissue functions compared to corresponding engineered lungs not treated with isolated mitochondria, wherein the one or more improved cell, organ, or tissue functions are increased cell adhesion to the scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced reactive oxygen species production, or any combination thereof. In preferred embodiments, the engineered lung is an engineered human lung.

[0191] In some embodiments, the method further comprises performing EVLP on the engineered lung by perfusing the lung with perfusion solution from an engineered reservoir. In some embodiments, the perfusion solution is introduced into the engineered lung via a cannulated pulmonary artery. In some embodiments, the engineered lung is ventilated in a chamber or container via a cannulated trachea.

[0192] In some embodiments, engineered lungs treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding engineered lungs not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0193] In some embodiments, engineered lungs treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury compared to corresponding engineered lungs not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0194] In some embodiments, engineered lungs treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding engineered lungs not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0195] Also disclosed herein are methods for improving the function of an engineered kidney, the methods comprising: (i) repopulating a decellularized scaffold kidney in a bioreactor, chamber, or container with repopulating cells to produce an engineered kidney; and (ii) delivering isolated mitochondria to the engineered kidney. Similarly, the methods can include repopulating the decellularized scaffold kidney with cells treated with isolated mitochondria before, during, after, or a combination thereof, when the cells are delivered to the decellularized scaffold. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered kidney. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered kidney. In preferred embodiments, engineered kidney cells treated with isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to corresponding engineered kidney cells not treated with isolated mitochondria. In particularly preferred embodiments, engineered kidneys treated with isolated mitochondria have one or more improved cell, organ, or tissue functions compared to corresponding engineered kidneys not treated with isolated mitochondria, wherein the one or more improved cell, organ, or tissue functions are increased cell adhesion to a scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced reactive oxygen species production, or any combination thereof. In preferred embodiments, the engineered kidney is an engineered human kidney.

[0196] In some embodiments, the isolated mitochondria are delivered to the engineered kidney after the step of repopulating the decellularized scaffold kidney. In other embodiments, the isolated mitochondria are delivered to the engineered kidney during the step of repopulating the decellularized scaffold kidney. In a preferred embodiment, the isolated mitochondria are delivered to the engineered kidney together with the repopulating cells in a bioreactor, chamber, or container during the step of repopulating the decellularized scaffold kidney. In a particularly preferred embodiment, the isolated mitochondria are delivered to the engineered kidney via a vein or via an artery.

[0197] In some embodiments, engineered kidneys treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding engineered kidneys not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0198] In some embodiments, engineered kidneys treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury compared to corresponding engineered kidneys not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0199] In some embodiments, engineered kidneys treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding engineered kidneys not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0200] Non-limiting examples of repopulating cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), immune cells, mesenchymal cells, pericytes, and any combination thereof.

[0201] Also disclosed herein are methods for improving the function of an engineered kidney, the methods comprising (i) delivering isolated mitochondria to repopulating cells, and (ii) repopulating a decellularized scaffold kidney in a bioreactor, chamber, or container with the repopulating cells treated with the isolated mitochondria to produce an engineered kidney. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered kidney. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the engineered kidney. In preferred embodiments, engineered kidney cells treated with isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to corresponding engineered kidney cells not treated with isolated mitochondria. In particularly preferred embodiments, an engineered kidney treated with isolated mitochondria has one or more improved cellular, organ, or tissue functions compared to a corresponding engineered kidney not treated with isolated mitochondria, wherein the one or more improved cellular, organ, or tissue functions are increased cell adhesion to the scaffold, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced production of reactive oxygen species, or any combination thereof. In preferred embodiments, the engineered kidney is an engineered human kidney.

[0202] In some embodiments, engineered kidneys treated with isolated mitochondria exhibit reduced inflammation and / or immune cell activation compared to corresponding engineered kidneys not treated with isolated mitochondria. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of MAPK14, JNK, or p53 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduced inflammation and / or immune cell activation is associated with reduced expression of NF-κB by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in inflammation and / or immune cell activation is associated with a reduction in secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of activation markers, such as CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, CD154 (CD40L), and any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In a preferred embodiment, the reduction in inflammation and / or immune cell activation is associated with a reduction in expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0203] In some embodiments, engineered kidneys treated with isolated mitochondria have reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury compared to corresponding engineered kidneys not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with a decrease in TLR9 expression, an altered HO-1 expression, a decrease in cytosolic mtDNA, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In some embodiments, the altered HO-1 expression is an increase in HO-1 expression after cold exposure. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with a decrease in NF-κB, MAPK14, JNK, p53 expression, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with a decrease in pro-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In particularly preferred embodiments, the reduction in cell apoptosis is associated with a decrease in expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%. In preferred embodiments, the reduction in cell apoptosis is associated with an increase in anti-apoptotic marker expression by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.In particularly preferred embodiments, the decrease in cell apoptosis is associated with an increase in expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, or MCL-1 by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0204] In some embodiments, engineered kidneys treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding engineered kidneys not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0205] In some embodiments of the methods of the present invention, the engineered organ, tissue, kidney, or lung is created using an artificial organ or tissue matrix. Methods and materials for preparing artificial organ or tissue matrices are known in the art. Any suitable material can be used to prepare such matrices. In a preferred embodiment, the artificial organ or tissue matrix can be a scaffold developed from a porous material such as polyglycolic acid, Pluronic® F-127 (PF-127), Gelfoam sponge, collagen-glycosaminoglycan (GAG), fibrinogen-fibronectin-vitronectin hydrogel (FFVH), and elastin. See, e.g., Ingenito et al., J Tissue Eng Regen Med. 2009 Dec 17; Hoganson et al., Pediatric Research, 2008, 63(5):520-526; Chen et al., Tissue Eng. 2005 Sep-Oct; 11(9-10): 1436-48. In some cases, the implanted artificial organ or tissue matrix can have a porous structure similar to that of the alveolar unit. See Andrade et al., Am J Physiol Lung Cell Mol Physiol. 2007, 292(2):L510-8. In some cases, the implanted artificial organ or tissue matrix can express organ-specific markers (e.g., lung-specific markers of Clara cells (i.e., club cells), pneumocytes, and respiratory epithelium). In some cases, implanted artificial organ or tissue matrices can organize into identifiable structures (e.g., structures similar to alveoli and terminal bronchioles in engineered lung matrices). For example, there is evidence that implanted engineered lung matrices created using FFVH promote cell adhesion, spreading, in vitro expression of extracellular matrix, and apparent in vivo engraftment, providing trophic benefits to surrounding tissues. See Ingenito et al., supra.See also U.S. Patent Nos. 7,662,409 and 6,087,552; U.S. Patent Publication Nos. 2010 / 0034791; 2009 / 0075282; 2009 / 0035855; 2008 / 0292677; 2008 / 0131473; 2007 / 0059293; 2005 / 0196423; 2003 / 0166274; 2003 / 0129751; 2002 / 0182261; 2002 / 0182241; and 2002 / 0172705. In a preferred embodiment, the artificial organ or tissue matrix is ​​infused with isolated mitochondria prior to seeding with proliferating cells to support the metabolism, attachment, and viability of the proliferating cells.

[0206] In some embodiments, the artificial organ or tissue matrix is ​​produced by bioprinting. See, e.g., Murphy, SV and Atala, A., Nat Biotechnol. 2004, 32(8):773-85. In a preferred embodiment, the proliferating cells and the artificial organ or tissue matrix are printed simultaneously to form the proliferating organ or tissue matrix. In a preferred embodiment, isolated mitochondria are delivered with the proliferating cells and / or matrix during printing to support cell viability initially after bioprinting. In a preferred embodiment, the bioprinted organ or tissue matrix is ​​injected with isolated mitochondria prior to seeding with the proliferating cells to support the metabolism, attachment, and viability of the proliferating cells.

[0207] In some embodiments of the methods of the present invention, cadaveric organs are prepared and maintained for use in transplantation. Methods and materials for isolating donor organs (e.g., lungs and kidneys) from human and animal donors are known in the art. See, for example, Pasque, M. et al., J Thorac Cardiovasc Surg. 2010, 139(1):13-7 and Bribriesco A. et al., Front Biosci 2013, 5:266-72. Any suitable method for their isolation can be used. These donor organs can be maintained using a bioreactor, chamber, or container for a time sufficient to prepare the recipient for transplantation, to transport the organ to the recipient, or to maintain the organ under conditions that promote repair of the organ or part of it so as to make it suitable for transplantation.

[0208] In some embodiments, donor organs from organ donors can be modified to remove the endothelial lining and then reseeded with recipient-derived endothelial cells to minimize immunogenicity. For example, this can be achieved by perfusion with deionized water, perfusion with a low surfactant concentration such as 0.05% polidocanol, or osmotic challenge with an enzyme solution such as DNase or collagenase. Donor organs that are found to be unsuitable for immediate transplantation due to infection, physical injury, such as trauma, ischemic injury due to prolonged hypoperfusion, or injury due to donor conditions such as brain death, can be repaired using the instruments and methods described herein (e.g., by mounting, perfusion, and repair using antibiotics, cells, growth factor stimulation, and anti-inflammatory treatments). Animal-derived organs can be reduced in immunogenicity through genetic and cellular modifications.

[0209] In some cases, donor lungs may show evidence of injury due to various factors, such as the quality of the donor lung, the type of preservation solution, the length of time between collection and culture, etc. To reduce and / or eliminate the extent of injury, donor lungs and / or portions thereof can be mounted, for example, using the apparatus described herein and ventilated with liquid and / or dry ventilation. In one example, air is perfused through the tracheal line, while the ventricular and / or atrial lines are perfused with solutions that mimic physiological parameters, such as saline, blood-containing solutions, Steen's solution, Perfadex, and / or preservation solutions. Donor lungs remain mounted until the donor lungs are needed for transplantation and / or until the injured donor lungs show re-epithelialization and improved pulmonary function (e.g., improved endothelial barrier function, improved vascular flow, reduced pulmonary edema, and / or improved ratio of arterial oxygen tension to inspired oxygen concentration (PaO2 / FiO2)). These perfusion methods can be combined with cell seeding methods, as described below.

[0210] In some methods described herein, lung or kidney tissue matrices, such as decellularized lung or kidney tissue matrices or engineered lung or kidney matrices, are seeded with cells, such as differentiated or regenerative cells. Any suitable regenerative cell type, such as a native or undifferentiated cell type, can be used to seed the lung or kidney tissue matrix. Cells can be seeded at various stages, including, but not limited to, stem cell stage (e.g., after induction), progenitor cell stage, hemangioblast stage, or differentiated stage (e.g., CD31+, CD144+). As used herein, regenerative cells can include "adult"-derived stem cells and fetal stem cells, including, but not limited to, progenitor cells, precursor cells, and umbilical cord cells (e.g., human umbilical vein endothelial cells). Regenerative cells can also include differentiated or committed cell types. Stem cells suitable for the methods and materials provided herein may include human induced pluripotent stem cells (iPSCs) (e.g., undifferentiated, differentiated endoderm, vestibulo-differentiated endoderm, TTF-1-positive lung progenitor cells), human mesenchymal stem cells, human umbilical vein endothelial cells, multipotent adult progenitor cells (MAPCs), iPS-derived mesenchymal cells, or embryonic stem cells. In some cases, regenerative cells derived from other tissues can also be used. For example, regenerative cells derived from skin, bone, muscle, heart, bone marrow, synovium, Wharton's jelly, placenta, foreskin, or adipose tissue can be used to develop stem cell-seeded tissue matrices.

[0211] In some cases, the lung or kidney tissue matrices provided herein can alternatively or additionally be seeded with differentiated cell types, such as (preferably human) epithelial and endothelial cells. For example, lung matrices can be seeded with endothelial cells via the vasculature (e.g., via an arterial or venous line) or epithelial cells via the airways (e.g., via a tracheal line). Lung or kidney matrices can also be seeded with one or more cell types (e.g., one or more types of epithelial and mesenchymal cells, adult peripheral blood-derived epithelial cells, umbilical cord blood-derived epithelial cells, iPS-derived epithelial cells, progenitor cells (e.g., smooth muscle), adult lung-derived cell mixtures (e.g., rat, human), commercially available small airway epithelial or alveolar epithelial cells, embryonic stem (ES) cell-derived epithelial cells, and / or human umbilical vein endothelial cells (HUVECs)). Any type of suitable commercially available media and / or media kits can be used for seeding and culturing the cells. For example, SAGM medium can be used for small airway cells (e.g., Lonza's SAGM BulletKit), and EGM-2 kits can be used for endothelial cells (e.g., Lonza's EGM-2 BulletKit). Customized media can be used for the seeded endothelial cell type (e.g., by increasing or decreasing growth factors such as VEGF), as described, for example, in Brudno, Y. et al., Biomaterials 2013, 34:9201-9. For endothelial cells, a series of different media compositions can be used to induce different stages of cell seeding, proliferation, engraftment, and maturation. For example, in the first stage, cell-seeded constructs can be perfused with "angiogenic medium" for 2–30 days to increase endothelial cell proliferation, migration, and metabolism. This medium is characterized by the presence of high concentrations of cytokines, e.g., 5-100 ng / ml VEGF and 5-100 ng / ml bFGF, as well as phorbol myristate acetate (PMA), e.g., 5-100 ng / ml PMA (which activates angiogenic pathways via activation of protein kinase C) and Ang-1 (which stimulates endothelial cell sprouting). In a second step, the cell-seeded constructs can then be perfused with an "enriched medium" that supports endothelial maturation and the formation of strong junctions.Enriched medium has the same basic composition as angiogenesis medium, but with reduced levels of VEGF, bFGF, and PMA (0.1–5 ng / ml VEGF, FGF, and PMA). Hydrocortisone, which has been shown to promote the formation of enhanced junctions and reduce pulmonary edema, can be added to enriched medium to promote vessel maturation. Additional maturation-promoting factors, such as PDGF and Ang-2, can be added to enriched medium to promote angiogenesis. The concentrations of these factors may be titrated to support various vessel sizes. To avoid the deleterious effects of sudden cytokine changes, medium changes can be performed gradually. As with endothelial cell-supporting medium, continuous medium changes can be used to guide epithelial cell fate. The initial medium may contain, for example, 10-200 ng / ml activin A and a Pi3K inhibitor, such as 0.01 μM ZSTK474, to induce distinct endoderm, followed by a TGF-β inhibitor, such as 0.1-10 μM A-8301, and a BMP4 antagonist, such as 0.05-1 μM DMH-1, to induce proderm, and finally, 1-100 μg / ml BMP4, 10-500 ng / ml FGF2, a GSK-3 beta inhibitor, such as 10-500 nM CHIR99021, a PI3K inhibitor, such as 1-100 nM PIK-75, or 1-100 nM methotrexate to induce the generation of lung progenitor cells.

[0212] Any suitable method for isolating and collecting cells for seeding can be used. For example, induced pluripotent stem cells can generally be obtained from somatic cells that have been "reprogrammed" into a pluripotent state by ectopic expression of transcription factors such as Oct4, Sox2, Klf4, c-MYC, Nanog, and Lin28. See Takahashi et al., Cell 2007, 131:861-72 (2007); Park et al., Nature 451:141-146 (2008); Yu et al., Science 318: 1917-20; Zhu et al., Cell Stem Cell 2010, 7:651-5; and Li et al., Cell Res. 2011, 21:196-204; Malik and Rao, Methods Mol Biol. 2013;997:23-33; Okano et al., Circ Res. 2013 Feb 1;112(3):523-33; Lin and Ying, Methods Mol Biol. 2013, 936:295-312. Peripheral blood-derived mononuclear cells can be isolated from a patient's blood sample and used to generate induced pluripotent stem cells. In another example, induced pluripotent stem cells can be obtained by reprogramming using constructs optimized for high co-expression of Oct4, Sox2, Klf4, and c-MYC in combination with small molecules such as transforming growth factor beta (SB431542), MEK / ERK (PD0325901), and Rho-kinase signaling (thiazovivin). See GroB et al., Curr Mol Med. 2013, 13:765-76 and Hou et al., Science 2013, 341:651-4. Methods for generating endothelial cells from stem cells are reviewed in Reed et al., Br J Clin Pharmacol. 2013, 75(4):897-906. Cord blood stem cells can be isolated from fresh or frozen umbilical cord blood. Mesenchymal stem cells can be isolated, for example, from raw, unpurified bone marrow or Ficoll-purified bone marrow.Epithelial and endothelial cells can be isolated and harvested from living or cadaveric donors, such as from a subject receiving a bioartificial kidney or lung, according to methods known in the art. For example, epithelial cells can be obtained from skin tissue samples (e.g., punch biopsies), and endothelial cells can be obtained from vascular tissue samples. In some embodiments, proteolytic enzymes are perfused into the tissue sample via a catheter placed in the vascular system. The enzymatically treated tissue portion may be further subjected to enzymatic and mechanical disruption. The resulting cell mixture can be separated to purify epithelial and endothelial cells. In some cases, flow cytometry-based methods (e.g., fluorescence-activated cell sorter analysis) can be used to sort cells based on the presence or absence of specific cell surface markers. Furthermore, kidney or lung cells (e.g., epithelial, mesenchymal, and endothelial) can be obtained from kidney or lung biopsies, for example, by transbronchial and endobronchial biopsies or surgical biopsies of kidney or lung tissue. If non-autologous cells are used, consideration should be given to selecting immunotype-matched cells to avoid organ or tissue rejection when transplanted into the subject.

[0213] In some cases, decellularized or artificial kidney or lung tissue matrices such as those provided herein can be seeded with cell types by perfusion seeding. For example, a flow perfusion system can be used to seed the decellularized kidney or lung tissue matrix via the vasculature preserved in the tissue matrix (e.g., via an arterial line). In some cases, an automated flow perfusion system can be used under appropriate conditions. Such perfusion seeding methods can improve seeding efficiency and provide a more uniform cell distribution throughout the composition. Quantitative biochemical and image analysis techniques can be used to assess the distribution of cells seeded according to either static or perfusion seeding methods.

[0214] In some cases, the tissue matrix can be impregnated with one or more growth factors to stimulate differentiation of the seeded regenerative cells. For example, the tissue matrix can be impregnated with growth factors appropriate for the methods and materials provided herein, such as vascular endothelial growth factor (VEGF), TGF-β growth factor, bone morphogenetic proteins (e.g., BMP-1, BMP-4), platelet-derived growth factor (PDGF), basic fibroblast growth factor (b-FGF), e.g., FGF-10, insulin-like growth factor (IGF), epidermal growth factor (EGF), or growth differentiation factor-5 (GDF-5). See, e.g., Desai and Cardoso, Respire. Res. 2002, 3:2. These growth factors can be encapsulated for controlled temporal release. Different portions of the scaffold can be enriched with different growth factors to add spatial control of growth factor stimulation. In some cases, the tissue matrix can be impregnated with extracellular matrix components (e.g., laminin, fibronectin, collagen, elastin) prior to seeding with the regenerative cells to support the attachment and proliferation of the regenerative cells. In some cases, the tissue matrix can be impregnated with isolated mitochondria prior to seeding with the regenerative cells to support the metabolism, attachment, and viability of the regenerative cells.

