Combination Therapy

Abstract

The present invention relates to combination therapies for cystic fibrosis, in particular the combination of modulators of the cystic fibrosis transmembrane conductance regulator (CFTR) with gene therapy.

Description

[Technical Field]

[0001] The present invention relates to combination therapies for cystic fibrosis, in particular the combination of modulators of the cystic fibrosis transmembrane conductance regulator (CFTR) with gene therapy. [Background technology]

[0002] Cystic fibrosis (CF) is a serious genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. These mutations result in the production of defective CFTR protein, the dysfunction of which affects the balance of salts and fluids inside and outside cells. This imbalance leads to thick, sticky mucus in the lungs, pancreas, and other organs.

[0003] Current treatments for CF include CFTR modulator therapy, which aims to correct CFTR dysfunction. These modulator drugs have the ability to enhance or even restore the functional expression of specific mutations that cause CF. These CFTR modulator drugs have been classified into five major groups based on their effect on CFTR mutations: potentiators, correctors, stabilizers, readthrough agents, and amplifiers. To date, four CFTR modulators are commercially available: Kalydeco® (ivacaftor), Orkambi® (lumacaftor / ivacaftor), Symdeko® (tezacaftor / ivacaftor), and Trikafta® (elexacaftor / tezacaftor / ivacaftor).

[0004] While CFTR modulators provide significant improvement for many CF patients, approximately 10% remain modulator-insensitive or intolerant. In particular, despite the recent success of CFTR channel modulators, there is an unmet need for patients who cannot tolerate the side effects of ion channel modulator therapy or for the subset who still lack disease-modifying treatment options, e.g., patients affected by homozygous class I mutations.

[0005] Lung disease is the primary cause of morbidity and mortality in CF. Since the cloning of the CFTR gene in 1989, there has been considerable interest in the potential of gene therapy as a treatment for CF. However, the efficiency of gene transfer into airway epithelia is generally low, at least in part because the receptors for many viral vectors appear to be primarily localized on the basolateral surface of airway epithelia. These vectors can also have difficulty overcoming the body's host defenses, and efficient expression after re-administration remains challenging. As a result of these challenges, although several gene therapy approaches for CF, including adenovirus, adeno-associated virus (AAV), and plasmid-based vectors, have been investigated in clinical trials to date, none have progressed to market approval, primarily due to concerns about their limited efficacy. In addition, the ability to repeatedly administer conventional viral vectors is essential for lifelong treatment of self-renewing epithelia, but this is limited by the patient's adaptive immune response, which prevents successful repeated administration. Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there is a need for new and effective treatments for CF, particularly for patients who are insensitive or intolerant to CF modulators or who have no disease-modifying treatment options. In particular, one object of the present invention is to provide new treatments that can combine existing CF modulators, particularly CFTR potentiators, with CF gene therapy, potentially maximizing the benefits associated with CF gene therapy. Combination therapy may also address some of the drawbacks associated with current treatments, including modulator insensitivity / resistance and / or low gene transfer efficiency of CF gene therapy vectors. [Means for solving the problem]

[0007] We now demonstrate that the combination of a CFTR modulator, particularly a CFTR potentiator, with a lentiviral gene therapy vector can not only induce CTFR expression but also improve CTFR function and restore airway cell function. Specifically, using air-liquid interface (ALI) cultures of cells from two different CFTR mutant backgrounds (class I and class II), we demonstrated that the combination of (i) ivacaftor or (ii) ivacaftor-containing combinations with a SIV vector pseudotyped with the hemagglutinin-neuraminidase (HN) and fusion (F) proteins from a respiratory paramyxovirus (rSIV.F / HN) containing a CFTR transgene can induce CFTR expression, restore CFTR chloride current, and increase ciliary beat frequency in both class I and class II CFTR mutant ALI models. The inventors show for the first time that a combination of a CFTR modulator and CF gene therapy, particularly one using the rSIV.F / HN vector, can achieve functional correction in a class I CFTR mutation model, where class I null mutations result in the complete absence of full-length CFTR protein and are therefore typically not amenable to functional correction using a CFTR modulator alone. Thus, the inventors have demonstrated beneficial and unexpected effects between CFTR modulators, particularly potentiators, and rSIV.F / HN for at least class I and class II CFTR mutations. Even more surprisingly, the inventors have demonstrated that CFTR modulators, particularly those including a CFTR potentiator, such as ivacaftor, achieve greater than expected enhancement of the CFTR transgene expressed by rSIV.F / HN. In particular, the effect of the combination of a CFTR modulator, particularly a CFTR potentiator, with rSIV.F / HN-CFTR is greater than the additive effect of the individual effects of the CFTR modulator / potentiator and rSIV.F / HN-mediated CFTR expression.This is exemplified herein using the CFTR potentiator ivacaftor and rSIV.F / HN-CFTR, which achieve an effect that is greater than the additive effect of the individual effects of ivacaftor and rSIV.F / HN-mediated CFTR expression. Thus, the inventors have demonstrated for the first time the advantageous therapeutic potential of combining a CFTR modulator with rSIV.F / HN-based CF gene therapy, particularly for patients with class I CFTR mutations or who are otherwise insensitive, intolerant, or poorly responsive to CFTR modulators.

[0008] Accordingly, the present invention provides a combination of (i) a lentiviral vector pseudotyped with hemagglutinin-neuraminidase (HN) and fusion (F) proteins from a respiratory paramyxovirus, the lentiviral vector comprising a cystic fibrosis transmembrane conductance regulator (CFTR) transgene, and (ii) a CFTR modulator, for use in a method of treating cystic fibrosis (CF).

[0009] The lentiviral vector may be an SIV vector, and the respiratory paramyxovirus may be a Sendai virus. The transgene may be operably linked to a promoter selected from the group consisting of a cytomegalovirus (CMV) promoter, an elongation factor 1a (EF1a) promoter, and a hybrid human CMV enhancer / EF1a (hCEF) promoter. The lentiviral vector may comprise a hybrid human CMV enhancer / EF1a (hCEF) promoter, which may comprise or consist of a nucleotide sequence having at least 90% identity to SEQ ID NO:2. The CFTR transgene may be a codon-optimized CFTR transgene, which may comprise or consist of a nucleotide sequence having at least 90% identity to SEQ ID NO:1. The lentiviral vector may be produced using a codon-optimized plasmid. The lentiviral vector can be generated using (i) pGM691 (SEQ ID NO:7) and / or (ii) pGM830 (SEQ ID NO:9) or pGM326 (SEQ ID NO:8), and preferably also pGM299 (SEQ ID NO:11), pGM301 (SEQ ID NO:12), and / or pGM303 (SEQ ID NO:13). The lentiviral vector can be vGM058, vGM195, or vGM244. The lentiviral vector can be an SIV vector pseudotyped with the hemagglutinin-neuraminidase (HN) and fusion (F) protein of Sendai virus, wherein the vector contains a modified retroviral RNA sequence comprising or consisting of the nucleic acid sequence of SEQ ID NO:16. The lentiviral vector can comprise an F protein having a first subunit comprising or consisting of the amino acid sequence of SEQ ID NO:19 and a second subunit comprising or consisting of the amino acid sequence of SEQ ID NO:20.The lentiviral vector may further comprise (a) a p17 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 22, (b) a p24 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 23, (c) a p8 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 24, (d) a protease comprising or consisting of the amino acid sequence of SEQ ID NO: 25, (e) a p51 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 26, (f) a p15 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 27, (g) a p31 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 28, (h) a Gag protein comprising or consisting of the amino acid sequence of SEQ ID NO: 29, and / or (i) a Pol protein comprising or consisting of the amino acid sequence of SEQ ID NO: 30, and the vector may comprise each of (a) to (g).

[0010] The CFTR modulator may be a CFTR potentiator and / or a CFTR corrector, preferably a CFTR potentiator. The CFTR modulator may be selected from ivacaftor, tezacaftor, elexacaftor, or lumacaftor, or a combination thereof. Preferably, the CFTR modulator is ivacaftor.

[0011] The present invention provides a combination of (A) an SIV vector pseudotyped with Sendai virus hemagglutinin-neuraminidase (HN) and a fusion (F) protein, wherein (a) the vector comprises a modified retroviral RNA sequence that comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 16, and (b) the F protein comprises a first subunit that comprises, or consists of, the amino acid sequence of SEQ ID NO: 19 and a second subunit that comprises, or consists of the amino acid sequence of SEQ ID NO: 20, and (B) ivacaftor, for use in a method for treating cystic fibrosis (CF). In the above combination, the vector may further comprise one or more of (a) a p17 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 22, (b) a p24 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 23, (c) a p8 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 24, (d) a protease comprising or consisting of the amino acid sequence of SEQ ID NO: 25, (e) a p51 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 26, (f) a p15 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 27, (g) a p31 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 28, (h) a Gag protein comprising or consisting of the amino acid sequence of SEQ ID NO: 29, and / or (i) a Pol protein comprising or consisting of the amino acid sequence of SEQ ID NO: 30, and the vector may comprise each of (a) to (g).

[0012] The patient to be treated may have at least one class I, class II, class III, class IV, class V, and / or class VI CFTR mutation. The patient to be treated may have at least one class I and / or class II CFTR mutation. The combination therapy of the invention may be suitable for use independent of the patient's CFTR mutation. The patient to be treated may have (a) at least one class I CFTR mutation selected from G542X, W1282X, and / or R553C, and / or (b) at least one class II CFTR mutation selected from F508del, N1303K, and / or I507del.

[0013] The lentiviral vector and the CFTR modulator may be administered simultaneously or sequentially. The lentiviral vector may be administered by inhalation and / or the CFTR modulator may be administered orally. The lentiviral vector may be administered in an amount of about 8 8 ~about 10 14 A dose of transducing units (TU), preferably about 10 6 ~about 10 12 The CFTR modulators may be administered at a dose of TU, ​​the lentiviral vector may be administered every 3 months, 6 months, 12 months, 24 months, 36 months, or 48 months, and / or the CFTR modulators may be administered at or below the concentration used for monotherapy of each modulator.

[0014] The treatment may restore CFTR activity to at least 10% of that in a healthy control. The treatment may restore CFTR activity to at least 50% of that in a healthy control. The treatment may increase CFTR activity by at least 1.2-fold compared to treatment with the lentiviral vector alone. The treatment may increase CFTR current by about 1.3-fold to about 3-fold, or about 1.3-fold to about 1.8-fold, compared to treatment with the lentiviral vector alone. The patient being treated may have a class I CFTR mutation, and the treatment may (i) restore CFTR activity to at least 10% of that in a healthy control, and / or (ii) increase CFTR current by about 1.3-fold to about 1.8-fold, or about 1.3-fold to about 3-fold, compared to treatment with the lentiviral vector alone. The patient being treated may have a Class II CFTR mutation, and the treatment may (i) restore CFTR activity to at least 10% of that in healthy controls, and / or (ii) increase CFTR current by about 1.3-fold to about 3-fold, or about 1.3-fold to about 1.8-fold, compared to treatment with the lentiviral vector alone. A transduction rate of about 10% to about 20%, preferably about 14% to about 17%, may be sufficient to achieve a therapeutic effect on CFTR activity as defined herein.

[0015] The present invention also provides a method of treating CF in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of each of (i) a lentiviral vector pseudotyped with a hemagglutinin-neuraminidase (HN) and fusion (F) protein from a respiratory paramyxovirus, the lentiviral vector comprising a cystic fibrosis transmembrane conductance regulator (CFTR) transgene, and (ii) a CFTR modulator.

[0016] The present invention further provides the use of a lentiviral vector pseudotyped with a hemagglutinin-neuraminidase (HN) and fusion (F) protein from a respiratory paramyxovirus in the manufacture of a medicament for use in a method of treating CF, wherein the lentiviral vector comprises a cystic fibrosis transmembrane conductance regulator (CFTR) transgene, and the method further comprises administration of a CFTR modulator. [Brief explanation of the drawings]

[0017] [Figure 1A] ~ [Figure 1G] AG show schematic diagrams of exemplary plasmids used for the construction of vectors of the invention. [Figure 2] Transduction efficiency and transduced cell types in HBEC ALI. (A) Experimental setup. (B) Quantification of transduced GFP+ cells 21 days post-transduction. (C) Immunofluorescence of ciliated cells (ACTUB), basal cells (KRT5), club cells (SCGB1A1), and goblet cells (MUC5AC) and their colocalization with transduced GFP+ cells. Arrows indicate colocalization. (D) Flow cytometry quantification of the percentage of transduced cells in specific epithelial cell populations. (E) Vector copy number (VCN) qPCR analysis in bulk samples transduced with either GFP or CFTR-expressing rSIV.F / HN. (F) Transgene mRNA (RT-ddPCR) on sorted single cells. MOI - multiplicity of infection; WPRE - woodchuck hepatitis post-transcriptional regulatory element. Scale bar in C - 20 μm. Differences in VCN were analyzed by two-way ANOVA (***p<0.001, ****p<0.0001). [Figure 3]Functional data demonstrating that rSIV.F / HN(vGM058) restores CFTR chloride current in primary CF HBECs (class II). (A) Gene expression of a codon-optimized CFTR transgene showing high transgene expression in CFTR-transduced cells but not in negative control GFP-transduced cells. (B) Expression of the endogenous human CFTR gene. (C) Gene expression ratio between transgene coCFTR and endogenous hCFTR. (D) Representative scheme of Ussing chamber measurements. (E) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin peak and CFTR-inhibited trough current is calculated. (F) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin plateau and CFTR-inhibited trough current is calculated. (G) Correlation of CFTR chloride current recovery with percentage relative to CFTR-expressing cells in primary CF HBECs. (H) Analysis of mean ciliary beat frequency in primary non-CF, CF, and transduced CF HBECs 28 days after airlift. ΔIsc = change in short-circuit current; UC = Ussing chamber; Amil = amiloride; Fsk = forskolin; Iva = ivacaftor; Luma = lumacaftor; Teza = tezacaftor; Elexa = elexacaftor; Hz = hertz. Differences in ΔIsc current and mean ciliary beat frequency were analyzed by one-way ANOVA (*p < 0.05, **p < 0.005, ***p < 0.001, ****p < 0.0001). For Ussing chamber experiments, N = 16–26 for most conditions except for MOIs of 30 and 90 (N = 4). Asterisks above the graph indicate statistical significance compared to the CF MOI 0 control. [Figure 4]Generation of CFTR KO (CFTR null, class I) hSABCi cell lines and evaluation of transduction with rSIV.F / HN-GFP (vGM107) and rSIV.F / HN-CFTR (vGM058). (A) CFTR protein expression in CFTR KO cells derived from hSBACi (originally described in Wang et al. Respir. Res. (2019) 20:196) and clone 5, which has very high editing efficiency. (B) Flow cytometry quantification of transduced GFP+ CFTR KO cells 21 days post-transduction. (C) Vector copy number (VCN) qPCR analysis in bulk CFTR KO samples transduced with GFP- and CFTR-expressing vectors. (D) Immunofluorescence for ciliated cells (ACTUB), basal cells (KRT5), club cells (SCGB1A1), and goblet cells (MUC5AC) and colocalization with transduced GFP+ cells. Arrows indicate colocalization. (E) Flow cytometric quantification of the percentage of transduced cells in specific epithelial cell populations. MOI - multiplicity of infection, FITC-A - fluorescein isothiocyanate area, SSC-A - side scatter area. Scale bar in E - 20 μm. Differences in VCN were analyzed by two-way ANOVA (**p<0.01, ****p<0.0001). [Figure 5-1] ~ [Figure 5-2]Functional data demonstrating that rSIV.F / HN(vGM058), in contrast to modulators, restores CFTR chloride current in CFTR KO cells (Class I). (A) Gene expression of a codon-optimized CFTR transgene showing high transgene expression in CFTR-transduced cells but not in GFP-transduced cells. (B) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin peak and CFTR-inhibited trough currents is calculated. Of note, there was no CFTR chloride current activation after treatment with modulators (Luma+Iva, Teza+Iva, Elexa+Teza+Iva). (C) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin plateau and CFTR-inhibited trough currents is calculated. Notably, there was no CFTR chloride current activation after treatment with the modulators (Luma + Iva, Teza + Iva, Elexa + Teza + Iva). (D) Correlation between percentage of CFTR-expressing cells and recovery of CFTR chloride current in transduced CFTR KO cells. ΔIsc - short-circuit current change; Iva - ivacaftor; Luma - lumacaftor; Teza - tezacaftor; Elexa - elexacaftor. Differences in ΔIsc were analyzed by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). N=5-11 for Ussing chamber experiments. Asterisks above the graph indicate statistical significance compared to the CF MOI 0 control. [Figure 6]Comparison of vGM058 and vGM244: VCN, coCFTR expression, and functional correction levels. (A) Vector copy number (VCN) ddPCR analysis in bulk samples transduced with either vGM107, vGM058, or vGM244 rSIV.F / HN. (B) Gene expression of the codon-optimized CFTR transgene in samples transduced with either vGM107, vGM058, or vGM244 rSIV.F / HN. (C) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the maximal forskolin peak current and the CFTR-inhibited trough current is calculated. (D) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin plateau and the CFTR-inhibited trough current is calculated. WPRE—Woodchuck Hepatitis Posttranscriptional Regulatory Element. ddPCR data were analyzed using the Mann-Whitney test, and Ussing chamber differences were analyzed by two-way ANOVA (*p<0.05). [Figure 7] DNA vector copy number and coCFTR RNA expression in class II cells transduced with vGM0244 and vGM107. (A) Vector copy number (VCN) qPCR analysis in bulk samples transduced with either GFP- or CFTR-expressing rSIV.F / HN. (B) Gene expression of a codon-optimized CFTR transgene showing high transgene expression in CFTR- but not GFP-transduced cells. WPRE—woodchuck hepatitis posttranscriptional regulatory element. Differences were analyzed by two-way ANOVA (****p<0.0001). [Figure 8]Functional data demonstrating that rSIV.F / HN(vGM244) restores CFTR chloride current in primary CF HBECs (class II). (A) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the maximal forskolin peak current and the calculated CFTR-inhibited trough current. (B) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin plateau and the CFTR-inhibited trough current was calculated. Teza-tezacaftor, Elexa-elexacaftor. Differences were analyzed by one-way ANOVA (**p<0.01, ***p<0.001, ****p<0.0001). For Ussing chamber experiments, N = 25–36 for most conditions except for MOI 90 (N = 12). [Figure 9] Transduction with vGM244 results in restoration of cilia beat frequency in class II CF HBECs. Mean cilia beat frequency analysis in primary non-CF, CF, and transduced CF HBECs 28 days after airlift. Hz = Hertz. Differences were analyzed by one-way ANOVA (*p<0.05, **p<0.005, ***p<0.001, ****p<0.0001). [Figure 10] DNA vector copy number and coCFTR RNA expression in class I cells transduced with vGM244 and vGM107. (A) Vector copy number (VCN) qPCR analysis in bulk samples transduced with either GFP- or CFTR-expressing rSIV.F / HN. (B) Gene expression of a codon-optimized CFTR transgene showing high transgene expression in CFTR- but not GFP-transduced cells. WPRE—woodchuck hepatitis posttranscriptional regulatory element. Differences were analyzed by two-way ANOVA (*p<0.05, **p<0.005, ****p<0.0001). [Figure 11]Functional data demonstrating that rSIV.F / HN(vGM244) restores CFTR chloride current in primary CF HBECs (class II). (A) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the maximal forskolin peak current and the CFTR-inhibited trough current is calculated. (B) Ussing chamber data expressed as a percentage of WT CFTR current. The difference between the forskolin plateau and the CFTR-inhibited trough current is calculated. Teza-tezacaftor, Elexa-elexacaftor. Differences were analyzed by one-way ANOVA (*p<0.05, **p<0.005, ***p<0.001, ****p<0.0001). For Ussing chamber experiments, N = 10–18 for most conditions except for MOI 90 (N = 4). DETAILED DESCRIPTION OF THE INVENTION

[0018] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide those skilled in the art with the general meaning of many of the terms used in this disclosure. The meaning and scope of the terms should be clear. However, in the event of potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions.

[0019] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein, as these may vary. In particular, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present disclosure.

[0020] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the present disclosure are described herein for illustrative purposes, those skilled in the relevant art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, where method steps or functions are presented in a given order, alternative embodiments may perform the functions in a different order, or may perform the functions substantially simultaneously. The teachings of the disclosure provided herein may be applied to other procedures or methods, as appropriate. The various embodiments described herein may be combined to provide further embodiments. Aspects of the present disclosure may be modified, if necessary, to employ the compositions, functions, and concepts of the above-mentioned references and applications to provide further embodiments of the present disclosure. Furthermore, considerations of biological functional equivalence allow for some changes to be made to protein structure without affecting the type or amount of biological or chemical activity. These and other changes can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.

[0021] Unless otherwise indicated, any nucleic acid sequence is written left to right in 5' to 3' orientation; an amino acid sequence is written left to right in amino to carboxy orientation, respectively.

[0022] The headings provided herein do not limit the various aspects or embodiments of the disclosure.

[0023] As used herein, the term "capable of" when used with a verb encompasses or means the action of the corresponding verb. For example, "capable of interacting" also means interacting, "capable of cleaving" also means cleaving, "capable of binding" also means binding, and "capable of specifically targeting" also means specifically targeting.

[0024] Numerical ranges are inclusive of the numbers defining the range. When a range of values ​​is provided, it is understood that each intervening value between the upper and lower limit of that range is also specifically disclosed, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise. Each smaller range between any stated or intervening value in a stated range and any other stated or intervening value in that stated range is included within the scope of the disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where one or both limits are included in the smaller range, or where neither limit is included in the smaller range, is also included within the scope of the disclosure, subject to any specifically excluded limits in the stated range. When a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included within the disclosure.

[0025] Amino acids are referred to herein using the amino acid name, three-letter abbreviation, or one-letter abbreviation.

[0026] As used herein, the terms "protein" and "polypeptide" are used interchangeably to designate a series of amino acid residues connected to one another by peptide bonds between the α-amino and carboxyl groups of adjacent residues. The terms "protein" and "polypeptide" refer to polymers of amino acids, regardless of their size or function, including modified amino acids (e.g., phosphorylated, glycosylated, glycosylated, etc.) and amino acid analogs. While "protein" and "polypeptide" are often used in reference to relatively large polypeptides, while the term "peptide" is often used in reference to small polypeptides, there is overlap in the usage of these terms in the art. The terms "protein" and "polypeptide" are used interchangeably herein when referring to gene products and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing. In this disclosure and claims, conventional one-letter and three-letter codes for amino acid residues may be used. The three-letter code for amino acids is defined in accordance with the IUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that a polypeptide can be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.

[0027] Minor variations in the amino acid sequences of the present invention are contemplated to be within the scope of the present invention, provided that the variations in the amino acid sequences maintain at least 60%, at least 70%, more preferably at least 80%, at least 85%, at least 90%, at least 95%, and most preferably at least 97% or at least 99% sequence identity with the amino acid sequences of the present invention or fragments thereof as defined elsewhere herein. The term homology is used herein to mean identity. Thus, the sequences of variants or analogs of the amino acid sequences of the present invention may differ based on substitutions (typically conservative substitutions), deletions, or insertions. Proteins containing such variations are referred to herein as variants.

[0028] Proteins of the invention may include variants in which amino acid residues from one species are substituted for the corresponding residue in another species, either at conserved or non-conserved positions. Variants of the protein molecules disclosed herein can be made and used in the present invention. Following the guidance of computational chemistry in applying multivariate data analysis techniques to structure / property-activity relationships [see, e.g., Wold, et al. Multivariate data analysis in chemistry. Chemometrics-Mathematics and Statistics in Chemistry (Ed.: B. Kowalski); D. Reidel Publishing Company, Dordrecht, Holland, 1984 (ISBN 90-277-1846-6)], quantitative activity-property relationships of proteins can be derived using well-known mathematical methods, such as statistical regression, pattern recognition, and classification [see, e.g., Norman et al. Applied Regression Analysis. Wiley-Interscience; 3rd edition (April 1998) ISBN: 0471170828; Kandel, Abraham et al. Computer-Assisted Reasoning in Cluster Analysis. Prentice Hall PTR, (May 11, 1995), ISBN: 0133418847; Krzanowski, Wojtek. Principles of Multivariate Analysis: A User's Perspective (Oxford Statistical Science Series, No 22 (Paper)). Oxford University Press; (December 2000), ISBN: 0198507089; Witten, Ian H. et al Data Mining: Practical Machine Learning Tools and Techniques with Java Implementations.See Morgan Kaufmann; (October 11, 1999), ISBN: 1558605525; Denison David GT (Editor) et al. Bayesian Methods for Nonlinear Classification and Regression (Wiley Series in Probability and Statistics). John Wiley & Sons; (July 2002), ISBN: 0471490369; Ghose, Arup K. et al. Combinatorial Library Design and Evaluation Principles, Software, Tools, and Applications in Drug Discovery. ISBN: 0-8247-0487-8. Protein properties can be derived from empirical and theoretical models of protein sequence, function, and three-dimensional structure (e.g., analysis of potential contact residues or calculated physicochemical properties), and these properties can be considered individually and in combination.