[0215] The seeded tissue matrix can be incubated for a period of time (e.g., several hours to about 14 days or more) after seeding to improve cell fixation and infiltration within the tissue matrix. The seeded tissue matrix can be maintained under conditions that allow at least a portion of the regenerative cells to proliferate and / or differentiate within and on the acellular tissue matrix. Such conditions include, but are not limited to, appropriate temperature (35-38°C) and / or pressure (e.g., atmospheric pressure), electrical and / or mechanical activity (e.g., positive or negative pressure ventilation with a positive end-expiratory pressure of 1-20 cmH2O, mean airway pressure of 5-50 cmH2O, and peak inspiratory pressure of 5-65 cmH2O), an appropriate amount of fluid, e.g., O2 (1-100% FiO2) and / or CO2 (0-10% FiCO2), an appropriate amount of humidity (10-100%), and sterile or near-sterile conditions. Such conditions also include wet ventilation, wet-to-dry ventilation, and dry ventilation. In some cases, nutritional supplements (e.g., nutrients and / or carbon sources such as glucose), exogenous hormones, or growth factors can be added to the seeded tissue matrix. Histological examination and cell staining can be performed to assess the proliferation of the seeded cells. Any suitable method can be performed to assess the differentiation of the seeded cells.

[0216] Thus, the methods described herein can be used to create implantable bioartificial organs or tissues, such as artificial kidneys or lungs, for implantation into a human subject. The transplantable organ or tissue will preferably retain a sufficiently intact vasculature to allow connection to the patient's vascular system.

[0217] IV. Methods of Treating a Subject Disclosed herein are methods for treating a pulmonary disease or disorder in a subject in need thereof, or for improving the function of a donor's lung before or after transplantation, comprising administering to the subject's or donor's lung a pharmaceutical composition comprising mesenchymal stem cells or endothelial progenitor cells pretreated with isolated mitochondria, or extracellular vesicles isolated from mesenchymal stem cells or endothelial progenitor cells. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject's or donor's lung. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject's or donor's lung. In some embodiments, the composition is administered to the subject by inhalation. In some embodiments, the composition is administered to the subject's or donor's lung via the pulmonary airway. In other embodiments, the composition is administered to the subject's or donor's lung by injection (e.g., intravenous, subcutaneous, intraperitoneal, and intramuscular injection). In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient.In preferred embodiments, the subject is a human subject.

[0218] Non-limiting examples of pharmaceutically acceptable carriers or excipients include respiratory buffers (e.g., buffers containing sucrose, glutamate, malate, succinate, and ADP); extracellular matrix components (e.g., laminin, fibronectin, collagen, elastin); organ or tissue preservation solutions (e.g., Euro-Collins solution); isotonic saline; water; balanced salt solutions; aqueous dextrose; polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.); and vegetable oils. Those skilled in the art can refer to the reference handbook "Handbook of Pharmaceutical Excipients", American Pharmaceutical Association, Pharmaceutical Press; 6th revised edition, 2009. Those skilled in the art can also select carriers or excipients from carriers and excipients known for pharmaceutical use to be compatible with the preparation of compositions intended for injection or inhalation. Dosage forms suitable for injectable use include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile infusion solutions or dispersions. In all cases, the dosage form can be fluid to the extent that easy syringability exists. Where necessary, various antibacterial and antifungal agents can be employed, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.

[0219] Non-limiting examples of active ingredients are treprostinil, antioxidants, antihistamines, immunomodulators, biological additives, analgesics, anesthetics, antibiotics, antifungals, UNEX-42, and anti-inflammatory agents. In certain embodiments, the active ingredient is an active pharmaceutical ingredient and exhibits a therapeutic effect.

[0220] Also disclosed herein are methods for treating a pulmonary disease or disorder in a subject in need thereof, or for improving the function of a donor's lung before or after transplantation, the methods comprising administering to the subject's or donor's lung (A) mesenchymal stem cells or endothelial progenitor cells, or extracellular vesicles isolated from mesenchymal stem cells or endothelial progenitor cells, and (B) isolated mitochondria, wherein (A) and (B) are contained in a single pharmaceutical composition or two separate pharmaceutical compositions. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject's or donor's lung. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject's or donor's lung. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the subject's or donor's lung via the pulmonary airway. In other embodiments, the composition is administered to the subject's or donor's lung by injection (e.g., intravenously, subcutaneously, intraperitoneally, intramuscularly). In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In preferred embodiments, the subject is a human subject.

[0221] Also disclosed herein is a method for treating a pulmonary disease or disorder in a subject in need thereof, the method comprising: (i) administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering a therapeutically effective amount of a drug for treating the pulmonary disease or disorder, wherein the composition is administered to the subject before, simultaneously with, or after administration of the drug for treating the pulmonary disease or disorder. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the subject by injection. In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In a preferred embodiment, the subject is a human subject.

[0222] Non-limiting examples of pulmonary diseases and disorders are pulmonary hypertension, bronchopulmonary dysplasia (BPD), pulmonary fibrosis, asthma, sleep-disordered breathing, or chronic obstructive pulmonary disease (COPD).

[0223] Non-limiting examples of pulmonary hypertension are pulmonary hypertension due to COPD, chronic thromboembolic pulmonary hypertension (CTEPH), pulmonary arterial hypertension (PAH), pulmonary veno-occlusive disease (PVOD), pulmonary capillary hemangiomatosis (PCH), persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary disease, chronic hypoxia, pulmonary hypertension due to chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

[0224] Non-limiting examples of drugs for treating pulmonary diseases or disorders, such as pulmonary hypertension, are treprostinil, epoprostenol, iloprost, bosentan, ambrisentan, macitentan, and sildenafil.

[0225] Also disclosed herein are methods for treating pulmonary hypertension in a subject in need thereof, the methods comprising: (i) administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering a therapeutically effective amount of treprostinil, wherein the composition is administered to the subject before, simultaneously with, or after administration of treprostinil. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the subject by injection. In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In a preferred embodiment, the subject is a human subject.

[0226] UNEX-42 is a preparation of extracellular vesicles secreted by human mesenchymal stem cells. Also disclosed herein are methods for treating a pulmonary disease or disorder in a subject in need thereof, or for improving the function of a donor's lung before or after transplantation, the methods comprising: (i) administering to the subject's or donor's lung a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering to the subject's or donor's lung a therapeutically effective amount of UNEX-42, wherein the composition is administered to the subject's or donor's lung before, simultaneously with, or after administration of UNEX-42. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the subject's or donor's lung via the pulmonary airways. In other embodiments, the composition is administered to the subject's or donor's lung by injection. In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In preferred embodiments, the subject is a human subject.

[0227] Also disclosed herein are methods for treating a pulmonary disease or disorder in a subject in need thereof, or for improving the function of a donor's lung before or after transplantation, the methods comprising: (i) administering a therapeutically effective amount of a composition comprising isolated mitochondria to the lungs of the subject or donor; and (ii) administering a therapeutically effective amount of an antioxidant to the lungs of the subject or donor, wherein the composition is administered to the lungs of the subject or donor before, simultaneously with, or after administration of the antioxidant. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In some embodiments, the antioxidant is n-acetylcysteine, tempol, or resveratrol. In some embodiments, the antioxidant is administered to the lungs of the subject or donor simultaneously with or as part of a composition comprising isolated mitochondria. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the lungs of the subject or donor via the pulmonary airways. In other embodiments, the composition is administered to the lungs of the subject or donor by injection. In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In a preferred embodiment, the subject is a human subject.

[0228] Also disclosed herein are methods for treating an acute exacerbation of a pulmonary disease or disorder in a subject, the method comprising administering to the subject an effective amount of a composition comprising isolated mitochondria for rescue therapy. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In preferred embodiments, the pulmonary disease or disorder is pulmonary hypertension, asthma, sleep-disordered breathing, BPD, COPD, or pulmonary fibrosis. In some embodiments, the pulmonary hypertension is neonatal pulmonary hypertension, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary disease, chronic hypoxia, pulmonary hypertension due to chronic arterial occlusion, or pulmonary hypertension with an unknown cause or multifactorial mechanism. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the subject by injection. In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In a preferred embodiment, the subject is a human subject.

[0229] Also disclosed herein are methods for treating acute kidney injury in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In some embodiments, administering a therapeutically effective amount of the composition reduces serum levels of one or more pro-inflammatory cytokines or pro-inflammatory mediators in the subject. In some embodiments, the one or more pro-inflammatory cytokines or pro-inflammatory mediators are selected from the group consisting of monocyte chemoattractant protein 1 (MCP1), C3A, and C5a. In some embodiments, administering a therapeutically effective amount of the composition reduces serum levels of kidney injury molecule-1 (KIM1) in the subject. In some embodiments, administering a therapeutically effective amount of the composition reduces blood urea nitrogen (BUN) levels in the subject. In some embodiments, administering a therapeutically effective amount of the composition reduces kidney weight in the subject.

[0230] Also disclosed herein are methods for treating a subject undergoing cardiac arrest or resuscitation, the methods comprising administering to the subject an effective amount of a composition comprising isolated mitochondria to facilitate the subject's transport to a medical facility or medical treatment. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the composition is administered to the subject by inhalation. In other embodiments, the composition is administered to the subject by injection. In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient. In a preferred embodiment, the subject is a human subject.

[0231] Also disclosed herein are methods for reducing inflammation in a subject in need thereof, the methods comprising (i) delivering isolated mitochondria to isolated hematopoietic cells from a subject, and (ii) administering the hematopoietic cells treated with the isolated mitochondria to the subject. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In preferred embodiments, the hematopoietic cells treated with the isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to corresponding hematopoietic cells not treated with the isolated mitochondria. In preferred embodiments, the subject is a human subject.

[0232] In some embodiments, the method further comprises introducing a transgene encoding at least one heterologous protein into the isolated hematopoietic cells prior to delivering the isolated mitochondria to the hematopoietic cells. In other embodiments, the method further comprises introducing a transgene encoding at least one heterologous protein into the isolated hematopoietic cells after delivering the isolated mitochondria to the hematopoietic cells.

[0233] In some embodiments, the isolated hematopoietic cells are bone marrow cells, bone marrow progenitor cells, or a combination thereof. In some embodiments, the hematopoietic cells are isolated from the peripheral blood of a subject. In some embodiments, the subject has been treated with a stem cell mobilizing agent prior to isolating the hematopoietic cells from the peripheral blood. In a preferred embodiment, the stem cell mobilizing agent is granulocyte colony-stimulating factor (G-CSF). In other embodiments, the hematopoietic cells are isolated from the bone marrow of a subject.

[0234] Techniques for isolating and enriching cell subsets from the blood or organ tissues of a subject are known in the art and include techniques such as flow cytometry, density centrifugation, and magnetic separation (see, e.g., Salvagno, C. and de Visser, KE, Methods Mol Biol. 2016; 1458:125-35, which is incorporated by reference in its entirety).

[0235] A variety of assays are available for determining protein (e.g., recombinant protein) levels and activity, including amplification / expression methods, immunohistochemistry, FISH, and shed antigen assays, Southern blotting, Western blotting, or PCR techniques. Additionally, protein expression or amplification can be assessed using in vivo diagnostic assays, for example, by administering a molecule (e.g., an antibody) that binds to the protein to be detected and is labeled with a detectable label (e.g., a radioisotope), and externally scanning the patient for label localization. That is, methods for measuring intracellular protein levels are known in the art and, where applicable, can be used to assess protein levels and / or activity in connection with the methods and compositions provided herein. These assays can be used to determine the effect of modifications to a recombinant protein encoded by a transgene. For example, these assays can be used to determine whether the modifications result in a transgene that is unable to produce normal levels or a fully functional gene product, or to identify a transgene containing a mutation of all or part of the recombinant protein.

[0236] In some embodiments, the method further comprises differentiating the isolated hematopoietic cells ex vivo prior to delivering the isolated mitochondria to the isolated hematopoietic cells. In other embodiments, the method further comprises differentiating the isolated hematopoietic cells ex vivo after delivering the isolated mitochondria to the isolated hematopoietic cells. In some embodiments, the isolated hematopoietic cells are differentiated ex vivo into macrophages having an M1 or M2 phenotype.

[0237] In a preferred embodiment, hematopoietic cells treated with isolated mitochondria have reduced expression of NF-κB compared to corresponding hematopoietic cells not treated with isolated mitochondria. In a particularly preferred embodiment, hematopoietic cells treated with isolated mitochondria have reduced secretion of pro-inflammatory cytokines and chemokines, such as MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, or any combination thereof, compared to corresponding hematopoietic cells not treated with isolated mitochondria.

[0238] In some embodiments, the isolated hematopoietic cells treated with isolated mitochondria are administered to a subject by injection. In some embodiments, the isolated hematopoietic cells treated with isolated mitochondria are administered to a subject as part of a microcarrier. In some embodiments, the microcarrier is preferably coated with a matrix having extracellular components. In some embodiments, the microcarrier is positively charged.

[0239] Non-limiting examples of myeloid cells or myeloid progenitor cells are monocytes, macrophages, neutrophils, hematopoietic stem cells, and myeloid progenitor cells.

[0240] V. Methods of Preserving Organs, Tissues, Limbs, or Other Body Parts Disclosed herein are methods for preserving tissues or organs for transport and transplantation, comprising delivering isolated mitochondria to a tissue or organ intended for transport and transplantation, wherein the tissue or organ is obtained from a deceased donor. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the deceased donor. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the deceased donor.

[0241] In some embodiments, the isolated mitochondria are delivered to the tissue or organ within 24 hours after the death of the donor. In other embodiments, the isolated mitochondria are delivered to the tissue or organ within 12 hours after the death of the donor. In other embodiments, the isolated mitochondria are delivered to the tissue or organ within 4 hours after the death of the donor.

[0242] In some embodiments, the method further comprises obtaining the tissue or organ from the deceased donor by harvesting the tissue or organ from the deceased donor. In some embodiments, the isolated mitochondria are delivered to the tissue or organ before harvesting the tissue or organ from the deceased donor. In other embodiments, the isolated mitochondria are delivered to the tissue or organ after harvesting the tissue or organ from the deceased donor. In some embodiments, the isolated mitochondria are delivered to the tissue or organ by injection. In some embodiments, the tissue or organ is a heart, liver, lung, blood vessel, ureter, trachea, skin patch, or kidney. In a preferred embodiment, the tissue or organ is a human tissue or organ.

[0243] In a preferred embodiment, the tissue or organ is the lung. In some embodiments, the isolated mitochondria are delivered to the lung via the airway, via a vein, or via an artery. In other embodiments, the isolated mitochondria are delivered to the lung during EVLP. In a particularly preferred embodiment, the lung is a human lung. In another preferred embodiment, the tissue or organ is the kidney. In some embodiments, the isolated mitochondria are delivered to the kidney via a vein or via an artery.

[0244] Also disclosed herein are methods for preserving a limb or other body part lost by traumatic amputation, the methods comprising delivering isolated mitochondria to the limb or other body part after traumatic amputation of the limb or other body part. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the limb or other body part. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the limb or other body part. In some embodiments, the isolated mitochondria are delivered to the amputated limb or other body part within 15 minutes, 30 minutes, 1 hour, 4 hours, 8 hours, 12 hours, or 24 hours after traumatic amputation. In some embodiments, the isolated mitochondria are delivered to the amputated limb or other body part by injection. In a preferred embodiment, the limb or other body part is a human limb or other body part.

[0245] VI. Methods for Improving Cellular Function and Cellular Therapy Disclosed herein are methods for improving cellular function of isolated cells, the methods comprising delivering isolated mitochondria to the isolated cells. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the isolated cells. In preferred embodiments, the cells treated with the isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to corresponding cells not treated with the isolated mitochondria.

[0246] In preferred embodiments, the isolated cells are human cells. In particularly preferred embodiments, the isolated cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), immune cells (e.g., hematopoietic cells), mesenchymal cells, pericytes, and any combination thereof.

[0247] In some embodiments, cells treated with isolated mitochondria exhibit increased extracellular vesicle secretion compared to corresponding cells not treated with isolated mitochondria. In some embodiments, cells treated with isolated mitochondria exhibit altered extracellular vesicle composition compared to corresponding cells not treated with isolated mitochondria. In preferred embodiments, the altered extracellular vesicle composition is altered in terms of protein content, nucleic acid content, lipid content, or any combination thereof.

[0248] In some embodiments, this method further comprises, before the step of delivering isolated mitochondria into isolated cells, introducing a transgene that encodes at least one heterologous protein into the isolated cells.In other embodiments, this method comprises, after the step of delivering isolated mitochondria into isolated cells, introducing a transgene that encodes at least one heterologous protein into the isolated cells.In a preferred embodiment, the heterologous protein is secreted from cells into extracellular vesicles.

[0249] In some embodiments, cells treated with isolated mitochondria exhibit reduced cell apoptosis, increased cell viability, reduced autophagy, reduced mitophagy, reduced senescence, reduced mitochondrial stress signaling, reduced cell injury, reduced cell inflammation, reduced reactive oxygen species production, increased cell barrier function, increased angiogenesis, increased cell adhesion, increased proliferation rate, or any combination thereof, compared to corresponding cells not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with reduced TLR9 expression, altered HO-1 expression, reduced cytosolic mtDNA, or any combination thereof. In some embodiments, the altered HO-1 expression is increased HO-1 expression after exposure to cold. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof. In preferred embodiments, the reduced cell apoptosis is associated with reduced expression of pro-apoptotic markers. In particularly preferred embodiments, the reduction in cell apoptosis is associated with decreased expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof. In preferred embodiments, the reduction in cell apoptosis is associated with increased expression of anti-apoptotic markers. In particularly preferred embodiments, the reduction in cell apoptosis is associated with increased expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, MCL-1, or any combination thereof.

[0250] In some embodiments, cells treated with isolated mitochondria exhibit increased glucose uptake and decreased lactate production compared to corresponding cells not treated with isolated mitochondria, hi preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof.

[0251] In preferred embodiments, the cells treated with isolated mitochondria have improved cell adhesion and proliferation rate on two-dimensional or three-dimensional cell supports compared with the corresponding cells not treated with isolated mitochondria.In some embodiments, the two-dimensional or three-dimensional cell supports are microcarriers.In some embodiments, the two-dimensional or three-dimensional cell supports comprise one or more extracellular matrix components.

[0252] In a preferred embodiment, cells treated with isolated mitochondria maintain viability during cold ischemia or cryopreservation longer than corresponding cells not treated with isolated mitochondria.

[0253] Non-limiting examples of isolated cells include epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), skeletal muscle cells, cardiac muscle cells, hepatocytes, immune cells (e.g., hematopoietic lineage cells), mesenchymal cells, pericytes, neural cells, and any combination thereof.

[0254] Also disclosed herein are methods for improving cell therapy in a subject in need thereof, the methods comprising (i) delivering isolated mitochondria to isolated cells in vitro, and (ii) administering the cells treated with the isolated mitochondria to the subject. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the subject. In some embodiments, the method further comprises isolating autologous cells from the subject prior to the step of delivering the isolated mitochondria to the isolated cells in vitro. In preferred embodiments, the cells treated with the isolated mitochondria have improved mitochondrial function by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%, compared to corresponding cells not treated with the isolated mitochondria. In preferred embodiments, the subject is a human subject.

[0255] In some embodiments, the isolated cells are allogeneic cells. In other embodiments, the isolated cells are autologous cells. In preferred embodiments, the isolated cells are human cells. In particularly preferred embodiments, the isolated cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), skeletal muscle cells, cardiac myocytes, hepatocytes, immune cells (e.g., hematopoietic cells), mesenchymal cells, pericytes, neural cells, or any combination thereof.

[0256] In some embodiments, cells treated with isolated mitochondria exhibit increased extracellular vesicle secretion compared to corresponding cells not treated with isolated mitochondria. In some embodiments, cells treated with isolated mitochondria exhibit altered extracellular vesicle composition compared to corresponding cells not treated with isolated mitochondria. In preferred embodiments, the altered extracellular vesicle composition is altered in terms of protein content, nucleic acid content, lipid content, or any combination thereof.

[0257] In some embodiments, this method further comprises, before the step of delivering isolated mitochondria into isolated cells, introducing a transgene that encodes at least one heterologous protein into the isolated cells.In other embodiments, this method further comprises, after the step of delivering isolated mitochondria into isolated cells, introducing a transgene that encodes at least one heterologous protein into the isolated cells.In a preferred embodiment, the heterologous protein is secreted from cells in extracellular vesicles.

[0258] In some embodiments, the isolated mitochondria-treated cells are administered to a subject by injection. In other embodiments, the isolated mitochondria-treated cells are administered to a subject via the airway. In some embodiments, the isolated mitochondria-treated cells are administered to a subject as part of a microcarrier.

[0259] In some embodiments, the treated cells exhibit reduced cell apoptosis, increased cell viability, reduced autophagy, reduced mitophagy, reduced senescence, reduced mitochondrial stress signaling, reduced reactive oxygen species production, reduced cell injury, reduced cell inflammation, increased cell barrier function, increased angiogenesis, increased cell adhesion, increased proliferation rate, or any combination thereof, compared to corresponding cells not treated with isolated mitochondria. In preferred embodiments, the reduced cell injury is associated with reduced TLR9 expression, altered HO-1 expression, reduced cytosolic mtDNA, or any combination thereof. In some embodiments, the altered HO-1 expression is increased HO-1 expression after exposure to cold. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell injury is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof. In preferred embodiments, the reduced cell apoptosis is associated with reduced expression of pro-apoptotic markers. In particularly preferred embodiments, the reduction in cell apoptosis is associated with decreased expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof. In preferred embodiments, the reduction in cell apoptosis is associated with increased expression of anti-apoptotic markers. In particularly preferred embodiments, the reduction in cell apoptosis is associated with increased expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, MCL-1, or any combination thereof.

[0260] In some embodiments, the treated cells have increased glucose uptake and decreased lactate production compared to corresponding cells not treated with isolated mitochondria. In preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof, by at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 80%.

[0261] In preferred embodiments, the cells treated with isolated mitochondria have improved cell adhesion and proliferation rate on two-dimensional or three-dimensional cell supports compared with the corresponding cells not treated with isolated mitochondria.In some embodiments, the two-dimensional or three-dimensional cell supports are microcarriers.In some embodiments, the two-dimensional or three-dimensional cell supports comprise one or more extracellular matrix components.

[0262] In a preferred embodiment, cells treated with isolated mitochondria maintain viability longer in cold ischemia than corresponding cells not treated with isolated mitochondria.

[0263] VII. Methods for improving cold transport, shipping, and storage of isolated cells Also disclosed herein are methods for improving cold transport, cold shipping, or cold storage of isolated cells, the methods comprising delivering isolated mitochondria to isolated cells before, during, or after cold transport, cold shipping, or cold storage, wherein the cells treated with the isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved viability compared to corresponding cells not treated with the isolated mitochondria. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria that are allogeneic to the cells. In some embodiments, the isolated mitochondria are isolated human mitochondria that are autologous to the cells. In preferred embodiments, the cells treated with the isolated mitochondria have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to corresponding cells not treated with the isolated mitochondria. In preferred embodiments, the isolated cells are human cells. In particularly preferred embodiments, the isolated cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), immune cells (e.g., hematopoietic cells), mesenchymal cells, or pericytes.

[0264] In preferred embodiments, cells treated with isolated mitochondria have reduced production of ROS-mediated oxidative by-products, improved cell viability, reduced necrosis, reduced cell lysis, increased total cellular ATP levels, reduced secretion of inflammatory cytokines, or any combination thereof, compared to corresponding cells not treated with isolated mitochondria. In some embodiments, the inflammatory cytokines include IL-6, IL-8, and IFN-γ. In some embodiments, the ROS-mediated oxidative by-products include 4-HNE and 8-OHdG.

[0265] In some embodiments, the method further comprises cryopreserving the isolated mitochondria-treated human cells. In preferred embodiments, the isolated mitochondria-treated human cells are cryopreserved by step-down liquid nitrogen freezing. In some embodiments, the isolated mitochondria-treated cells are maintained in a solution containing lipids, proteins, sugars, oligosaccharides, polysaccharides, or any combination thereof. In preferred embodiments, the isolated mitochondria-treated cells are maintained in a solution containing trehalose, sucrose, glycerol, PlasmaLyte, CryoStor, dimethyl sulfoxide, lipids, glutamic acid, PEG, PVA, albumin, or any combination thereof. In particularly preferred embodiments, the isolated mitochondria are present in this solution. The isolated mitochondria can be delivered to the human cells before the step of cryopreserving the human cells, during the step of cryopreserving the human cells, upon thawing from cryopreservation, or any combination thereof.

[0266] In some embodiments, the isolated cells are allogeneic cells. In other embodiments, the isolated cells are autologous cells. In preferred embodiments, the isolated cells are human cells. In particularly preferred embodiments, the isolated cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), skeletal muscle cells, cardiac myocytes, hepatocytes, immune cells (e.g., hematopoietic cells), mesenchymal cells, pericytes, neural cells, or any combination thereof.

[0267] VIII. Preservation Methods for Isolated Mitochondria Disclosed herein are methods for cryopreserving isolated mitochondria, such as porcine mitochondria, comprising freezing the isolated mitochondria in a freezing buffer containing a cryoprotectant. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria. In some embodiments, the method further comprises isolating mitochondria from cells or tissues. In some embodiments, the cryoprotectant is a lipid, protein, sugar, disaccharide, oligosaccharide, polysaccharide, or any combination thereof. In some embodiments, the isolated mitochondria are stored at physiological pH using an isotonic buffer, optionally containing a polypeptide, protein, or other agent to maintain the integrity of the mitochondrial membrane. For example, the cryopreservation buffer can have a pH between 7.0 and 7.5, such as about 7.2, 7.35, or 7.4. In preferred embodiments, the cryoprotectant is trehalose, sucrose, glycerol, PlasmaLyte, CryoStor, DMSO, glutamic acid, PEG, PVA, albumin, or any combination thereof. In some embodiments, isolated mitochondria are cryopreserved by freezing in reduced pressure liquid nitrogen. In some embodiments, trehalose or other cryoprotectant can be present in an amount of 100-500 mM, 200-400 mM, 250-350 mM, or 275-325 mM. Mitochondria can be kept at temperatures below -20°C, below -40°C, below -60°C, below -70°C, or below -80°C.

[0268] In some embodiments, the method further comprises thawing the frozen isolated mitochondria and assessing the health and / or function of the thawed isolated mitochondria by measuring one or more of mitochondrial swelling, mitochondrial permeability transition pore (mPTP) opening, mitochondrial respiration, mitochondrial membrane potential, complete mitochondrial permeability, and mitochondrial swelling. In some preferred embodiments, the mitochondria are porcine mitochondria. In other embodiments, the method further comprises thawing the frozen isolated mitochondria and assessing the health and / or function of the frozen isolated mitochondria by scoring the overall morphology of the mitochondria and / or measuring the average size of the mitochondria. In some embodiments, the thawed isolated mitochondria can be classified based on predefined criteria using techniques such as flow cytometry, such as isolating only healthy and / or functional mitochondria.

[0269] Also disclosed herein are methods for long-term storage of isolated mitochondria, such as porcine mitochondria, comprising: (i) isolating mitochondria from cells or tissues; (ii) suspending the isolated mitochondria in a cryopreservation buffer; (iii) freezing the isolated mitochondria in the cryopreservation buffer at a temperature of about -70°C to about -100°C; and (iv) maintaining the frozen isolated mitochondria at a temperature of about -70°C to about -100°C for 24 hours or more. In some embodiments, the isolated mitochondria are isolated porcine mitochondria. In some embodiments, the isolated mitochondria are isolated human mitochondria.

[0270] In some embodiments, the method comprises freezing isolated mitochondria in a cryopreservation buffer at a temperature of about -70°C to about -100°C and maintaining the frozen isolated mitochondria at a temperature of about -70°C to about -100°C for at least 24 hours. In a preferred embodiment, the isolated mitochondria in the cryopreservation buffer are frozen at a temperature of about -75°C to about -95°C, wherein the frozen isolated mitochondria are maintained at a temperature of about -75°C to about -95°C. In a particularly preferred embodiment, the isolated mitochondria in the cryopreservation buffer are frozen at a temperature of about -80°C to about -90°C, and the frozen isolated mitochondria are maintained at a temperature of about -80°C to about -90°C. In some embodiments, the cryopreservation buffer comprises trehalose, sucrose, glycerol, CryoStor, or any combination thereof. In a preferred embodiment, the cryopreservation buffer is isotonic and has a pH of about 7.0 to about 7.5. In a particularly preferred embodiment, the cryopreservation buffer is isotonic and has a pH of about 7.2. In a particularly preferred embodiment, the cryopreservation buffer contains trehalose. In a particularly preferred embodiment, the cryopreservation buffer contains 300 mM trehalose, 10 mM HEPES, 10 mM KCl, 1 mM EGTA, and 0.1% fatty acid-free BSA. In some embodiments, the frozen isolated mitochondria are maintained at the temperature for one week or more. In some embodiments, the frozen isolated mitochondria are maintained at the temperature for one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, or more. In some embodiments, the method further includes (v) thawing the frozen isolated mitochondria, and (vi) assessing the health and / or function of the thawed isolated mitochondria by measuring one or more of mitochondrial swelling, mitochondrial permeability transition pore (mPTP) opening, mitochondrial respiration, mitochondrial membrane potential, complete mitochondrial permeability, and mitochondrial swelling.In some embodiments, the method further comprises (v) thawing the frozen isolated mitochondria, (vi) assessing the health of the thawed isolated mitochondria by measuring mitochondrial swelling using flow cytometry, and (vi) isolating healthy mitochondria from mitochondria with a swelling phenotype using flow cytometry-assisted cell sorting. In other embodiments, the method further comprises (v) thawing the frozen isolated mitochondria, and (vi) assessing the health of the thawed isolated mitochondria by scoring the overall mitochondrial morphology and / or measuring the average mitochondrial size. In some preferred embodiments, the mitochondria are porcine mitochondria.

[0271] IX. Methods for detecting pig mitochondria in human cells Disclosed herein is a method for detecting pig mitochondria in a human cell, tissue, or organ sample, the method comprising detecting the presence of a nucleic acid marker in a human cell, tissue, or organ sample in vitro or ex vivo, wherein the nucleic acid marker comprises a sequence of mitochondrial DNA or RNA, and the nucleic acid marker is present in pig mitochondria and absent from human mitochondria. In a preferred embodiment, the method further comprises quantifying the amount of the nucleic acid marker in the human cell, tissue, or organ sample.

[0272] In some embodiments, this method further comprises amplifying nucleic acid markers by polymerase chain reaction (PCR).In some embodiments, the presence of nucleic acid markers is detected by PCR using a primer pair, wherein at least one primer of the primer pair specifically hybridizes with the nucleic acid marker.In other embodiments, the presence of nucleic acid markers is detected using a nucleic acid probe that specifically hybridizes with the nucleic acid marker.

[0273] X. Compositions Comprising Human Cells with Exogenous Mitochondria Disclosed herein is a composition comprising human cells, wherein the cytosol of the human cells comprises exogenous mitochondria, wherein the human cells of the composition have at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100% improved mitochondrial function compared to corresponding human cells lacking exogenous mitochondria, and the improved mitochondrial function is an increase in oxygen consumption rate and / or ATP synthesis of at least 1%, or at least 2%, or at least 5%, or at least 10%, or at least 20%, or at least 50%, or at least 100%. In some embodiments, the exogenous mitochondria are porcine mitochondria. In some embodiments, the exogenous mitochondria are allogeneic human mitochondria to the human cells. In some embodiments, the exogenous mitochondria are derived from porcine heart. In some embodiments, the human cells are epithelial cells (e.g., type I pneumocytes, type II pneumocytes, small and large airway epithelial cells), endothelial cells (e.g., human pulmonary artery endothelial cells (HPAECs)), fibroblasts, progenitor cells (e.g., endothelial progenitor cells and mesenchymal stem cells), smooth muscle cells (e.g., pulmonary artery smooth muscle cells), skeletal muscle cells, cardiomyocytes, hepatocytes, immune cells (e.g., hematopoietic cells), mesenchymal cells, pericytes, neural cells, or any combination thereof.

[0274] In some embodiments, the human cells have increased extracellular vesicle secretion compared to corresponding human cells lacking exogenous mitochondria. In some embodiments, the human cells have altered extracellular vesicle composition compared to corresponding human cells lacking exogenous mitochondria. In preferred embodiments, the altered extracellular vesicle composition is altered in terms of protein content, nucleic acid content, lipid content, or any combination thereof.

[0275] In some embodiments, the human cell further comprises a transgene encoding at least one heterologous protein. In some embodiments, the transcription of the transgene occurs in the nucleus of the human cell. In some embodiments, the transgene is stably integrated into the nuclear DNA of the human cell. In a preferred embodiment, the heterologous protein is secreted from the human cell in extracellular vesicles. In other embodiments, the transcription of the transgene occurs in exogenous mitochondria. In some embodiments, the transgene is stably integrated into the mitochondrial DNA (mtDNA) of the exogenous mitochondria.

[0276] In a preferred embodiment, the human cells maintain viability in cold ischemia or cryopreservation longer than corresponding human cells lacking exogenous mitochondria.

[0277] In preferred embodiments, the human cells exhibit reduced cell apoptosis, increased cell viability, reduced autophagy, reduced mitophagy, reduced senescence, reduced mitochondrial stress signaling, reduced reactive oxygen species production, reduced cell inflammation, reduced cell damage, increased cell adhesion, increased cell barrier function, increased angiogenesis, increased proliferation rate, or any combination thereof, compared to corresponding human cells lacking exogenous mitochondria. In particularly preferred embodiments, the reduced cell damage is associated with reduced TLR9 expression, altered HO-1 expression, reduced cytosolic mtDNA, or any combination thereof. In some embodiments, the altered HO-1 expression is increased HO-1 expression after exposure to cold. In preferred embodiments, the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell damage is associated with reduced expression of NF-κB, MAPK14, JNK, or p53. In preferred embodiments, the reduced cell apoptosis is associated with reduced expression of pro-apoptotic markers. In particularly preferred embodiments, the reduction in cell apoptosis is associated with decreased expression of pro-apoptotic initiators (BIM, PUMA), pro-apoptotic effectors (BAX, BAK), apoptosis inducers (SMAC, DIABLO, BID, BAD, etc.), or any combination thereof. In preferred embodiments, the reduction in cell apoptosis is associated with increased expression of anti-apoptotic markers. In particularly preferred embodiments, the reduction in cell apoptosis is associated with increased expression of BCL-2, BCL-XL, BCL-W, A1 / BFL-1, MCL-1, or any combination thereof.

[0278] In some embodiments, the human cells have increased glucose uptake and decreased lactate production compared to corresponding human cells not treated with exogenous mitochondria, hi preferred embodiments, the increased glucose uptake and decreased lactate production are associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof.

[0279] In a preferred embodiment, the human cells have improved cell adhesion and proliferation rate on two-dimensional or three-dimensional cell supports compared to corresponding human cells that lack exogenous mitochondria.In some embodiments, the composition further comprises a two-dimensional or three-dimensional cell support.In some embodiments, the two-dimensional or three-dimensional cell support is a microcarrier.In some embodiments, the two-dimensional or three-dimensional cell support comprises one or more extracellular matrix components.

[0280] In some embodiments, the composition further comprises at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the composition further comprises at least one active ingredient.

[0281] The isolated polypeptides and recombinant proteins described herein can be produced by any suitable method known in the art. Such methods range from direct protein synthesis to constructing DNA sequences encoding the isolated polypeptide sequences and expressing these sequences in a suitable transformed host. In some embodiments, DNA sequences are constructed by isolating or synthesizing a DNA sequence encoding a wild-type protein of interest using recombinant techniques. Optionally, the sequence can be mutagenized by site-directed mutagenesis to provide a functional analog thereof. See, e.g., Mark, D.F., et al., Proc Natl Acad Sci USA. 1984 Sep;81(18):5662-6 and U.S. Pat. No. 4,588,585, incorporated herein by reference in its entirety.

[0282] DNA sequences (e.g., transgenes) encoding one or more polypeptides of interest (e.g., recombinant proteins) can be constructed by chemical synthesis using an oligonucleotide synthesizer. Such oligonucleotides can be designed based on the amino acid sequence of the desired polypeptide, and codons preferred in the host cell in which the polypeptide of interest will be produced are selected. Standard methods can be applied to synthesize isolated polynucleotide sequences encoding isolated polypeptides of interest. For example, the complete amino acid sequence can be used to construct a reverse-translated gene. Additionally, DNA oligomers containing nucleotide sequences encoding specific isolated polypeptides can be synthesized. For example, several small oligonucleotides encoding portions of the desired polypeptide can be synthesized and then ligated. Individual oligonucleotides usually contain 5' or 3' overhangs for complementary assembly.

[0283] Once assembled (by synthesis, site-directed mutagenesis, or otherwise), a polynucleotide sequence encoding a particular isolated polypeptide of interest is inserted into an expression vector and operably linked to expression control sequences appropriate for expression of the protein in a desired host. Proper assembly can be confirmed by nucleotide sequencing, restriction mapping, and expression of a biologically active polypeptide in a suitable host. As is known in the art, to obtain high expression levels of a transfected gene in a host, the gene can be operably linked to transcriptional and translational expression control sequences that are functional in the selected expression host.

[0284] In certain embodiments, recombinant expression vectors can be used to amplify and express DNA (e.g., transgenes) encoding one or more polypeptides of interest (e.g., recombinant proteins). A recombinant expression vector is a replicable DNA construct containing a synthetic or cDNA-derived DNA fragment encoding a polypeptide of interest operably linked to appropriate transcriptional or translational regulatory elements derived from mammalian, microbial, viral, or insect genes. A transcription unit generally comprises an assembly of (1) one or more genetic elements that have a regulatory role in gene expression, such as a transcriptional promoter or enhancer; (2) a structural or coding sequence that is transcribed into mRNA and translated into protein; and (3) appropriate transcriptional and translational start and stop sequences, as described in detail below. Such regulatory elements can include an operator sequence to control transcription. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants can additionally be incorporated. DNA regions are operably linked when they are functionally related to each other. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor that participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned to permit translation. Structural elements intended for use in yeast expression systems include a leader sequence that enables extracellular secretion of translated protein by the host cell. Alternatively, if the recombinant protein is expressed without a leader or transport sequence, it can include an N-terminal methionine residue. This residue can then, optionally, be cleaved from the expressed recombinant protein to provide the final product.

[0285] The choice of expression control sequence and expression vector will depend on the choice of host. A wide variety of expression host / vector combinations can be used. Useful expression vectors for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus, and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids such as E. coli-derived plasmids including pCR1, pBR322, pMB9, and their derivatives, broader host range plasmids such as M13, and filamentous single-stranded DNA phages.

[0286] Suitable host cells for expressing one or more polypeptides of interest include prokaryotes, yeast, insect, or higher eukaryotic cells under the control of a suitable promoter. Prokaryotes include gram-negative or gram-positive bacteria, such as Escherichia coli or Bacillus. Higher eukaryotic cells include established cell lines of mammalian origin, as described below. Cell-free translation systems can also be used. Suitable cloning and expression vectors for use in bacterial, fungal, yeast, and mammalian cell hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, NY, 1985), the relevant disclosures of which are incorporated herein by reference. Additional information regarding protein production methods can be found, for example, in U.S. Patent Publication No. 2008 / 0187954, U.S. Patent Nos. 6,413,746 and 6,660,501, and International Patent Publication No. WO04009823, each of which is incorporated herein by reference in its entirety.