[0029] Amino acid residues at non-conserved positions may be substituted with conservative or non-conserved residues. In particular, conservative amino acid substitutions are envisaged.

[0030] A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, or histidine), acidic side chains (e.g., aspartic acid or glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, or cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, or tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, or histidine). Thus, when an amino acid in a polypeptide is replaced with another amino acid from the same side chain family, the amino acid substitution is considered conservative. The inclusion of conservatively modified variants in the proteins of the invention does not exclude other forms of variants, such as polymorphic variants, interspecies homologs, and alleles.

[0031] "Non-conservative amino acid substitutions" include (i) substitutions of a residue with a positively charged side chain (e.g., Arg, His, or Lys) for or by a negatively charged residue (e.g., Glu or Asp); (ii) substitutions of a hydrophilic residue (e.g., Ser or Thr) for or by a hydrophobic residue (e.g., Ala, Leu, Ile, Phe, or Val); (iii) substitutions of cysteine ​​or proline for or by any other residue; or (iv) substitutions of a residue with a bulky hydrophobic or aromatic side chain (e.g., Val, His, Ile, or Trp) for or by one with a smaller side chain (e.g., Ala or Ser) or no side chain (e.g., Gly).

[0032] "Insertions" or "deletions" are typically in the range of about 1, 2, or 3 amino acids. Acceptable variations can be determined empirically by systematically introducing amino acid insertions or deletions into a protein using recombinant DNA techniques and assaying the resulting recombinant variants for activity. This does not require more experimentation than is routine for one of ordinary skill in the art.

[0033] A "fragment" of a polypeptide typically comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97% or more of the original polypeptide.

[0034] As used herein, the terms "polynucleotide," "nucleic acid," and "nucleic acid sequence" refer to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid, or their analogs. A nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of denatured double-stranded DNA. Alternatively, it can be a single-stranded nucleic acid that is not derived from any double-stranded DNA. In one embodiment, a nucleic acid can be DNA. In another embodiment, a nucleic acid can be RNA. Suitable nucleic acid molecules are DNA, including genomic DNA or cDNA. Other suitable nucleic acid molecules are RNA, including siRNA, shRNA, and antisense oligonucleotides. The terms "transgene" and "gene" are also used interchangeably, and both terms encompass fragments or variants thereof that encode target proteins.

[0035] Transgenes of the present invention include nucleic acid sequences removed from their naturally occurring environment, recombinant or cloned DNA isolates, and chemically synthesized analogs or biologically synthesized analogs produced by heterologous systems.

[0036] The polynucleotides of the present invention may be prepared by any means known in the art. For example, large quantities of polynucleotides may be produced by replication in suitable host cells. Natural or synthetic DNA fragments encoding the desired fragments are incorporated into recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and replication in prokaryotic or eukaryotic cells. Typically, DNA constructs are suitable for autonomous replication in unicellular hosts, such as yeast or bacteria, but introduction into and integration into the genome of cultured insect, mammalian, plant, or other eukaryotic cell lines may also be intended.

[0037] Polynucleotides of the invention may also be produced by chemical synthesis, for example, by the phosphoramidite or triester method, which may be performed using commercially available automated oligonucleotide synthesizers. Double-stranded fragments can be obtained from the single-stranded product of chemical synthesis by either synthesizing the complementary strand and annealing the strands under appropriate conditions, or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.

[0038] The term "isolated" in the context of the present invention, when applied to a nucleic acid sequence, means that the polynucleotide sequence has been removed from its natural genetic environment and therefore does not contain other foreign or undesired coding sequences (but may include naturally occurring 5' and 3' untranslated regions, e.g., promoters and terminators), and is in a form suitable for use within engineered protein production systems. Such isolated molecules are separated from their natural environment.

[0039] Given the degeneracy of the genetic code, considerable sequence variation is possible among the polynucleotides of the present invention. Degenerate codons that encompass all possible codons for a given amino acid are shown below. [Table 1]

[0040] Those skilled in the art will understand that there is flexibility in determining degenerate codons that represent all possible codons that encode each amino acid. For example, some polynucleotides falling within the scope of the degenerate sequence may encode variant amino acid sequences, and those skilled in the art can readily identify such variant sequences by reference to the amino acid sequences of the present invention.

[0041] A "variant" nucleic acid sequence has substantial homology or substantial similarity to a reference nucleic acid sequence (or a fragment thereof). A nucleic acid sequence or a fragment thereof is "substantially homologous" (or "substantially identical") to a reference sequence if there is nucleotide sequence identity in at least about 70%, 75%, 80%, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or more percent of the nucleotide bases when optimally aligned (with appropriate nucleotide insertions or deletions) with another nucleic acid (or its complementary strand). Methods for determining nucleic acid sequence homology are known in the art.

[0042] Alternatively, a "variant" nucleic acid sequence is substantially homologous (or substantially identical) to a reference sequence (or a fragment thereof) if the "variant" and the reference sequence are capable of hybridizing under stringent (e.g., highly stringent) hybridization conditions. Nucleic acid sequence hybridization is influenced by conditions such as salt concentration (e.g., NaCl), temperature, or organic solvents, in addition to base composition, length of complementary strands, and number of nucleotide base mismatches between hybridizing nucleic acids, as will be readily understood by those skilled in the art. Stringent temperature conditions are preferably used, including temperatures generally above 30°C, typically above 37°C, and preferably above 45°C. Stringent salt conditions are usually less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM. pH is typically between 7.0 and 8.3. The combination of parameters is far more important than any single parameter.

[0043] Methods for determining nucleic acid sequence identity percentage are known in the art.For example, when evaluating nucleic acid sequence identity, a sequence having a specified number of consecutive nucleotides can be aligned with the nucleic acid sequence (having the same number of consecutive nucleotides) from the corresponding part of the nucleic acid sequence of the present invention.Tools known in the art for determining nucleic acid sequence identity percentage include Nucleotide BLAST (described below).

[0044] Those skilled in the art will understand that different species exhibit "preferential codon usage." As used herein, the term "preferential codon usage" refers to the codons most frequently used in cells of a particular species, thus favoring one or a small number of representatives of the possible codons encoding each amino acid. For example, the amino acid threonine (Thr) can be encoded by ACA, ACC, ACG, or ACT, with ACC being the most commonly used codon in mammalian host cells, while other species may prefer different codons. Codons preferred for a particular host cell species can be introduced into the polynucleotides of the present invention by various methods known in the art. Introduction of preferred codon sequences into recombinant DNA can enhance protein production, for example, by making protein translation more efficient in a particular cell type or species. Thus, according to the present invention, any nucleic acid sequence, in addition to the gag-pol gene, may be codon-optimized for expression in a host or target cell. In particular, the vector genome (or corresponding plasmid), the REV gene (or corresponding plasmid), the fusion protein (F) gene (or corresponding plasmid) and / or the hemagglutinin-neuraminidase (HN) gene (or corresponding plasmid), or any combination thereof, may be codon optimized.

[0045] A "fragment" of a desired polynucleotide comprises a series of contiguous nucleotides from the sequence of said full-length polynucleotide. By way of example, a "fragment" of a desired polynucleotide may comprise (or consist of) at least 30 contiguous nucleotides from the sequence of said polynucleotide (e.g., at least 35, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 contiguous nucleic acid residues of said polynucleotide). A fragment may comprise at least one antigenic determinant and / or encode at least one antigenic epitope of the corresponding desired polypeptide. Typically, fragments as defined herein retain the same function as the full-length polynucleotide.

[0046] The terms "increased," "increase," "enhance," or "activate" are all used herein to mean an increase by a statistically significant amount. The terms "increased," "increase," "enhance," or "activate" can mean an increase of at least 10% compared to a reference level, e.g., an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to 100%, including 100%, or any increase between 10 and 100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold, or any increase between 2-fold and 10-fold or more compared to a reference level. In the context of yield or titer, an "increase" is an observable or statistically significant increase in such level.

[0047] The terms "reduce," "reduced," "reduction," or "inhibit" are all used herein to mean a statistically significant amount of reduction. The terms "reduce," "reduction," or "reducing" or "inhibiting" typically mean a reduction of at least 10% compared to a reference level (e.g., in the absence of a given treatment), and can include, for example, a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, "reduction" or "inhibition" encompasses complete inhibition or reduction compared to a reference level. "Complete inhibition" is 100% inhibition (i.e., abolition) compared to a reference level.

[0048] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "a CFTR modulator" includes a plurality of such agents, and a reference to "the CFTR modulator" includes a reference to one or more CFTR modulators and equivalents thereof known to those skilled in the art, and so forth. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0049] "About" may generally refer to an acceptable degree of error for the quantity measured, given the nature or precision of the measurement. Exemplary degrees of error are within 20 percent (%), typically within 10%, and more typically within 5% of a given value or range of values. Preferably, the term "about" is understood herein as plus or minus (±) 5% of the numerical value of the number with which it is used, preferably ±4%, ±3%, ±2%, ±1%, ±0.5%, ±0.1%.

[0050] The term "consisting of" refers to the compositions, methods, and each component thereof described herein, to the exclusion of any element not recited in that description of the invention.

[0051] As used herein, the term "consisting essentially of" refers to elements required for a given invention. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristics of the invention (i.e., inert or non-immunogenic components).

[0052] Embodiments described in this specification as "comprising" one or more features may also be considered to disclose corresponding embodiments "consisting of" and / or "consisting essentially of" such features.

[0053] Concentrations, amounts, volumes, percentages, and other numerical values ​​may be presented herein in a range format, and it should be understood that such range format is used merely for convenience and brevity and not only includes the numerical values ​​explicitly recited as the limits of the range, but that all individual numerical values ​​or subranges contained within the range should also be interpreted flexibly as if each numerical value and subrange were explicitly recited.

[0054] As used herein, the terms "vector," "retroviral vector," and "retroviral F / HN vector" are used interchangeably to refer to a retroviral vector comprising a retroviral RNA sequence and pseudotyped with a hemagglutinin-neuraminidase (HN) and fusion (F) protein from a respiratory paramyxovirus, unless otherwise specified. The terms "lentiviral vector" and "lentiviral F / HN vector" are used interchangeably to refer to a lentiviral vector pseudotyped with a hemagglutinin-neuraminidase (HN) and fusion (F) protein from a respiratory paramyxovirus, unless otherwise specified. All disclosures herein regarding the retroviral vectors of the present invention apply equally and unconditionally to the lentiviral vectors of the present invention and to SIV vectors pseudotyped with a hemagglutinin-neuraminidase (HN) and fusion (F) protein from a respiratory paramyxovirus (also referred to herein as SIV F / HN or SIV-FHN).

[0055] As defined herein, the term "retroviral RNA sequence" refers to a nucleic acid molecule contained within a retroviral vector. The retroviral RNA sequence includes a long terminal repeat (LTR) element, a nucleic acid sequence required for incorporation of the retroviral RNA sequence into a retroviral particle, and a transgene expression cassette. The transgene expression cassette is composed of a suitable enhancer / promoter element, a transgene cDNA, and post-transcriptional regulatory elements. The retroviral RNA sequence begins with a 5' LTR R sequence and ends with a 3' LTR R sequence. The 5' region retroviral RNA sequence typically comprises or consists of a retroviral LTR R sequence followed (5' to 3') by a retroviral LTR U5 sequence. The 3' region retroviral RNA sequence typically comprises or consists of a retroviral LTR R sequence followed (5' to 3') by a retroviral LTR U5 sequence.

[0056] The terms "DNA provirus" or "DNA provirus sequence" and "DNA proviral sequence" refer interchangeably to a DNA sequence that is integrated into the genome of a cell transduced by a retrovirus. The DNA proviral sequence contains additional regions of nucleic acid not found within the retroviral RNA sequence, including the 5' LTR U3 sequence and the 3' LTR U5 sequence. Thus, the sequences of the DNA provirus and retroviral RNA sequence are not identical; rather, the sequence of the retroviral RNA sequence is shorter than the proviral DNA sequence from which it was derived. The exact 5' and 3' limits of a retroviral RNA sequence compared to the proviral DNA sequence from which it was derived cannot be easily and reliably determined by simple analysis of the proviral DNA sequence.

[0057] The terms "individual," "subject," and "patient" are used interchangeably herein to refer to a mammalian subject for whom diagnosis, prognosis, disease monitoring, treatment, therapy, and / or therapy optimization is desired. The mammal may be (but is not limited to) a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In a preferred embodiment, the individual, subject, or patient is human. An "individual" may be an adult, juvenile, or infant. An "individual" may be male or female.

[0058] A "subject in need" of treatment for a particular condition can be an individual who has the condition, has been diagnosed with the condition, or is at risk of developing the condition.

[0059] The subject may be a subject previously diagnosed or identified as suffering from or having a condition in need of treatment or one or more complications related to such a condition, or may be a subject who has already received treatment for a condition as defined herein or one or more complications related to said condition. Alternatively, the subject may also be a subject who has not previously been diagnosed with a condition as defined herein or one or more complications related to said condition. For example, the individual may be an individual who exhibits one or more risk factors for a condition or one or more complications related to said condition, or a subject who does not exhibit risk factors.

[0060] As used herein, the term "healthy individual" refers to an individual or group of individuals who are in a healthy state, e.g., who do not exhibit any symptoms of a disease, have not been diagnosed with a disease, and / or are unlikely to develop a disease, e.g., cystic fibrosis (CF) or any other disease described herein. Preferably, the healthy individual is not receiving medication that affects CF and has not been diagnosed with any other disease. One or more healthy individuals may have similar gender, age, and / or body mass index (BMI) compared to the test individual. Application of standard statistical methods used in medicine allows for the determination of normal levels of expression in healthy individuals, and significant deviations from such normal levels.

[0061] As used herein, the terms "control" and "reference population" are used interchangeably.

[0062] The term "pharmaceutically acceptable," as used herein, means approved by a regulatory agency of the federal or state government or listed in the United States Pharmacopoeia, the European Pharmacopoeia, or other generally recognized pharmacopoeias.

[0063] Other definitions of terms may appear throughout the specification. Before exemplary embodiments are described in more detail, it is to be understood that the disclosure is not limited to the particular embodiments described, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the disclosure is defined only by the appended claims.

[0064] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that such publication constitutes prior art to the claims appended hereto. All references cited herein are incorporated herein by reference for their entire disclosure content and the disclosure content specifically mentioned herein.

[0065] Disclosures relating to various methods of the invention are intended to apply equally to other methods, therapeutic uses or methods, and vice versa.

[0066] Retroviral and lentiviral vectors The present invention relates to combination therapies comprising retroviral / lentiviral (e.g., SIV) constructs. The term "retrovirus" refers to any member of the Retroviridae family of RNA viruses that encode the enzyme reverse transcriptase. The term "lentivirus" refers to a family of retroviruses. Examples of retroviruses suitable for use in the present invention include gammaretroviruses, such as murine leukemia virus (MLV) and feline leukemia virus (FLV). Examples of lentiviruses suitable for use in the present invention include simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), and visna / maedi virus. Typically, the present invention relates to combination therapies comprising lentiviral vectors, particularly SIV vectors (including all strains and subtypes), such as SIV-AGM (originally isolated from the African green monkey, Cercopithecus aethiops).

[0067] The retroviral / lentiviral (e.g., SIV) vectors of the present invention are pseudotyped with the hemagglutinin-neuraminidase (HN) and fusion (F) proteins from a respiratory paramyxovirus, preferably Sendai virus (murine parainfluenza virus type 1).

[0068] The F protein may be a truncated F protein, typically one in which the cytoplasmic domain has been truncated. Preferably, the truncated F protein is Fct4 in which 38 amino acids have been truncated from the C-terminus of the F protein and 4 amino acids of the F protein cytoplasmic domain have been retained. Thus, the F protein may comprise or consist of an Fct4 amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or more, up to 100%, identity to SEQ ID NO: 17 or 18. Preferably, the F protein may comprise or consist of an Fct4 amino acid sequence having at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 17 or 18.

[0069] The full-length F protein, or its C-terminal truncated form (e.g., Fct4), is typically fusion-inactive. The fusion-inactive form of the F protein can be cleaved to generate two subunits: a first subunit (also known as F2) and a second subunit (also known as F1).

[0070] The first subunit of the F protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or more, up to 100%, identity to SEQ ID NO: 19. Preferably, the first subunit may be a subunit that may comprise or consist of an amino acid sequence having at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 19. SEQ ID NO: 19 is the first subunit of Fct4.

[0071] Alternatively or additionally, and preferably additionally, the second subunit of the F protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or more, up to 100%, identity to SEQ ID NO: 20. Preferably, the second subunit may be a subunit that may comprise or consist of an amino acid sequence having at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 20. SEQ ID NO: 20 is the second subunit of Fct4.

[0072] An F protein (e.g., Fct4) may contain an N-terminal signal peptide. Alternatively, the F protein may lack such a signal peptide. The F protein signal peptide may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or more, up to 100%, identity to SEQ ID NO:21. This signal peptide can be cleaved to form the mature F protein. The signal peptide of Fct4 is SEQ ID NO:21, which forms amino acid residues 1-25 of SEQ ID NO:18. Thus, the mature form of Fct4 may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100%, identity to amino acid residues 26 to 527 of SEQ ID NO: 18.

[0073] The HN protein may be a truncated and / or chimeric HN protein, typically one in which the cytoplasmic domain has been truncated or replaced. Preferably, the HN protein is a chimeric HN protein in which (i) the cytoplasmic domain of HN has been replaced by the cytoplasmic domain of a transmembrane protein (TMP), or (ii) the cytoplasmic domain of a TMP has been added to the cytoplasmic domain of the HN protein. The HN protein may be as described in Kobayashi et al. (J. Virol. (2003) 77(4):2607-2614), which is incorporated herein by reference in its entirety.

[0074] Retroviral / lentiviral (e.g., SIV) vectors of the invention may comprise a codon-optimized Gag protein, a codon-optimized Pol protein, a codon-optimized GagPol polyprotein, or a combination thereof. Accordingly, the present invention provides retroviral / lentiviral (e.g., SIV) vectors comprising a codon-optimized Gag protein comprising or consisting of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or more, up to 100%, sequence identity to SEQ ID NO:29. Preferably, the present invention provides retroviral vectors comprising a codon-optimized Gag protein comprising or consisting of an amino acid sequence having at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:29. The present invention provides retroviral vectors comprising a codon-optimized Pol protein comprising or consisting of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or more, up to 100%, sequence identity to SEQ ID NO: 30. Preferably, the present invention provides retroviral vectors comprising a codon-optimized Pol protein comprising or consisting of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 30.

[0075] GagPol is expressed as a polyprotein that is processed within the viral particle to yield several smaller proteins. The extent of processing, and therefore the presence and / or concentration of GagPol or any of the component proteins within the retroviral / lentiviral (e.g., SIV) vectors of the invention, may change over time.

[0076] Thus, the retroviral / lentiviral (e.g., SIV) vectors of the present invention may comprise one or more of p17 protein, p27 protein, p8 protein, protease, p51 protein, p15 protein, and p31 protein. One or more of these proteins may be present in combination with Gag, Pol, and / or GagPol. Preferably, the present invention provides retroviral vectors comprising p17 protein, p27 protein, p8 protein, protease, p51 protein, p15 protein, and p31 protein. These proteins may also be present in combination with Gag, Pol, and / or GagPol.

[0077] The p17 protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100%, sequence identity to SEQ ID NO: 22. Preferably, the p17 protein comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 22.

[0078] The p24 protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100%, sequence identity to SEQ ID NO: 23. Preferably, the p24 protein comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 23.

[0079] The p8 protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100% sequence identity to SEQ ID NO: 24. Preferably, the p8 protein comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 24.

[0080] The protease may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100% sequence identity to SEQ ID NO: 25. Preferably, the protease comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO:25.

[0081] The p51 protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100% sequence identity to SEQ ID NO: 26. Preferably, the p51 protein comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO:26.

[0082] The p15 protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100% sequence identity to SEQ ID NO: 27. Preferably, the p15 protein comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 27.

[0083] The p31 protein may comprise or consist of an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or more, up to 100% sequence identity to SEQ ID NO: 28. Preferably, the p31 protein comprises or consists of an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 28.

[0084] Retroviral / lentiviral (e.g., SIV) vectors of the invention may comprise a p17 protein comprising, or consisting of, an amino acid sequence having at least 90% sequence identity to SEQ ID NO:22 (as described above), a p24 protein comprising, or consisting of, an amino acid sequence having at least 90% sequence identity to SEQ ID NO:23 (as described above), a p8 protein comprising, or consisting of, an amino acid sequence having at least 90% sequence identity to SEQ ID NO:24 (as described above), a protease comprising, or consisting of, an amino acid sequence having at least 90% sequence identity to SEQ ID NO:25 (as described above), a p51 protein comprising, or consisting of, an amino acid sequence having at least 90% sequence identity to SEQ ID NO:26 (as described above), a p15 protein comprising, or consisting of an amino acid sequence having at least 90% sequence identity to SEQ ID NO:27 (as described above), and a p31 protein comprising, or consisting of an amino acid sequence having at least 90% sequence identity to SEQ ID NO:28 (as described above).

[0085] Retroviral / lentiviral (e.g., SIV) vectors produced according to the present invention may be integrase-competent (IC). Alternatively, lentiviral (e.g., SIV) vectors may be integrase-deficient (ID).

[0086] Retroviral / lentiviral vectors, such as those used in the combination therapy of the present invention, can integrate into the genome of transduced cells, resulting in long-term, sustained expression, making them suitable for transduction of stem / progenitor cells. In the lung, several cell types with regenerative potential have been identified as responsible for maintaining specific cell lineages in the conducting airways and alveoli. These include basal cells and submucosal gland duct cells in the upper respiratory tract; ciliated cells, goblet cells, club cells (SCGB1A1+), and neuroendocrine cells in the bronchiolar airways; bronchoalveolar stem cells in the terminal bronchioles; and type II pneumocytes in the alveoli. Therefore, without being bound by theory, it is believed that the retroviral / lentiviral (e.g., SIV) vectors can result in long-term gene expression of a desired transgene by introducing the transgene into one or more cell types of the airway epithelium, such as those listed above. Airway epithelial cells are expected to have a lifespan of many months, and as a result, transfection of these cells promotes expression over the cell's lifespan, resulting in a long-term therapeutic effect.

[0087] Thus, the retroviral / lentiviral (e.g., SIV) vectors used in the combination therapy according to the present invention typically transduce one or more cell types or cell lineages within the airway epithelium. These cells may or may not have regenerative capacity; rather, long-term expression occurs due to the long lifespan of the transduced cells. For example, the retroviral / lentiviral (e.g., SIV) vectors may transduce one or more cell types selected from (i) basal cells and / or submucosal gland duct cells in the upper respiratory tract, (ii) ciliated cells, goblet cells, club cells (SCGB1A1+) and / or neuroendocrine cells in the bronchiolar airways, (iii) bronchoalveolar stem cells in the terminal bronchioles, and / or (iv) type II pneumocytes in the alveoli, or any combination thereof.

[0088] Alternatively or additionally, the retroviral / lentiviral (e.g., SIV) vectors used in the combination therapy according to the present invention can transduce one or more cell types or cell lineages with regenerative potential within the lungs (including the airways and respiratory tract) to achieve long-term gene expression. For example, the retroviral / lentiviral (e.g., SIV) vectors can transduce basal cells, e.g., those within the upper airways / respiratory tract. Basal cells play a central role in the process of epithelial maintenance and repair after injury. In addition, basal cells are widely distributed along the human airway epithelium, with a relative distribution ranging from 30% (larger airways) to 6% (smaller airways).

[0089] Retroviral / lentiviral (e.g., SIV) vectors may be used to transduce isolated and expanded stem / progenitor cells ex vivo prior to administration to a patient as part of a combination therapy described herein. Preferably, retroviral / lentiviral (e.g., SIV) vectors are used to transduce cells in the lungs (or airways / respiratory tract) in vivo.

[0090] The retroviral / lentiviral (e.g., SIV) vectors of the present invention exhibit remarkable resistance to shear forces with only a slight decrease in transduction capacity when passed through clinically relevant delivery devices, such as spray bottles and nebulizers. Other routes of inhalation administration, such as via bronchoscopy, can similarly benefit from the shear force resistance of the retroviral / lentiviral (e.g., SIV) vectors of the present invention.

[0091] The retroviral / lentiviral (e.g., SIV) vectors of the invention may comprise one or more transgenes encoding a polypeptide or protein that is therapeutic for the treatment of CF. Preferably, the retroviral / lentiviral (e.g., SIV) vectors of the invention comprise a CFTR transgene, i.e., the transgene encodes CFTR.

[0092] The transgene contained in the vector of the invention may be modified to facilitate expression. For example, the transgene sequence may be CpG-depleted (or CpG-deficient) and / or codon-optimized to facilitate gene expression. Standard techniques for modifying transgene sequences in this manner are known in the art.

[0093] Thus, one example of a CFTR cDNA is provided by SEQ ID NO: 1. Variants thereof (as described herein) are also included, particularly variants having at least 90% (e.g., at least 90, 92, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to SEQ ID NO: 1. SEQ ID NO: 1 is a codon-optimized, CpG-depleted CFTR transgene previously designed by the present inventors to enhance translation in human cells. Variants of the same sequence (as defined herein) that have the same technical effect of enhancing translation compared to the unmodified (wild-type) CFTR gene sequence are also included within the scope of the present invention.

[0094] The retroviral / lentiviral (e.g., SIV) vectors of the present invention enable high-level transgene expression, resulting in high (therapeutic) expression of therapeutic proteins. Therefore, the retroviral / lentiviral (e.g., SIV) vectors of the present invention can usefully provide high levels of transgene expression when administered to a patient. The terms high expression and therapeutic expression are used interchangeably herein. Expression may be measured by any appropriate method (qualitative or quantitative, preferably quantitative), and concentrations are given in any appropriate measurement unit, such as ng / ml or nM.

[0095] The expression of a desired transgene may be given relative to the expression of the corresponding endogenous (defective) gene in the patient. Expression may be measured in terms of DNA vector copy number (VCN), mRNA, or protein expression. Expression of a transgene of the invention, e.g., a functional CFTR gene, can be quantified relative to an endogenous gene, such as an endogenous (dysfunctional) CFTR gene, in terms of mRNA copies per cell or any other suitable unit.

[0096] The expression level of the CFTR transgene of the invention and / or the encoded CFTR protein may be measured in lung tissue. Thus, high and / or therapeutic expression levels may refer to concentrations in the lung, epithelial lining fluid, and / or serum / plasma.

[0097] The retroviral / lentiviral (e.g., SIV) vectors of the present invention exhibit efficient airway cell uptake, stable transgene expression, and do not suffer from loss of efficacy upon repeated administration. Thus, the retroviral / lentiviral (e.g., SIV) vectors of the present invention have the ability to produce long-lasting, repeatable, high-level expression in airway cells without inducing an excessive immune response. An excessive immune response may be defined as one extreme enough to render administration to the patient impossible and / or to induce significant negative effects on vector transduction and / or CFTR expression.

[0098] The retroviral / lentiviral (e.g., SIV) vectors of the present invention enable long-term transgene expression, resulting in long-term expression of a therapeutic protein. As used herein, the terms "long-term expression," "sustained expression," "long-term persistent expression," and "persistent expression" are used interchangeably. Long-term expression according to the present invention refers to expression of a therapeutic gene and / or protein for at least 45 days, at least 60 days, at least 90 days, at least 120 days, at least 180 days, at least 250 days, at least 360 days, at least 450 days, at least 730 days, or longer, preferably at therapeutic levels. Preferably, long-term expression refers to expression for at least 90 days, at least 120 days, at least 180 days, at least 250 days, at least 360 days, at least 450 days, at least 720 days, or longer, more preferably at least 360 days, at least 450 days, at least 720 days, or longer. This long-term expression may be achieved by repeated doses or a single dose.

[0099] Repeat doses may be administered twice daily, daily, twice weekly, weekly, monthly, bimonthly, trimonthly, 4 months, 6 months, yearly, biennially, or longer. Dosing may be continued for as long as needed, for example, at least 6 months, at least 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, or longer, up to the life of the patient being treated.

[0100] Retroviral / lentiviral (e.g., SIV) vectors include a promoter operably linked to a transgene that allows expression of the transgene. Typically, the promoter is a hybrid human CMV enhancer / EF1a (hCEF) promoter. This hCEF promoter may lack an intron corresponding to nucleotides 570-709 and an exon corresponding to nucleotides 728-733 of the hCEF promoter. A preferred example of an hCEF promoter sequence of the present invention is provided by SEQ ID NO:2. Thus, the hCEF promoter included in a retroviral / lentiviral (e.g., SIV) vector of the present invention may comprise (or consist of) a nucleic acid sequence having at least 90% (e.g., at least 90, 92, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to the hCEF nucleic acid sequence of SEQ ID NO:2. In a further embodiment, the hCEF may comprise (or consist of) a nucleic acid sequence having at least 95% (e.g., at least 95, 96, 97, 98, 99, or 100%) sequence identity to the hCEF nucleic acid sequence of SEQ ID NO: 2. Alternatively, the promoter may be a CMV promoter. An example of a CMV promoter sequence is provided by SEQ ID NO: 3. The promoter may be a human elongation factor 1a (EF1a) promoter. An example of an EF1a promoter is provided by SEQ ID NO: 4. Other promoters for transgene expression are known in the art, and their compatibility with the retroviral / lentiviral (e.g., SIV) vectors of the invention is determined using routine techniques known in the art. Non-limiting examples of other promoters include UbC and UCOE. As described herein, promoters may be modified to further regulate expression of the transgenes of the invention.

[0101] The promoter contained in the retroviral / lentiviral (e.g., SIV) vector of the present invention may be specifically selected and / or modified to further refine the regulation of therapeutic gene expression. Again, suitable promoters and standard techniques for their modification are known in the art. As a non-limiting example, some suitable (CpG-free) promoters suitable for use in the present invention are described in Pringle et al. (J. Mol. Med. Berl. 2012, 90(12): 1487-96), which is incorporated herein by reference in its entirety. Preferably, the retroviral / lentiviral vector of the present invention (particularly the SIV F / HN vector) comprises an hCEF promoter with low or no CpG dinucleotide content. The hCEF promoter may have all CG dinucleotides replaced by any one of AG, TG, or GT. Thus, the hCEF promoter may be CpG-free. A preferred example of a CpG-free hCEF promoter sequence of the present invention is provided by SEQ ID NO: 2. The absence of CpG dinucleotides further improves the performance of the retroviral / lentiviral (e.g., SIV) vectors of the invention, particularly in situations where it is undesirable to induce an immune response to the expressed antigen or an inflammatory response to the delivered expression construct. The elimination of CpG dinucleotides reduces the incidence of flu-like symptoms and inflammation that can result from administration of the construct, particularly when administered to the respiratory tract.

[0102] The retroviral / lentiviral (e.g., SIV) vector of the present invention can be modified to allow gene expression to be silenced. Standard techniques for modifying vectors in this manner are known in the art. As a non-limiting example, Tet-responsive promoters are widely used.

[0103] Thus, the present invention relates to F / HN retroviral / lentiviral vectors, particularly SIV.F / HN vectors, comprising a promoter and a transgene. F / HN pseudotyping is particularly efficient at targeting cells in the respiratory epithelium, and therefore is typically delivered to cells of the respiratory tract, including cells of the respiratory epithelium, for therapeutic applications. Thus, the retroviral / lentiviral (e.g., SIV) vectors of the present invention are particularly suitable for treating CF.

[0104] The retroviral / lentiviral (e.g., SIV) vectors of the present invention may not have an intron located between the promoter and the transgene. Similarly, in the vector genome (pDNA1) plasmid (e.g., pGM326 described herein, shown in Figure 1A, and having the sequence of SEQ ID NO: 3), there may be no intron between the promoter and the transgene.

[0105] Preferably, the retroviral / lentiviral (e.g., SIV) vector comprises an hCEF promoter and a CFTR transgene, including those described herein. The retroviral / lentiviral (e.g., SIV) vector may not have an intron located between the promoter and the transgene. Such retroviral / lentiviral (e.g., SIV) vectors can be produced by the methods described herein using a genomic plasmid carrying the CFTR transgene and promoter. Particularly preferred is the SIV.F / HN vector carrying an hCEF promoter and a CFTR transgene, including those described herein.

[0106] The retroviral / lentiviral (e.g., SIV) vectors described herein comprise at least one transgene, which comprises a nucleic acid sequence encoding a gene product, e.g., a protein, particularly a therapeutic protein, and preferably the at least one transgene comprises or consists of CFTR.

[0107] For example, the nucleic acid sequence encoding CFTR may comprise (or consist of) a nucleic acid sequence having at least 90% (e.g., at least 90, 92, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to a respective CFTR nucleic acid sequence, examples of which are described herein. In a further embodiment, the nucleic acid sequence encoding CFTR may comprise (or consist of) a nucleic acid sequence having at least 95% (e.g., at least 95, 96, 97, 98, 99, or 100%) sequence identity to a respective CFTR nucleic acid sequence, examples of which are described herein. In one embodiment, the nucleic acid sequence encoding CFTR is provided by SEQ ID NO: 1 or a variant thereof.

[0108] The amino acid sequence of CFTR encoded by the CFTR transgene may comprise (or consist of) an amino acid sequence having at least 95% (e.g., at least 95, 96, 97, 98, 99, or 100%) sequence identity to a functional CFTR polypeptide sequence, respectively.

[0109] Retroviral / lentiviral (e.g., SIV) vectors of the invention may comprise a central polypurine tract (cPPT) and / or a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). An exemplary WPRE sequence is provided by SEQ ID NO:14.

[0110] Retroviral / lentiviral (e.g., SIV) vectors according to the present invention may be those described in WO 2015 / 177501, PCT / GB2022 / 050524 (which claims priority from UK Patent Application No. 2102832.9), and UK Patent Application No. 2212472.1, each of which is incorporated herein by reference in its entirety. Particularly preferred are retroviral / lentiviral (e.g., SIV) vectors according to UK Patent Application No. 2212472.1.

[0111] Thus, particularly preferred is a retroviral / lentiviral (e.g., SIV) vector that is an SIV vector pseudotyped with the hemagglutinin-neuraminidase (HN) and fusion (F) protein of Sendai virus, wherein (a) the vector comprises a modified retroviral RNA sequence that comprises or consists of the nucleic acid sequence of SEQ ID NO: 16 (including a CFTR transgene), preferably the modified retroviral RNA sequence consists of the nucleic acid sequence of SEQ ID NO: 16, and (b) the F protein comprises a first subunit that comprises or consists of the amino acid sequence of SEQ ID NO: 19 and a second subunit that comprises or consists of the amino acid sequence of SEQ ID NO: 20. The vector may further comprise one or more of (a) a p17 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 22, (b) a p24 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 23, (c) a p8 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 24, (d) a protease comprising or consisting of the amino acid sequence of SEQ ID NO: 25, (e) a p51 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 26, (f) a p15 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 27, (g) a p31 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 28, (h) a Gag protein comprising or consisting of the amino acid sequence of SEQ ID NO: 29, and / or (i) a Pol protein comprising or consisting of the amino acid sequence of SEQ ID NO: 30, and the vector may comprise each of (a) to (g).

[0112] Methods for Producing Retroviral / Lentiviral (e.g., SIV) Vectors The retroviral / lentiviral (e.g., SIV) vector of the present invention can be produced by any suitable method.Non-limiting examples of such methods are described in International Publication No. 2015 / 177501, International Application No. PCT / GB2022 / 050524 (which claims the priority of UK Patent Application No. 2102832.9) and UK Patent Application No. 2212472.1, each of which is incorporated herein by reference in its entirety.Particularly preferred is the method described in UK Patent Application No. 2212472.1.

[0113] The retroviral / lentiviral (e.g., SIV) vectors of the present invention are typically produced by scalable, GMP-compliant methods. Exemplary methods are described herein. The present invention encompasses combination therapies that include the use of retroviral / lentiviral (e.g., SIV) vectors, particularly SIV.F / HN vectors, obtained or obtainable by any of the methods described herein.

[0114] The generation of retroviral / lentiviral (e.g., SIV) vectors typically uses one or more plasmids that provide the elements required for vector production: the retroviral / lentiviral vector genome, Gag-Pol, Rev, F, and HN. Multiple elements can be provided on a single plasmid. Preferably, each element is provided on a separate plasmid, resulting in five plasmids, one each for the vector genome, Gag-Pol, Rev, F, and HN.

[0115] Alternatively, a single plasmid may provide the Gag-Pol and Rev elements, which may be referred to as the packaging plasmid (pDNA2). The remaining elements (genome, F, and HN) may be provided by separate plasmids (pDNA1, pDNA3a, and pDNA3b, respectively), resulting in four plasmids used for the generation of retroviral / lentiviral (e.g., SIV) vectors according to the invention. In the four-plasmid approach, pDNA1, pDNA3a, and pDNA3b may be as described herein in connection with the five-plasmid approach.

[0116] Any one of the plasmids used to generate the retroviral / lentiviral (e.g., SIV) vectors of the present invention may be independently codon-optimized or at least partially codon-optimized. Partial codon optimization encompasses at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher codon optimization. Codon optimization is a technique for maximizing protein expression by increasing the translation efficiency of the encoding gene. Translation efficiency is enhanced by modifying the nucleic acid sequence. Codon optimization is routine in the art, and it is within the routine practice of one of ordinary skill in the art to devise a codon-optimized version of a given nucleic acid sequence. As described herein, the transgene and / or promoter may each be independently codon-optimized. Alternatively or additionally, the Gag-Pol gene may be codon-optimized. In particular, codon optimization of the Gag-Pol gene is preferred because it can improve the safety profile of the resulting retroviral / lentiviral (e.g., SIV) vector, particularly the SIV.F / HN vector, without adversely affecting vector titer, and can even increase vector titer (as described in International Application No. PCT / GB2022 / 050524, which claims priority from UK Patent Application No. 2102832.9).

[0117] Thus, retroviral / lentiviral (e.g., SIV) vectors of the invention, particularly those pseudotyped with hemagglutinin-neuraminidase (HN) and fusion (F) proteins from respiratory paramyxoviruses and comprising a promoter and a transgene, are produced by methods including the use of a codon-optimized gag-pol gene. Preferably, the codon-optimized gag-pol gene used in the production methods of the invention is an SIV gag-pol gene. An exemplary wild-type SIV gag-pol gene that may be modified to generate a codon-optimized gag-pol gene is set forth in SEQ ID NO:5. An exemplary codon-optimized gag-pol gene derived from SEQ ID NO:5 is set forth in SEQ ID NO:6. In addition to codon optimization, the codon-optimized gag-pol gene used in the production methods of the invention may include other modifications, such as translation slippage (which allows translation to slip from one region to another, allowing for the production of both Gag and Pol). The codon-optimized gag-pol gene of the present invention can use any suitable variation in codon usage, provided that (i) homology between the vector genome plasmid and the GagPol plasmid is reduced, minimizing the risk of RCL production, and (ii) sufficient RRE-free GagPol is produced after codon optimization, further reducing homology and the risk of RCL production.

[0118] The codon-optimized gag-pol gene used in the production methods of the present invention may be fully (100%) or partially codon-optimized. Partial codon optimization of the gag-pol gene includes at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or higher codon optimization.

[0119] Preferably, the gag-pol gene itself is fully codon-optimized, but may contain regions (e.g., between the gag and pol genes) that do not contain non-codon-optimized sequences. As a non-limiting example, to maintain translation slippage in the reading frame between the gag and pol genes, the region surrounding the translation slippage sequence may not be codon-optimized (e.g., if the correct translation slippage sequence is important for this function). An example of a non-codon-optimized translation slippage sequence within a codon-optimized gag-pol gene is shown in SEQ ID NO:6.

[0120] Preferably, the codon-optimized gag-pol gene used to generate the retrovirus / lentivirus (e.g., SIV) of the present invention comprises or consists of the nucleic acid sequence of SEQ ID NO: 6 or a variant thereof (as defined herein). In particular, the codon-optimized gag-pol gene may comprise or consist of a nucleic acid sequence having at least 80%, more preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher percent sequence identity to SEQ ID NO: 6. Preferably, the codon-optimized gag-pol gene used in the methods of the present invention may comprise or consist of a nucleic acid sequence having at least 90%, more preferably at least 95%, even more preferably at least 98%, or higher percent sequence identity to SEQ ID NO: 6. The codon-optimized gag-pol gene of SEQ ID NO: 6 contains translation slippages and therefore does not form a single conventional open reading frame.

[0121] Preferably, the codon-optimized gag-pol gene used in the methods of the present invention is contained in a plasmid comprising or consisting of the nucleic acid sequence of SEQ ID NO: 7 (pGM691) or a variant thereof (as defined herein). In particular, the codon-optimized gag-pol gene is contained in a plasmid comprising or consisting of a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or higher percent sequence identity to SEQ ID NO: 7. Preferably, the codon-optimized gag-pol gene is contained in a plasmid comprising or consisting of a nucleic acid sequence having at least 90%, more preferably at least 95%, even more preferably at least 98% or higher percent sequence identity to SEQ ID NO: 7. In the plasmid of SEQ ID NO: 7 (or a variant thereof), (i) the codon-optimized gag-pol gene of SEQ ID NO: 6 contains translation slippages and therefore does not form a single conventional open reading frame, and (ii) the codon-optimized gag-pol gene of SEQ ID NO: 6 is operably linked to a CAG promoter. An exemplary CAG promoter is shown in SEQ ID NO:15.

[0122] In the preferred five-plasmid method of the present invention, the vector genome plasmid encodes all of the genetic material to be packaged into the final retroviral / lentiviral vector, including the transgene. Typically, only a portion of the genetic material found in the vector genome plasmid ultimately becomes viral. The vector genome plasmid may be designated herein as "pDNA1" and typically contains the transgene and transgene promoter.

[0123] The other four plasmids are production plasmids encoding the Gag-Pol, Rev, F, and HN proteins. These plasmids can be named "pDNA2a," "pDNA2b," "pDNA3a," and "pDNA3b," respectively.

[0124] Modifications may be made to the vector genome plasmid (pDNA1), particularly to further improve the safety profile of the vector. As exemplified herein, such modifications may include or consist of modifying the pDNA1 sequence to remove viral, particularly retroviral / lentiviral (e.g., SIV) ORFs from the pDNA1 sequence. Thus, retroviral / lentiviral (e.g., SIV) vectors of the present invention may be generated using modified pDNA1 containing a reduced number of non-transgene ORFs. The modified pDNA1 may contain modifications within any region of the plasmid sequence. In particular, the modified pDNA1 may contain modifications to remove (i) the 5' to 3' ORFs, (ii) ORFs of 100 amino acids or more, and / or (iii) ORFs upstream of the transgene and / or promoter operably linked to the transgene. The modified pDNA1 may be free of ORFs other than the transgene, although this is not required. Alternatively, the modified pDNA1 may still contain ORFs other than the transgene, but may have a reduced number of non-transgene ORFs compared to the unmodified pDNA1 from which it was derived. As a non-limiting example, the modified pDNA1 may contain at least one, at least two, at least three, at least four, at least five, or more fewer non-transgene ORFs compared to the corresponding unmodified pDNA1. As a specific example, pGM830 (derived from pGM326) contains two fewer non-transgene ORFs compared to pGM326. The modified pDNA1 may contain at least one, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 15, at least 20, or more modifications (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 modifications) compared to the corresponding unmodified pDNA1. As a non-limiting example, the modified pDNA1 may contain about 1 to about 20, e.g., about 5 to about 15, or about 5 to about 10 modifications compared to the corresponding unmodified pDNA1.As a specific example, pGM830 (derived from pGM326) contains seven modifications compared to pGM326.

[0125] Use of the modified pDNA1 (e.g., pGM830) described herein may result in improved SIV titers compared to production methods using unmodified pDNA1 plasmids (e.g., pGM326) while all other plasmid and process parameters are kept constant.

[0126] The five plasmids can be characterized by Figures 1A-2G, where pDNA1 is the pGM326 plasmid in Figure 1A or the pGM830 plasmid in Figure 1B, pDNA2a is the pGM691 plasmid in Figure 1C or the pGM297 in Figure 1D, pDNA2b is the pGM299 plasmid in Figure 1E, pDNA3a is the pGM301 plasmid in Figure 1F, and pDNA3b is the pGM303 plasmid in Figure 1G, or a variant of any of these plasmids (as described herein). Using plasmids pGM326, pGM297, pGM299, pGM301, and pGM303, the final CFTR-containing retroviral / lentiviral vector can be designated vGM058. Using plasmids pGM326, pGM691, pGM299, pGM301, and pGM303, the final CFTR-containing retroviral / lentiviral vector can be designated vGM195. The pGM691 plasmid (typically containing pGM326, pGM299, pGM301, and pGM303) and the vGM195 vector may be preferred. Using the plasmids pGM830, pGM691, pGM299, pGM301, and pGM303, the final CFTR-containing retroviral / lentiviral vector can be designated vGM244. The pGM691 and pGM830 plasmids (typically containing pGM299, pGM301, and pGM303) and the vGM244 vector are particularly preferred.

[0127] The pGM326 plasmid defined in Figure 1A is represented by SEQ ID NO:8, the pGM830 plasmid defined in Figure 1B is represented by SEQ ID NO:9, the pGM691 plasmid defined in Figure 1C is represented by SEQ ID NO:7, the pGM297 plasmid defined in Figure 1D is represented by SEQ ID NO:10, the pGM299 plasmid defined in Figure 1E is represented by SEQ ID NO:11, the pGM301 plasmid defined in Figure 1F is represented by SEQ ID NO:12, and the pGM303 plasmid defined in Figure 1G is represented by SEQ ID NO:13. Variants of these plasmids (as defined herein) are also included within the scope of the present invention. In particular, variants having at least 90% (e.g., at least 90, 92, 94, 95, 96, 97, 98, 99, 99.5, or 100%) sequence identity to any one of SEQ ID NOs:7-13 are included.

[0128] In the five-plasmid method of the present invention, all five plasmids contribute to the formation of the final retroviral / lentiviral (e.g., SIV) vector. During production of a retroviral / lentiviral (e.g., SIV) vector, the vector genome plasmid (pDNA1) provides the enhancer / promoter, Psi, RRE, cPPT, mWPRE, SIN LTR, and SV40 polyA, which are important for virus production (see Figure 1A or 1B). Using pGM326 or pGM830 as non-limiting examples of pDNA1, the CMV enhancer / promoter, SV40 polyA, colE1 Ori, and KanR are involved in the production of the retroviral / lentiviral (e.g., SIV) vector of the present invention (e.g., vGM195 or vGM244), but are not found in the final retroviral / lentiviral (e.g., SIV) vector. The RRE, cPPT (central polypurine tract), hCEF, soCFTR2 (transgene), and mWPRE from pGM326 or pGM830 are found in the final retroviral / lentiviral (e.g., SIV) vector. The SIN LTR (long terminal repeat, SIN / IN self-inactivating) and Psi (packaging signal) may be found in the final retroviral / lentiviral (e.g., SIV) vector.

[0129] For other retroviral / lentiviral (e.g., SIV) vectors of the invention, corresponding elements from other vector genome plasmids (pDNA1) are required for production (but are not found in the final vector) or are present in the final retroviral / lentiviral (e.g., SIV) vector.

[0130] The F and HN proteins (preferably Sendai F and HN proteins) from pDNA3a and pDNA3b are important for infection of target cells by the final retroviral / lentiviral (e.g., SIV) vector, i.e., entry into the patient's epithelial cells (typically lung, preferably airway epithelial cells, as described herein). The products of the pDNA2a and pDNA2b plasmids are important for viral transduction, i.e., insertion of retroviral / lentiviral (e.g., SIV) DNA into the host genome. The promoter, control elements (such as the WPRE), and transgene are important for transgene expression in the target cells.

[0131] The retroviral / lentiviral (e.g., SIV) vectors of the present invention may be produced by a method comprising or consisting of the following steps: (a) growing cells in suspension, (b) transfecting the cells with one or more plasmids, (c) adding a nuclease, (d) harvesting the lentivirus (e.g., SIV), (e) adding trypsin, and (f) purifying the lentivirus (e.g., SIV).