[0287] Proteins produced by transformed hosts can be purified according to any appropriate method. Such standard methods include chromatography (e.g., ion exchange, affinity, and size column chromatography), gradients, centrifugation, differential solubility, or other standard techniques for protein purification. Proteins can be conjugated to affinity tags, such as hexahistidine, maltose-binding domain, influenza coat sequence, or glutathione-S-transferase, and purified by passage through an appropriate affinity column. Isolated proteins can also be physically characterized using techniques such as proteolysis, nuclear magnetic resonance, and X-ray crystallography.

[0288] In certain embodiments of the present invention, cells harboring at least one integrative or non-integrative vector can be identified in vitro by including a reporter gene in the expression vector. Generally, a selectable reporter is one that confers a selectable property. A positive selectable reporter is one in which the presence of the reporter gene allows its selection, while a negative selectable reporter is one in which its presence prevents its selection. Examples of positive selectable markers are drug resistance markers (genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin, and histidinol). Other types of reporters include screenable reporters such as GFP.

[0289] A variety of assays are available for determining protein (e.g., recombinant protein) levels and activity, such as amplification / expression methods, immunohistochemistry, FISH and shed antigen assays, Southern blotting, Western blotting, or PCR techniques. Additionally, protein expression or amplification can be assessed using in vivo diagnostic assays, for example, by administering a molecule (e.g., an antibody) that binds to the protein to be detected and is labeled with a detectable label (e.g., a radioisotope), and externally scanning the patient to determine the location of the label. Thus, methods for measuring intracellular protein levels are known in the art and, where applicable, can be used to assess protein levels and / or activity in connection with the methods and compositions provided herein. These assays can be used to determine the effect of modifications to a recombinant protein encoded by a transgene. For example, these assays can be used to determine whether the modifications result in a transgene that is unable to produce normal levels or a fully functional gene product, or to identify a transgene containing a mutation of all or part of the recombinant protein.

[0290] Upon formulation, aqueous solutions for parenteral administration will be administered in a manner compatible with the dosage formulation, and in such amount as is therapeutically or prophylactically effective. If necessary, the solution should be suitably buffered, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous administration. In this connection, employable sterile aqueous vehicles will be known to those of skill in the art in light of the present disclosure.

[0291] Appropriate dosages of cells, mitochondria, or additional active agents of the compositions described herein will depend on: the type of disease, pathological condition, or disorder being treated; the severity and course of the disease, pathological condition, or disorder; the responsiveness of the disease, pathological condition, or disorder to previous treatments; the subject's medical history; etc. The compositions can be administered once, or over a series of treatments lasting from several days to several months, or until a cure is effected or a diminution of the disease state, pathological condition, or disorder is achieved.

[0292] Stem cells according to certain embodiments of the present invention can be cultured and maintained in an essentially undifferentiated state using defined feeder-independent culture systems, such as TeSR medium (Ludwig et al., Nat. Biotechnol. 2006, 24(2):185-7 and Ludwig et al., Nat. Methods 2006, 3(8):637-46). Feeder-independent culture systems and media can be used to culture stem cells. These approaches allow the stem cells to grow in an essentially undifferentiated state without the need for a "feeder layer" of mouse fibroblasts.

[0293] The cell culture medium for culturing cells according to certain embodiments of the present invention can be prepared using, as its basal medium, a medium used for culturing animal cells, such as TeSR, BME, BGJb, CMRL1066, Glasgow MEM, Improved MEM Zinc Option, IMDM, Medium 199, Eagle's MEM, αMEM, DMEM, Ham's, RPMI1640, and Fisher's Medium, and any combination thereof, but is not particularly limited thereto, as long as it can be used to culture animal cells. In particular, the medium can be xeno-free or chemically defined.

[0294] The cell culture medium may be a serum-containing medium or a serum-free medium. A serum-free medium refers to a medium that does not contain untreated or unpurified serum, and therefore may include a medium containing purified blood-derived components or animal tissue-derived components (e.g., growth factors). To prevent contamination with components derived from other animals, the serum may be derived from the same animal as the stem cells.

[0295] The cell culture medium may or may not contain a serum substitute. Serum substitutes may include materials that suitably contain albumin (lipid-rich albumin, albumin substitutes, e.g., recombinant albumin, plant starch, dextran, and protein hydrolysates), transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolglycerol, human plasma lysate, or equivalents thereof. Serum substitutes may be prepared, for example, by methods disclosed in WO 98 / 30679. Alternatively, commercially available materials may be used for greater convenience. Commercially available materials include Knockout Serum Replacer (KSR), Chemically Defined Lipid Concentrate (Gibco), and Glutamax (Gibco).

[0296] The cell culture medium may also contain fatty acids or lipids, glucose, amino acids (such as non-essential amino acids), vitamins, growth factors, cytokines, antioxidants, 2-mercaptoethanol, pyruvic acid, buffering agents, and inorganic salts. The concentration of 2-mercaptoethanol may be, for example, about 0.05 to 1.0 mM, particularly about 0.1 to 0.5 mM, but is not particularly limited thereto as long as it is suitable for culturing stem cells.

[0297] Culture vessels used to culture cells according to certain aspects of the present invention can include, but are not limited to, flasks, tissue culture flasks, dishes, petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, multi-plates, multi-well plates, microslides, chamber slides, tubes, trays, CellSTACK™, chambers, culture bags, and roller bottles, so long as stem cells can be cultured therein. Cells can be cultured in volumes of at least or about 0.2, 0.5, 1, 2, 5, 10, 20, 30, 40, 50 ml, 100 ml, 150 ml, 200 ml, 250 ml, 300 ml, 350 ml, 400 ml, 450 ml, 500 ml, 550 ml, 600 ml, 800 ml, 1000 ml, 1500 ml, or any range derivable therein, depending on the needs of the culture. In certain embodiments, the culture vessel can be a bioreactor, which can refer to any apparatus or system that supports a biologically active environment. The bioreactor can have a volume of at least or about 2, 4, 5, 6, 8, 10, 15, 20, 25, 50, 75, 100, 150, 200, 500 liters, 1, 2, 4, 6, 8, 10, 15 cubic meters, or any range derivable therein.

[0298] The culture vessel may be cell-adhesive or non-adhesive, and is selected depending on the purpose. The cell-adhesive culture vessel may be coated with any substrate for cell adhesion, such as an extracellular matrix (ECM), to improve the adhesion of the vessel surface to cells. The substrate for cell adhesion may be any material intended to attach cells. Cell adhesion substrates include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, and fibronectin, as well as fragments or mixtures thereof.

[0299] Cells according to certain embodiments of the present invention may also be cultured by suspension culture, including suspension culture on a carrier (Fernandes et al., Nature Cell Biology, 2004; 6:1082-93) or by gel / biopolymer encapsulation (U.S. Patent Publication No. 2007 / 0116680). The term suspension culture of cells means that the cells are cultured under non-adherent conditions with respect to the culture vessel or feeder cells (if used) in the medium.

[0300] The various approaches described herein can be used with the present invention to differentiate stem cells into cells or cell lineages, including but not limited to keratinocytes, hematopoietic cells, muscle cells, fibroblasts, epithelial cells, and epidermal cells, and tissues or organs derived therefrom. [Example]

[0301] It is understood that the examples and embodiments disclosed herein are for illustrative purposes only, and that various modifications or changes in light thereof will be suggested to those skilled in the art, which are to be included within the spirit and scope of the present application.

[0302] Example 1 Treatment of cells with porcine mitochondria improves oxygen consumption rates after short- and long-term exposure to cold. To isolate porcine mitochondria, the entire left ventricle was removed from a freshly excised porcine heart and placed in ice-cold wash medium (300 mM sucrose, 1 mM EGTA, 10 mM Hepes, pH 7.4) for transport. A 1-inch square piece of tissue was cut from the left ventricle and transferred to a pre-chilled 50 ml conical tube containing 20 ml of ice-cold trehalose buffer. The tissue sample was finely minced to obtain pieces approximately 1-2 mm in size. The sample was enzymatically digested on ice in subtilisin A solution (5 mg / ml subtilisin A in 250 µl of trehalose buffer) for 10 min and homogenized (3-7 passes) using a Potter-Elvehjem pattern tissue homogenizer. The sample was then passed through gauze and placed in a 50 ml conical tube. The samples were centrifuged (500g for 10 minutes at 4°C) and the supernatant was decanted into a new 50mL conical tube. The samples were centrifuged at 15,000g for 10 minutes at 4°C. The supernatant was discarded. The sample pellet was resuspended in 500µl of trehalose buffer and transferred to a 1.5mL Eppendorf tube. The 50mL conical tube was then rinsed with 500µl of trehalose buffer, which was added to the sample in the 1.5mL Eppendorf tube. The sample pellet was washed three times by centrifugation (15,000g for 10 minutes at 4°C) and resuspended in 1mL of trehalose buffer.

[0303] It has previously been shown that oxygen consumption rate (OCR), an indicator of mitochondrial respiration, can be measured in real time in living cells using the Seahorse assay with a Seahorse Extracellular Flux (XF) analyzer (Seahorse Bioscience, Inc., North Billerica, MA). See Rose, S., et al., PLOS One (2014), 9(1):e85436 (“Rose et al.”), which is incorporated herein by reference in its entirety. Rose et al. showed that treating cells with specific inhibitors can provide multiple measures of mitochondrial respiration, such as basal respiration, ATP-coupled respiration, proton leak respiration, and spare capacity (herein). In particular, cells can be treated with oligomycin, an inhibitor of complex V, to obtain ATP-coupled respiration and proton leak respiration. The protonophore carbonyl cyanide-p-trifluoromethoxyphenyl-hydrazone (FCCP) collapses the gradient across the inner mitochondrial membrane, allowing the electron transport chain (ETC) to function at its maximum rate (herein). Thus, maximal respiratory capacity can be determined by treating cells with FCCP (herein). Non-mitochondrial respiration can be measured by treating cells with a combination of the complex I inhibitor rotenone and the complex III inhibitor antimycin A, effectively shutting down ETC function.

[0304] The effect of treatment of human pulmonary artery endothelial cells (HPAECs) with isolated porcine mitochondria on oxygen consumption rate (OCR) after brief cold exposure was determined using the Seahorse assay. HPAECs were placed at 4°C for 6 h. HPAECs were allowed to recover in normoxia at 37°C for 1 h in the presence of 20 μL of mitochondrial suspension (29 particles / cell in respiration buffer; "+MITO") or 20 μL of respiration buffer alone ("-MITO") and equilibrated for 10 min in a non-CO2 incubator. Next, a "mitochondrial stress test" was performed using the Seahorse apparatus with 10 μM oligomycin, 20 μM FCCP, and 5 μM rotenone / antimycin A (Rot / AA). As shown in Figure 1, porcine mitochondria treatment increased the OCR of baseline (43.6% increase), oligomycin-treated HPAECs (204.9% increase), FCCP-treated HPAECs (8.4% increase), and Rot / AA-treated HPAECs (34.1% increase) compared to the corresponding baseline, oligomycin-treated, FCCP-treated, or Rot / AA-treated "-MITO" HPAEC controls.

[0305] The effect of porcine mitochondria treatment of HPAECs on OCR after prolonged cold exposure was also examined. HPAECs were placed at 4°C for 12 hours. HPAECs were allowed to recover for 1 hour at 37°C under normoxia in the presence of 20 μL of mitochondrial suspension (172 particles / cell in respiration buffer; "+MITO") or 20 μL of respiration buffer alone ("-MITO"), and then equilibrated for 50 minutes in a non-CO2 incubator. HPAECs were then rested in a Seahorse apparatus at 37°C under non-CO2 conditions. Next, a "mitochondrial stress test" was performed using 10 μM oligomycin, 20 μM FCCP, and 5 μM rotenone / antimycin A (Rot / AA) in the Seahorse apparatus. As shown in Figure 2, porcine mitochondria treatment increased the OCR of baseline (32.4% increase), oligomycin-treated HPAECs (51.9% increase), FCCP-treated HPAECs (9.5% increase), and Rot / AA-treated HPAECs (45.2% increase) compared to the corresponding baseline, oligomycin-treated, FCCP-treated, or Rot / AA-treated "-MITO" HPAEC controls.

[0306] The uptake of porcine mitochondria by HPAECs exposed to cold stress was assessed using a probe specific for porcine (Sus scrofa) mitochondrial ND5 (MTND5). Specifically, the effects of porcine mitochondria treatment during cold stress and cold recovery were evaluated. Porcine mitochondria were administered to cold-stressed HPAECs. In the cold-recovery group, HPAECs were cultured at room temperature for 24 hours, then at 4°C for 24 hours, before treatment with porcine mitochondria. After treatment with porcine mitochondria, cold-recovered HPAECs were cultured under recovery conditions (room temperature of 37°C) for 24, 48, or 72 hours before harvesting. In the cold-exposed group, cells were cultured at room temperature for 48 hours, treated with porcine mitochondria, and immediately placed at 4°C. Cold-exposed HPAECs were harvested after 24, 48, or 72 hours of cold exposure. cDNA was generated for each sample, and the expression level of porcine MtND5 was examined in comparison with the control gene PPIA using a primer / probe mixture (forward primer sequence: CAGCACTATGTGCAATCACACAAAA; reverse primer sequence: TGGTTGATGCCGATTGTCACTATT; reporter sequence: TCGTAGCCTTCTCAACTTC; context sequence: CAGCACTATGTGCAATCACACAAAA). As shown in Figure 3, HPAECs under cold stress uptake porcine mitochondria in a dose-dependent manner, with maximum expression of porcine MtND5 achieved at 1,666 particles / cell. Under cold-recovery conditions, maximum expression of porcine MtND5 was achieved at 24 hours, with a 26,201% increase in porcine MtND5 observed compared to untreated cold-recovery controls. Under cold-exposure conditions, maximum expression of porcine MtND5 was achieved at 72 hours, with a 301,932% increase in MtND5 observed compared to untreated cold-exposed controls.

[0307] As shown in Figure 4, human mitochondrial DNA transcription in HPAECs exposed to cold stress was largely unaffected by treatment with porcine mitochondria. HPAECs were treated as described above, cultured under cold-recovery or cold-exposure conditions, and harvested at 24, 48, or 72 hours as described above. Untreated control HPAECs under cold-recovery conditions showed a 55% increase in human MtND5 expression compared to normothermic controls, as determined using a probe specific for human MtND5. This increase was mitigated by treatment with porcine mitochondria, which at 1 particle / cell showed a 3.8% decrease in expression compared to untreated normothermic HPAECs and a 33% decrease in expression compared to untreated cold-recovery controls. In the cold-exposed group, maximum expression of human MtND5 was achieved at 72 hours, but this increase was not significantly affected by treatment with porcine mitochondria.

[0308] Taken together, these findings indicate that human endothelial cells exposed to cold stress incorporate porcine mitochondria, which increases cellular oxygen consumption after cold injury without affecting human mitochondrial RNA transcription. Compared to oligomycin-treated "-MITO" HPAEC controls, porcine mitochondria treatment increased the OCR of oligomycin-treated HPAECs after short and long cold exposures (Figures 1 and 2). These data indicate that mitochondrial treatment increases proton leak respiration (i.e., the process by which protons are transferred to the matrix without generating ATP). Studies suggest that proton leak respiration reduces mitochondrial reactive oxygen species (ROS) production, and that this leak, or uncoupling, protects against ROS in various diseases. See, for example, Ganote, C. E. and S. C. Armstrong, J. Mol. Cell. Cardiol. 2003, 35(7):749-59; Speakman, J. R., et al., Aging Cell. 2004, 3(3):87-95; and Green, K., et al., Diabetes. 2004, 53(Suppl. 1):S110-8. Thus, processing porcine mitochondria may protect against ROS in various diseases, such as diabetes and cardiovascular disease.

[0309] Example 2 Treatment of cells with porcine mitochondria during cold recovery and cold exposure alters the expression of genes related to inflammation, innate immune responses, and cellular stress NF-κB is a transcription factor known to upregulate pro-inflammatory gene expression. The effect of porcine mitochondria treatment on NF-κB gene expression in HPAECs under cold-exposed and cold-recovery conditions was assessed by qRT-PCR. As shown in Figure 5, porcine mitochondria treatment of HPAECs reduces NF-κB expression at 24 hours of cold recovery. HPAECs were treated and cultured under cold-recovery or cold-exposed conditions as described above in Figure 3 and harvested at 24, 48, or 72 hours. Under cold-recovery conditions, untreated control HPAECs showed an 83% increase in NF-κB expression at 24 hours compared to normothermic controls. Pig mitochondria treatment tended to reduce NF-κB expression compared to untreated cold-recovery control HPAECs, showing a 22% decrease at 1 particle / cell compared to untreated cold-recovery control HPAECs. Under cold exposure conditions, HPAECs treated with porcine mitochondria showed a slight increase in NF-κB expression after 24 hours, but this increase was not statistically significant. These data suggest that treatment of human endothelial cells with porcine mitochondria reduces the pro-inflammatory response associated with recovery from cold exposure.

[0310] Toll-like receptor-9 (TLR-9) activates the innate immune response upon recognition of cytosolic mitochondrial DNA (mtDNA), a sign of cellular injury. As shown in Figure 6, treatment of HPAECs with porcine mitochondria reduced TLR-9 expression after 24 hours of cold recovery. HPAECs were treated as described above in Figure 3, cultured under cold recovery or cold exposure conditions, and harvested at 24, 48, or 72 hours. Under cold recovery conditions, untreated control HPAECs showed a 101% increase in TLR-9 expression at 24 hours compared to normothermic controls. Treatment with porcine mitochondria tended to reduce TLR-9 expression compared to untreated cold-recovered control HPAECs, with 166 particles / cell showing a 37% decrease compared to untreated cold-recovered control HPAECs. Under cold-exposed conditions, maximum TLR-9 expression occurred in HPAECs treated with 1 particle / cell, with a 60% increase in TLR-9 expression observed compared to untreated cold-exposed control HPAECs. These data suggest that treatment of human endothelial cells with porcine mitochondria during cold recovery reduces the innate immune response associated with cold-exposure-induced cellular injury.

[0311] Upregulation of heme oxygenase-1 (HO-1) reduces inflammation and tissue injury during cellular stress and is cryoprotective. As shown in Figure 7, treatment of HPAECs with porcine mitochondria affects HO-1 expression. HPAECs were treated and cultured under cold recovery or cold exposure conditions, as described above in Figure 3, and harvested at 24, 48, or 72 hours. Treatment with porcine mitochondria increased HO-1 expression under cold exposure conditions. Treatment with porcine mitochondria had the greatest effect at 16 particles / cell, resulting in a 24% increase in HO-1 expression compared to untreated cold-exposed control HPAECs (a 242% increase compared to untreated normothermic control HPAECs). These data suggest that treatment of human endothelial cells with porcine mitochondria reduces inflammation and cellular injury during cold exposure by increasing HO-1 expression.

[0312] Example 3 Treatment of cells with porcine mitochondria under hypoxic conditions reduces secretion of pro-inflammatory gene products To evaluate the effects of porcine mitochondria treatment on human endothelial cells under hypoxic conditions, HPAECs were cultured under normoxia or hypoxia (1% O2) for 24 hours before treatment with porcine mitochondria. After treatment, HPAECs were returned to the respective conditions, normoxia or hypoxia. 300 μL of cell culture medium was then collected at 24, 48, or 72 hours and placed into a sterile 1.5 mL Eppendorf tube at the appropriate time point (24, 48, or 72 hours). The tubes were centrifuged at 2,000 rpm at 4°C for 10 minutes. The supernatant (270 μL) was collected and placed into a new sterile 1.5 mL Eppendorf tube. These samples were immediately stored at -80°C until analysis by inflammatory cytokine array. Secreted proinflammatory gene products were measured in the cell culture medium using an inflammatory cytokine array (RayBiotech; Norcross, GA). A medium-only control was used for background correction.