[0132] This method may use either the four- or five-plasmid system described herein. Thus, for the preferred five-plasmid method, one or more plasmids may comprise or consist of the vector genome plasmid pDNA1, the gag-pol plasmid pDNA2a, the Rev plasmid pDNA2b, the fusion (F) protein plasmid pDNA3a, and the hemagglutinin-neuraminidase (HN) plasmid pDNA3b. pDNA1 may be selected from pGM326 and pGM830, preferably pGM830. pDNA2a may be selected from pGM297 and pGM691, preferably pGM297. pDNA2b may be pGM299. pDNA3a may be pGM301. pDNA3b may be pGM303. Any combination of pDNA1, pDNA2a, pDNA2b, pDNA3a, and pDNA3b may be used. Preferably, pDNA1 is pGM326 or pGM830 (pGM830 is particularly preferred), pDNA2a is pGM297 or pGM691 (pGM691 is particularly preferred), pDNA2b is pGM299, pDNA3a is pGM301, and pDNA3b is pGM303. An SIV vector generated using pGM830, pGM691, pGM299, pGM301, and pGM303 is designated vGM244. An SIV vector generated using pGM326, pGM691, pGM299, pGM301, and pGM303 is designated vGM195. vGM195 and vGM244 are preferred SIV.F / HN vectors for use in combination therapy according to the present invention, with vGM244 being particularly preferred.

[0133] In producing retrovirus / lentivirus (e.g., SIV), any suitable ratio of vector genome plasmid:co-gagpol plasmid:Rev plasmid:F plasmid:HN plasmid can be used.

[0134] Steps (a) through (f) of the method are typically performed sequentially, starting with step (a) through step (f). The method may include one or more additional steps, such as an additional purification step, buffer exchange, concentration of the purified retroviral / lentiviral (e.g., SIV) vector, and / or formulation of the purified (or concentrated) retroviral / lentiviral (e.g., SIV) vector. Each step may include one or more substeps. For example, harvesting may involve one or more steps or substeps, and / or purification may involve one or more steps or substeps.

[0135] Any suitable cell type may be transfected with one or more plasmids (e.g., the five plasmids described herein) to produce the retroviral / lentiviral (e.g., SIV) vectors of the present invention. Typically, mammalian cells, particularly human cell lines, are used. Non-limiting examples of cells suitable for use in the methods of the present invention include HEK293 cells (such as HEK293F or HEK293T cells) and 293T / 17 cells. Commercially available cell lines suitable for virus production are also readily available (e.g., Gibco Viral Production Cells—catalog number A35347, ThermoFisher Scientific).

[0136] Cells can be grown as adherent or suspension cultures in animal component-free media, including serum-free media. Cells may also be grown in media containing human components. Cells may also be grown in defined media that contain or consist of synthetically produced components.

[0137] Any suitable transfection means may be used in accordance with the present invention. The selection of a suitable transfection means is within the routine practice of one of ordinary skill in the art. By way of non-limiting example, transfection may be carried out using PEIPro™, Lipofectamine 2000™, Lipofectamine 3000™, or calcium triphosphate.

[0138] Any suitable nuclease may be used in accordance with the present invention. The selection of a suitable nuclease is within the routine practice of one skilled in the art. Typically, the nuclease is an endonuclease. As a non-limiting example, the nuclease may be Benzonase® or Denarase®. The addition of the nuclease may be at a pre-harvest stage, a post-harvest stage, or during the harvest step.

[0139] Trypsin activity may preferably be provided by a recombinant enzyme free of animal origin, such as TrypLE Select™. Addition of trypsin may be at a pre-harvest stage, a post-harvest stage, or during the harvest step.

[0140] Any suitable purification means may be used to purify retroviral / lentiviral (e.g., SIV) vectors. Non-limiting examples of suitable purification steps include depth / end filtration, tangential flow filtration (TFF), and chromatography. A purification step typically includes at least one chromatography step. Non-limiting examples of chromatography steps that can be used in accordance with the present invention include mixed-mode size exclusion chromatography (SEC) and / or anion exchange chromatography. Elution may be performed with or without, preferably without, a salt gradient.

[0141] This method may be used to generate retroviral / lentiviral (e.g., SIV) vectors of the invention as described herein, or which contain any of the above-described genes or genes encoding the above-described proteins.

[0142] The retroviral / lentiviral (eg, SIV) vectors of the present invention can be produced by methods using any combination of one or more of the specific plasmid constructs provided by Figures 1A-1G.

[0143] CFTR mutations CF is caused by mutations in the CFTR gene. To date, more than 2,000 different mutations have been identified in the CFTR gene. Some CFTR gene mutations result in the absence of CFTR protein production. Other mutations result in the production of dysfunctional CFTR protein. Using current conventional nomenclature, the various CF-causing mutations in the CFTR gene can be classified into classes depending on the effect of the mutation on the production, conformation, or function of the CFTR protein.

[0144] Class I CFTR mutations are proteinogenic mutations that result in the absence of functional CFTR protein. Approximately 22% of CF patients have at least one Class I CFTR mutation. Several nonsense and splice mutations are classified as Class I. Examples of Class I CFTR mutations include G542X, W1282X, and R553X.

[0145] Class II CFTR mutations are protein processing mutations. Class II CFTR mutations do not prevent CFTR protein from being produced, but the translated CFTR protein is misfolded and unable to form the correct higher-order structure. Typically, CFTR proteins with class II mutations are not transported to the cell membrane or are transported at a reduced level compared to normal CFTR proteins. Approximately 88% of CF patients have at least one class II CFTR mutation. Examples of class II CFTR mutations include F508del, N1303K, and I507del. F508del is the most common CFTR mutation that causes CF.

[0146] Class III CFTR mutations are gating mutations. Class III CFTR mutations do not prevent the CFTR protein from being produced or transported to the cell membrane. Instead, gating mutations cause the CFTR protein to adopt a closed conformation, preventing or reducing chloride transport. Approximately 6% of CF patients have at least one Class III CFTR mutation. Examples of Class III CFTR mutations include G551D and S549N.

[0147] Class IV CFTR mutations are conduction mutations. Class IV CFTR mutations do not prevent the CFTR protein from being produced or transported to the cell membrane, nor do they maintain the CFTR protein in a closed conformation. However, class IV mutations affect the internal conformation of the chloride channel within the CFTR protein, reducing chloride transport. Approximately 6% of CF patients have at least one class IV CFTR mutation. Examples of class IV CFTR mutations include D1152H, R347P, and R117H.

[0148] Class V CFTR mutations are called "insufficient protein mutations." Class V CFTR mutations result in a reduced amount of CFTR protein present in the cell membrane. This may occur because less CFTR protein is produced, resulting in only a small amount of protein functioning properly on the cell surface, or because normal CFTR protein in the cell membrane is degraded too quickly. Several missense and splice mutations are classified as class V. Approximately 5% of CFTR patients have at least one class V CFTR mutation. Examples of class V CFTR mutations include 3849+10kbC→T, 2789+5G→A, and A455E.

[0149] Class VI CFTR mutations destabilize the CFTR protein in post-endoplasmic reticulum (ER) compartments and / or at the plasma membrane by reducing the conformational stability of CFTR and / or by generating additional internalization signals. These mutations result in accelerated CFTR turnover at the plasma membrane and decreased expression at the apical plasma membrane.

[0150] The present invention relates to the treatment of CF caused by any combination of Class I, II, III, IV, V, and / or VI mutations. Patients treated according to the present invention may have CF caused by one or more Class I mutations, one or more Class II mutations, one or more Class III mutations, one or more Class IV mutations, one or more Class V mutations, and / or one or more Class VI mutations. The patient to be treated may have: (i) one or more mutations in class I and one or more mutations in class II; (ii) one or more mutations in class I and one or more mutations in class III; (iii) one or more mutations in class I and one or more mutations in class IV; (iv) one or more mutations in class I and one or more mutations in class V; (v) one or more mutations in class I and one or more mutations in class VI; (vi) one or more mutations in class II and one or more mutations in class III; (vii) one or more mutations in class II and one or more mutations in class IV; (viii) one or more mutations in class II and one or more mutations in class V; (ix) one or more mutations in class II (x) one or more mutations in Class III and one or more mutations in Class IV, (xi) one or more mutations in Class III and one or more mutations in Class V, (xii) one or more mutations in Class III and one or more mutations in Class VI, (xiii) one or more mutations in Class IV and one or more mutations in Class V, (xiv) one or more mutations in Class IV and one or more mutations in Class VI, (xv) one or more mutations in Class V and one or more mutations in Class VI, (xvi) one or more mutations in Class I, one or more mutations in Class II and one or more mutations in Class III.(xvii) one or more mutations in class I, one or more mutations in class II, and one or more mutations in class IV; (xviii) one or more mutations in class I, one or more mutations in class II, and one or more mutations in class V; (xix) one or more mutations in class I, one or more mutations in class II, and one or more mutations in class VI; (xx) one or more mutations in class I, one or more mutations in class III, and one or more mutations in class IV; (xxi) one or more mutations in class I, one or more mutations in class III, and one or more mutations in class V; (xxii) one or more mutations in class I, one or more mutations in class III, and one or more mutations in class VI; (xxiii) one or more mutations in class I, one or more mutations in class IV, and one or more mutations in class V; (xxiv) one or more mutations in class I (xxv) one or more mutations in class I, one or more mutations in class V and one or more mutations in class VI, (xxvi) one or more mutations in class II, one or more mutations in class III and one or more mutations in class IV, (xxvii) one or more mutations in class II, one or more mutations in class III and one or more mutations in class V, (xxviii) one or more mutations in class II, one or more mutations in class III and one or more mutations in class VI, (xxix) one or more mutations in class II, one or more mutations in class IV and one or more mutations in class V, (xxx) one or more mutations in class II, one or more mutations in class IV and one or more mutations in class VI, (xxxi) one or more mutations in class II.(xxxii) one or more mutations in class III, one or more mutations in class IV and one or more mutations in class V, (xxxiii) one or more mutations in class III, one or more mutations in class IV and one or more mutations in class VI, (xxxiv) one or more mutations in class III, one or more mutations in class V and one or more mutations in class VI, (xxxv) one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI, (xxxvi) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III and one or more mutations in class IV, (xxxvii) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III and one or more mutations in class IV (xxxviii) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III and one or more mutations in class VI, (xxxix) one or more mutations in class I, one or more mutations in class II, one or more mutations in class IV and one or more mutations in class V, (xl) one or more mutations in class I, one or more mutations in class II, one or more mutations in class IV and one or more mutations in class VI, (xli) one or more mutations in class I, one or more mutations in class II, one or more mutations in class V and one or more mutations in class VI, (xlii) one or more mutations in class I, one or more mutations in class III, one or more mutations in class IV and one or more mutations in class V, (xliii) one or more mutations in class I,(xliv) one or more mutations in class I, one or more mutations in class III, one or more mutations in class V and one or more mutations in class VI; (xlv) one or more mutations in class I, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI; (xlvi) one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV and one or more mutations in class V; (xlvii) one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV and one or more mutations in class VI; (xlviii) one or more mutations in class II, one or more mutations in class III, one or more mutations in class V (xlix) one or more mutations in class II, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI; (l) one or more mutations in class III, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI; (li) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV and one or more mutations in class V; (lii) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV and one or more mutations in class VI; (liii) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV and one or more mutations in class VI.(liv) one or more mutations in class I, one or more mutations in class II, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI, (lv) one or more mutations in class I, one or more mutations in class III, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI, (lvi) one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI, or (lvii) one or more mutations in class I, one or more mutations in class II, one or more mutations in class III, one or more mutations in class IV, one or more mutations in class V and one or more mutations in class VI.

[0151] Patients treated according to the present invention may have at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or more mutations in the CFTR gene, each of which may be independently selected from the Class I, Class II, Class III, Class IV and / or Class V mutations described herein.

[0152] Patients treated according to the present invention may have at least one class I and / or class II CFTR mutation, such as those described herein. Patients treated may have (i) at least one class I CFTR mutation, which may be selected from G542X, W1282X, and / or R553C, and / or (ii) at least one class II CFTR mutation, which may be selected from F508del, N1303K, and / or I507del.

[0153] As exemplified herein, the combination therapy of the present invention successfully restored CFTR expression and function in a model of class I CFTR mutation, and the surprising effect of the combination was greater for a CFTR transgene expressed by a retro / lentiviral (e.g., SIV) vector than for the endogenous CFTR gene. Therefore, the combination therapy of the present invention may be suitable for use regardless of the patient's CFTR mutation. In other words, without being bound by theory, the nature of the CF-causing mutation in the endogenous CFTR gene may be irrelevant, since a CFTR modulator may exert a greater therapeutic effect on the CFTR transgene. Thus, the present invention has the potential to treat patients with CF independently of the CF-causing mutation. This is advantageous, since currently approved CFTR modulator therapies are only suitable for patients with specific CFTR mutations.

[0154] CFTR modulators CFTR modulators are active pharmaceutical ingredients (APIs) designed to correct dysfunctional CFTR protein. CFTR modulators are a group of specialized therapies, as different modulators are designed to address the underlying defect in the CFTR protein caused by a specific CFTR mutation or class of CFTR mutations.

[0155] There are three main types of CFTR modulators: CFTR potentiators, CFTR collectors, and CFTR amplifiers.

[0156] As discussed herein, class III CFTR mutations, such as G551D, are gating mutations that prevent the normal opening of the CFTR protein and facilitate chloride transport. CFTR potentiators alleviate this defect by opening the CFTR protein gates and keeping them open longer, facilitating the smooth flow of chloride. Ivacaftor (Kalydeco®) is an example of a CFTR potentiator developed by Vertex Pharmaceuticals. It is an oral medication approved by the U.S. Food and Drug Administration (FDA), the EU, and Health Canada for CF patients as young as one year old who have at least one mutation (such as G551D) that impairs chloride flow. Another example of a CFTR potentiator is PTI-808, an experimental therapeutic agent being developed by Proteostasis Therapeutics.

[0157] As discussed herein, class II CFTR mutations are protein processing mutations that result in misfolding of the CFTR protein, which can affect transport of the misfolded CFTR to the cell surface. CFTR correctors help the CFTR protein fold correctly into its 3D conformation, allowing it to be successfully transported to the cell membrane where it can function. Lumacaftor (VX-809) and tezacaftor (VX-661) are two treatments from Vertex Pharmaceuticals that function as correctors. Another CFTR corrector is elexacaftor. While these correctors help the CFTR protein fold correctly and reach the cell surface, they are not sufficient by themselves to alleviate CF symptoms. For this reason, they have not been approved as monotherapy for CF. Another CFTR corrector in development (from Proteostasis Therapeutics) is PTI-801.

[0158] As discussed herein, Class V CFTR mutations result in reduced levels of CFTR protein present on the cell surface, for example, by reducing the level of expressed CFTR protein or increasing the rate of CFTR protein degradation. Amplifiers are a type of CFTR modulator that enhances the production of CFTR protein by cells. PTI-428 is a first-generation CFTR amplifier being developed by Proteostasis Therapeutics, Inc. and is being tested as a monotherapy and combination therapy for CF.

[0159] CFTR potentiators, correctors, and amplifiers have been described in the art for use independently as monotherapies. In addition, combinations of these CFTR modulators are also known, and three of the four currently approved CFTR modulator therapies are combination therapies. As a non-limiting example, combining a potentiator with a corrector can improve CFTR activity by correcting CFTR conformation and opening the gate to allow chloride ion transport. In particular, the combination of the potentiator ivacaftor and the corrector macaftor has been approved as a combination therapy and is sold by Vertex as Orkambi® for use in treating CF patients with two F508del CFTR mutations. Another example of an approved combination therapy is the potentiator ivacaftor and the corrector tezacaftor, which is sold by Vertex as Symdeko® in the United States and Symkevi® in the EU.

[0160] Amplifiers can also be used in combination with other CFTR modulators. Combining a CFTR amplifier with other CFTR modulators can be advantageous because the CFTR amplifier can cause more CFTR protein to be expressed, which can then be acted upon by the other CFTR modulators.

[0161] In addition to these first-generation CFTR modulators, so-called next-generation modulators may combine multiple CFTR correctors to produce combination therapies with three or more APIs. An example of an approved next-generation CFTR modulator is Trikafta®, which combines the potentiator ivacaftor with two correctors tezacaftor and elexacaftor.

[0162] Any reference to a CFTR modulator herein encompasses any salts, derivatives, and analogs of the CFTR modulator, unless expressly stated to the contrary. Accordingly, the present invention relates to combinations of known CFTR modulators, such as those individually described herein (particularly ivacaftor) or salts, derivatives, or analogs thereof. Salt forms preferably include pharmaceutically acceptable salts. Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids, such as hydrochloric acid or phosphoric acid, or with organic acids, such as acetic acid, oxalic acid, tartaric acid, maleic acid, and the like. An "analog" of a CFTR modulator, as the term is used herein, refers to a chemical structure that retains substantial similarity to a CFTR modulator but cannot be readily synthetically derived from the CFTR modulator. Related chemical structures that can be readily synthetically derived from the CFTR modulator structure are referred to as "derivatives." All of these are within the scope of the present invention. As a non-limiting example, reference to "ivacaftor" includes salt forms, analogs, and derivatives of ivacaftor, such as deuterated ivacaftor (D-ivacaftor).

[0163] Thus, the present invention relates to therapeutic methods that include a gene therapy vector, particularly one using a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, in combination with one or more CFTR modulators, which may be selected from one or more CFTR potentiators, one or more CFTR correctors, and / or one or more CFTR amplifiers, or a combination thereof. Combinations that include one or more CFTR potentiators in combination with a retro / lentiviral (e.g., SIV) vector are particularly preferred. Thus, the present invention may relate to the use of a gene therapy vector, particularly one using a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, in combination with one or more CFTR potentiators. One or more CFTR correctors and / or one or more CFTR amplifiers may be used in addition to a gene therapy vector, particularly one using a retro / lentiviral (e.g., SIV) vector, preferably the SIV.F / HN vector, described herein, in combination with one or more CFTR potentiators.

[0164] Thus, the present invention relates to the combination of a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, with a CFTR modulator, which may be selected from one or more CFTR potentiators, one or more CFTR correctors, and / or one or more CFTR amplifiers, or a combination thereof. Typically, the present invention relates to the combination of a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, with a CFTR potentiator and / or a CFTR corrector. Preferably, the present invention relates to the combination of a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, with a CFTR potentiator and any one or more CFTR correctors and / or one or more CFTR amplifiers.

[0165] Any CFTR modulator may be used in combination with the retro / lentiviral (e.g., SIV) vectors described herein, preferably the SIV.F / HN vectors according to the invention, such as those described herein. Thus, non-limiting examples of CFTR modulators that may be used in combination with the retro / lentiviral (e.g., SIV) vectors described herein, preferably the SIV.F / HN vectors according to the invention, include ivacaftor (Kalydeco®), PTI-808, VX-809 (lumacaftor) and VX-661 (tezacaftor), elexacaftor, PTI-801, PTI-428, and combinations such as ivacaftor + lumacaftor (Orkambi®), ivacaftor + tezacaftor (Symdeko® or Symkevi®), and ivacaftor + tezacaftor + elexacaftor (Trikafta®).

[0166] Preferably, the present invention relates to a combination of a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, with a CFTR modulator selected from ivacaftor, tezacaftor, elexacaftor, or lumacaftor, or a combination thereof. Particularly preferred is a combination of a retro / lentiviral (e.g., SIV) vector described herein, preferably the SIV.F / HN vector, with the CFTR modulator (specifically the CFTR potentiator) ivacaftor.

[0167] A preferred embodiment relates to the use of (A) an SIV vector pseudotyped with Sendai virus hemagglutinin-neuraminidase (HN) and fusion (F) protein, wherein (a) the vector comprises a modified retroviral RNA sequence comprising or consisting of the nucleic acid sequence of SEQ ID NO: 16 (including a CFTR transgene), preferably the modified retroviral RNA sequence consists of the nucleic acid sequence of SEQ ID NO: 16, (b) the F protein comprises a first subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 19 and a second subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 20, in combination with (B) a CFTR modulator selected from ivacaftor, tezacaftor, elexacaftor, or lumacaftor, or a combination thereof.

[0168] A particularly preferred embodiment relates to the use of (A) an SIV vector pseudotyped with Sendai virus hemagglutinin-neuraminidase (HN) and fusion (F) protein, wherein (a) the vector comprises a modified retroviral RNA sequence comprising or consisting of the nucleic acid sequence of SEQ ID NO: 16 (including a CFTR transgene), preferably the modified retroviral RNA sequence consists of the nucleic acid sequence of SEQ ID NO: 16, (b) the F protein comprises a first subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 19 and a second subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 20, in combination with (B) ivacaftor, a CFTR modulator (specifically a CFTR potentiator).

[0169] As described herein, in the particularly preferred embodiment, an SIV vector is pseudotyped with a Sendai virus hemagglutinin-neuraminidase (HN) and fusion (F) protein, wherein (a) the vector comprises a modified retroviral RNA sequence comprising or consisting of the nucleic acid sequence of SEQ ID NO: 16 (including a CFTR transgene), preferably the modified retroviral RNA sequence consists of the nucleic acid sequence of SEQ ID NO: 16; (b) the F protein comprises a first subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 19 and a second subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 20; and the vector further comprises (a) a p17 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 22; (b) a p24 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 23; and (c) a p8 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 24. (d) a protease comprising or consisting of the amino acid sequence of SEQ ID NO: 25; (e) a p51 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 26; (f) a p15 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 27; (g) a p31 protein comprising or consisting of the amino acid sequence of SEQ ID NO: 28; (h) a Gag protein comprising or consisting of the amino acid sequence of SEQ ID NO: 29; and / or (i) a Pol protein comprising or consisting of the amino acid sequence of SEQ ID NO: 30; and the vector may comprise each of (a) to (g), and is combined with a CFTR modulator selected from ivacaftor, tezacaftor, elexacaftor, or lumacaftor, or a combination thereof, and is particularly combined with ivacaftor, which is a CFTR modulator (specifically a CFTR potentiator).

[0170] Therapeutic indications The retroviral / lentiviral (e.g., SIV) vectors of the present invention enable higher and more sustained gene expression through efficient gene transfer. The F / HN-pseudotyped retroviral / lentiviral (e.g., SIV) vectors of the present invention are capable of (i) airway transduction without disruption of epithelial integrity, (ii) sustained gene expression, (iii) lack of chronic toxicity, and (iv) efficient repeated administration. Long-term / sustained stable gene expression, preferably at therapeutically effective levels, can be achieved using repeated administration of the vectors of the present invention. Alternatively, a single dose may be used to achieve the desired long-term expression. Advantageously, the retroviral / lentiviral (e.g., SIV) vectors of the present invention can be used in gene therapy for CF by providing a functional copy of the CFTR gene to ameliorate or prevent lung disease in CF patients, independent of underlying mutations.

[0171] CFTR modulators are a breakthrough treatment that targets the underlying cause of CF rather than improving the symptoms of the disease, but current CFTR modulators are only effective in patients with specific mutations.

[0172] Therefore, combining the use of gene therapy with CFTR modulators may bring about significant advances in the treatment of CF. The present inventors have for the first time investigated the effects of combining retroviral / lentiviral (e.g., SIV) vectors with CFTR modulators. In particular, the present inventors have shown that gene therapy using the retroviral / lentiviral (e.g., SIV) vectors of the present invention, when combined with CFTR modulators, produces a greater therapeutic effect than expected. As exemplified herein, the present inventors have surprisingly demonstrated that the effect of the combination of a CFTR modulator, particularly a CFTR potentiator, with rSIV.F / HN-CFTR is greater than the additive effect of the individual effects of the CFTR modulator, particularly a CFTR potentiator, and rSIV.F / HN-mediated CFTR expression.

[0173] Thus, retroviral / lentiviral (eg, SIV) vectors carrying a CFTR transgene according to the invention can be used in combination with one or more CFTR modulators to treat CF.

[0174] A preferred embodiment relates to the therapeutic use of (A) an SIV vector pseudotyped with Sendai virus hemagglutinin-neuraminidase (HN) and a fusion (F) protein, wherein (a) the vector comprises a modified retroviral RNA sequence comprising or consisting of the nucleic acid sequence of SEQ ID NO: 16 (including a CFTR transgene), preferably wherein the modified retroviral RNA sequence consists of the nucleic acid sequence of SEQ ID NO: 16; (b) the F protein comprises a first subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 19 and a second subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 20; and (B) in combination with a CFTR modulator selected from ivacaftor, tezacaftor, elexacaftor, or lumacaftor, or a combination thereof.

[0175] A particularly preferred embodiment relates to the therapeutic use of (A) an SIV vector pseudotyped with Sendai virus hemagglutinin-neuraminidase (HN) and a fusion (F) protein, wherein (a) the vector comprises a modified retroviral RNA sequence comprising or consisting of the nucleic acid sequence of SEQ ID NO: 16 (including a CFTR transgene), preferably the modified retroviral RNA sequence consists of the nucleic acid sequence of SEQ ID NO: 16, (b) the F protein comprises a first subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 19 and a second subunit comprising or consisting of the amino acid sequence of SEQ ID NO: 20, in combination with (B) ivacaftor, a CFTR modulator (specifically a CFTR potentiator).

[0176] A retroviral / lentiviral (e.g., SIV) vector and one or more CFTR modulators can be administered to a patient with CF who is exhibiting one or more symptoms of CF. When administered to such a patient, the retroviral / lentiviral (e.g., SIV) vector and one or more CFTR modulators can cure, delay, reduce the severity of, or ameliorate one or more symptoms and / or extend the patient's survival beyond that expected in the absence of such treatment and / or beyond that expected with conventional CF treatments (e.g., CFTR modulators, particularly CFTR potentiators alone). Thus, retroviral / lentiviral (e.g., SIV) vectors and one or more CFTR modulators, particularly CFTR potentiators, can be administered to patients with CF to ameliorate disease and / or extend the survival of patients with CF beyond that expected in the absence of such treatment and / or beyond that expected with conventional CF treatments (e.g., CFTR modulators or CFTR potentiators alone).

[0177] The retroviral / lentiviral (e.g., SIV) vector and one or more CFTR modulators are administered in combination. Administered "in combination" encompasses both simultaneous (also called concomitant) and sequential (also called separate) administration / delivery.

[0178] With respect to "simultaneous" or "concurrent delivery," delivery of the retroviral / lentiviral (e.g., SIV) vector may still be occurring at the time delivery of the CFTR modulator is initiated, or delivery of the CFTR modulator may still be occurring at the time delivery of the retroviral / lentiviral (e.g., SIV) vector is initiated, such that there is an overlap in terms of administration. Concurrent delivery may typically encompass delivery of the retroviral / lentiviral (e.g., SIV) vector and the CFTR modulator within weeks to months or even years of each other, such that retroviral / lentiviral (e.g., SIV) vector delivery overlaps with delivery of the CFTR modulator.

[0179] Alternatively, delivery of the retroviral / lentiviral (e.g., SIV) vector may terminate before delivery of the CFTR modulator begins, or delivery of the CFTR modulator may terminate before delivery of the retroviral / lentiviral (e.g., SIV) vector begins. Sequential administration may include administration of the retroviral / lentiviral (e.g., SIV) vector and the CFTR modulator within 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, or 24 hours, 1 week, 2 weeks, 1 month, 2 months, or longer of each other.

[0180] The CFTR modulator may be administered once every hour, once every 2 hours, once every 3 hours, once every 4 hours, once every 6 hours, once every 8 hours, once every 12 hours, once daily, once every 2 days, or at longer intervals. Typically, the CFTR modulator is administered every 12 hours.

[0181] Retroviral / lentiviral (e.g., SIV) vectors may be administered monthly, once every two months, once every three months, once every four months, once every six months, once every eight months, once every twelve months, or at longer intervals. Because retroviral / lentiviral (e.g., SIV) vectors are administered less frequently than CFTR modulators, administration of the combination therapy is typically by sequential administration.

[0182] Treatment with the retroviral / lentiviral (e.g., SIV) vector and / or CFTR modulator at the desired dosing frequency may be continued for as long as needed, for example, at least 6 months, at least 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, or longer, up to the life of the patient being treated.

[0183] Typically, treatment is more effective due to the combined administration. For example, treatment with a CFTR modulator may be more effective, e.g., a comparable effect is seen with a lesser CFTR modulator, or the CFTR modulator alleviates symptoms to a greater extent than would be seen if the CFTR modulator were administered in the absence of a retroviral / lentiviral (e.g., SIV) vector, or a similar situation would be seen with a retroviral / lentiviral (e.g., SIV) vector. Typically, delivery is such that alleviation of symptoms or other parameters associated with CF is greater than that observed with a CFTR modulator delivered in the absence of a retroviral / lentiviral (e.g., SIV) vector, or a similar situation would be seen with a retroviral / lentiviral (e.g., SIV) vector.

[0184] It will be understood that appropriate dosages of retroviral / lentiviral (eg, SIV) vector and / or CFTR modulator will depend on the particular agent and may vary from patient to patient.

[0185] It will be understood that appropriate dosages of retroviral / lentiviral (eg, SIV) vector and / or CFTR modulator will depend on the particular agent and may vary from patient to patient.

[0186] Determining the optimal dosage generally involves balancing the level of therapeutic benefit against any risk or adverse side effects of the treatments described herein. The selected dosage level will depend on a variety of factors, including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of treatment, other drugs, compounds, and / or materials used in combination, and the patient's age, sex, weight, condition, general health, and medical history. The amount of compound and route of administration are ultimately at the discretion of the physician, but generally, the dosage will achieve a local concentration at the site of action that achieves the desired effect without causing substantial harmful or toxic side effects. Non-limiting exemplary dosages and routes of administration are described herein.

[0187] In vivo administration can be carried out in a single dose, sequentially, or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those skilled in the art and will vary depending on the formulation used for treatment, the purpose of the treatment, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out, with the dose level and pattern being selected by the treating physician.

[0188] The duration of action of a combination therapy according to the invention may be at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 12 weeks, at least 6 months, at least 1 year or longer. Typically, this is assessed with respect to the last administration of a retroviral / lentiviral (e.g., SIV) vector and / or CFTR modulator, particularly the last administration of a retroviral / lentiviral (e.g., SIV) vector.

[0189] The retroviral / lentiviral (e.g., SIV) vector according to the present invention is typically administered by inhalation. Thus, the retroviral / lentiviral (e.g., SIV) vector can be formulated for inhalation as described herein. One or more CFTR modulators can be administered by any suitable route and formulated accordingly. In particular, one or more CFTR modulators can be administered orally or formulated for oral administration.

[0190] Accordingly, the present invention provides methods of treating CF in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of each of (i) a retroviral / lentiviral (e.g., SIV) vector of the invention, and (ii) one or more CFTR modulators. Any of the retroviral / lentiviral (e.g., SIV) vectors described herein may be used in combination with any one or more CFTR modulators, such as those described and exemplified herein.

[0191] The combination therapy of the present invention can restore CFTR expression and / or activity to a level that provides a therapeutic benefit. The combination therapy can restore (increase) CFTR expression and / or activity to a level that matches or exceeds the CFTR expression and / or activity in a healthy control. However, restoration of normal CFTR expression and / or activity is not necessary to achieve a therapeutic benefit. Instead, the therapeutic threshold, i.e., the level above which a therapeutic benefit is achieved, can be lower than the level of CFTR expression and / or activity in a healthy control. In fact, patients, particularly those with class I CFTR mutations that result in null CFTR expression, can receive therapeutic benefit even from a relatively small increase in CFTR expression and / or activity (e.g., 5% or 10% CFTR expression and / or activity compared to healthy control expression levels).

[0192] The retroviral / lentiviral (e.g., SIV) vectors described herein, particularly in the context of the combination therapies of the invention, are capable of increasing (restoring) CFTR expression (particularly cellular CFTR expression levels and / or global expression in the lung or respiratory tree), CFTR activity, and / or CFTR current as described herein. Any combination of increases in CFTR expression (cellular and / or global), CFTR activity, and / or CFTR current, including the quantified increases described below, is within the scope of the invention.

[0193] The retroviral / lentiviral (e.g., SIV) vectors described herein, particularly in the context of the combination therapies of the present invention, can increase (restore) CFTR expression (particularly cellular CFTR expression levels and / or global expression in the lung or respiratory tree) to at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 120% or more of CFTR expression in a healthy control. Typically, the retroviral / lentiviral (e.g., SIV) vectors described herein, particularly in the context of the combination therapies of the present invention, can increase (restore) CFTR expression, particularly CFTR cellular expression levels, to at least 20%, preferably at least 50%, and more preferably at least 75% of CFTR expression in a healthy control. The retroviral / lentiviral (e.g., SIV) vectors described herein, particularly in the context of the combination therapy of the present invention, can increase (restore) CFTR expression, particularly overall CFTR expression in the lung, to at least 5%, at least 10%, and preferably at least 20% of CFTR expression in healthy controls. The expression level of the transgene and / or encoded therapeutic protein of the present invention can be measured in lung tissue. Thus, a high and / or therapeutic expression level can refer to the concentration in the lung. CFTR expression can be quantified using one or more of the following techniques: CFTR RNA expression in lung tissue, CFTR protein expression in lung tissue, PK assay (vector copy number, integration), or DNA content in sputum (as a surrogate for NETosis).

[0194] Other endpoints for assessing the efficacy of treatment according to the invention include: improvement in FEV1 (lung function), MRI and / or CT scans to assess efficacy, reduction in the expression of one or more biomarkers of inflammation, for example IL-8, IL 1β, IL-6, TNFα (typically measured in sputum), calprotectin (typically measured in serum), sputum cell fraction, reduction in serum surfactant protein D (SP-D) as a marker of reduced epithelial damage, reduction in pulmonary exacerbations, improvement in lung clearance index, quality of life as a patient reported outcome via the CFQ-R respiratory domain (and / or other appropriate questionnaires as well), exploratory imaging endpoints (e.g. via Eichinger score on mRI to indicate improvement in lung ventilation, mucus obstruction and / or other).

[0195] Alternatively or additionally, the combination therapy of the present invention can increase (restore) CFTR activity (particularly cellular CFTR activity in the lung or respiratory tree and / or overall activity) by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 120%, or more of the CFTR activity in a healthy control. Typically, the combination therapy of the present invention can increase (restore) CFTR activity, particularly CFTR cellular activity, by at least 20%, preferably at least 50%, and more preferably at least 75% of the CFTR activity in a healthy control. The retroviral / lentiviral (e.g., SIV) vectors described herein, particularly in the context of the combination therapy of the present invention, can increase (restore) CFTR activity, particularly overall CFTR expression in the lung, by at least 5%, at least 10%, and preferably at least 20% of the CFTR activity in a healthy control.

[0196] As used herein, a healthy control is typically a comparable individual or population that does not have CF. Preferably, the healthy control is a comparable individual or population that does not have CF and is otherwise in good health. The healthy control can be matched to the subject using standard clinical methods (e.g., age / gender matching, or matching based on other criteria).

[0197] Other controls may be comparable individuals with CF who have been treated with either a retroviral / lentiviral (eg, SIV) vector or a CFTR modulator alone.

[0198] CFTR activity can be defined in terms of CFTR RNA expression in lung tissue, CFTR protein expression in lung tissue, and / or activity of the CFTR channel itself (e.g., by electrophysiological measurements using bronchial brushings from a patient).

[0199] The combination therapy of the present invention can increase (restore) CFTR current by at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 2-fold, or more compared to treatment with a retroviral / lentiviral (e.g., SIV) vector alone (i.e., compared to the increase in CFTR current achieved with treatment with a retroviral / lentiviral (e.g., SIV) vector alone). The combination therapy of the present invention can increase (restore) CFTR current by about 1.3-fold to about 3-fold, or about 1.2-fold to about 2-fold compared to treatment with a retroviral / lentiviral (e.g., SIV) vector alone (i.e., compared to the increase in CFTR current achieved with treatment with a retroviral / lentiviral (e.g., SIV) vector alone). Preferably, the combination therapy of the present invention can increase (restore) CFTR current by at least about 1.2-fold, at least about 1.3-fold, at least about 1.5-fold, or at least about 1.8-fold, e.g., about 1.3-fold to about 1.8-fold, compared to treatment with a retroviral / lentiviral (e.g., SIV) vector alone.

[0200] The combination therapy of the present invention can increase (restore) CFTR current to at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 120%, or more than that in a healthy control. Typically, the combination therapy of the present invention can increase (restore) CFTR cellular current to at least 20%, preferably at least 50%, and more preferably at least 75% of that in a healthy control. The retroviral / lentiviral (e.g., SIV) vectors described herein, particularly in the context of the combination therapy of the present invention, can increase (restore) CFTR current, particularly in the lung overall, to at least 5%, at least 10%, and preferably at least 20% of that in a healthy control.

[0201] The present invention provides a combination of a retrovirus / lentivirus (e.g., SIV) and one or more CFTR modulators as described herein for use in the treatment of CF, wherein the treatment (i) restores cellular CFTR activity to at least 10% or at least 50% (e.g., at least 70%) of CFTR activity in healthy controls, (ii) restores global CFTR activity in the lung to at least 5% or at least 10% (e.g., at least 20%) of CFTR activity in healthy controls, and / or (iii) increases CFTR current by at least about 1.3-fold (e.g., from about 1.3-fold to about 1.8-fold, from about 1.3-fold to about 3-fold, or about 1.3-fold) compared to treatment with the retrovirus / lentivirus (e.g., SIV) vector alone. Typically, the invention provides a combination of a retrovirus / lentivirus (e.g., SIV) and one or more CFTR modulators described herein for use in the treatment of CF, wherein the treatment (i) restores overall CFTR activity in the lung to at least 5% or at least 10% (e.g., at least 20%) of CFTR activity in healthy controls, and / or (ii) increases CFTR current by at least about 1.3-fold (e.g., from about 1.3-fold to about 1.8-fold, from about 1.3-fold to about 3-fold, or about 1.3-fold) compared to treatment with the retrovirus / lentivirus (e.g., SIV) vector alone.

[0202] The present invention provides a combination of a retrovirus / lentivirus (e.g., SIV) and one or more CFTR modulators described herein for use in the treatment of CF, wherein the patient being treated has at least one Class I CFTR mutation, and the treatment (i) restores cellular CFTR activity to at least 10% or at least 50% (e.g., at least 70%) of CFTR activity in healthy controls, (ii) restores global CFTR activity in the lung to at least 5% or at least 10% (e.g., at least 20%) of CFTR activity in healthy controls, and / or (iii) increases CFTR current by at least about 1.3-fold (e.g., from about 1.3-fold to about 1.8-fold, from about 1.3-fold to about 3-fold, or about 1.3-fold) compared to treatment with the retrovirus / lentivirus (e.g., SIV) vector alone. Typically, the invention provides a combination of a retrovirus / lentivirus (e.g., SIV) and one or more CFTR modulators described herein for use in the treatment of CF, wherein the patient being treated has at least one Class I CFTR mutation and the treatment (i) restores overall CFTR activity in the lung to at least 5% or at least 10% (e.g., at least 20%) of the CFTR activity in healthy controls, and / or (ii) increases CFTR current by at least about 1.3-fold (e.g., from about 1.3-fold to about 1.8-fold, from about 1.3-fold to about 3-fold, or about 1.3-fold) compared to treatment with the retrovirus / lentivirus (e.g., SIV) vector alone.

[0203] The present invention provides a combination of a retrovirus / lentivirus (e.g., SIV) and one or more CFTR modulators described herein for use in the treatment of CF, wherein the patient being treated has at least one Class II CFTR mutation, and the treatment (i) restores cellular CFTR activity to at least 10% or at least 50% (e.g., at least 70%) of CFTR activity in healthy controls, (ii) restores global CFTR activity in the lung to at least 5% or at least 10% (e.g., at least 20%) of CFTR activity in healthy controls, and / or (ii) increases CFTR current by at least about 1.3-fold (e.g., from about 1.3-fold to about 1.8-fold, from about 1.3-fold to about 3-fold, or about 1.3-fold) compared to treatment with the retrovirus / lentivirus (e.g., SIV) vector alone. Typically, the invention provides a combination of a retrovirus / lentivirus (e.g., SIV) and one or more CFTR modulators described herein for use in the treatment of CF, wherein the patient being treated has at least one class II CFTR mutation and the treatment (i) restores overall CFTR activity in the lung to at least 5% or at least 10% (e.g., at least 20%) of CFTR activity in healthy controls, and / or (ii) increases CFTR current by at least about 1.3-fold (e.g., from about 1.3-fold to about 1.8-fold, from about 1.3-fold to about 3-fold, or about 1.3-fold) compared to treatment with the retrovirus / lentivirus (e.g., SIV) vector alone.

[0204] The retroviruses / lentiviruses (e.g., SIV) described herein, typically as part of a combination therapy of the invention, are capable of transducing airway epithelial cells at a transduction rate sufficient to achieve a therapeutic effect on CFTR expression and / or activity. Typically, the retroviruses / lentiviruses (e.g., SIV) described herein, typically as part of a combination therapy of the invention, are capable of transducing airway epithelial cells at a transduction rate of at least about 5%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, or higher, e.g., about 10% to about 20% (i.e., about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%). Preferably, the retroviruses / lentiviruses (e.g., SIV) described herein, typically as part of a combination therapy of the present invention, are capable of transducing airway epithelial cells at a transduction rate of about 1% to about 50% (i.e., about 14%, 15%, 17%, 18%, 20%, 25%, 30%, 35%, 40%, or 45%). As defined herein, the term "airway epithelial cells" encompasses any cell found within the airway epithelium as described herein, including, but not limited to, basal cells and submucosal gland duct cells in the upper respiratory tract, goblet cells, club cells, and neuroendocrine cells in the bronchiolar airways, bronchoalveolar stem cells in the terminal bronchioles, and type II pneumocytes in the alveoli, and any combination thereof.

[0205] The retroviral / lentiviral (e.g., SIV) vectors described herein may achieve a VCN of at least 1 copy / cell, 2 copies / cell, 3 copies / cell, 4 copies / cell, 5 copies / cell, 6 copies / cell, 7 copies / cell, 8 copies / cell, 9 copies / cell, at least 10 copies / cell or more, particularly in the context of the combination therapies of the invention.

[0206] In some embodiments, the present invention relates to the use of a retroviral / lentiviral (e.g., SIV) vector carrying a CFTR transgene according to the present invention in combination with one or more CFTR modulators, wherein the combination does not further comprise a LasB inhibitor. In other words, the present invention relates to the treatment of CF using a retroviral / lentiviral (e.g., SIV) vector carrying a CFTR transgene according to the present invention in combination with one or more CFTR modulators, with the proviso that no LasB inhibitor is used in the method. In particular, in such embodiments, the use of indane as a LasB inhibitor, as disclosed in WO 2021 / 191240, is abandoned.

[0207] The present invention also provides combinations of retroviral / lentiviral (e.g., SIV) vectors described herein with one or more CFTR modulators for use in methods of treating CF. Any of the retroviral / lentiviral (e.g., SIV) vectors described herein may be used in combination with any one or more CFTR modulators, such as those described and exemplified herein.

[0208] The present invention also provides for the use of a retroviral / lentiviral (e.g., SIV) vector described herein in the manufacture of a medicament for use in a method of treating CF, wherein the method of treatment further comprises the administration of one or more CFTR modulators. The present invention also provides for the use of a CFTR modulator as described herein in the manufacture of a medicament for use in a method of treating CF, wherein the method of treatment further comprises the administration of a retroviral / lentiviral (e.g., SIV) vector. Any retroviral / lentiviral (e.g., SIV) vector as described herein may be used in combination with any one or more CFTR modulators, such as those described and exemplified herein.

[0209] Formulation and Administration The retroviral / lentiviral (e.g., SIV) vectors and CFTR modulators of the invention may each be administered independently at any dosage appropriate to achieve the desired therapeutic effect. Appropriate dosages can be determined by a clinician or other physician in the routine course of treatment using standard techniques.

[0210] A non-limiting example of a suitable dosage for a retroviral / lentiviral (e.g., SIV) vector is about 1 x 10 6 (10 6 Transducing units (TU) ~ about 1 x 10 14 (10 14 (may be written as) TU, preferably about 10 6 TU~about 10 12 TU, e.g., about 10 6 TU, 1.5 x 10 6 TU, 10 7 TU, 1.5 x 10 7 TU, 10 8 TU, 1.5 x 10 8 TU, 5×10 8 TU, 8×10 8 TU, 10 9 TU, 1.5 x 10 9 TU, 10 10 TU, 1.5 x 10 10 TU, 10 11 TU, 1.5 x 10 11 Preferred dose ranges include about 8 TU or more. 8 ~about 10 14 Between TUs, or about 10 6 ~about 10 12 These doses may be administered at any dosing interval determined by the treating clinician, for example, at dosing intervals described herein (e.g., every 3 months, every 6 months, every 12 months, every 24 months, every 36 months, or every 48 months). As a non-limiting example, 6 A dose of TU may be administered once every six months. As a further non-limiting example, 10 A dose of TU may be administered once every 12 months.

[0211] Each CFTR modulator may be administered at the standard dose specified for monotherapy of CF with that CFTR modulator, i.e., at the approved or standard dose / concentration for monotherapy with that modulator. Each CFTR modulator, as part of a combination therapy according to the present invention, may be administered at a dose lower than the standard dose specified for monotherapy with that CFTR modulator, i.e., at a concentration lower than the approved or standard dose / concentration for monotherapy with that modulator. The CFTR modulator may be administered at a dose of about 5 mg to about 200 mg, e.g., about 5 mg to about 150 mg, about 25 mg to about 150 mg, or about 75 mg to about 150 mg. These doses may be administered at any dosing interval determined by the treating clinician, e.g., at a dosing interval described herein (e.g., every 4 hours, every 8 hours, or every 12 hours, preferably every 12 hours).

[0212] As a non-limiting example, ivacaftor may be administered at a dose of about 5 mg to about 150 mg, preferably about 25 mg to about 150 mg, e.g., about 150 mg, every 12 hours. As a further non-limiting example, in pediatric dosing, ivacaftor may be administered at a dose of about 75 mg every 12 hours.

[0213] As a further non-limiting example, Trikafta® (elexacaftor+tezacaftor+ivacaftor) may be administered every 12 hours, with the first (typically morning) dose of Trikafta® typically containing about 200 mg of elexacaftor, about 100 mg of tezacaftor, and about 150 mg of ivacaftor (e.g., in the form of two tablets, each containing elexacaftor+tezacaftor+ivacaftor), and the second (typically evening) dose containing about 150 mg of ivacaftor (e.g., in the form of two tablets).

[0214] As a further non-limiting example, Orkambi® (lumacaftor plus ivacaftor) may be administered every 12 hours, with each dose of Orkambi® typically containing about 400 mg of lumacaftor and about 250 mg of ivacaftor (e.g., in the form of two tablets, each containing lumacaftor plus ivacaftor). As a further non-limiting example, in pediatric dosing, Orkambi® may be administered every 12 hours, with each dose of Orkambi® typically containing about 200 mg of lumacaftor and about 250 mg of ivacaftor (e.g., in the form of two tablets, each containing lumacaftor plus ivacaftor).

[0215] As a further non-limiting example, Symdeko® (tezacaftor plus ivacaftor) may be administered every 12 hours, with a first (typically morning) dose of Symdeko® typically comprising about 100 mg of tezacaftor and about 150 mg of ivacaftor (e.g., in the form of a single tablet containing tezacaftor plus ivacaftor), and a second (typically evening) dose of about 150 mg of ivacaftor (e.g., in the form of one tablet).

[0216] Combination therapies according to the present invention may employ compositions comprising the retroviral / lentiviral (e.g., SIV) vectors described above and a pharmaceutically acceptable carrier, typically formulated for administration by inhalation.

[0217] The CFTR modulators used in the combination therapies of the invention may be suitably formulated in a composition comprising a pharmaceutically acceptable carrier. The CFTR modulators are typically formulated for oral administration.

[0218] Administration of CFTR modulators is generally by conventional routes, such as oral, intravenous, subcutaneous, intraperitoneal, or mucosal routes. Administration may also be by parenteral injection, such as subcutaneous, intradermal, or intramuscular injection. For example, CFTR modulators may be particularly suitable for oral administration. Administration of small molecule CFTR modulators may be by injection, such as intravenous, intramuscular, intradermal, or subcutaneous, or preferably by oral administration (typically small molecules with a molecular weight of less than 500 Da that exhibit oral bioavailability).

[0219] The CFTR modulators may be prepared as injectables, either as liquid solutions or suspensions. Alternatively, solid forms suitable for solution or suspension in liquid prior to injection may be prepared. The preparation may also be emulsified, or the peptide may be encapsulated in liposomes or microcapsules.

[0220] Preferably, the CFTR modulator is prepared for oral administration. The CFTR modulator may be encapsulated in an oral dosage form. Oral formulations contain commonly used excipients such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. These compositions may take the form of a solution, suspension, tablet, pill, capsule, sustained-release formulation, or powder.

[0221] The active ingredients (e.g., CFTR modulators used in the combination therapies of the invention) are often mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredients. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, if desired, the compositions may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, and / or adjuvants that enhance the effectiveness of the CFTR modulator.