[0313] Macrophage colony-stimulating factor (M-CSF), also known as colony-stimulating factor-1 (CSF-1), promotes healing but also promotes macrophages with an M1 phenotype. In ischemia / transplantation models, M-CSF serum levels rise sharply during acute rejection of the transplanted organ. As shown in Figure 8, pro-inflammatory cytokine array assays demonstrated that treatment of HPAECs with porcine mitochondria reduced M-CSF secretion under hypoxic conditions. Treatment with porcine mitochondria had the greatest effect at 3 particles / cell, with M-CSF secretion reduced by 65% ​​at 48 hours compared to untreated, hypoxic control HPAECs.

[0314] Macrophage inflammatory protein-1β (MIP-1β), also known as chemokine (C-C motif) ligand 4 (CCL4), is important in the immune response to infection and inflammation. MIP-1β activates immune cells, causing acute inflammation and inducing the synthesis and release of pro-inflammatory cytokines, such as IL-1β, IL-6, and TNF-α. As shown in Figure 9, pro-inflammatory cytokine array assays demonstrated that treatment of HPAECs with porcine mitochondria reduced MIP-1β secretion under hypoxic conditions. Treatment with porcine mitochondria was maximally effective at reducing MIP-1β secretion at 3 particles / cell, with MIP-1β secretion reduced by 73% at 48 hours compared to untreated, hypoxic control HPAECs. A decrease in efficacy was observed at 3,687 particles / cell.

[0315] Platelet-derived growth factor-BB (PDGF-BB) is a potent inducer of pro-inflammatory cytokine production and stimulates cell proliferation. As shown in Figure 10, pro-inflammatory cytokine array assays demonstrated that treatment of HPAECs with porcine mitochondria reduced PDGF-BB secretion under hypoxic conditions. Treatment with porcine mitochondria was maximally effective at reducing PDGF-BB secretion at 36 particles / cell, with PDGF-BB secretion reduced by 69% at 48 hours compared to untreated, hypoxic control HPAECs. A decrease in efficacy was observed at 3,687 particles / cell.

[0316] RANTES, also known as chemokine (C-C motif) ligand 5 (CCL5), is a pro-inflammatory chemokine upregulated by the NF-κB pathway. RANTES plays an active role in recruiting leukocytes to inflammatory sites. As shown in Figure 11, pro-inflammatory cytokine array assays demonstrated that treatment of HPAECs with porcine mitochondria reduced RANTES secretion under hypoxic conditions. Treatment with porcine mitochondria was maximally effective at reducing RANTES secretion at 0.3 particles / cell, with RANTES secretion reduced by 59% at 48 hours compared to untreated, hypoxic control HPAECs. A decrease in efficacy was observed at 3,687 particles / cell.

[0317] Under inflammatory conditions,...

Claims

1. A method of organ transplantation comprising delivering isolated mitochondria to an organ intended for transplantation.

2. 10. The method of claim 1, further comprising harvesting the organ from a donor.

3. 3. The method of claim 2, wherein the isolated mitochondria are delivered to the organ prior to the step of harvesting the organ from the donor.

4. 3. The method of claim 2, wherein the isolated mitochondria are delivered to the organ after harvesting the organ from the donor.

5. The method of any one of claims 1 to 4, further comprising transplanting the organ treated with the isolated mitochondria into a recipient.

6. 6. The method of claim 5, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the recipient.

7. 6. The method of claim 5, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the recipient.

8. The method according to any one of claims 1 to 5, wherein the organ intended for transplantation is taken from a human donor.

9. 9. The method of claim 8, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the human donor.

10. 9. The method of claim 8, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the human donor.

11. 10. The method of claim 1, wherein the organ intended for transplantation is engineered from a porcine organ scaffold.

12. 12. The method of any one of claims 1 to 5, 8, or 11, wherein the isolated mitochondria are isolated porcine mitochondria.

13. 13. The method of any one of claims 1 to 12, wherein cells of the organ treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to cells of the corresponding organ not treated with the isolated mitochondria.

14. 14. The method of claim 13, wherein the improved mitochondrial function is increased oxygen consumption and / or increased adenosine triphosphate (ATP) synthesis.

15. 15. The method of any one of claims 1 to 14, wherein the isolated mitochondria are delivered to the organ via a vein or via an artery.

16. The method according to any one of claims 1 to 15, wherein the organ is a lung.

17. 17. The method of claim 16, wherein the isolated mitochondria-treated lung is transplanted into a human recipient suffering from a lung disease or disorder.

18. 18. The method of claim 17, wherein the pulmonary disease or disorder is pulmonary hypertension, bronchopulmonary dysplasia (BPD), pulmonary fibrosis, asthma, sleep-disordered breathing, or chronic obstructive pulmonary disease (COPD).

19. 19. The method of claim 18, wherein the pulmonary hypertension is pulmonary hypertension due to COPD, chronic thromboembolic pulmonary hypertension (CTEPH), pulmonary arterial hypertension (PAH), pulmonary veno-occlusive disease (PVOD), pulmonary capillary hemangiomatosis (PCH), persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

20. 20. The method of any one of claims 16 to 19, wherein the isolated mitochondria are delivered to the lungs via the airways, via a vein, or via an artery.

21. The method according to any one of claims 1 to 15, wherein the organ is a kidney.

22. 22. The method of claim 21, wherein the kidney treated with the isolated mitochondria is transplanted into a human recipient suffering from a renal disease or disorder.

23. 23. The method of claim 21 or 22, wherein the isolated mitochondria are delivered to the kidney via a vein or via an artery.

24. 1. A method for improving the performance of an implanted tissue or transplanted organ in a subject, wherein the tissue or organ is a donor tissue, donor organ, engineered tissue, or engineered organ, comprising delivering isolated mitochondria to the tissue or organ before, during, or after implantation or transplantation of the tissue or organ.

25. 25. The method of claim 24, wherein the isolated mitochondria are isolated porcine mitochondria.

26. 25. The method of claim 24, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the tissue or organ.

27. 25. The method of claim 24, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the tissue or organ.

28. 28. The method of any one of claims 24 to 27, wherein cells of the tissue or organ treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to cells of the corresponding tissue or organ not treated with the isolated mitochondria.

29. 29. The method of claim 28, wherein the improved mitochondrial function is increased oxygen consumption and / or increased adenosine triphosphate (ATP) synthesis.

30. 30. The method of any one of claims 24 to 29, wherein the isolated mitochondria are delivered to the organ via a vein or via an artery.

31. 31. The method of any one of claims 24 to 30, wherein the tissue or organ is selected from the group consisting of a blood vessel, a ureter, a trachea, and a skin patch.

32. The method according to any one of claims 24 to 29, wherein the organ is a lung.

33. 33. The method of claim 32, wherein the isolated mitochondria are delivered to the lungs via the airways, via a vein, or via an artery.

34. The method according to any one of claims 24 to 29, wherein the organ is a kidney.

35. 35. The method of claim 34, wherein the isolated mitochondria are delivered to the kidney via a vein or via an artery.

36. 36. The method of any one of claims 24 to 35, wherein the tissue or organ is produced by bioprinting.

37. 1. A method for improving the function of lungs subjected to ex vivo lung perfusion (EVLP), comprising: (i) delivering isolated mitochondria to the lung; and (ii) Performing EVLP on the lungs in a chamber or container by perfusing the lungs with perfusion solution from a reservoir.

38. 38. The method of claim 37, wherein the isolated mitochondria are isolated porcine mitochondria.

39. 38. The method of claim 37, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the lung.

40. 38. The method of claim 37, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the lung.

41. 41. The method of any one of claims 37 to 40, wherein the lung cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding lung cells not treated with the isolated mitochondria.

42. 42. The method of claim 41, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

43. 43. The method of any one of claims 37-42, wherein the lungs treated with the isolated mitochondria exhibit enhanced stability or maintenance of one or more EVLP parameters compared to corresponding lungs not treated with the isolated mitochondria.

44. 44. The method of claim 43, wherein the lungs treated with the isolated mitochondria exhibit enhanced stability or maintenance of pulmonary artery pressure (PAP), tidal volume (TV), dynamic compliance, pulmonary vascular resistance (PVR), gas exchange, or any combination thereof, compared to corresponding lungs not treated with the isolated mitochondria.

45. 43. The method of any one of claims 37-42, wherein the lungs treated with the isolated mitochondria have at least a 5% improvement in one or more EVLP parameters compared to corresponding lungs not treated with the isolated mitochondria.

46. 46. ​​The method of claim 45, wherein the improvement in one or more EVLP parameters is improved PAP, improved TV, improved dynamic compliance, increased glucose / lactose ratio, decreased histological measurements of cell death, increased angiogenesis and gap junction formation, decreased PVR, decreased lactate production, decreased ammonium production, improved minute ventilation, improved blood flow, decreased pulmonary edema, improved pulmonary elastance, improved gas exchange, or any combination thereof.

47. 47. The method of any one of claims 37-46, wherein lungs treated with the isolated mitochondria exhibit improved expression of gap junction markers, reduced reactive oxygen species (ROS)-induced DNA oxidation, reduced ROS-mediated production of oxidation by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to corresponding lungs not treated with the isolated mitochondria.

48. 48. The method of claim 47, wherein the gap junction markers include junctional adhesion molecule 1 (JAM1) and CD31.

49. 48. The method of claim 47, wherein the proinflammatory cytokines include IL-6, IL-8, and interferon gamma (IFN-γ).

50. 48. The method of claim 47, wherein the ROS-mediated oxidation byproducts include 4-hydroxynonenal (4-HNE) and 8-hydroxydeoxyguanosine (8-OHdG).

51. 48. The method of claim 47, wherein the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

52. 52. The method of any one of claims 37 to 51, further comprising the step of harvesting the lungs from a donor before performing EVLP.

53. 53. The method of claim 52, further comprising the step of transplanting the lung into a recipient after performing EVLP.

54. 54. The method of claim 53, wherein the recipient is a human recipient suffering from a lung disease or disorder.

55. 55. The method of claim 54, wherein the pulmonary disease or disorder is pulmonary hypertension, bronchopulmonary dysplasia (BPD), pulmonary fibrosis, asthma, sleep-disordered breathing, or chronic obstructive pulmonary disease (COPD).

56. 56. The method of claim 55, wherein the pulmonary hypertension is pulmonary hypertension due to COPD, chronic thromboembolic pulmonary hypertension (CTEPH), pulmonary arterial hypertension (PAH), pulmonary veno-occlusive disease (PVOD), pulmonary capillary hemangiomatosis (PCH), persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

57. 57. The method of any one of claims 37 to 56, wherein the isolated mitochondria are delivered to the lung via the airways.

58. 57. The method of any one of claims 37 to 56, wherein the isolated mitochondria are delivered to the lung from a reservoir.

59. 57. The method of any one of claims 37 to 56, wherein the isolated mitochondria are delivered to the lung via a vein or via an artery.

60. 60. The method of any one of claims 37 to 59, wherein the isolated mitochondria are delivered to the lung before performing EVLP.

61. 60. The method of any one of claims 37 to 59, wherein the isolated mitochondria are delivered to the lung during EVLP.

62. 60. The method of any one of claims 37 to 59, wherein the isolated mitochondria are delivered to the lung after performing EVLP.

63. 54. The method of claim 52 or 53, wherein the isolated mitochondria are delivered to the lungs prior to the step of harvesting the lungs from the donor.

64. 54. The method of claim 52 or 53, wherein the isolated mitochondria are delivered to the lungs after the step of harvesting the lungs from the donor.

65. 65. The method of claim 63 or 64, wherein the isolated mitochondria are delivered to the lung via the airways, via a vein, or via an artery.

66. 66. The method of any one of claims 37-65, wherein the perfusion solution comprises Steen's solution, Perfadex, low-potassium dextran solution, whole blood, diluted blood, packed red blood cells (RBCs), plasma substitutes, one or more vasodilators, sodium bicarbonate, glucose, or any combination thereof.

67. 67. The method of any one of claims 37 to 66, wherein the perfusion solution is introduced into the lungs via a cannulated pulmonary artery.

68. 68. The method of any one of claims 37 to 67, wherein the lungs are ventilated in a chamber or container via a cannulated trachea.

69. 1. A method of minimizing injury to an organ ex vivo due to cold ischemia during transport, shipping, or storage, comprising delivering isolated mitochondria to the organ 0-24 hours before, during, or 0-24 hours after cold ischemia, Cells from an organ treated with the isolated mitochondria have at least a 5% improvement in mitochondrial function compared to cells from a corresponding organ not treated with the isolated mitochondria; and The method, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

70. 70. The method of claim 69, wherein the isolated mitochondria are isolated porcine mitochondria.

71. 70. The method of claim 69, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said organ.

72. 70. The method of claim 69, wherein the isolated mitochondria are isolated human mitochondria autologous to the organ.

73. 73. The method of any one of claims 69-72, wherein the organ treated with the isolated mitochondria has reduced production of ROS-mediated oxidative by-products, improved cell viability, reduced necrosis, reduced cell lysis, increased total levels of cellular ATP, reduced inflammatory cytokine secretion, or any combination thereof, compared to a corresponding organ not treated with the isolated mitochondria.

74. 74. The method of claim 73, wherein the inflammatory cytokines include IL-6, IL-8, and IFN-γ.

75. 74. The method of claim 73, wherein the ROS-mediated oxidation byproducts include 4-HNE and 8-OHdG.

76. 76. The method of any one of claims 69 to 75, further comprising the step of harvesting the organ from a donor.

77. 77. The method of any one of claims 69-76, wherein the isolated mitochondria are delivered to the organ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours prior to cold ischemia.

78. 77. The method of any one of claims 69 to 76, wherein the isolated mitochondria are delivered to the organ during cold ischemia.

79. 77. The method of any one of claims 69-76, wherein the isolated mitochondria are delivered to the organ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours after cold ischemia.

80. 80. The method of any one of claims 69 to 79, wherein the isolated mitochondria are delivered intravenously or intraarterially.

81. The method according to any one of claims 69 to 80, wherein the organ is a kidney.

82. 82. The method of claim 81, further comprising transplanting the kidney into a human recipient suffering from a renal disease or disorder.

83. 83. The method of claim 81 or 82, further comprising the step of harvesting the kidney from a donor.

84. 80. The method of any one of claims 69 to 79, wherein the organ is a lung and the method further comprises performing EVLP on the lung in a chamber or container by perfusing the lung with perfusion solution from a reservoir.

85. 85. The method of claim 84, wherein the lungs treated with the isolated mitochondria exhibit enhanced stability or maintenance of one or more EVLP parameters compared to corresponding lungs not treated with the isolated mitochondria.

86. 86. The method of claim 85, wherein the lungs treated with the isolated mitochondria exhibit enhanced stability or maintenance of PAP, TV, dynamic compliance, PVR, gas exchange, or any combination thereof, compared to corresponding lungs not treated with the isolated mitochondria.

87. 85. The method of claim 84, wherein the lungs treated with the isolated mitochondria have at least a 5% improvement in one or more EVLP parameters compared to corresponding lungs not treated with the isolated mitochondria.

88. 88. The method of claim 87, wherein the improvement in one or more EVLP parameters is improved PAP, improved TV, improved dynamic compliance, increased glucose / lactose ratio, decreased histological measurements of cell death, increased angiogenesis and gap junction formation, decreased PVR, decreased lactate production, decreased ammonium production, improved minute ventilation, improved blood flow, decreased pulmonary edema, improved pulmonary elastance, improved gas exchange, or any combination thereof.

89. 89. The method of any one of claims 84-88, wherein lungs treated with the isolated mitochondria have improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced ROS-mediated production of oxidation by-products, reduced ROS-mediated chemokine secretion, reduced levels of pathogenic cytokines, reduced apoptosis, or any combination thereof, compared to corresponding lungs not treated with the isolated mitochondria.

90. 90. The method of claim 89, wherein the gap junction markers include JAM1 and CD31.

91. 90. The method of claim 89, wherein the inflammatory cytokines include IL-6, IL-8, and IFN-γ.

92. 90. The method of claim 89, wherein the ROS-mediated oxidation byproducts include 4-HNE and 8-OHdG.

93. 90. The method of claim 89, wherein the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

94. 94. The method of any one of claims 84 to 93, further comprising transplanting the lung into a human recipient suffering from a lung disease or disorder.

95. 95. The method of claim 94, wherein the pulmonary disease or disorder is pulmonary hypertension, bronchopulmonary dysplasia (BPD), pulmonary fibrosis, asthma, sleep-disordered breathing, or chronic obstructive pulmonary disease (COPD).

96. 96. The method of claim 95, wherein the pulmonary hypertension is pulmonary hypertension due to COPD, chronic thromboembolic pulmonary hypertension (CTEPH), pulmonary arterial hypertension (PAH), pulmonary veno-occlusive disease (PVOD), pulmonary capillary hemangiomatosis (PCH), persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

97. 97. The method of any one of claims 84 to 96, further comprising the step of harvesting the lungs from a donor.

98. 98. The method of any one of claims 84-97, wherein the isolated mitochondria are delivered to the lung via the airways.

99. 98. The method of any one of claims 84-97, wherein the isolated mitochondria are delivered to the lung from the reservoir.

100. 98. The method of any one of claims 84-97, wherein the isolated mitochondria are delivered to the lung via a vein or via an artery.

101. 101. The method of any one of claims 98-100, wherein the isolated mitochondria are delivered to the lung before performing EVLP.

102. 101. The method of any one of claims 98-100, wherein the isolated mitochondria are delivered to the lung during EVLP.

103. 101. The method of any one of claims 98-100, wherein the isolated mitochondria are delivered to the lung after performing EVLP.

104. 98. The method of claim 97, wherein the isolated mitochondria are delivered to the lungs prior to the step of harvesting the lungs from the donor.

105. 98. The method of claim 97, wherein the isolated mitochondria are delivered to the lungs after harvesting the lungs from the donor.

106. 106. The method of claim 104 or 105, wherein the isolated mitochondria are delivered to the lung via the airways, via a vein, or via an artery.

107. 107. The method of any one of claims 84-106, wherein the perfusion solution comprises Steen's solution, Perfadex, low potassium dextran solution, whole blood, diluted blood, packed red blood cells, plasma substitute, one or more vasodilators, sodium bicarbonate, glucose, or any combination thereof.

108. 108. The method of any one of claims 84 to 107, wherein the perfusion solution is introduced into the lungs via a cannulated pulmonary artery.

109. 109. A method according to any one of claims 84 to 108, wherein the lungs are ventilated in the chamber or container via a cannulated trachea.

110. 1. A method for improving the function of an engineered organ or tissue, the method comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; (ii) growing the organ or tissue scaffold in a bioreactor, chamber, or container with growing cells to generate an engineered organ or tissue; and (iii) delivering isolated mitochondria to said engineered organ or tissue.

111. 111. The method of claim 110, wherein the isolated mitochondria are isolated porcine mitochondria.

112. 111. The method of claim 110, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said engineered organ or tissue.

113. 111. The method of claim 110, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the engineered organ or tissue.

114. 111. The method of claim 110, wherein cells of the engineered organ or tissue treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to cells of a corresponding engineered organ or tissue not treated with the isolated mitochondria.