[0222] Non-limiting examples of pharmaceutically acceptable carriers include water, saline, and phosphate buffered saline. However, in some embodiments, the composition is in lyophilized form, which may include a stabilizer such as bovine serum albumin (BSA). In some embodiments, it may be desirable to formulate the composition with a preservative, such as thiomersal or sodium azide, to facilitate long-term storage.

[0223] Preferably, the CFTR modulators used in the combination therapies of the invention are formulated for and administered orally. Thus, the invention typically relates to combination therapies that use two separate formulations, one containing a retroviral / lentiviral (e.g., SIV) vector (typically for inhaled administration) and the other containing one or more CFTR modulators (typically for oral administration).

[0224] The retroviral / lentiviral (e.g., SIV) vectors of the present invention and / or one or more CFTR modulators may each independently be administered by any suitable route. It may be desirable to direct the compositions of the present invention (as described above) to the respiratory system of a subject. Efficient delivery of the therapeutic / prophylactic composition or medicament to the site of infection in the respiratory tract can be achieved by oral administration, by inhalation, for example as an aerosol, or by catheter. Typically, the retroviral / lentiviral (e.g., SIV) vectors of the present invention are administered by inhalation and are therefore preferably stable in clinically appropriate nebulizers, inhalers (including metered-dose inhalers), catheters, aerosols, and the like. Typically, the one or more CFTR modulators are administered orally.

[0225] Formulations for inhalation administration may be in the form of droplets and may be administered by nebulization using a suitable device. Formulations for inhalation administration may comprise droplets having an approximate mass median aerodynamic diameter (MMAD) in the range of 0.1 to 50 μm, e.g., 1 to 25 μm, 1 to 10 μm, or 1 to 5 μm, particularly 1 to 10 μm. Alternatively, in terms of volume, the droplets may range from about 0.001 to 100 μl, e.g., 0.1 to 50 μl or 1.0 to 25 μl, or e.g., 0.001 to 1 μl.

[0226] Aerosol formulations can take the form of a powder, suspension, or solution. The size of the aerosol droplets is related to the delivery capacity of the aerosol. Smaller droplets can travel further down the respiratory tract toward the alveoli than larger particles. In one embodiment, the aerosol droplets have a diameter distribution that facilitates delivery along the entire length of the trachea, bronchi, and bronchioles, i.e., the conducting airways. Alternatively, the droplet size distribution may be selected to target specific portions of the respiratory tract, such as the bronchioles or alveoli. For aerosol delivery of pharmaceuticals, the droplets may have diameters ranging from approximately 0.1 to 50 μm, preferably 1 to 25 μm, and more preferably 1 to 10 μm or 1 to 5 μm.

[0227] The aerosol particles may be for delivery using a nebulizer (e.g., via the mouth) or a nasal spray. The aerosol formulation may contain a propellant and / or a surfactant.

[0228] The formulation of pharmaceutical aerosols is routine for those skilled in the art; see, for example, Sciarra, J. in Remington's Pharmaceutical Sciences, supra. The drug may be formulated as a solution aerosol, a dry powder dispersion or suspension aerosol, an emulsion, or a semisolid preparation. The aerosol may be delivered using any propellant system known to those skilled in the art. The aerosol may be applied to the upper respiratory tract, the lower respiratory tract, or both, for example, via nasal inhalation. The portion of the lung to which the drug is delivered may be determined by the disorder. Compositions containing the vectors of the present invention may contain a humectant, particularly when intranasal delivery is used. This may help reduce or prevent drying of the mucous membranes and prevent membrane irritation. Suitable humectants include, for example, sorbitol, mineral oil, vegetable oil, and glycerol, soothing agents, membrane conditioners, sweeteners, and combinations thereof. The composition may contain a surfactant. Suitable surfactants include nonionic, anionic, and cationic surfactants. Examples of surfactants that may be used include, for example, polyoxyethylene derivatives of fatty acid partial esters of sorbitol anhydride, such as Tween 80, polyoxyl 40 stearate, polyoxyethylene 50 stearate, fusieates, bile salts and octoxynol.

[0229] As described herein, in some cases, subsequent administrations of retroviral / lentiviral (e.g., SIV) vectors may be administered after the initial administration. Administration may be, for example, at least one week, two weeks, one month, two months, three months, four months, six months, one year, or more after the initial administration. In some cases, the retroviral / lentiviral (e.g., SIV) vectors of the present invention may be administered at least once a week, once every two weeks, once a month, every two months, every six months, every year, or at longer intervals. Preferably, administration is every six months, more preferably every year. The retroviral / lentiviral (e.g., SIV) vector may be administered at intervals determined, for example, when the effectiveness of previous administrations is diminishing. Administration of the retroviral / lentiviral (e.g., SIV) vector at a desired frequency may be continued throughout the patient's lifetime.

[0230] Also, as described herein, the CFTR modulator is typically administered continuously at the frequency described herein. The CFTR modulator may be administered at a prescribed interval, for example, when the effect of a previous administration is diminishing. Administration of the CFTR modulator at a desired frequency may be continued for the life of the patient.

[0231] The combination therapy of the invention may be combined with one or more additional treatments for CF, including one or more additional CF modulators, bronchodilators, steroids, agents that thin or clear mucus or other lung secretions, antibiotics, and / or airway clearance techniques, such as active cycle breathing (ACBT) and autologous drainage. The one or more additional treatments for CF may be administered sequentially or simultaneously (as defined herein) with the combination therapy of the invention.

[0232] sequence homology Any of a variety of sequence alignment methods can be used to determine percent identity, including, but not limited to, global, local, and hybrid methods, such as segmental approaches. Protocols for determining percent identity are routine procedures within the skill of those in the art. Global methods align sequences from the beginning to the end of the molecule, sum up the scores of individual residue pairs, and determine the best alignment by imposing gap penalties. Non-limiting methods include, for example, CLUSTAL W (see, e.g., Julie D. Thompson et al., CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice, 22(22) Nucleic Acids Research 4673-4680 (1994); and iterative refinement (see, e.g., Osamu Gotoh, Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments, 264(4) J. Mol. Biol. 823-838 (1996)). Local methods align sequences by identifying one or more conserved motifs shared by all of the input sequences.Non-limiting methods include, for example, Match-box, see, e.g., Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CABIOS 501-509 (1992); Gibbs sampling, see, e.g., C.E. Lawrence et al., Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment, 262(5131) Science 208-214 (1993); Align-M, see, e.g., Ivo Van Walle et al., Align-M - A New Algorithm for Multiple Alignment of Highly Divergent Sequences, 20(9) Bioinformatics:1428-1435 (2004).

[0233] Thus, percent sequence identity is determined by conventional methods. See, e.g., Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-19, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment score using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff (ibid.), as shown below (amino acids are indicated by standard single-letter codes):

[0234] The "percent sequence identity" between two or more nucleic acid or amino acid sequences is a function of the number of identical positions shared by the sequences. Thus, the percent identity may be calculated as the number of identical nucleotides / amino acids divided by the total number of nucleotides / amino acids multiplied by 100. The calculation of percent sequence identity may also take into account the number of gaps that need to be introduced to optimize the alignment of two or more sequences, and the length of each gap. Sequence comparison and determination of percent identity between two or more sequences can be performed using specific mathematical algorithms familiar to those skilled in the art, such as BLAST.

[0235] Alignment scores for determining sequence identity ARNDCQEGHILKMFPSTWYV A4 R -1 5 N -2 0 6 D -2 -2 1 6 C 0 -3 -3 -3 9 Q -1 1 0 0 -3 5 E -1 0 0 2 -4 2 5 G 0 -2 0 -1 -3 -2 -2 6 H -2 0 1 -1 -3 0 0 -2 8 I -1 -3 -3 -3 -1 -3 -3 -4 -3 4 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 K -1 2 0 -1 -3 1 1 -2 -1 -3 -2 5 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6 P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7 S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4 T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5 W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11 Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7 V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4

[0236] The percent identity is then calculated as follows: Total number of identical matches _________________________×100 [length of the longer sequence + number of gaps introduced into the longer sequence to align the two sequences]

[0237] Substantially homologous polypeptides are characterized as having one or more amino acid substitutions, deletions, or additions. These changes are preferably minor in nature, i.e., conservative amino acid substitutions (as described herein) and other substitutions that do not significantly affect the folding or activity of the polypeptide, small deletions, typically deletions of 1 to about 30 amino acids, and small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag.

[0238] In addition to the 20 standard amino acids, non-standard amino acids (e.g., 4-hydroxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovaline, and α-methylserine) may be substituted for amino acid residues in the polypeptides of the invention. A limited number of non-conservative amino acids, amino acids not encoded by the genetic code, and unnatural amino acids may be substituted for polypeptide amino acid residues. The polypeptides of the invention may also include non-naturally occurring amino acid residues.

[0239] Non-naturally occurring amino acids include, but are not limited to, trans-3-methylproline, 2,4-methano-proline, cis-4-hydroxyproline, trans-4-hydroxy-proline, N-methylglycine, allo-threonine, methyl-threonine, hydroxy-ethylcysteine, hydroxyethylhomo-cysteine, nitro-glutamine, homoglutamine, pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenyl-alanine, 4-azaphenyl-alanine, and 4-fluorophenylalanine. Several methods for incorporating non-naturally occurring amino acid residues into proteins are known in the art. For example, an in vitro system can be used in which nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylation of tRNAs are known in the art. Transcription and translation of the nonsense mutation-containing plasmid is carried out in a cell-free system containing an E. coli S30 extract and commercially available enzymes and other reagents. The protein is purified by chromatography. See, e.g., Robertson et al., J. Am. Chem. Soc. 113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-9, 1993). In the second method, translation is performed in Xenopus oocytes by microinjection of mutant mRNA and chemically aminoacylated suppressor tRNA (Turcatti et al., J. Biol. Chem. 271:19991-8, 1996). In the third method, E. coli cells are cultured in the absence of the natural amino acid to be replaced (e.g., phenylalanine) and in the presence of the desired unnatural amino acid (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine).Non-naturally occurring amino acids are incorporated into polypeptides in place of their natural counterparts. See Koide et al., Biochem. 33:7470-6, 1994. Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993).

[0240] A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may substitute for amino acid residues in the polypeptides of the invention.

[0241] Essential amino acids in the polypeptides of the invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244:1081-5, 1989). Sites of biological interaction can also be determined by physical analysis of the structure, using techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutations of putative contact site amino acids. See, e.g., Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homology with related components of the polypeptides of the invention (e.g., translocation or protease components).

[0242] Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods in which two or more positions in a polypeptide are randomized simultaneously, functional polypeptides are selected, and the mutagenized polypeptides are then sequenced to determine the spectrum of permissible substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Pat. No. 5,223,409; Huse, WIPO WO 92 / 06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).

[0243] Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods in which two or more positions in a polypeptide are randomized simultaneously, functional polypeptides are selected, and the mutagenized polypeptides are then sequenced to determine the spectrum of permissible substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Pat. No. 5,223,409; Huse, WIPO WO 92 / 06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).

[0244] Sequence information Array Description SEQ ID NO: 1 Exemplary CFTR transgene (soCFTR2) SEQ ID NO: 2 Exemplary hCEF promoter SEQ ID NO: 3 Exemplary CMV promoter SEQ ID NO: 4 Exemplary EF1a promoter SEQ ID NO: 5 Wild-type SIV gag-pol nucleic acid sequence SEQ ID NO: 6 Codon-optimized SIV gal-pol nucleic acid sequence SEQ ID NO: 7 Plasmid defined in Figure 2C (pDNA2a pGM691) SEQ ID NO: 8 Plasmid defined in Figure 2A (pDNA1 pGM326) SEQ ID NO: 9 Plasmid defined in Figure 2B (pDNA1 pGM830) SEQ ID NO: 10 Plasmid defined in Figure 2G (pDNA2a pGM297) SEQ ID NO: 11 Plasmid defined in Figure 2D (pDNA2b pGM299) SEQ ID NO: 12 Plasmid defined in Figure 2E (pDNA3a pGM301) SEQ ID NO: 13 Plasmid defined in Figure 2F (pDNA3b pGM303) SEQ ID NO: 14 Exemplary WPRE component (mWPRE) SEQ ID NO: 15 Exemplary CAG promoter SEQ ID NO: 16 Modified SIV / CFTR RNA sequence SEQ ID NO: 17 Fct4 protein SEQ ID NO: 18 Fct4 protein (including signal sequence) SEQ ID NO: 19 Fct4 protein (fragment 1) SEQ ID NO: 20 Fct4 protein (fragment 2) SEQ ID NO: 21 Fct4 protein signal sequence SEQ ID NO: 22 p17 protein sequence SEQ ID NO: 23 p24 protein sequence SEQ ID NO: 24 p8 protein sequence SEQ ID NO: 25 Protease sequence SEQ ID NO: 26 p51 protein sequence SEQ ID NO: 27 p15 protein sequence SEQ ID NO: 28 p31 protein sequence SEQ ID NO: 29 Gag protein SEQ ID NO: 30 Pol protein