115. 115. The method of claim 114, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

116. 116. The method of any one of claims 110-115, wherein the engineered organ or tissue treated with the isolated mitochondria is an engineered human kidney.

117. 116. The method of any one of claims 110-115, wherein the engineered organ or tissue treated with the isolated mitochondria is an engineered human lung.

118. 118. The method of claim 117, wherein the engineered human lung treated with the isolated mitochondria exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered human lung not treated with the isolated mitochondria.

119. 119. The method of claim 118, wherein the engineered human lung treated with the isolated mitochondria exhibits enhanced stability or maintenance of PAP, TV, dynamic compliance, PVR, gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

120. 118. The method of claim 117, wherein the engineered human lung treated with the isolated mitochondria has at least a 5% improvement in one or more EVLP parameters compared to a corresponding engineered human lung not treated with the isolated mitochondria.

121. The method of claim 120, wherein the improvement in one or more EVLP parameters is improved PAP, improved TV, improved dynamic compliance, increased glucose / lactose ratio, decreased histological measurements of cell death, increased angiogenesis and gap junction formation, decreased PVR, decreased lactate production, decreased ammonium production, improved minute ventilation, improved blood flow, decreased pulmonary edema, improved pulmonary elastance, improved gas exchange, or any combination thereof.

122. 122. The method of any one of claims 117-121, wherein the engineered human lung treated with the isolated mitochondria has improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced ROS-mediated production of oxidation by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

123. 123. The method of claim 122, wherein the gap junction markers include JAM1 and CD31.

124. 123. The method of claim 122, wherein the inflammatory cytokines include IL-6, IL-8, and IFN-γ.

125. 123. The method of claim 122, wherein the ROS-mediated oxidation byproducts include 4-HNE and 8-OHdG.

126. 123. The method of claim 122, wherein the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

127. 127. The method of any one of claims 110 to 126, wherein the proliferating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

128. 128. The method of claim 127, wherein the epithelial cells comprise type I pneumocytes, type II pneumocytes, small and large airway epithelial cells, or any combination thereof.

129. 128. The method of claim 127, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

130. 128. The method of claim 127, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

131. 128. The method of claim 127, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

132. 132. The method of any one of claims 110-131, wherein the isolated mitochondria are delivered to the engineered organ or tissue after growing the organ or tissue scaffold.

133. 132. The method of any one of claims 110-131, wherein the isolated mitochondria are delivered to the engineered organ or tissue during the process of growing the organ or tissue scaffold.

134. 134. The method of claim 133, wherein the isolated mitochondria are delivered to the engineered organ or tissue along with growing cells in a bioreactor, chamber, or container.

135. 135. The method of any one of claims 132-134, wherein the isolated mitochondria are delivered to the engineered organ or tissue intravenously, intraarterially, or by perfusion.

136. 136. The method of any one of claims 110-135, wherein the isolated mitochondria are injected into the organ or tissue scaffold prior to growing the organ or tissue scaffold in a bioreactor, chamber, or container.

137. 137. The method of any one of claims 110 to 136, wherein the organ or tissue scaffold is produced by bioprinting.

138. 138. The method of claim 137, wherein the expanded cells and artificial organ or tissue matrix are bioprinted simultaneously to generate the engineered organ or tissue.

139. 1. A method for improving the function of an engineered organ or tissue, the method comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; and (ii) Growing the organ or tissue scaffold in a bioreactor, chamber, or container with cells treated with isolated mitochondria to produce an engineered organ or tissue.

140. 140. The method of claim 139, wherein the isolated mitochondria are isolated porcine mitochondria.

141. 140. The method of claim 139, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said engineered organ or tissue.

142. 140. The method of claim 139, wherein said isolated mitochondria are isolated human mitochondria that are autologous to said engineered organ or tissue.

143. 143. The method of any one of claims 139-142, wherein cells of an engineered organ or tissue treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to cells of a corresponding engineered organ or tissue not treated with the isolated mitochondria.

144. 144. The method of claim 143, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

145. 145. The method of any one of claims 139-144, wherein the engineered organ or tissue treated with the isolated mitochondria is an engineered human kidney.

146. 145. The method of any one of claims 139-144, wherein the engineered organ or tissue treated with the isolated mitochondria is an engineered human lung.

147. 147. The method of claim 146, wherein the engineered human lung treated with the isolated mitochondria exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered human lung not treated with the isolated mitochondria.

148. 148. The method of claim 147, wherein the engineered human lung treated with the isolated mitochondria exhibits enhanced stability or maintenance of PAP, TV, dynamic compliance, PVR, gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

149. 147. The method of claim 146, wherein the engineered human lung treated with the isolated mitochondria has at least a 5% improvement in one or more EVLP parameters compared to a corresponding engineered human lung not treated with the isolated mitochondria.

150. The method of claim 149, wherein the improvement in one or more EVLP parameters is improved PAP, improved TV, improved dynamic compliance, increased glucose / lactose ratio, decreased histological measurements of cell death, increased angiogenesis and gap junction formation, decreased PVR, decreased lactate production, decreased ammonium production, improved minute ventilation, improved blood flow, decreased pulmonary edema, improved pulmonary elastance, improved gas exchange, or any combination thereof.

151. 151. The method of any one of claims 146-150, wherein the engineered human lung treated with the isolated mitochondria has improved expression of gap junction markers, reduced ROS-induced DNA oxidation, reduced ROS-mediated production of oxidation by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

152. 152. The method of claim 151, wherein the gap junction markers include JAM1 and CD31.

153. 152. The method of claim 151, wherein the inflammatory cytokines include IL-6, IL-8, and IFN-γ.

154. 152. The method of claim 151, wherein the ROS-mediated oxidation byproducts include 4-HNE and 8-OHdG.

155. 152. The method of claim 151, wherein the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

156. 156. The method of any one of claims 139 to 155, wherein the proliferating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

157. 157. The method of claim 156, wherein the epithelial cells comprise type I pneumocytes, type II pneumocytes, small and large airway epithelial cells, or any combination thereof.

158. 157. The method of claim 156, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

159. 157. The method of claim 156, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

160. 157. The method of claim 156, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

161. 161. The method of any one of claims 139-160, wherein the isolated mitochondria are injected into the organ or tissue scaffold prior to growing the organ or tissue scaffold in a bioreactor, chamber, or container.

162. 162. The method of any one of claims 139 to 161, wherein the organ or tissue scaffold is produced by bioprinting.

163. 163. The method of claim 162, wherein the expanded cells and artificial organ or tissue matrix are simultaneously bioprinted to generate an engineered organ or tissue.

164. 1. A method for improving the function of an engineered organ or tissue, the method comprising: (i) preparing an organ or tissue scaffold comprising one or more extracellular matrix components; (ii) injecting isolated mitochondria into the organ or tissue scaffold; and (iii) Growing said organ or tissue scaffold in a bioreactor, chamber, or container with growing cells to produce an engineered organ or tissue.

165. 165. The method of claim 164, wherein the isolated mitochondria are isolated porcine mitochondria.

166. 165. The method of claim 164, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said engineered organ or tissue.

167. 165. The method of claim 164, wherein said isolated mitochondria are isolated human mitochondria that are autologous to said engineered organ or tissue.

168. 168. The method of any one of claims 164-167, wherein cells of the engineered organ or tissue have at least 5% improved mitochondrial function compared to cells of a corresponding engineered organ or tissue that have not been treated with the isolated mitochondria.

169. 169. The method of claim 168, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

170. 170. The method of any one of claims 164 to 169, wherein the engineered organ or tissue is an engineered human kidney.

171. 170. The method of any one of claims 164 to 169, wherein the engineered organ or tissue is an engineered human lung.

172. 172. The method of claim 171, wherein the engineered human lung has enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered human lung not treated with the isolated mitochondria.

173. 173. The method of claim 172, wherein the engineered human lung exhibits enhanced stability or maintenance of PAP, TV, dynamic compliance, PVR, gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

174. 172. The method of claim 171, wherein the engineered human lung has at least a 5% improvement in one or more EVLP parameters compared to a corresponding engineered human lung not treated with the isolated mitochondria.

175. The method of claim 174, wherein the improvement in one or more EVLP parameters is improved PAP, improved TV, improved dynamic compliance, increased glucose / lactose ratio, decreased histological measurements of cell death, increased angiogenesis and gap junction formation, decreased PVR, decreased lactate production, decreased ammonium production, improved minute ventilation, improved blood flow, decreased pulmonary edema, improved pulmonary elastance, improved gas exchange, or any combination thereof.

176. 176. The method of any one of claims 171-175, wherein the engineered human lung treated with the isolated mitochondria has improved expression of gap junction markers, reduced reactive oxygen species (ROS)-induced DNA oxidation, reduced ROS-mediated production of oxidation by-products, reduced ROS-mediated chemokine secretion, reduced inflammatory cytokine levels, reduced apoptosis, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

177. 177. The method of claim 176, wherein the gap junction markers include JAM1 and CD31.

178. 177. The method of claim 176, wherein the inflammatory cytokines include IL-6, IL-8, and IFN-γ.

179. 177. The method of claim 176, wherein the ROS-mediated oxidation byproducts include 4-HNE and 8-OHdG.

180. 177. The method of claim 176, wherein the ROS-mediated chemokines include IL-8, CXCL9, MCP-1, and GROα.

181. 181. The method of any one of claims 164 to 180, wherein the proliferating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

182. 182. The method of claim 181, wherein the epithelial cells comprise type I pneumocytes, type II pneumocytes, small and large airway epithelial cells, or any combination thereof.

183. 182. The method of claim 181, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

184. 182. The method of claim 181, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

185. 182. The method of claim 181, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

186. 186. The method of any one of claims 164 to 185, wherein the organ or tissue scaffold is produced by bioprinting.

187. 187. The method of claim 186, wherein the expanded cells and artificial organ or tissue matrix are simultaneously bioprinted to generate an engineered organ or tissue.

188. 1. A method for improving the function of an engineered lung, comprising: (i) repopulating the decellularized scaffold lung in a bioreactor, chamber, or container with proliferating cells to generate an engineered lung; and (ii) delivering isolated mitochondria to the engineered lung.

189. 189. The method of claim 188, wherein the isolated mitochondria are isolated porcine mitochondria.

190. 189. The method of claim 188, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said engineered lung.

191. 189. The method of claim 188, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the engineered lung.

192. 192. The method of any one of claims 188-191, wherein the engineered lung cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding engineered lung cells not treated with the isolated mitochondria.

193. 193. The method of claim 192, wherein the improved mitochondrial function is increased oxygen consumption.

194. 194. The method of claim 193, wherein the improved mitochondrial function is increased ATP synthesis.

195. 195. The method of any one of claims 188-194, wherein the repopulating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

196. 196. The method of claim 195, wherein the epithelial cells comprise type I pneumocytes, type II pneumocytes, small and large airway epithelial cells, or any combination thereof.

197. 196. The method of claim 195, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

198. 196. The method of claim 195, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

199. 196. The method of claim 195, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

200. 200. The method of any one of claims 188-199, wherein the isolated mitochondria are delivered to the engineered lung after repopulating the decellularized scaffold lung.

201. 200. The method of any one of claims 188-199, wherein the isolated mitochondria are delivered to the engineered lung during the process of repopulating the decellularized scaffold lung.

202. 202. The method of claim 201, wherein the isolated mitochondria are delivered to the engineered lung along with repopulating cells in a bioreactor, chamber, or container.

203. 203. The method of any one of claims 200-202, wherein the isolated mitochondria are delivered to the engineered lung via the airways, via a vein, or via an artery.

204. 189. The method of claim 188, further comprising the step of performing EVLP on the engineered lung by perfusing the engineered lung with perfusion solution from a reservoir.

205. 205. The method of claim 204, wherein the engineered lung treated with the isolated mitochondria exhibits enhanced stability or maintenance of one or more EVLP parameters compared to a corresponding engineered lung not treated with the isolated mitochondria.

206. 173. The method of claim 172, wherein the engineered lung treated with the isolated mitochondria exhibits enhanced stability or maintenance of PAP, TV, dynamic compliance, PVR, gas exchange, or any combination thereof, compared to a corresponding engineered human lung not treated with the isolated mitochondria.

207. 205. The method of claim 204, wherein the engineered lung treated with the isolated mitochondria has at least a 5% improvement in one or more EVLP parameters compared to a corresponding engineered lung not treated with the isolated mitochondria.

208. The method of claim 207, wherein the improvement in one or more EVLP parameters is improved PAP, improved TV, improved dynamic compliance, increased glucose / lactose ratio, decreased histological measurements of cell death, increased angiogenesis and gap junction formation, decreased PVR, decreased lactate production, decreased ammonium production, improved minute ventilation, improved blood flow, decreased pulmonary edema, improved pulmonary elastance, improved gas exchange, or any combination thereof.

209. 209. The method of any one of claims 204-208, wherein the isolated mitochondria are delivered to the engineered lung via the airways, via a vein, or via an artery.

210. 209. The method of any one of claims 204-208, wherein the isolated mitochondria are delivered from the reservoir to the engineered lung.

211. 211. The method of claim 209 or 210, wherein the isolated mitochondria are delivered to the engineered lung prior to performing EVLP.

212. 211. The method of claim 209 or 210, wherein the isolated mitochondria are delivered to the engineered lung during EVLP.

213. 213. The method of any one of claims 204-212, wherein the perfusion solution comprises Steen's solution, Perfadex, low potassium dextran solution, whole blood, diluted blood, packed red blood cells, plasma substitute, one or more vasodilators, sodium bicarbonate, glucose, or any combination thereof.

214. 214. The method of any one of claims 204 to 213, wherein the perfusion solution is introduced into the engineered lung via a cannulated pulmonary artery.

215. 215. The method of any one of claims 204 to 214, wherein the engineered lung is ventilated in a bioreactor, chamber, or container via a cannulated trachea.

216. 1. A method for improving the function of an engineered lung, comprising: (i) delivering isolated mitochondria to repopulating cells; and (ii) Repopulating the decellularized scaffold lung in a bioreactor, chamber, or container with repopulating cells treated with isolated mitochondria to generate an engineered lung.

217. 217. The method of claim 216, wherein the isolated mitochondria are isolated porcine mitochondria.

218. 217. The method of claim 216, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said engineered lung.

219. 217. The method of claim 216, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the engineered lung.

220. 217. The method of claim 216, wherein the engineered lung cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding engineered lung cells not treated with the isolated mitochondria.

221. 221. The method of claim 220, wherein the improved mitochondrial function is increased oxygen consumption.

222. 221. The method of claim 220, wherein the improved mitochondrial function is increased ATP synthesis.

223. 223. The method of any one of claims 216 to 222, wherein the repopulating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

224. 224. The method of claim 223, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

225. 224. The method of claim 223, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

226. 224. The method of claim 223, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

227. The method of any one of claims 216 to 226, further comprising the step of performing EVLP on the engineered lung by perfusing the engineered lung with a perfusion solution from a reservoir.

228. 228. The method of claim 227, wherein the perfusion solution comprises Steen's solution, Perfadex, low-potassium dextran solution, whole blood, diluted blood, packed red blood cells, plasma substitute, one or more vasodilators, sodium bicarbonate, glucose, or any combination thereof.

229. 229. The method of claim 227 or 228, wherein the perfusion solution is introduced into the engineered lung via a cannulated pulmonary artery.

230. 230. The method of any one of claims 227 to 229, wherein the engineered lung is ventilated within the bioreactor, chamber, or container via a cannulated trachea.

231. 1. A method for improving the function of an engineered kidney, comprising: (i) repopulating the decellularized scaffold kidney in a bioreactor, chamber, or container with repopulating cells to produce an engineered kidney; and (ii) Delivery of isolated mitochondria to engineered kidneys.

232. 232. The method of claim 231, wherein the isolated mitochondria are isolated porcine mitochondria.

233. 232. The method of claim 231, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered kidney.

234. 232. The method of claim 231, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the engineered kidney.

235. 235. The method of any one of claims 231-234, wherein the engineered kidney cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding engineered kidney cells not treated with the isolated mitochondria.

236. The method of claim 235, wherein the improved mitochondrial function is increased oxygen consumption.

237. The method of claim 235, wherein the improved mitochondrial function is increased ATP synthesis.

238. 238. The method of any one of claims 231-237, wherein the repopulating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

239. 239. The method of claim 238, wherein the epithelial cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

240. 240. The method of claim 239, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

241. 241. The method of any one of claims 231-240, wherein the isolated mitochondria are delivered to the engineered kidney after repopulating the decellularized scaffold kidney.

242. 241. The method of any one of claims 231-240, wherein the isolated mitochondria are delivered to the engineered kidney during the process of repopulating the decellularized scaffold kidney.

243. 243. The method of claim 242, wherein the isolated mitochondria are delivered to the engineered kidney along with repopulating cells in a bioreactor, chamber, or container.

244. 244. The method of any one of claims 231-243, wherein the isolated mitochondria are delivered to the engineered kidney via a vein or via an artery.

245. 1. A method for improving the function of an engineered kidney, comprising: (i) delivering isolated mitochondria to repopulating cells; and (ii) Repopulating the decellularized scaffold kidney in a bioreactor, chamber, or container with repopulating cells treated with the isolated mitochondria to produce an engineered kidney.

246. 246. The method of claim 245, wherein the isolated mitochondria are isolated porcine mitochondria.

247. 246. The method of claim 245, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the engineered kidney.

248. 246. The method of claim 245, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the engineered kidney.

249. 249. The method of any one of claims 245-248, wherein the engineered kidney cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding engineered kidney cells not treated with the isolated mitochondria.

250. 250. The method of claim 249, wherein the improved mitochondrial function is increased oxygen consumption.

251. 250. The method of claim 249, wherein the improved mitochondrial function is increased ATP synthesis.

252. 252. The method of any one of claims 245-251, wherein the repopulating cells comprise epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, immune cells, mesenchymal cells, pericytes, or any combination thereof.

253. 253. The method of claim 252, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

254. 254. The method of any one of claims 1-253, wherein the organ, tissue, kidney, or lung treated with the isolated mitochondria exhibits reduced inflammation and / or immune cell activation compared to a corresponding organ, tissue, kidney, or lung not treated with the isolated mitochondria.

255. 255. The method of claim 254, wherein said reduction in inflammation and / or immune cell activation is associated with a reduction in expression of NF-κB.

256. 255. The method of claim 254, wherein the reduction in inflammation and / or immune cell activation is associated with a reduction in expression of MAPK14, JNK, or p53.

257. 257. The method of any one of claims 254 to 256, wherein the reduced inflammation and / or immune cell activation is associated with a reduced secretion of one or more pro-inflammatory cytokines or chemokines selected from the group consisting of MIP-1β (CCL4), PDGF-BB, RANTES (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, and TGF-β1.

258. 258. The method of any one of claims 254 to 257, wherein the reduced inflammation and / or immune cell activation is associated with reduced expression of one or more activation markers selected from the group consisting of CD69, CD95, CD30, CD137, CD25 (IL2RA), CD38, and CD154 (CD40L).

259. 259. The method of any one of claims 254 to 258, wherein the reduced inflammation and / or immune cell activation is associated with reduced expression or secretion of IL-2, IL-4, IL-5, IL-6, IL-9, IL-13, IL17, TNF-α, IFN-γ, or any combination thereof.

260. 260. The method of any one of claims 1-259, wherein the organ, tissue, kidney, or lung treated with the isolated mitochondria has one or more improved cellular, organ, or tissue functions compared to a corresponding organ, tissue, kidney, or lung not treated with the isolated mitochondria, wherein the one or more improved functions are improved cell adhesion, increased cell viability, reduced apoptosis, reduced cell injury, increased cell proliferation, increased cell barrier function, reduced DNA damage, increased angiogenesis, improved vascular maintenance, reduced mitochondrial stress signaling, reduced production of reactive oxygen species, or any combination thereof.