[0245] array SEQ ID NO: 1 Exemplary CFTR transgene (soCFTR2) 1 GCTAGCCACC ATGCAGAGAA GCCCTCTGGA GAAGGCCTCT GTGGTGAGCA AGCTGTTCTT 61 CAGCTGGACC AGGCCCATCC TGAGGAAGGG CTACAGGCAG AGACTGGAGC TGTCTGACAT 121 CTACCAGATC CCCTCTGTGG ACTCTGCTGA CAACCTGTCT GAGAAGCTGG AGAGGGAGTG 181 GGAGAGAG CTGGCCAGCA AGAAGAACCC CAAGCTGATC AATGCCCTGA GGAGATGCTT 241 CTTCTGGAGA TTCATGTTCT ATGGCATCTT CCTGTACCTG GGGGAAGTGA CCAAGGCTGT 301 GCAGCCTCTG CTGCTGGGCA GAATCATTGC CAGCTATGAC CCTGACAACA GAATCATTGC 361 GAGCATTGCC ATCTACCTGG GCATTGGCCT GTGCCTGCTG TTCATTGTGA GGACCCTGCT 421 GCTGCACCCT GCCATCTTTG GCCTGCACCA CATTGGCATG TRUE TTGCCATGTT 481 CAGCCTGATC TACAAGAAAA CCCTGAAGCT GTCCAGCAGA GTGCTGGACA AGATCAGCAT 541 TGGCCAGCTG GTGAGCCTGC TGAGCAACAA CCTGAACAAG TTTGATGAGG GCCTGGCCCT 601 GGCCCACTTT GTGTGGATTG CCCCTCTGCA GGTGGCCCTG CTGATGGGCC TGATTTGGGA 661 GCTGCTGCAG GCCTCTGCCT TTTGTGGCCT GGGCTTCCTG ATTGTGCTGG CCCTGTTTCA 721 GGCTGGCCTG GGCAGGATGA TGATGAAGTA CAGGGACCAG AGGGCAGGCA AGATCAGTGA 781 GAGGCTGGTG ATCACCTCTG GAACATCCAG TCTGTGAAGG CCTACTGTTG 841 GGAGGAAGCT ATGGAGAAGA TGATTGAAAA CCTGAGGCAG ACAGAGCTGA AGCTGACCAG 901 GAAGGCTGCC TATGTGAGAT ACTTCAACAG CTCTGCCTTC TTCTTCTCTG GCTTCTTTGT 961 GGTGTTCCTG TCTGTGCTGC CCTATGCCCT GATCAAGGGG ATCATCCTGA GAAAGATTTT 1021 CACCACCATC AGCTTCTGCA TTGTGCTGAG GATGGCTGTG ACCAGACAGT TCCCCTGGGC 1081 TGTGCAGACC TGGTATGACA GCCTGGGGGC CATCAACAAG ATCCAGGACT TCCTGCAGAA 1141 GCAGGAGTAC AAGACCCTGG AGTACAACCT GACCACCACA AAGTGGTGA TGGAGATGT 1201 GACAGCCTTC TGGGAGGAGG GCTTTGGGGA GCTGTTTGAG AAGGCCAAGC AGAACAACAA 1261 CACAGAAAAG ACCAGCAATG GGGATGACTC CCTGTTCTTC TCCAACTTCT CCCTGCTGGG 1321 CACACCCTGTG CTGAAGGACA TCAACTTCAA GATTGAGAGG GGGCAGCTGC TGGCTGTGGC 1381 TGGATCTACA GGGGCTGGCA AGACCAGCCT GCTGATGATG ATCATGGGGG AGCTGGAGCC 1441 TTCTGAGGGC AAGATCAAGC ACTCTGGCAG GATCAGCTTT TGCAGCCAGT TCAGCTGGAT 1501 CATGCCTGGC ACCATCAAGG AGAACATCAT CTTTGGAGTG AGCTATGATG AGTACAGATA 1561 CAGGAGTGTG ATCAAGGCCT GCCAGCTGGA GGAGGACATC AGCAAGTTTG CTGAGAAGGA 1621 CAACATTGTG CTGGGGGAGG GAGGCATTAC ACTGTCTGGG GGCCAGAGAG CCAGAATCAG 1681 CCTGGCCAGG GCTGTGTACA AGGATGCTGA CCTGTACCTG CTGGACTCCC CCTTTGGCTA 1741 CCTGGATGTG CTGACAGAGA AGGAGATTTT TGAGAGCTGT GTGTGCAAGC TGATGGCCAA 1801 CHAPTER ATCCTGGTGA CCAGCHAT GGAGCACCTG AAGAAGGCTG ACAAGATCCT 1861 GATCCTGCAT GAGGGCAGCA GCTACTTCTA TGGGACCTTC TCTGAGCTGC AGAACCTGCA 1921 GCCTGACTTC AGCTCTAAGC TGATGGGCTG TGACAGCTTT GACCAGTTCT CTGCTGAGAG 1981 GAGGAACAGC ATCCTGACAG AGACCCTGCA CAGATTCAGC CTGGAGGGAG ATGCCCCTGT 2041 GAGCTGGACA GAGACCAT AGCAGAGCTT GAGACA GGGGAGTTTG GGGAGAGAG 2101 GAAGAACTCC ATCCTGAACC CCATCAACAG CATCAGGAAG TTCAGCATTG TGCAGAAAAC 2161 CCCCCTGCAG ATGAATGGCA TTGAGGAAGA TTCTGATGAG CCCCTGGAGA GGAGACTGAG 2221 CCTGGTGCCT GATTCTGAGC AGGGAGAGGC CATCCTGCCT AGGATCTCTG TGATCAGCAC 2281 AGGCCCTACA CTGCAGGCCA GAAGGAGGCA GTCTGTGCTG AACCTGATGA CCCACTCTGT 2341 GAACCAGGGC CAGAACATCC ACAGGAAAAC CACAGCCTCC ACCAGGAAAG TGAGCCTGGC 2401 CCCTCAGGCC AATCTGACAG AGCTGGACAT CTACAGCAGG AGGCTGTCTC AGGAGACAGG 2461 CCTGGAGATT TCTGAGGAGA TCAATGAGGA GGACCTGAAA GAGTGCTTCT TTGATGACAT 2521 GGAGAGCATC CCTGCTGTGA CCACCTGGAA CACCTACCTG AGATACATCA CAGTGCACAA 2581 GAGCCTGATC TTTGTGCTGA TCTGGTGCCT GGTGATCTTC CTGGCTGAAG TGGCTGCCTC 2641 TCTGGTGGTG CTGTGGCTGC TGGGAAACAC CCCACTGCAG GACAAGGGCA ACAGCACCCA 2701 CAGCAGGAAC AACAGCTATG CTGTGATCAT CACCTCCACC TCCAGCTACT ATGTGTTCTA 2761 CATCTATGTG GGAGTGGCTG ATACCCTGCT GGCTATGGGC TTCTTTAGAG GCCTGCCCCT 2821 GGTGCACACA CTGATCACAG TGAGCAAGAT CCTCCACCAC AAGATGCTGC ACTCTGTGCT 2881 GCAGGCTCCT ATGAGCACCC TGAATACCCT GAAGGCTGGG GGCATCCTGA ACAGATTCTC 2941 CAAGGATATT GCCATCCTGG ATGACCTGCT GCCTCTCACC ATCTTTGACT TCATCCAGCT 3001 GCTGCTGATT GTGATTGGGG CCATTGCTGT GGTGGCAGTG CTGCAGCCCT ACATCTTTGT 3061 GGCCACAGTG CCTGTGATTG TGGCCTTCAT CATGCTGAGG GCCTACTTTC TGCAGACCTC 3121 CCAGCAGCTG AGCAGCTGG AGTCTGAGGG CAGAAGCCCC ATCTTCACCC ACCTGGTGAC 3181 AAGCCTGAAG GGCCTGTGGA CCCTGAGAGC CTTTGGCAGG CAGCCCTACT TTGAGACCCT 3241 GTTCCACAAG GCCCTGAACC TGCACACAGC CAACTGGTTC CTCTACCTGT CCACCCTGAG 3301 ATGGTTCCAG ATGAGAATTG AGATGATCTT TGTCATCTTC TTCATTGCTG TGACCTTCAT 3361 CAGCATTCTG ACCACAGGAG AGGGAGAGG CAGAGTGGGC ATTATCCTGA CCCTGGCCAT 3421 GAACATCATG AGCACACTGC AGTGGGCAGT GAACAGCAGC ATTGATGTGG ACAGCCTGAT 3481 GAGGAGTGTG AGCAGAGTGT TCAAGTTCAT TGATATGCCC ACAGAGGGCA AGCCTACCAA 3541 GAGCACCAAG CCCTACAAGA ATGGCCAGCT GAGCAAGTG ATGATCATTG AGAACAGCCA 3601 TGTGAAGAAG GATGATCT GGCCCAGTGG AGGCCAGATG ACAGTGAAGG ACCTGACAGC 3661 CAAGTACACA GAGGGGGGCA ATGCTATCCT GGAGAACATC TCCTTCAGCA TCTCCCCTGG 3721 CCAGAGAGTG GGACTGCTGG GAAGAACAGG CTCTGGCAAG TCTACCCTGC TGTCTGCCTT 3781 CCTGAGGCTG CTGAACACAG AGGGAGAT CCAGATTGAT GGAGTGTCCT GGGACAGCAT 3841 CACACTGCAG CAGTGGAGGA AGGCCTTTGG TGTGATCCCC CAGAAAGTGT TCATCTTCAG 3901 TGGCACCTTC AGGAAACC TGGACCCCTA TGAGCAGTGG TCTGACCAGG AGATTTGGAA 3961 AGTGGCTGAT GAAGTGGGCC TGAGAGTGT GATTGAGCAG TTCCCTGGCA AGCTGGACTT 4021 TGTCCTGGTG GATGGGGGCT GTGTGCTGAG CCATGGCCAC AAGCAGCTGA TGTGCCTGGC 4081 CAGATCAGTG CTGAGCAAGG CCAAGATCCT GCTGCTGGAT GAGCCTTCTG CCCACCTGGA 4141 TCCTGTGACC TACCAGATCA TCAGGAGGAC CCTCAAGCAG GCCTTTGCTG ACTGCACAGT 4201 CATCCTGTGT GAGCACAGGA TTGAGGCCAT GCTGGAGTGC CAGCAGTTCC TGGTGATTGA 4261 GGAGAACAAA GTGAGGCAGT ATGACAGCAT CCAGAAGCTG CTGAATGAGA GGAGCCTGTT 4321 CAGGCAGGCC ATCAGCCCCT CTGATAGAGT GAAGCTGTTC CCCCACAGGA ACAGCTCCAA 4381 GTGCAAGAGC AAGCCCCAGA TTGCTGCCCT GAAGGAGGAG ACAGAGGAGG AAGTGCAGGA 4441 CACCAGGCTG TGAGGGCCC SEQ ID NO: 2 Exemplary hCEF promoter 1 AGATCTGTTA CATAACTTAT GGTAAATGGC CTGCCTGGCT GACTGCCCAA TGACCCCTGC 61 CCAATGATGT CAATAATGAT GTATGTTCCC ATGTAATGCC AATAGGGACT TTCCATTGAT 121 GTCAATGGGT GGAGTATTTA TGGTAACTGC CCACTTGGCA GTACATCAAG TGTATCATAT 181 GCCAAGTATG CCCCCTATTG ATGTCAATGA TGGTAAATGG CCTGCCTGGC ATTATGCCCA 241 GTACATGACC TTATGGGACT TTCCTACTTG GCAGTACATC TATGTATTAG TCATTGCTAT 301 TACCATGGGA ATTCACTAGT GGAGAAGAGC ATGCTTGAGG GCTGAGTGCC CCTCAGTGGG 361 CAGAGAGCAC ATGGCCCACA GTCCCTGAGA AGTTGGGGGG AGGGGTGGGC AATTGAACTG 421 GTGCCTAGAG AAGGTGGGGC TTGGGTAAAC TGGGAAAGTG ATGTGGTGTA CTGGCTCCAC 481 CTTTTTCCCC AGGGTGGGGG AGAACCATAT ATAAGTGCAG TAGTCTCTGT GAACATTCAA 541 GCTTCTGCCT TCTCCCTCCT GTGAGTTTGC TAGC SEQ ID NO: 3 Exemplary CMV promoter CCGCGGAGATCTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCT ATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACC GCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCA TATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCC CATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGT GGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTT GGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCG TGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGG CACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGC GTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGC GGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGC AGAAGTTGGTCGTGAGGCACTGGGCAGGCTAGC The EF1a promoter exemplified by SEQ ID NO: 4 AGATCCATATCCGCGCAATTTTAAAAAGAAAGGGAGGAATAGGGGGACAGACTTCAGCAGAGAGACTAATTAATATAATAACAACACAATTAGAAATACAACATTTACAAACCAAAATTCAAAAATTTTAAATTTTAGAGCCGCGAGATCCCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCC ACAGTCCCCGAGAAGTTGGGGGGAGGGGTCCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTAGC sequence number 5 wild-type SIV gag-pol nucleic acid sequence(pGM297) SEQ ID NO: 6 Codon-optimized SIV gal-pol nucleic acid sequence (derived from pGM691) SEQ ID NO: 7 Plasmid defined in Figure 1C (pDNA2a pGM691) SEQ ID NO: 8 Plasmid defined in Figure 1A (pDNA1 pGM326) ATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAG ACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACAATTGGTCGACGGATCC SEQ ID NO: 9 Plasmid defined in Figure 1B (pDNA1 pGM830) CCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAG CAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACAATTGGTCGACGGATCC SEQ ID NO: 10 Plasmid defined in Figure 1D (pDNA2a pGM297) SEQ ID NO: 11 Plasmid defined in Figure 1E (pDNA2b pGM299) SEQ ID NO: 12 Plasmid defined in Figure 1F (pDNA3a pGM301) SEQ ID NO: 13 Plasmid defined in Figure 1G (pDNA3b pGM303) SEQ ID NO: 14 Exemplary WPRE component (mWPRE) 1 GGGCCCAATC AACCTCTGGA TTACAAAATT TGTGAAAGAT TGACTGGTAT TCTTAACTAT 61 GTTGCTCCTT TTACGCTATG TGGATACGCT GCTTTAATGC CTTTGTATCA TGCTATTGCT 121 TCCCGTATGG CTTTCATTTT CTCCTCCTTG TATAAATCCT GGTTGCTGTC TCTTTATGAG 181 GAGTTGTGGC CCGTTGTCAG GCAACGTGGC GTGGTGTGCA CTGTGTTTGC TGACGCAACC 241 CCCACTGGTT GGGGCATTGC CACCACCTGT CAGCTCCTTT CCGGGACTTT CGCTTTCCCC 301 CTCCCTATTG CCACGGCGGA ACTCATCGCC GCCTGCCTTG CCCGCTGCTG GACAGGGGCT 361 CGGCTGTTGG GCACTGACAA TTCCGTGGTG TTGTCGGGGA AATCATCGTC CTTTCCTTGG 421 CTGCTCGCCT GTGTTGCCAC CTGGATTCTG CGCGGGACGT CCTTCTGCTA CGTCCCTTCG 481 GCCCTCAATC CAGCGGACCT TCCTTCCCGC GGCCTGCTGC CGGCTCTGCG GCCTCTTCCG 541 CGTCTTCGCC TTCGCCCTCA GACGAGTCGG ATCTCCCTTT GGGCCGCCTC CCCGCAAGCT SEQ ID NO: 15 Exemplary CAG promoter SIV / CFTR RNA sequence ucucuuacua ggagaccagc uugagccugg guguucgcug guuagccuaa ccugguuggc 60 caccagggggu aaggacuccu uggcuuagaa agcuaauaaa cuugccugca uuagagcuua 120 ucugagucaa guguccucau ugacgccuca cucucuugaa cgggaaucuu ccuuacuggg 180 uucucucu gacccaggcg agaaacuc cagcaguggc gcccgaacag ggacuugagu 240 gagagugaag gcacguacag cugagaaggc gucggagcgc areaagcgc ggggugcgac 300 gcgaccaaga aggagacaug gugaguaggc uucucgagug ccgggaaaaa gcucgagccu 360 420 gguacgcaau uggggggcgg uaccucagca cuaaauagga gacaauuaga ccaauuugag 480 aaaauacgac uucgcccgaa cggaaagaaa aaguaccaaa uuaaacauuu aauugggc 540 aggcaaggag auuggagcgc uucggccucc augagagggu guggagagagagagggggu 600 guaaaagaau cauagaaguc cucuaccccc uagaaccaac aggaucggag ggcuuaaaaa 660 gucuguucaa ucuugugugc gugcuauauu gcuugcacaa ggaacagaaa gugaaagaca 720 cagagaagc aguagcaaca guaagacaac acugccaucu aguggaaaaa gaaaaaagug 780 caacagagac aucuagugga caaaagaaaa augacaaggg aauagcagcg ccaccuggug 840 cgagucagaa uuuuccagcg caacaacaag gaauugccu ggguacaugu acccuuguca 900 ccgcgcaccu uaaaugcgug gguaaaagca guagaggaga aaaaauuugg agcagaaaua 960 1020 uggggggcugc uggaacugca uugggagcag cggcgacagc ccugacgguc cagucucagc 1080 auuugcuugc uggguaacug cagcagcaga agaaucugcu ggcggcugug gaggcucaac 1140 agcagauguu gaagcugacc auuuggggug uuaaaaaccu caaugcccgc gucacagccc 1200 uugagaaagua ccuagaggau caggcacgac uaaacuccug ggggugcgca uggaaacaag 1260 uaugucauac cacaguggag uggcccugga caaaucggac uccggauugg caaaauaaga 1320 cuugguugga gugggaaaga caaauagcug auuuggaag caacauuacg agacaauuag 1380 ugaaggcuag agaacaagag gaaaagaauc uagaugccua ucagaaguua acuaguuggu 1440 cagauuucug gucuugguuc gauuucucaa aauggcuuaa cauuuuaaaa aagggauuuu 1500 uaguaauagu aggaauaaua ggguuaagau uacuuuacac aguauaugga uguauaguga 1560 ggguuaggca gggauauguu ccucuaucuc cacagaucca uauaaagcgg caauuuuaaa 1620 agaaagggag gaauaggggg acagacuuca gcagagagac uaauuaauau aauaacaaca 1680 caauuagaaa uacaacauuu acaaaccaaa auucaaaaaa uuuuaaauuu uagagccgcg 1740 gagaucuguu acauaacuua ugguaaaugg ccugccuggc ugacugccca augaccccug 1800 cccaaugaug ucaauaauga uguauguucc cauguaaugc caauagggac uuuccauuga 1860 ugucaauggg uggaguauuu augguaacug cccacuuggc aguacaucaa guguaucaua 1920 ugccaaguau gcccccuauu gaugucaaug augguaaaug gccugccugg cauuaugccc 1980 aguacaugac cuuaugggac uuuccuacuu ggcaguacau cuauguauua gucauugcua 2040 uuaccauggg aauucacuag uggagaagag caugcuugag ggcugagugc cccucagugg 2100 gcagagagca cauggcccac agucccugag aaguuggggg gagggggg cauugaacu 2160 ggugccuag gaggggggg cugggcuaaa neighborhood gauggugu cuggcucca 2220 ccuuuuuccc cagggugggg gagaaccaua uauaagugca guagucucug ugaacauca 2280 agcuucugcc uucuccucc ugugaguuug quagccacca ugcagagag cccucuggag 2340 aaggccucug gaggagça gcugucuuc agcuggacca ggcccug gaggaagggc 2400 uacaggcaga gacuggagcu gucugacauc uaccagaucc ccucugugga cucugcugac 2460 aaccugucug agaagcugga gagggagugg gauagagagc uggccagca gagaacccc 2520 augcugauca augcccugag gagaugcuuc augcuggau augcuucuc augcuucuc 2580 cuguaccugg gggaagugac caggcugug cagcucugc ugcugggcag aucauugcc 2640 agcuaugacc cugashaacha ggaggagagg agcauugcca cugaccuggg cauggccug 2700 ugccugcugu ucauugugag gacccugcug cugcacccug ccaucuuugg cugcaccac 2760 auuggcaugc agaagaggau ugccauguuc agccugaucu ahaaaaac ccugaagcug 2820 shake shake shake gaucashauu ggshagcugg shake shake shake shake 2880 cugacaagu uugaugagggg cuggcccug gccacuuug uguggauugc cccucugcag 2940 guggcccugc ugaugggccu gauuugggag cugcugcagg cucugccuu uugggccug 3000 ggcuuccuga uugugcuggc ccuguuucag gcuggccugg gcaggaugau gaugaaguac 3060 agggaccaga gggcaggca gaucagugag agggaccaga ucaccucuga gaugauugag 3120 aacauccagu cugugaggc cucuguugg gaggaagcua uggagau gauugaaaac 3180 cugaggcaga cagagcugaa gcugaccagg aaggcugccu augugagaua cucacagc 3240 quagcuucu cucucucugg cucuucug cugugcugcc cucugcugcc cucugcug 3300 aucaagggga ucauccugag aagauuuuc accaccauca gcuucugcau ugugcugagg 3360 auggcuguga ccagacagou ccccuggggcu gugcagaccu gguaugacag ccuggggggcc 3420 aucacaaga uccaggacuu ccugcagag caggaguaca agacccugga guacaccug 3480 accaccacag aaggugau ggagaaugug accacccuucu gggagggggg 3540 cuguuugaga aggccaagca gaacaacaac aacagaaaga ccagcaaugg ggaugacucc 3600 cuguucuucu ccaacuucuc ccugcugggc acaccugugc ugaaggacau caacuucaag 3660 auugagaggg ggcagcugcu ggcuguggcu ggaucuacag gggcuggcaa gaccagccug 3720 3780 aucagcuuuu gcagccaguu cagcuggauc augccuggca ccaucaaagga gaacaucauc 3840 3900 gagacauca ccaaguuuugc ugagaaggac aacauugugc uggggggaggg aggcauuaca 3960 cugucugggg gccagagagc cagaaucagc cuggccaggg cuguguacaa ggaugcugac 4020 cuguaccugc uggacucccc cuuuggcuac cuggaugugc ugacagagaa ggagauuuu 4080 gagagcugug ugugcaagcu gauggccaac aagaccagaa uccuggugac cagcaagaug 4140 4200 4260 gacagcuuug accaguucuc ugcugagagg aggaacagca uccugacaga gaccugcac 4320 agauucagcc uggagggaga ugccccugug agcuggacag agaccaagaa cgagagcuuc 4380 aagcagacag gggaguuugg ggagaagagg aagacucca uccugaaccc caucaacagc 4440 aucaggaagu ucagcauugu gcagaaaacc ccccugcaga ugaauggcau ugagaagagau 4500 ucugaugagc cccuggagag gagacugagc cuggugccug auucugagca gggagaggcc 4560 auccugccua ggaucucugu gaucagcaca ggcccuacac ugcaggccag aaagggcag 4620 ucugugcuga accugaugac ccacucugug aaccagggcc agaacaucca caggaaaacc 4680 acagccucca ccaggaaagu gagccuggcc ccucaggcca aucugacaga ggugcauc 4740 uacagcagga ggcugucuca ggagacaggc cuggagaauuu cugaggagau caaugaggag 4800 gaccugaaag agugcuucuu ugaugacaug gagagcaucc cugcugugac caccuggaac 4860 4920 gugaucuucc uggcugaagu ggcugcccu cugguggugc uguggcugcu gggaaacacc 4980 ccacugcagg acaagggcaa cagcacccac agcaggaaca acagcuaugc ugugaucauc 5040 accuccaccu ccagcuacua ugguucuac aucuaugugg gaguggcuga uacccugcug 5100 gcuaugggcu ucuuuagagg ccugccccug gugcacacac ugaucacagu gagcaagauc 5160 cuccaccaca agaugcugca cucugugcug caggcuccua ugagcacccu gaauacccug 5220 aaggcugggg gcauccugaa cagauucucc aagcauauug ccauccugga ugaccugcug 5280 ccucucacca ucuuugacuu cauccagcug cugcugauug ugauuggggc cauugcugug 5340 guggcagugc ugcagcccua caucuuugug gccacagugc cugugauugu ggccuucauc 5400 augcugaggg ccuacuuucu gcagaccucc cagcagcuga agcagcugga gucugagggc 5460 agaagcccca ucuucaccca ccuggugaca agccugaagg gccuguggac ccugagagcc 5520 uuuggcaggc agcccuacuu ugacaccug uuccacaagg cccugaaccu gcacacagcc 5580 aacugguucc ucuaccuguc cacccugaga ugguuccaga ugagaauuga gaugaucuuu 5640 gucaucuucu ucauugcugu gaccuucauc agcauucuga ccacaggaga gggagagggc 5700 agagugggca uuauccugac ccuggccaug aacaucauga gcacacugca gugggcagug 5760 aacagcagca uugaugugga cagccugaug aggaguuga cgagaguguu caaguucauu 5820 gauaugccca cagagggcaa gccuaccaag agcaccaagc ccuacaagaa uggccagcug 5880 agcaaaguga ugaucauuga gaacagccau gugaagaagg augauaucug gcccagugga 5940 ggccagauga cagugaagga ccugacagcc aaguacacag aggggggcaa ugcuauccug 6000 gagaacaucu ccuucagcau cuccccuggc cagagagugg gacugcugg aagaacaggc 6060 ucuggcaagu cuacccugcu gucugcccuuc cugaggcugc ugaacacaga gggagagauc 6120 cagauugaug gaguguccug ggacagcauc acacugcagc aguggagaa ggccuuuggu 6180 gugaucccc agaaaguguu caucuucagu ggcaccuuca ggagaaaccu ggaccccuau 6240 gagcaggu cugaccagga gauuuggaa guggcugaug aagugggccu gagaagugug 6300 auugagcagu ucccuggcaa gcuggacuuu guccuggugg auggggggcug ugugcugagc 6360 cauggccaca agcagcugau gugccuggcc aguacagugc ugagcaaggc caagauccug 6420 cugcuggaug agccucugc ccucuggaccu ccugugaccu accugaucau caggaggacc 6480 cucaagcagg ccuuggcuga cucacaguc accugugug accucaggau ugaggccaug 6540 shuggagugcc shake ggugauugg gagahaagg shake shake 6600 cagaagcugc ugaagagag gagccuguuc aggcaggcca ucagccccuc ugauagagug 6660 aagcugucc cccaccaggaa agcuccaag ugcagagca agccccagau ugcugccug 6720 agghagga agghaggaaaaggcuaaaaggcuaaaaggcuaaaaaaggcua 6780 gauuacaaa uugugaaag auugacuggu aucuuaacu auguugcucc uuuuacgcua 6840 uguggauacg cugcuuuaau gccuuuguau caugcuauug cucccguau ggcuuucau 6900 cucuccuccu uguauaaauc cuggugcug cucuuuaug agggaguug gcccguuguc 6960 aggcaacgug gcguggug cacuguguuu gcugacgcaa cccccacugg uuggggcauu 7020 gccaccaccu gugcuccu uuccgggacu ucgcuuucc cccuccuau ugccacggcg 7080 gaacucaucg ccgccugccu ugcccgcugc uggacagggg cucggcuguu gggcacugac 7140 aauuccgugg uguugucggg gaaaucaucg uccuuuccuu ggcugcucgc cuguguugcc 7200 accuggauuc ugcgcgggac guccuucugc uacgucccuu cggcccucaa uccagcggac 7260 cuuccuuccc gcggccugcu gccggcucug cggccucuuc cgcgucuucg ccuucgcccu 7320 cagacgaguc ggaucucccu uugggccgcc uccccgcaag cuucgcacuu uuuaaaagaa 7380 aagggaggac uggaugggau uuauuacucc gauaggacgc uggcuuguaa cucagucucu 7440 uacuaggaga ccagcuugag ccuggguguu cgcugguuag ccuaaccugg uuggccacca 7500 gggguaagga cuccuuggcu uagaaagcua auaaacuugc cugcauuaga gcu 7553 SEQ ID NO: 17 Fct4 protein Gln Ile Pro Arg Asp Arg Leu Ser Asn Ile Gly Val Ile Val Asp Glu 1 5 10 15 Gly Lys Ser Leu Lys Ile Ala Gly Ser His Glu Ser Arg Tyr Ile Val 20 25 30 Leu Ser Leu Val Pro Gly Val Asp Phe Glu Asn Gly Cys Gly Thr Ala<H000H136>35 40 45 Gln Val Ile Gln Tyr Lys Ser Leu Leu Asn Arg Leu Leu Ile Pro Leu 50 55 60 Arg Asp Ala Leu Asp Leu Gln Glu Ala Leu Ile Thr Val Thr Asn Asp 65 70 75 80 Thr Thr Gln Asn Ala Gly Ala Pro Gln Ser Arg Phe Phe Gly Ala Val 85 90 95 Ile Gly Thr Ile Ala Leu Gly Val Ala Thr Ser Ala Gln Ile Thr Ala 100 105 110 Gly Ile Ala Leu Ala Glu Ala Arg Glu Ala Lys Arg Asp Ile Ala Leu 115 120 125 Ile Lys Glu Ser Met Thr Lys Thr His Lys Ser Ile Glu Leu Leu Gln 130 135 140 Asn Ala Val Gly Glu Gln Ile Leu Ala Leu Lys Thr Leu Gln Asp Phe 145 150 155 160 Val Asn Asp Glu Ile Lys Pro Ala Ile Ser Glu Leu Gly Cys Glu Thr 165 170 175 Ala Ala Leu Arg Leu Gly Ile Lys Leu Thr Gln His Tyr Ser Glu Leu 180 185 190 Leu Thr Ala Phe Gly Ser Asn Phe Gly Thr Ile Gly Glu Lys Ser Leu 195 200 205 Thr Leu Gln Ala Leu Ser Ser Leu Tyr Ser Ala Asn Ile Thr Glu Ile 210 215 220 Met Thr Thr Ile Arg Thr Gly Gln Ser Asn Ile Tyr Asp Val Ile Tyr 225 230 235 240 Thr Glu Gln