261. 261. The method of claim 260, wherein said reduced cytotoxicity is associated with a decrease in TLR9 expression, an alteration in heme oxygenase-1 (HO-1) expression, a reduction in cytosolic mtDNA, or any combination thereof.

262. 262. The method of claim 261, wherein the alteration in HO-1 expression is an increase in HO-1 expression after exposure to cold.

263. The method of claim 260, wherein the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell damage is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof.

264. The method of claim 263, wherein the reduction in cell apoptosis is associated with a decrease in the expression of at least one pro-apoptotic marker.

265. 265. The method of claim 264, wherein the at least one pro-apoptotic marker is BIM, PUMA, BAX, BAK, SMAC, DIABLO, BID, NOXA, BIK, or any combination thereof.

266. The method of claim 263, wherein the decrease in cell apoptosis is associated with an increase in the expression of at least one anti-apoptotic marker.

267. 267. The method of claim 266, wherein said at least one anti-apoptotic marker is BCL-2, BCL-XL, BCL-W, MCL-1, A1 / BFL-1, or any combination thereof.

268. 268. The method of any one of claims 1-267, wherein the organ, tissue, kidney, or lung treated with the isolated mitochondria has increased glucose uptake and decreased lactate production compared to a corresponding organ, tissue, kidney, or lung not treated with the isolated mitochondria.

269. The method of claim 268, wherein the increased glucose uptake and decreased lactate production is associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof.

270. 270. The method of any one of claims 1 to 269, wherein the organ, tissue, kidney, or lung is a human organ, tissue, kidney, or lung.

271. 1. A method for treating a lung disease or disorder in a subject in need thereof, or for improving lung function of a donor before or after transplantation, comprising administering to the lungs of the subject or donor a pharmaceutical composition comprising mesenchymal stem cells or endothelial progenitor cells pretreated with isolated mitochondria, or extracellular vesicles isolated from mesenchymal stem cells or endothelial progenitor cells.

272. 1. A method for treating a lung disease or disorder in a subject in need thereof, or for improving lung function of a donor before or after transplantation, comprising administering to the lungs of the subject or donor (A) mesenchymal stem cells or endothelial progenitor cells, or extracellular vesicles isolated from mesenchymal stem cells or endothelial progenitor cells, and (B) isolated mitochondria, wherein (A) and (B) are contained in a single pharmaceutical composition or in two separate pharmaceutical compositions.

273. 273. The method of claim 271 or 272, wherein the isolated mitochondria are isolated porcine mitochondria.

274. 273. The method of claim 271 or 272, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the subject's or donor's lungs.

275. 273. The method of claim 271 or 272, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject's or donor's lungs.

276. 276. The method of any one of claims 271 to 275, wherein the pulmonary disease or disorder is pulmonary hypertension, bronchopulmonary dysplasia (BPD), pulmonary fibrosis, asthma, sleep-disordered breathing, or chronic obstructive pulmonary disease (COPD).

277. The method of claim 276, wherein the pulmonary hypertension is pulmonary hypertension due to COPD, chronic thromboembolic pulmonary hypertension (CTEPH), pulmonary arterial hypertension (PAH), pulmonary veno-occlusive disease (PVOD), pulmonary capillary hemangiomatosis (PCH), persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

278. 1. A method for treating a pulmonary disease or disorder in a subject in need thereof, comprising: (i) administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering a therapeutically effective amount of a drug for treating said pulmonary disease or disorder; wherein the composition is administered to the subject before, simultaneously with, or after administration of a drug to treat the pulmonary disease or disorder.

279. 279. The method of claim 278, wherein the isolated mitochondria are isolated porcine mitochondria.

280. 279. The method of claim 278, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

281. 279. The method of claim 278, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

282. 282. The method of any one of claims 278 to 281, wherein the pulmonary disease or disorder is pulmonary hypertension, asthma, sleep-disordered breathing, BPD, COPD, or pulmonary fibrosis.

283. The method of claim 282, wherein the pulmonary hypertension is COPD, CTEPH, PAH, PVOD, PCH, persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

284. The method of any one of claims 278 to 283, wherein the agent for treating a pulmonary disease or disorder is selected from the group consisting of treprostinil, epoprostenol, iloprost, bosentan, ambrisentan, macitentan, and sildenafil.

285. 1. A method for treating pulmonary hypertension in a subject in need thereof, comprising: (i) administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering a therapeutically effective amount of treprostinil, wherein the composition is administered to the subject before, simultaneously with, or after administration of treprostinil.

286. 286. The method of claim 285, wherein the isolated mitochondria are isolated porcine mitochondria.

287. 286. The method of claim 285, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

288. 286. The method of claim 285, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

289. The method of any one of claims 285 to 288, wherein the pulmonary hypertension is pulmonary hypertension due to COPD, CTEPH, PAH, PVOD, PCH, persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

290. 1. A method for treating a pulmonary disease or disorder in a subject in need thereof or for improving donor lung function pre- or post-transplant, the method comprising: (i) administering to the lungs of the subject or donor a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering a therapeutically effective amount of UNEX-42 to the lungs of the subject or donor; wherein the composition is administered to the lungs of the subject or donor before, simultaneously with, or after administration of UNEX-42.

291. 291. The method of claim 290, wherein the isolated mitochondria are isolated porcine mitochondria.

292. 291. The method of claim 290, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

293. 291. The method of claim 290, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

294. 1. A method for treating a pulmonary disease or disorder in a subject in need thereof or for improving donor lung function pre- or post-transplant, the method comprising: (i) administering to the lungs of the subject or donor a therapeutically effective amount of a composition comprising isolated mitochondria; and (ii) administering a therapeutically effective amount of an antioxidant to the lungs of the subject or donor; wherein the composition is administered to the lungs of the subject or donor before, simultaneously with, or after administration of an antioxidant.

295. 295. The method of claim 294, wherein the isolated mitochondria are isolated porcine mitochondria.

296. 295. The method of claim 294, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

297. 295. The method of claim 294, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

298. 298. The method of any one of claims 294 to 297, wherein the antioxidant is n-acetylcysteine, tempol, or resveratrol.

299. 300. The method of any one of claims 294-298, wherein the antioxidant is administered to the lungs of the subject or donor simultaneously with, and as part of, a composition comprising isolated mitochondria.

300. 1. A method for treating an acute exacerbation of a pulmonary disease or disorder in a subject, the method comprising administering to the subject an effective amount of a composition comprising isolated mitochondria for rescue therapy.

301. 301. The method of claim 300, wherein the isolated mitochondria are isolated porcine mitochondria.

302. 301. The method of claim 300, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

303. 301. The method of claim 300, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

304. 304. The method of any one of claims 300 to 303, wherein the pulmonary disease or disorder is pulmonary hypertension, asthma, sleep-disordered breathing, BPD, COPD, or pulmonary fibrosis.

305. The method of claim 304, wherein the pulmonary hypertension is pulmonary hypertension due to COPD, CTEPH, PAH, PVOD, PCH, persistent pulmonary hypertension of the newborn, BPD-induced pulmonary hypertension, pulmonary hypertension secondary to left heart disease, pulmonary hypertension due to lung disease, chronic hypoxia, chronic arterial occlusion, or pulmonary hypertension with an unknown or multifactorial mechanism.

306. 1. A method for treating acute kidney injury in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a composition comprising isolated mitochondria.

307. 307. The method of claim 306, wherein the isolated mitochondria are isolated porcine mitochondria.

308. 307. The method of claim 306, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

309. 307. The method of claim 306, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

310. 310. The method of any one of claims 306-309, wherein administering a therapeutically effective amount of said composition reduces serum levels of one or more pro-inflammatory cytokines or pro-inflammatory mediators in said subject.

311. 311. The method of claim 310, wherein the one or more pro-inflammatory cytokines or pro-inflammatory mediators are selected from the group consisting of monocyte chemoattractant protein 1 (MCP1), C3A, and C5a.

312. The method of any one of claims 306-311, wherein administering a therapeutically effective amount of said composition reduces kidney injury molecule-1 (KIM1) serum levels in said subject.

313. 313. The method of any one of claims 306-312, wherein administering a therapeutically effective amount of the composition reduces blood urea nitrogen (BUN) levels in the subject.

314. 314. The method of any one of claims 306 to 313, wherein administering a therapeutically effective amount of the composition reduces kidney weight in the subject.

315. 1. A method for treating a subject undergoing cardiac arrest or resuscitation therapy, the method comprising administering to the subject an effective amount of a composition comprising isolated mitochondria to facilitate transport of the subject to a medical facility or medical treatment.

316. 316. The method of claim 315, wherein the isolated mitochondria are isolated porcine mitochondria.

317. 316. The method of claim 315, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

318. The method of any one of claims 278 to 317, wherein the composition is administered to the subject by inhalation.

319. 318. The method of any one of claims 278-317, wherein the composition is administered to the lungs of the subject or donor via the pulmonary airways.

320. The method of any one of claims 278 to 317, wherein the composition is administered to the lungs of the subject or donor by injection.

321. The method of any one of claims 278 to 320, wherein the composition further comprises at least one pharmaceutically acceptable carrier or excipient.

322. The method of claim 321, wherein the at least one pharmaceutically acceptable carrier or excipient is selected from the group consisting of a respiratory buffer, one or more extracellular matrix components, an organ or tissue preservation solution, saline, water, a balanced salt solution, aqueous dextrose, one or more polyols, and a vegetable oil.

323. The method of any one of claims 278 to 322, wherein the composition further comprises at least one active ingredient.

324. 324. The method of claim 323, wherein the at least one active ingredient is selected from the group consisting of treprostinil, antioxidants, UNEX-42, and anti-inflammatory agents.

325. The method of any one of claims 278 to 324, wherein the subject is a human subject.

326. 1. A method for preserving a tissue or organ for transport and transplantation, comprising delivering isolated mitochondria to the tissue or organ intended for transport and transplantation, wherein the tissue or organ is obtained from a deceased donor.

327. 327. The method of claim 326, wherein the isolated mitochondria are isolated porcine mitochondria.

328. 327. The method of claim 326, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said deceased donor.

329. 327. The method of claim 326, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the deceased donor.

330. 330. The method of any one of claims 326-329, wherein the isolated mitochondria are delivered to the tissue or organ within 24 hours of the donor's death.

331. 330. The method of any one of claims 326-329, wherein the isolated mitochondria are delivered to the tissue or organ within 12 hours of the donor's death.

332. 330. The method of any one of claims 326-329, wherein the isolated mitochondria are delivered to the tissue or organ within four hours of the donor's death.

333. 333. The method of any one of claims 326-332, further comprising the step of obtaining said tissue or organ from said deceased donor by harvesting said tissue or organ from said deceased donor.

334. 334. The method of claim 333, wherein the isolated mitochondria are delivered to the tissue or organ prior to harvesting the tissue or organ from the deceased donor.

335. 334. The method of claim 333, wherein the isolated mitochondria are delivered to the tissue or organ after harvesting the tissue or organ from the deceased donor.

336. 336. The method of any one of claims 326-335, wherein the tissue or organ is selected from the group consisting of heart, liver, lung, blood vessel, ureter, trachea, skin patch, or kidney.

337. 337. The method of claim 336, wherein the isolated mitochondria are delivered to the tissue or organ by injection.

338. 337. The method of claim 336, wherein the tissue or organ is a kidney.

339. 339. The method of claim 338, wherein the isolated mitochondria are delivered to the kidney via a vein or via an artery.

340. 337. The method of claim 336, wherein the tissue or organ is the lung.

341. 341. The method of claim 340, wherein the isolated mitochondria are delivered to the lungs via the airways, via a vein, or via an artery.

342. 341. The method of claim 340, wherein the isolated mitochondria are delivered to the lung by EVLP.

343. 343. The method of any one of claims 326 to 342, wherein the tissue or organ is a human tissue or organ.

344. 1. A method for preserving a limb or other body part lost by traumatic amputation, said method comprising delivering isolated mitochondria to said limb or other body part after traumatic amputation of said limb or other body part.

345. The method of claim 344, wherein the isolated mitochondria are isolated pig mitochondria.

346. 345. The method of claim 344, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said limb or other part of the body.

347. 345. The method of claim 344, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the limb or other part of the body.

348. 345. The method of claim 344, wherein the isolated mitochondria are delivered to the severed limb or other part of the body within 15 minutes, 30 minutes, 1 hour, 4 hours, 8 hours, 12 hours, or 24 hours after traumatic amputation.

349. 349. The method of claim 347 or 348, wherein the isolated mitochondria are delivered to the amputated limb or other part of the body by injection.

350. 350. A method according to any one of claims 344 to 349, wherein the limb or other body part is a human limb or other body part.

351. 1. A method of reducing inflammation in a subject in need thereof, comprising: (ii) delivering the isolated mitochondria to hematopoietic cells isolated from said subject; and (iii) administering the hematopoietic cells treated with the isolated mitochondria to the subject.

352. 352. The method of claim 351, wherein the isolated mitochondria are isolated porcine mitochondria.

353. 352. The method of claim 351, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

354. 352. The method of claim 351, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the subject.

355. The method of claim 351, wherein the hematopoietic cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding hematopoietic cells not treated with the isolated mitochondria.

356. The method of claim 355, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

357. 357. The method of any one of claims 351-356, further comprising the step of introducing a transgene encoding at least one heterologous protein into said isolated hematopoietic cells prior to the step of delivering said isolated mitochondria to said hematopoietic cells.

358. 357. The method of any one of claims 351-356, further comprising, after the step of delivering the isolated mitochondria to hematopoietic cells, introducing a transgene encoding at least one heterologous protein into the isolated hematopoietic cells.

359. The method of any one of claims 351 to 356, wherein the isolated hematopoietic cells are bone marrow cells or bone marrow progenitor cells.

360. 360. The method of claim 359, wherein the bone marrow cells or bone marrow progenitor cells are monocytes, macrophages, neutrophils, hematopoietic stem cells, bone marrow progenitor cells, or any combination thereof.

361. 361. The method of any one of claims 351-360, wherein the hematopoietic cells are isolated from the peripheral blood of the subject.

362. The method of claim 361, wherein the subject has been treated with a stem cell mobilizing agent prior to isolating the hematopoietic cells from the peripheral blood.

363. 363. The method of claim 362, wherein the stem cell mobilizing agent is granulocyte colony-stimulating factor (G-CSF).

364. 361. The method of any one of claims 351-360, wherein said hematopoietic cells are isolated from the bone marrow of said subject.

365. 365. The method of any one of claims 351-364, further comprising differentiating said isolated hematopoietic cells ex vivo prior to the step of delivering said isolated mitochondria to said isolated hematopoietic cells.

366. The method of any one of claims 351-364, further comprising, after the step of delivering said isolated mitochondria to said isolated hematopoietic cells, differentiating said isolated hematopoietic cells ex vivo.

367. The method of claim 365 or 366, wherein the isolated hematopoietic cells are differentiated ex vivo into macrophages having an M1 or M2 phenotype.

368. The method of any one of claims 351 to 367, wherein the hematopoietic cells treated with isolated mitochondria have reduced expression of NF-κB compared to corresponding hematopoietic cells not treated with isolated mitochondria.

369. The method of any one of claims 351-368, wherein the hematopoietic cells treated with isolated mitochondria exhibit reduced secretion of a pro-inflammatory cytokine or chemokine selected from the group consisting of MIP-1β (CCL4), PDGF-BB, RANTES, (CCL5), soluble ICAM-1 (sICAM-1), M-CSF (CSF-1), IL-1β, IL-6, IL-8 (CXCL8), GDF-15, TGF-β1, and any combination thereof, compared to corresponding hematopoietic cells not treated with isolated mitochondria.

370. 370. The method of any one of claims 351-369, wherein the isolated hematopoietic cells treated with the isolated mitochondria are administered to the subject by infusion.

371. 371. The method of any one of claims 351 to 370, wherein the isolated hematopoietic cells treated with the isolated mitochondria are administered to the subject as part of a microcarrier.

372. 372. The method of any one of claims 351 to 371, wherein the subject is a human subject.

373. 1. A method of improving cellular function in an isolated cell, said method comprising delivering isolated mitochondria to said isolated cell.

374. 374. The method of claim 373, wherein the isolated mitochondria are isolated porcine mitochondria.

375. 374. The method of claim 373, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said isolated cells.

376. The method of claim 373, wherein the cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding cells not treated with the isolated mitochondria.

377. The method of claim 376, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

378. 378. The method of any one of claims 373-377, wherein the isolated cells are epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, skeletal muscle cells, cardiac muscle cells, hepatocytes, immune cells, mesenchymal cells, pericytes, neuronal cells, or any combination thereof.

379. The method of claim 378, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

380. The method of claim 378, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

381. The method of claim 378, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

382. The method of claim 378, wherein the immune cells comprise hematopoietic cells.

383. 383. The method of any one of claims 373-382, wherein the cells treated with the isolated mitochondria exhibit increased extracellular vesicle secretion compared to corresponding cells not treated with the isolated mitochondria.

384. 384. The method of any one of claims 373-383, wherein the cells treated with the isolated mitochondria have an altered extracellular vesicle composition compared to corresponding cells not treated with the isolated mitochondria.

385. The method of claim 384, wherein the altered extracellular vesicle composition is altered with respect to protein content, nucleic acid content, lipid content, or any combination thereof.

386. 386. The method of any one of claims 373-385, further comprising the step of introducing a transgene encoding at least one heterologous protein into said isolated cells prior to the step of delivering said isolated mitochondria to said isolated cells.

387. 386. The method of any one of claims 373-385, further comprising the step of introducing a transgene encoding at least one heterologous protein into said isolated cells after the step of delivering said isolated mitochondria to said isolated cells.

388. The method of claim 386 or 387, wherein the heterologous protein is secreted from the cell in an extracellular vesicle.

389. 389. The method of any one of claims 373-388, wherein the cells treated with the isolated mitochondria have decreased cell apoptosis, increased cell viability, decreased autophagy, decreased mitophagy, decreased senescence, decreased mitochondrial stress signaling, decreased reactive oxygen species production, decreased cell inflammation, decreased cell injury, increased cell barrier function, increased angiogenesis, increased cell adhesion, increased proliferation rate, or any combination thereof, compared to corresponding cells not treated with the isolated mitochondria.

390. 390. The method of claim 389, wherein said reduced cytotoxicity is associated with a decrease in TLR9 expression, an alteration in heme oxygenase-1 (HO-1) expression, a reduction in cytosolic mtDNA, or any combination thereof.

391. 391. The method of claim 390, wherein the change in HO-1 expression is an increase in HO-1 expression after exposure to cold.

392. The method of claim 389, wherein the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell damage is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof.

393. The method of claim 389, wherein the reduction in cell apoptosis is associated with a decrease in the expression of at least one pro-apoptotic marker.

394. 394. The method of claim 393, wherein the at least one pro-apoptotic marker is BIM, PUMA, BAX, BAK, SMAC, DIABLO, BID, NOXA, BIK, or any combination thereof.

395. The method of claim 389, wherein the decrease in cell apoptosis is associated with an increase in the expression of at least one anti-apoptotic marker.

396. 396. The method of claim 395, wherein said at least one anti-apoptotic marker is BCL-2, BCL-XL, BCL-W, MCL-1, A1 / BFL-1, or any combination thereof.

397. 397. The method of any one of claims 373-396, wherein the cells treated with the isolated mitochondria have increased glucose uptake and decreased lactate production compared to corresponding cells not treated with the isolated mitochondria.

398. The method of claim 397, wherein the increased glucose uptake and decreased lactate production is associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof.

399. 400. The method of any one of claims 373 to 398, wherein cells treated with said isolated mitochondria have improved cell adhesion and proliferation rates on a two-dimensional or three-dimensional cell support compared to corresponding cells not treated with said isolated mitochondria.

400. 399. The method of claim 399, wherein the two-dimensional or three-dimensional cell support is a microcarrier.

401. 401. The method of claim 399 or 400, wherein the two-dimensional or three-dimensional cell support comprises one or more extracellular matrix components.

402. 402. The method of any one of claims 373-401, wherein the cells treated with the isolated mitochondria maintain viability in cold ischemia longer than corresponding cells not treated with the isolated mitochondria.

403. 403. The method of any one of claims 373 to 402, wherein the isolated cell is an isolated human cell.

404. 1. A method for improving cell therapy in a subject in need thereof, the method comprising: (i) delivering isolated mitochondria to isolated cells in vitro; and (ii) administering the cells treated with the isolated mitochondria to the subject.

405. 405. The method of claim 404, wherein the isolated mitochondria are isolated porcine mitochondria.

406. 405. The method of claim 404, wherein said isolated mitochondria are isolated human mitochondria that are allogeneic to said subject.

407. 405. The method of claim 404, wherein said isolated mitochondria are isolated human mitochondria that are autologous to said subject.

408. The method of claim 404, wherein the cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding cells not treated with the isolated mitochondria.

409. The method of claim 408, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

410. 410. The method of any one of claims 404-409, wherein the isolated cells are epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, skeletal muscle cells, cardiomyocytes, hepatocytes, immune cells, mesenchymal cells, pericytes, neuronal cells, or any combination thereof.

411. The method of claim 410, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

412. The method of claim 410, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

413. 411. The method of claim 410, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

414. 411. The method of claim 410, wherein the immune cells comprise hematopoietic cells.

415. 415. The method of any one of claims 404-414, wherein the isolated cells are allogeneic cells.

416. 415. The method of any one of claims 404-414, wherein the isolated cells are autologous cells.

417. 417. The method of claim 416, further comprising isolating the autologous cells from the subject prior to delivering isolated mitochondria to the isolated cells in vitro.

418. 418. The method of any one of claims 404-417, wherein the cells treated with the isolated mitochondria exhibit increased extracellular vesicle secretion compared to corresponding cells not treated with the isolated mitochondria.

419. The method of any one of claims 404 to 418, wherein the cells treated with the isolated mitochondria have an altered extracellular vesicle composition compared to corresponding cells not treated with the isolated mitochondria.

420. 420. The method of claim 419, wherein the altered extracellular vesicle composition is altered with respect to protein content, nucleic acid content, lipid content, or any combination thereof.

421. 421. The method of any one of claims 404-420, further comprising the step of introducing a transgene encoding at least one heterologous protein into said isolated cells prior to the step of delivering said isolated mitochondria to said isolated cells.

422. 421. The method of any one of claims 404-420, further comprising, after the step of delivering said isolated mitochondria to said isolated cells, introducing a transgene encoding at least one heterologous protein into said isolated cells.

423. The method of claim 421 or 422, wherein the heterologous protein is secreted from the cell in extracellular vesicles.

424. 424. The method of any one of claims 404-423, wherein the isolated mitochondria treated cells are administered to the subject by injection.

425. 424. The method of any one of claims 404-423, wherein the isolated mitochondria-treated cells are administered to the subject via the airway.

426. 426. The method of claim 424 or 425, wherein the cells treated with the isolated mitochondria are administered to the subject as part of a microcarrier.

427. 427. The method of any one of claims 404-426, wherein the treated cells have decreased cell apoptosis, increased cell viability, decreased autophagy, decreased mitophagy, decreased senescence, decreased mitochondrial stress signaling, decreased cell injury, decreased reactive oxygen species production, decreased cell inflammation, increased cell barrier function, increased angiogenesis, increased cell adhesion, increased proliferation rate, or any combination thereof, compared to corresponding cells not treated with the isolated mitochondria.

428. 428. The method of claim 427, wherein the reduced cytotoxicity is associated with a decrease in TLR9 expression, an alteration in heme oxygenase-1 (HO-1) expression, a reduction in cytosolic mtDNA, or any combination thereof.

429. The method of claim 428, wherein the alteration in HO-1 expression is an increase in HO-1 expression after exposure to cold.

430. The method of claim 427, wherein the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell damage is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof.

431. The method of claim 427, wherein the reduction in cell apoptosis is associated with a decrease in the expression of at least one pro-apoptotic marker.

432. 432. The method of claim 431, wherein the at least one pro-apoptotic marker is BIM, PUMA, BAX, BAK, SMAC, DIABLO, BID, NOXA, BIK, or any combination thereof.

433. The method of claim 427, wherein the decrease in cell apoptosis is associated with an increase in the expression of at least one anti-apoptotic marker.

434. 434. The method of claim 433, wherein said at least one anti-apoptotic marker is BCL-2, BCL-XL, BCL-W, MCL-1, A1 / BFL-1, or any combination thereof.

435. 435. The method of any one of claims 404-434, wherein the treated cells have increased glucose uptake and decreased lactate production compared to corresponding cells not treated with the isolated mitochondria.

436. The method of claim 435, wherein the increased glucose uptake and decreased lactate production is associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof.

437. 437. The method of any one of claims 404 to 436, wherein cells treated with said isolated mitochondria have improved cell adhesion and proliferation rates on a two-dimensional or three-dimensional cell support compared to corresponding cells not treated with said isolated mitochondria.

438. The method of claim 437, wherein the two-dimensional or three-dimensional cell support is a microcarrier.

439. The method of claim 437 or 438, wherein the two-dimensional or three-dimensional cell support comprises one or more extracellular matrix components.

440. 440. The method of any one of claims 404-439, wherein cells treated with said isolated mitochondria maintain viability in cold ischemia longer than corresponding cells not treated with said isolated mitochondria.

441. The method of any one of claims 404 to 440, wherein the subject is a human subject.

442. 1. A method for improving cold transport, cold shipping, or cold storage of isolated cells, the method comprising delivering isolated mitochondria to the isolated cells before, during, or after cold transport, cold shipping, or cold storage, wherein the cells treated with the isolated mitochondria have at least a 5% improvement in viability compared to corresponding cells not treated with the isolated mitochondria.

443. 443. The method of claim 442, wherein the isolated mitochondria are isolated porcine mitochondria.

444. 443. The method of claim 442, wherein the isolated mitochondria are isolated human mitochondria that are allogeneic to the cells.

445. 443. The method of claim 442, wherein the isolated mitochondria are isolated human mitochondria that are autologous to the cell.

446. The method of claim 442, wherein cells treated with the isolated mitochondria have reduced production of ROS-mediated oxidative by-products, improved cell viability, reduced necrosis, reduced cell lysis, increased total levels of cellular ATP, reduced inflammatory cytokine secretion, or any combination thereof, compared to corresponding cells not treated with the isolated mitochondria.

447. The method of claim 446, wherein the inflammatory cytokines include IL-6, IL-8, and IFN-γ.

448. The method of claim 446, wherein the ROS-mediated oxidation byproducts include 4-HNE and 8-OHdG.

449. The method of claim 442, wherein cells treated with the isolated mitochondria have at least 5% improved mitochondrial function compared to corresponding cells not treated with the isolated mitochondria.

450. The method of claim 449, wherein the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

451. 451. The method of any one of claims 442-450, wherein the isolated cells are epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, skeletal muscle cells, cardiac muscle cells, hepatocytes, immune cells, mesenchymal cells, pericytes, neuronal cells, or any combination thereof.

452. The method of claim 451, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

453. The method of claim 452, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

454. The method of claim 452, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

455. The method of claim 452, wherein the immune cells comprise hematopoietic cells.

456. 456. The method of any one of claims 442-455, further comprising the step of cryopreserving said human cells treated with said isolated mitochondria.

457. 457. The method of claim 456, wherein the isolated mitochondria are delivered to the human cells prior to the step of cryopreserving the human cells, during the step of cryopreserving the human cells, upon thawing from cryopreservation, or any combination thereof.

458. 457. The method of claim 456, wherein the human cells treated with the isolated mitochondria are cryopreserved by step-down liquid nitrogen freezing.

459. 459. The method of any one of claims 442-458, wherein the cells treated with the isolated mitochondria are maintained in a solution comprising lipids, proteins, sugars, polysaccharides, or any combination thereof.

460. 460. The method of claim 459, wherein the sugar or polysaccharide is a monosaccharide, disaccharide, or oligosaccharide.

461. 459. The method of any one of claims 442-458, wherein the cells treated with the isolated mitochondria are maintained in a solution comprising trehalose, sucrose, glycerol, PlasmaLyte, CryoStor, DMSO, lipids, glutamic acid, PEG, PVA, albumin, or any combination thereof.

462. 1. A method for cryopreserving isolated mitochondria, said method comprising freezing isolated mitochondria in a freezing buffer comprising a cryoprotectant.

463. 463. The method of claim 462, wherein the isolated mitochondria are isolated porcine mitochondria.

464. 463. The method of claim 462, wherein the isolated mitochondria are isolated human mitochondria.

465. 465. The method of any one of claims 462-464, further comprising isolating said mitochondria from a cell or tissue.

466. 466. The method of any one of claims 462-465, wherein the cryoprotectant is a lipid, a protein, a sugar, a disaccharide, an oligosaccharide, a polysaccharide, or any combination thereof.

467. The method of any one of claims 462 to 465, wherein the cryoprotectant is trehalose, sucrose, glycerol, PlasmaLyte, CryoStor, DMSO, glutamic acid, PEG, PVA, albumin, or any combination thereof.

468. 468. The method of any one of claims 462-467, wherein the isolated mitochondria are cryopreserved by step-down liquid nitrogen freezing.

469. 469. The method of any one of claims 462-468, further comprising thawing the frozen isolated mitochondria and assessing the health and / or function of the thawed isolated mitochondria by measuring one or more of mitochondrial swelling, mitochondrial permeability transition pore (mPTP) opening, mitochondrial respiration, mitochondrial membrane potential, complete mitochondrial permeability, and mitochondrial swelling.

470. 469. The method of any one of claims 462-468, further comprising thawing the frozen isolated mitochondria and assessing the health and / or function of the thawed isolated mitochondria by scoring overall mitochondrial morphology and / or measuring average mitochondrial size.

471. 1. A method for long-term storage of isolated mitochondria, comprising: (i) isolating mitochondria from cells or tissues; (ii) suspending the isolated mitochondria in a cryopreservation buffer; (iii) freezing the isolated mitochondria in a cryopreservation buffer at a temperature of about −70° C. to about −100° C.; and (iv) maintaining the frozen isolated mitochondria at a temperature of about −70° C. to about −100° C. for 24 hours or more.

472. 472. The method of claim 471, wherein the isolated mitochondria are isolated porcine mitochondria.

473. 472. The method of claim 471, wherein the isolated mitochondria are isolated human mitochondria.

474. 474. The method of claim 473, wherein said isolated mitochondria in a cryopreservation buffer are frozen at a temperature of about -75°C to about -95°C, and said frozen isolated mitochondria are maintained at a temperature of about -75°C to about -95°C.

475. 475. The method of claim 474, wherein said isolated mitochondria in cryopreservation buffer are frozen at a temperature of about -80°C to about -90°C, and said frozen isolated mitochondria are maintained at a temperature of about -80°C to about -90°C.

476. 476. The method of any one of claims 471-475, wherein the cryopreservation buffer comprises trehalose, sucrose, glycerol, CryoStor, or any combination thereof.

477. 477. The method of claim 476, wherein the cryopreservation buffer is isotonic and has a pH of about 7.0 to about 7.

5.

478. 478. The method of claim 477, wherein the cryopreservation buffer comprises trehalose.

479. 479. The method of any one of claims 471-478, wherein said frozen isolated mitochondria are maintained at said temperature for one week or more.

480. 479. The method of any one of claims 471-478, wherein said frozen isolated mitochondria are maintained at said temperature for one month or more.

481. 479. The method of any one of claims 471-478, wherein said frozen isolated mitochondria are maintained at said temperature for one year or more.

482. The method of any one of claims 471 to 481, further comprising: (v) thawing the frozen isolated mitochondria; and (vi) assessing the health and / or function of the thawed isolated mitochondria by measuring one or more of mitochondrial swelling, mitochondrial permeability transition pore (mPTP) opening, mitochondrial respiration, mitochondrial membrane potential, complete mitochondrial permeability, and mitochondrial swelling.

483. The method of any one of claims 471 to 481, further comprising: (v) thawing the frozen isolated mitochondria; (vi) assessing the health of the thawed isolated mitochondria by measuring mitochondrial swelling using flow cytometry; and (vii) Isolating healthy mitochondria from mitochondria with a swollen phenotype using flow cytometry-assisted cell sorting.

484. A method for detecting pig mitochondria in a human cell, tissue, or organ sample, said method comprising detecting the presence of a nucleic acid marker in said human cell, tissue, or organ sample in vitro or ex vivo, wherein said nucleic acid marker comprises a sequence of mitochondrial DNA or RNA, and said nucleic acid marker is present in pig mitochondria and absent from human mitochondria.

485. The method of claim 484, further comprising amplifying the nucleic acid marker by polymerase chain reaction (PCR).

486. The method of claim 484 or 485, wherein the presence of the nucleic acid marker is detected by PCR using a primer pair, at least one of the primers of the primer pair specifically hybridizing to the nucleic acid marker.

487. 486. The method of claim 484 or 485, wherein the presence of the nucleic acid marker is detected using a nucleic acid probe that specifically hybridizes to the nucleic acid marker.

488. The method of any one of claims 484 to 487, further comprising quantifying the amount of said nucleic acid marker in said human cell, tissue or organ sample.

489. A composition comprising human cells, wherein the cytosol of the human cells comprises exogenous mitochondria, and the human cells of the composition have at least 5% improved mitochondrial function compared to corresponding human cells lacking exogenous mitochondria, and the improved mitochondrial function is increased oxygen consumption and / or increased ATP synthesis.

490. The composition of claim 489, wherein the exogenous mitochondria are porcine mitochondria.

491. The composition of claim 490, wherein the exogenous mitochondria are derived from pig heart.

492. The composition of claim 489, wherein the exogenous mitochondria are human mitochondria that are allogeneic to the human cells.

493. 493. The composition of any one of claims 489-492, wherein the human cells are epithelial cells, endothelial cells, fibroblasts, progenitor cells, smooth muscle cells, skeletal muscle cells, cardiac muscle cells, hepatocytes, immune cells, mesenchymal cells, pericytes, neuronal cells, or any combination thereof.

494. The composition of claim 493, wherein the endothelial cells comprise human pulmonary artery endothelial cells (HPAECs).

495. The composition of claim 493, wherein the smooth muscle cells comprise pulmonary artery smooth muscle cells.

496. The composition of claim 493, wherein the progenitor cells comprise endothelial progenitor cells and / or mesenchymal stem cells.

497. The composition of claim 493, wherein the immune cells comprise hematopoietic cells.

498. The composition of any one of claims 489 to 497, wherein the human cells have increased secretion of extracellular vesicles compared to corresponding human cells lacking exogenous mitochondria.

499. The composition of any one of claims 489 to 498, wherein the human cells have an altered extracellular vesicle composition compared to a corresponding human cell lacking exogenous mitochondria.

500. The composition of claim 499, wherein the altered extracellular vesicle composition is altered with respect to protein content, nucleic acid content, lipid content, or any combination thereof.

501. The composition of any one of claims 489-500, wherein said human cells further comprise a transgene encoding at least one heterologous protein.

502. The composition of claim 501, wherein transcription of the transgene occurs in the nucleus of the human cell.

503. The composition of claim 502, wherein the transgene is stably integrated into the nuclear DNA of the human cell.

504. The composition of claim 502 or 503, wherein the heterologous protein is secreted from human cells in extracellular vesicles.

505. The composition of claim 501, wherein transcription of the transgene occurs in exogenous mitochondria.

506. The composition of claim 505, wherein the transgene is stably integrated into the mitochondrial DNA (mtDNA) of the exogenous mitochondria.

507. The composition of any one of claims 489-506, wherein the human cells maintain viability in cold ischemia longer than corresponding human cells lacking exogenous mitochondria.

508. The composition of any one of claims 489-507, wherein the human cells have decreased cell apoptosis, increased cell viability, decreased autophagy, decreased mitophagy, decreased senescence, decreased mitochondrial stress signaling, decreased cell injury, decreased production of reactive oxygen species, decreased cell inflammation, increased cell barrier function, increased angiogenesis, increased cell adhesion, increased proliferation rate, or any combination thereof, compared to corresponding human cells lacking exogenous mitochondria.

509. The composition of claim 508, wherein the reduced cytotoxicity is associated with a decrease in TLR9 expression, an alteration in heme oxygenase-1 (HO-1) expression, a reduction in cytosolic mtDNA, or any combination thereof.

510. The composition of claim 509, wherein the alteration in HO-1 expression is an increase in HO-1 expression following exposure to cold.

511. The composition of claim 508, wherein the reduced cell apoptosis, increased cell viability, reduced mitochondrial stress signaling, and / or reduced cell damage is associated with reduced expression of NF-κB, MAPK14, JNK, p53, or any combination thereof.

512. The composition of claim 508, wherein the reduction in cell apoptosis is associated with a decrease in the expression of at least one pro-apoptotic marker.

513. The composition of claim 512, wherein the at least one pro-apoptotic marker is BIM, PUMA, BAX, BAK, SMAC, DIABLO, BID, NOXA, BIK, or any combination thereof.

514. The composition of claim 508, wherein the reduction in cell apoptosis is associated with an increase in the expression of at least one anti-apoptotic marker.

515. The composition of claim 514, wherein said at least one anti-apoptotic marker is BCL-2, BCL-XL, BCL-W, MCL-1, A1 / BFL-1, or any combination thereof.

516. The composition of any one of claims 489-515, wherein the human cells have increased glucose uptake and decreased lactate production compared to corresponding human cells lacking exogenous mitochondria.

517. The composition of claim 516, wherein the increased glucose uptake and decreased lactate production is associated with increased expression of HK, VDAC1, GLUT, AKT1, or any combination thereof.

518. 518. The composition of any one of claims 489-517, wherein the human cells have improved cell attachment and proliferation rates on a two-dimensional or three-dimensional cell support compared to corresponding human cells lacking exogenous mitochondria.

519. The composition of any one of claims 489 to 518, wherein the composition further comprises a two-dimensional or three-dimensional cell support.

520. The composition of claim 519, wherein the two-dimensional or three-dimensional cell support is a microcarrier.

521. The composition of claim 519 or 520, wherein the two-dimensional or three-dimensional cell support comprises one or more extracellular matrix components.

522. The composition of any one of claims 489 to 521, wherein the composition further comprises at least one pharmaceutically acceptable carrier or excipient.

523. The composition of claim 522, wherein the at least one pharmaceutically acceptable carrier or excipient is selected from the group consisting of a respiratory buffer, one or more extracellular matrix components, an organ or tissue preservation solution, saline, water, a balanced salt solution, aqueous dextrose, one or more polyols, and a vegetable oil.

524. The composition of any one of claims 489 to 523, wherein the composition further comprises at least one active ingredient.

525. The composition of claim 524, wherein the at least one active ingredient is selected from the group consisting of treprostinil, antioxidants, UNEX-42, and anti-inflammatory agents.