Ile Lys Gly Thr Val Ile Asp Val Asp Leu Glu Arg Tyr 245 250 255 Met Val Thr Leu Ser Val Lys Ile Pro Ile Leu Ser Glu Val Pro Gly 260 265 270 Val Leu Ile His Lys Ala Ser Ser Ile Ser Tyr Asn Ile Asp Gly Glu 275 280 285 Glu Trp Tyr Val Thr Val Pro Ser His Ile Leu Ser Arg Ala Ser Phe 290 295 300 Leu Gly Gly Ala Asp Ile Thr Asp Cys Val Glu Ser Arg Leu Thr Tyr 305 310 315 320 Ile Cys Pro Arg Asp Pro Ala Gln Leu Ile Pro Asp Ser Gln Gln Lys 325 330 335 Cys Ile Leu Gly Asp Thr Thr Arg Cys Pro Val Thr Lys Val Val Asp 340 345 350 Ser Leu Ile Pro Lys Phe Ala Phe Val Asn Gly Gly Val Val Ala Asn 355 360 365 Cys Ile Ala Ser Thr Cys Thr Cys Gly Thr Gly Arg Arg Pro Ile Ser 370 375 380 Gln Asp Arg Ser Lys Gly Val Val Phe Leu Thr His Asp Asn Cys Gly 385 390 395 400 Leu Ile Gly Val Asn Gly Val Glu Leu Tyr Ala Asn Arg Arg Gly His 405 410 415 Asp Ala Thr Trp Gly Val Gln Asn Leu Thr Val Gly Pro Ala Ile Ala 420 425 430 Ile Arg Pro Val Asp Ile Ser Leu Asn Leu Ala Asp Ala Thr Asn Phe 435 440 445 Leu Gln Asp Ser Lys Ala Glu Leu Glu Lys Ala Arg Lys Ile Leu Ser 450 455 460 Glu Val Gly Arg Trp Tyr Asn Ser Arg Glu Thr Val Ile Thr Ile Ile 465 470 475 480 Val Val Met Val Val Ile Leu Val Val Ile Ile Val Ile Ile Ile Val 485 490 495 Leu Tyr Arg Leu Arg Arg SEQ ID NO:18 Fct4 protein (including signal sequence) ​​​​​​​​Ser Asn Ile Gly Val Ile Val Asp Glu Gly Lys Ser Leu Lys Ile Ala 35 40 45 Gly Ser His Glu Ser Arg Tyr Ile Val Leu Ser Leu Val Pro Gly Val 50 55 60 Asp Phe Glu Asn Gly Cys Gly Thr Ala Gln Val Ile Gln Tyr Lys Ser 65 70 75 80 Leu Leu Asn Arg Leu Leu Ile Pro Leu Arg Asp Ala Leu Asp Leu Gln 85 90 95 Glu Ala Leu Ile Thr Val Thr Asn Asp Thr Thr Gln Asn Ala Gly Ala 100 105 110 Pro Gln Ser Arg Phe Phe Gly Ala Val Ile Gly Thr Ile Ala Leu Gly 115 120 125 Val Ala Thr Ser Ala Gln Ile Thr Ala Gly Ile Ala Leu Ala Glu Ala 130 135 140 Arg Glu Ala Lys Arg Asp Ile Ala Leu Ile Lys Glu Ser Met Thr Lys 145 150 155 160 Thr His Lys Ser Ile Glu Leu Leu Gln Asn Ala Val Gly Glu Gln Ile 165 170 175 Leu Ala Leu Lys Thr Leu Gln Asp Phe Val Asn Asp Glu Ile Lys Pro 180 185 190 Ala Ile Ser Glu Leu Gly Cys Glu Thr Ala Ala Leu Arg Leu Gly Ile 195 200 205 Lys Leu Thr Gln His Tyr Ser Glu Leu Leu Thr Ala Phe Gly Ser Asn 210 215 220 Phe Gly Thr Ile Gly Glu Lys Ser Leu Thr Leu Gln Ala Leu Ser Ser 225 230 235 240 Leu Tyr Ser Ala Asn Ile Thr Glu Ile Met Thr Thr Ile Arg Thr Gly 245 250 255 Gln Ser Asn Ile Tyr Asp Val Ile Tyr Thr Glu Gln Ile Lys Gly Thr 260 265 270 Val Ile Asp Val Asp Leu Glu Arg Tyr Met Val Thr Leu Ser Val Lys 275 280 285 Ile Pro Ile Leu Ser Glu Val Pro Gly Val Leu Ile His Lys Ala Ser 290 295 300 Ser Ile Ser Tyr Asn Ile Asp Gly Glu Glu Trp Tyr Val Thr Val Pro 305 310 315 320 Ser His Ile Leu Ser Arg Ala Ser Phe Leu Gly Gly Ala Asp Ile Thr 325 330 335 Asp Cys Val Glu Ser Arg Leu Thr Tyr Ile Cys Pro Arg Asp Pro Ala 340 345 350 Gln Leu Ile Pro Asp Ser Gln Gln Lys Cys Ile Leu Gly Asp Thr Thr 355 360 365 Arg Cys Pro Val Thr Lys Val Val Asp Ser Leu Ile Pro Lys Phe Ala 370 375 380 Phe Val Asn Gly Gly Val Val Ala Asn Cys Ile Ala Ser Thr Cys Thr 385 390 395 400 Cys Gly Thr Gly Arg Arg Pro Ile Ser Gln Asp Arg Ser Lys Gly Val 405 410 415 Val Phe Leu Thr His Asp Asn Cys Gly Leu Ile Gly Val Asn Gly Val 420 425 430 Glu Leu Tyr Ala Asn Arg Arg Gly His Asp Ala Thr Trp Gly Val Gln 435 440 445 Asn Leu Thr Val Gly Pro Ala Ile Ala Ile Arg Pro Val Asp Ile Ser 450 455 460 Leu Asn Leu Ala Asp Ala Thr Asn Phe Leu Gln Asp Ser Lys Ala Glu 465 470 475 480 Leu Glu Lys Ala Arg Lys Ile Leu Ser Glu Val Gly Arg Trp Tyr Asn 485 490 495 Ser Arg Glu Thr Val Ile Thr Ile Ile Val Val Met Val Val Ile Leu 500 505 510 Val Val Ile Ile Val Ile Ile Ile Val Leu Tyr Arg Leu Arg Arg 515 520 525 SEQ ID NO:19 Fct4 protein (fragment 1) Phe Phe Gly Ala Val Ile Gly Thr Ile Ala Leu Gly Val Ala Thr Ser 1 5 10 15 Ala Gln Ile Thr Ala Gly Ile Ala Leu Ala Glu Ala Arg Glu Ala Lys 20 25 30 Arg Asp Ile Ala Leu Ile Lys Glu Ser Met Thr Lys Thr His Lys Ser 35 40 45 Ile Glu Leu Leu Gln Asn Ala Val Gly Glu Gln Ile Leu Ala Leu Lys 50 55 60 Thr Leu Gln Asp Phe Val Asn Asp Glu Ile Lys Pro Ala Ile Ser Glu 65 70 75 80 Leu Gly Cys Glu Thr Ala Ala Leu Arg Leu Gly Ile Lys Leu Thr Gln 85 90 95 His Tyr Ser Glu Leu Leu Thr Ala Phe Gly Ser Asn Phe Gly Thr Ile 100 105 110 Gly Glu Lys Ser Leu Thr Leu Gln Ala Leu Ser Ser Leu Tyr Ser Ala 115 120 125 Asn Ile Thr Glu Ile Met Thr Thr Ile Arg Thr Gly Gln Ser Asn Ile 130 135 140 Tyr Asp Val Ile Tyr Thr Glu Gln Ile Lys Gly Thr Val Ile Asp Val 145 150 155 160 Asp Leu Glu Arg Tyr Met Val Thr Leu Ser Val Lys Ile Pro Ile Leu 165 170 175 Ser Glu Val Pro Gly Val Leu Ile His Lys Ala Ser Ser Ile Ser Tyr 180 185 190 Asn Ile Asp Gly Glu Glu Trp Tyr Val Thr Val Pro Ser His Ile Leu 195 200 205 Ser Arg Ala Ser Phe Leu Gly Gly Ala Asp Ile Thr Asp Cys Val Glu 210 215 220 Ser Arg Leu Thr Tyr Ile Cys Pro Arg Asp Pro Ala Gln Leu Ile Pro 225 230 235 240 Asp Ser Gln Gln Lys Cys Ile Leu Gly Asp Thr Thr Arg Cys Pro Val 245 250 255 Thr Lys Val Val Asp Ser Leu Ile Pro Lys Phe Ala Phe Val Asn Gly 260 265 270 Gly Val Val Ala Asn Cys Ile Ala Ser Thr Cys Thr Cys Gly Thr Gly 275 280 285 Arg Arg Pro Ile Ser Gln Asp Arg Ser Lys Gly Val Val Phe Leu Thr 290 295 300 His Asp Asn Cys Gly Leu Ile Gly Val Asn Gly Val Glu Leu Tyr Ala 305 310 315 320 Asn Arg Arg Gly His Asp Ala Thr Trp Gly Val Gln Asn Leu Thr Val 325 330 335 Gly Pro Ala Ile Ala Ile Arg Pro Val Asp Ile Ser Leu Asn Leu Ala 340 345 350 Asp Ala Thr Asn Phe Leu Gln Asp Ser Lys Ala Glu Leu Glu Lys Ala 355 360 365 Arg Lys Ile Leu Ser Glu Val Gly Arg Trp Tyr Asn Ser Arg Glu Thr 370 375 380 Val Ile Thr Ile Ile Val Val Met Val Val Ile Leu Val Val Ile Ile 385 390 395 400 Val Ile Ile Ile Val Leu Tyr Arg Leu Arg Arg 405 410 SEQ ID NO: 20 Fct4 Protein (Fragment 2) Gln Ile Pro Arg Asp Arg Leu Ser Asn Ile Gly Val Ile Val Asp Glu 1 5 10 15 Gly Lys Ser Leu Lys Ile Ala Gly Ser His Glu Ser Arg Tyr Ile Val 20 25 30 Leu Ser Leu Val Pro Gly Val Asp Phe Glu Asn Gly Cys Gly Thr Ala 35 40 45 Gln Val Ile Gln Tyr Lys Ser Leu Leu Asn Arg Leu Leu Ile Pro Leu 50 55 60 Arg Asp Ala Leu Asp Leu Gln Glu Ala Leu Ile Thr Val Thr Asn Asp 65 70 75 80 Thr Thr Gln Asn Ala Gly Ala Pro Gln Ser Arg 85 90 SEQ ID NO: 21 Fct4 Protein Signal Sequence MATYIQRVQC ISTSLLVVLT TLVSC 25 SEQ ID NO:​​​​​​​​​​​​​​​​​​​​​Val Cys Val Leu Tyr Cys Leu His Lys Glu Gln Lys Val Lys Asp Thr 85 90 95 Glu Glu Ala Val Ala Thr Val Arg Gln His Cys His Leu Val Glu Lys 100 105 110 Glu Lys Ser Ala Thr Glu Thr Ser Ser Gly Gln Lys Lys Asn Asp Lys 115 120 125 Gly Ile Ala Ala Pro Pro Gly Gly Ser Gln Asn Phe 130 135 140 sequence number 23 p24 protein sequence Pro Ala Gln Gln Gln Gly Asn Ala Trp Val His Val Pro Leu Ser Pro 1 5 10 15 Arg Thr Leu Asn Ala Trp Val Lys Ala Val Glu Glu Lys Lys Phe Gly 20 25 30 Ala Glu Ile Val Pro Met Phe Gln Ala Leu Ser Glu Gly Cys Thr Pro 35 40 45 Tyr Asp Ile Asn Gln Met Leu Asn Val Leu Gly Asp His Gln Gly Ala 50 55 60 Leu Gln Ile Val Lys Glu Ile Ile Asn Glu Glu Ala Ala Gln Trp Asp 65 70 75 80 Val Thr His Pro Leu Pro Ala Gly Pro Leu Pro Ala Gly Gln Leu Arg 85 90 95 Asp Pro Arg Gly Ser Asp Ile Ala Gly Thr Thr Ser Ser Val Gln Glu 100 105 110 Gln Leu Glu Trp Ile Tyr Thr Ala Asn Pro Arg Val Asp Val Gly Ala 115 120 125 Ile Tyr Arg Arg Trp Ile Ile Leu Gly Leu Gln Lys Cys Val Lys Met 130 135 140 Tyr Asn Pro Val Ser Val Leu Asp Ile Arg Gln Gly Pro Lys Glu Pro 145 150 155 160 Phe Lys Asp Tyr Val Asp Arg Phe Tyr Lys Ala Ile Arg Ala Glu Gln 165 170 175 Ala Ser Gly Glu Val Lys Gln Trp Met Thr Glu Ser Leu Leu Ile Gln 180 185 190 Asn Ala Asn Pro Asp Cys Lys Val Ile Leu Lys Gly Leu Gly Met His 195 200 205 Pro Thr Leu Glu Glu Met Leu Thr Ala Cys Gln Gly Val Gly Gly Pro 210 215 220 Ser Tyr Lys Ala Lys Val Met 225 230 sequence number 24 p8 protein sequence Val Gln Gln Gly Gly Pro Lys Arg Gln Arg Pro Pro Leu Arg Cys Tyr 1 5 10 15 Asn Cys Gly Lys Phe Gly His Met Gln Arg Gln Cys Pro Glu Pro Arg 20 25 30 Lys Thr Lys Cys Leu Lys Cys Gly Lys Leu Gly His Leu Ala Lys Asp 35 40 45 Cys Arg Gly Gln Val Asn 50 Sequence number 25 Protease sequence Phe Glu Leu Pro Leu Trp Arg Arg Pro Ile Lys Thr Val Tyr Ile Glu 1 5 10 15 Gly Val Pro Ile Lys Ala Leu Leu Asp Thr Gly Ala Asp Asp Thr Ile 20 25 30 Ile Lys Glu Asn Asp Leu Gln Leu Ser Gly Pro Trp Arg Pro Lys Ile 35 40 45 Ile Gly Gly Ile Gly Gly Gly Leu Asn Val Lys Glu Tyr Asn Asp Arg 50 55 60 Glu Val Lys Ile Glu Asp Lys Ile Leu Arg Gly Thr Ile Leu Leu Gly 65 70 75 80 Ala Thr Pro Ile Asn Ile Ile Gly Arg Asn Leu Leu Ala Pro Ala Gly 85 90 95 Ala Arg Leu Val Met 100 Sequence number 26 p51 protein sequence Gly Gln Leu Ser Glu Lys Ile Pro Val Thr Pro Val Lys Leu Lys Glu 1 5 10 15 Gly Ala Arg Gly Pro Cys Val Arg Gln Trp Pro Leu Ser Lys Glu Lys 20 25 30 Ile Glu Ala Leu Gln Glu Ile Cys Ser Gln Leu Glu Gln Glu Gly Lys 35 40 45 Ile Ser Arg Val Gly Gly Glu Asn Ala Tyr Asn Thr Pro Ile Phe Cys 50 55 60 Ile Lys Lys Lys Asp Lys Ser Gln Trp Arg Met Leu Val Asp Phe Arg 65 70 75 80 Glu Leu Asn Lys Ala Thr Gln Asp Phe Phe Glu Val Gln Leu Gly Ile 85 90 95 Pro His Pro Ala Gly Leu Arg Lys Met Arg Gln Ile Thr Val Leu Asp 100 105 110 Val Gly Asp Ala Tyr Tyr Ser Ile Pro Leu Asp Pro Asn Phe Arg Lys 115 120 125 Tyr Thr Ala Phe Thr Ile Pro Thr Val Asn Asn Gln Gly Pro Gly Ile 130 135 140 Arg Tyr Gln Phe Asn Cys Leu Pro Gln Gly Trp Lys Gly Ser Pro Thr 145 150 155 160 Ile Phe Gln Asn Thr Ala Ala Ser Ile Leu Glu Glu Ile Lys Arg Asn 165 170 175 Leu Pro Ala Leu Thr Ile Val Gln Tyr Met Asp Asp Leu Trp Val Gly 180 185 190 Ser Gln Glu Asn Glu His Thr His Asp Lys Leu Val Glu Gln Leu Arg 195 200 205 Thr Lys Leu Gln Ala Trp Gly Leu Glu Thr Pro Glu Lys Lys Val Gln 210 215 220 Lys Glu Pro Pro Tyr Glu Trp Met Gly Tyr Lys Leu Trp Pro His Lys 225 230 235 240 Trp Glu Leu Ser Arg Ile Gln Leu Glu Glu Lys Asp Glu Trp Thr Val 245 250 255 Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ala Gln Leu 260 265 270 Tyr Pro Gly Leu Arg Thr Lys Asn Ile Cys Lys Leu Ile Arg Gly Lys 275 280 285 Lys Asn Leu Leu Glu Leu Val Thr Trp Thr Pro Glu Ala Glu Ala Glu 290 295 300 Tyr Ala Glu Asn Ala Glu Ile Leu Lys Thr Glu Gln Glu Gly Thr Tyr 305 310 315 320 Tyr Lys Pro Gly Ile Pro Ile Arg Ala Ala Val Gln Lys Leu Glu Gly 325 330 335 Gly Gln Trp Ser Tyr Gln Phe Lys Gln Glu Gly Gln Val Leu Lys Val 340 345 350 Gly Lys Tyr Thr Lys Gln Lys Asn Thr His Thr Asn Glu Leu Arg Thr 355 360 365 Leu Ala Gly Leu Val Gln Lys Ile Cys Lys Glu Ala Leu Val Ile Trp 370 375 380 Gly Ile Leu Pro Val Leu Glu Leu Pro Ile Glu Arg Glu Val Trp Glu 385 390 395 400 Gln Trp Trp Ala Asp Tyr Trp Gln Val Ser Trp Ile Pro Glu Trp Asp 405 410 415 Phe Val Ser Thr Pro Pro Leu Leu Lys Leu Trp Tyr Thr Leu Thr Lys 420 425 430 Glu Pro Ile Pro Lys Glu Asp Val Tyr 435 440 Sequence number 27 p15 protein sequence Tyr Val Asp Gly Ala Cys Asn Arg Asn Ser Lys Glu Gly Lys Ala Gly 1 5 10 15 Tyr Ile Ser Gln Tyr Gly Lys Gln Arg Val Glu Thr Leu Glu Asn Thr 20 25 30 Thr Asn Gln Gln Ala Glu Leu Thr Ala Ile Lys Met Ala Leu Glu Asp 35 40 45 Ser Gly Pro Asn Val Asn Ile Val Thr Asp Ser Gln Tyr Ala Met Gly 50 55 60 Ile Leu Thr Ala Gln Pro Thr Gln Ser Asp Ser Pro Leu Val Glu Gln 65 70 75 80 Ile Ile Ala Leu Met Ile Gln Lys Gln Gln Ile Tyr Leu Gln Trp Val 85 90 95 Pro Ala His Lys Gly Ile Gly Gly Asn Glu Glu Ile Asp Lys Leu Val 100 105 110 Ser Lys Gly Ile Arg Arg Val Leu 115 120 sequence number 28 p31 protein sequence Phe Leu Glu Lys Ile Glu Glu Ala Gln Glu Glu His Glu Arg Tyr His 1 5 10 15 Asn Asn Trp Lys Asn Leu Ala Asp Thr Tyr Gly Leu Pro Gln Ile Val 20 25 30 Ala Lys Glu Ile Val Ala Met Cys Pro Lys Cys Gln Ile Lys Gly Glu 35 40 45 Pro Val His Gly Gln Val Asp Ala Ser Pro Gly Thr Trp Gln Met Asp 50 55 60 Cys Thr His Leu Glu Gly Lys Val Val Ile Val Ala Val His Val Ala 65 70 75 80 Ser Gly Phe Ile Glu Ala Glu Val Ile Pro Arg Glu Thr Gly Lys Glu 85 90 95 Thr Ala Lys Phe Leu Leu Lys Ile Leu Ser Arg Trp Pro Ile Thr Gln 100 105 110 Leu His Thr Asp Asn Gly Pro Asn Phe Thr Ser Gln Glu Val Ala Ala 115 120 125 Ile Cys Trp Trp Gly Lys Ile Glu His Thr Thr Gly Ile Pro Tyr Asn 130 135 140 Pro Gln Ser Gln Gly Ser Ile Glu Ser Met Asn Lys Gln Leu Lys Glu 145 150 155 160 Ile Ile Gly Lys Ile Arg Asp Asp Cys Gln Tyr Thr Glu Thr Ala Val 165 170 175 Leu Met Ala Cys His Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly 180 185 190 Gly Gln Thr Ser Ala Glu Arg Leu Ile Asn Ile Ile Thr Thr Gln Leu 195 200 205 Glu Ile Gln His Leu Gln Thr Lys Ile Gln Lys Ile Leu Asn Phe Arg 210 215 220 Val Tyr Tyr Arg Glu Gly Arg Asp Pro Val Trp Lys Gly Pro Ala Gln 225 230 235 240 Leu Ile Trp Lys Gly Glu Gly Ala Val Val Leu Lys Asp Gly Ser Asp 245 250 255 Leu Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Lys Asp Tyr Glu 260 265 270 Pro Lys Gln Arg Val Gly Asn Glu Gly Asp Val Glu Gly Thr Arg Gly 275 280 285 Ser Asp Asn 290 sequence number 29 Gag protein Met Gly Ala Ala Thr Ser Ala Leu Asn Arg Arg Gln Leu Asp Gln Phe 1 5 10 15 Glu Lys Ile Arg Leu Arg Pro Asn Gly Lys Lys Lys Tyr Gln Ile Lys 20 25 30 His Leu Ile Trp Ala Gly Lys Glu Met Glu Arg Phe Gly Leu His Glu 35 40 45 Arg Leu Leu Glu Thr Glu Glu Gly Cys Lys Arg Ile Ile Glu Val Leu 50 55 60 Tyr Pro Leu Glu Pro Thr Gly Ser Glu Gly Leu Lys Ser Leu Phe Asn 65 70 75 80 Leu Val Cys Val Leu Tyr Cys Leu His Lys Glu Gln Lys Val Lys Asp 85 90 95 Thr Glu Glu Ala Val Ala Thr Val Arg Gln His Cys His Leu Val Glu 100 105 110 Lys Glu Lys Ser Ala Thr Glu Thr Ser Ser Gly Gln Lys Lys Asn Asp 115 120 125 Lys Gly Ile Ala Ala Pro Pro Gly Gly Ser Gln Asn Phe Pro Ala Gln 130 135 140 Gln Gln Gly Asn Ala Trp Val His Val Pro Leu Ser Pro Arg Thr Leu 145 150 155 160 Asn Ala Trp Val Lys Ala Val Glu Glu Lys Lys Phe Gly Ala Glu Ile 165 170 175 Val Pro Met Phe Gln Ala Leu Ser Glu Gly Cys Thr Pro Tyr Asp Ile 180 185 190 Asn Gln Met Leu Asn Val Leu Gly Asp His Gln Gly Ala Leu Gln Ile 195 200 205 Val Lys Glu Ile Ile Asn Glu Glu Ala Ala Gln Trp Asp Val Thr His 210 215 220 Pro Leu Pro Ala Gly Pro Leu Pro Ala Gly Gln Leu Arg Asp Pro Arg 225 230 235 240 Gly Ser Asp Ile Ala Gly Thr Thr Ser Ser Val Gln Glu Gln Leu Glu 245 250 255 Trp Ile Tyr Thr Ala Asn Pro Arg Val Asp Val Gly Ala Ile Tyr Arg 260 265 270 Arg Trp Ile Ile Leu Gly Leu Gln Lys Cys Val Lys Met Tyr Asn Pro 275 280 285 Val Ser Val Leu Asp Ile Arg Gln Gly Pro Lys Glu Pro Phe Lys Asp 290 295 300 Tyr Val Asp Arg Phe Tyr Lys Ala Ile Arg Ala Glu Gln Ala Ser Gly 305 310 315 320 Glu Val Lys Gln Trp Met Thr Glu Ser Leu Leu Ile Gln Asn Ala Asn 325 330 335 Pro Asp Cys Lys Val Ile Leu Lys Gly Leu Gly Met His Pro Thr Leu 340 345 350 Glu Glu Met Leu Thr Ala Cys Gln Gly Val Gly Gly Pro Ser Tyr Lys 355 360 365 Ala Lys Val Met Ala Glu Met Met Gln Thr Met Gln Asn Gln Asn Met 370 375 380 Val Gln Gln Gly Gly Pro Lys Arg Gln Arg Pro Pro Leu Arg Cys Tyr 385 390 395 400 Asn Cys Gly Lys Phe Gly His Met Gln Arg Gln Cys Pro Glu Pro Arg 405 410 415 Lys Thr Lys Cys Leu Lys Cys Gly Lys Leu Gly His Leu Ala Lys Asp 420 425 430 Cys Arg Gly Gln Val Asn Phe Leu Gly Tyr Gly Arg Trp Met Gly Ala 435 440 445 Lys Pro Arg Asn Phe Pro Ala Ala Thr Leu Gly Ala Glu Pro Ser Ala 450 455 460 Pro Pro Pro Pro Ser Gly Thr Thr Pro Tyr Asp Pro Ala Lys Lys Leu 465 470 475 480 Leu Gln Gln Tyr Ala Glu Lys Gly Lys Gln Leu Arg Glu Gln Lys Arg 485 490 495 Asn Pro Pro Ala Met Asn Pro Asp Trp Thr Glu Gly Tyr Ser Leu Asn 500 505 510 Ser Leu Phe Gly Glu Asp Gln 515 sequence number 30 Pol protein Met Ser Lys Val Trp Lys Ile Gly Thr Pro Ser Lys Arg Leu Gln Gly 1 5 10 15 Thr Gly Glu Phe Phe Arg Val Trp Thr Val Asp Gly Gly Lys Thr Glu 20 25 30 Lys Phe Ser Arg Arg Tyr Ser Trp Ser Gly Thr Glu Cys Ala Ser Ser 35 40 45 Thr Glu Arg His His Pro Ile Arg Pro Ser Lys Glu Ala Pro Ala Ala 50 55 60 Ile Cys Arg Glu Arg Glu Thr Thr Glu Gly Ala Lys Glu Glu Ser Thr 65 70 75 80 Gly Asn Glu Ser Gly Leu Asp Arg Gly Ile Phe Phe Glu Leu Pro Leu 85 90 95 Trp Arg Arg Pro Ile Lys Thr Val Tyr Ile Glu Gly Val Pro Ile Lys 100 105 110 Ala Leu Leu Asp Thr Gly Ala Asp Asp Thr Ile Ile Lys Glu Asn Asp 115 120 125 Leu Gln Leu Ser Gly Pro Trp Arg Pro Lys Ile Ile Gly Gly Ile Gly 130 135 140 Gly Gly Leu Asn Val Lys Glu Tyr Asn Asp Arg Glu Val Lys Ile Glu 145 150 155 160 Asp Lys Ile Leu Arg Gly Thr Ile Leu Leu Gly Ala Thr Pro Ile Asn 165 170 175 Ile Ile Gly Arg Asn Leu Leu Ala Pro Ala Gly Ala Arg Leu Val Met 180 185 190 Gly Gln Leu Ser Glu Lys Ile Pro Val Thr Pro Val Lys Leu Lys Glu 195 200 205 Gly Ala Arg Gly Pro Cys Val Arg Gln Trp Pro Leu Ser Lys Glu Lys 210 215 220 Ile Glu Ala Leu Gln Glu Ile Cys Ser Gln Leu Glu Gln Glu Gly Lys 225 230 235 240 Ile Ser Arg Val Gly Gly Glu Asn Ala Tyr Asn Thr Pro Ile Phe Cys 245 250 255 Ile Lys Lys Lys Asp Lys Ser Gln Trp Arg Met Leu Val Asp Phe Arg 260 265 270 Glu Leu Asn Lys Ala Thr Gln Asp Phe Phe Glu Val Gln Leu Gly Ile 275 280 285 Pro His Pro Ala Gly Leu Arg Lys Met Arg Gln Ile Thr Val Leu Asp 290 295 300 Val Gly Asp Ala Tyr Tyr Ser Ile Pro Leu Asp Pro Asn Phe Arg Lys 305 310 315 320 Tyr Thr Ala Phe Thr Ile Pro Thr Val Asn Asn Gln Gly Pro Gly Ile 325 330 335 Arg Tyr Gln Phe Asn Cys Leu Pro Gln Gly Trp Lys Gly Ser Pro Thr 340 345 350 Ile Phe Gln Asn Thr Ala Ala Ser Ile Leu Glu Glu Ile Lys Arg Asn 355 360 365 Leu Pro Ala Leu Thr Ile Val Gln Tyr Met Asp Asp Leu Trp Val Gly 370 375 380 Ser Gln Glu Asn Glu His Thr His Asp Lys Leu Val Glu Gln Leu Arg 385 390 395 400 Thr Lys Leu Gln Ala Trp Gly Leu Glu Thr Pro Glu Lys Lys Val Gln 405 410 415 Lys Glu Pro Pro Tyr Glu Trp Met Gly Tyr Lys Leu Trp Pro His Lys 420 425 430 Trp Glu Leu Ser Arg Ile Gln Leu Glu Glu Lys Asp Glu Trp Thr Val 435 440 445 Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ala Gln Leu 450 455 460 Tyr Pro Gly Leu Arg Thr Lys Asn Ile Cys Lys Leu Ile Arg Gly Lys 465 470 475 480 Lys Asn Leu Leu Glu Leu Val Thr Trp Thr Pro Glu Ala Glu Ala Glu 485 490 495 Tyr Ala Glu Asn Ala Glu Ile Leu Lys Thr Glu Gln Glu Gly Thr Tyr 500 505 510 Tyr Lys Pro Gly Ile Pro Ile Arg Ala Ala Val Gln Lys Leu Glu Gly 515 520 525 Gly Gln Trp Ser Tyr Gln Phe Lys Gln Glu Gly Gln Val Leu Lys Val 530 535 540 Gly Lys Tyr Thr Lys Gln Lys Asn Thr His Thr Asn Glu Leu Arg Thr 545 550 555 560 Leu Ala Gly Leu Val Gln Lys Ile Cys Lys Glu Ala Leu Val Ile Trp 565 570 575 Gly Ile Leu Pro Val Leu Glu Leu Pro Ile Glu Arg Glu Val Trp Glu 580 585 590 Gln Trp Trp Ala Asp Tyr Trp Gln Val Ser Trp Ile Pro Glu Trp Asp 595 600 605 Phe Val Ser Thr Pro Pro Leu Leu Lys Leu Trp Tyr Thr Leu Thr Lys 610 615 620 Glu Pro Ile Pro Lys Glu Asp Val Tyr Tyr Val Asp Gly Ala Cys Asn 625 630 635 640 Arg Asn Ser Lys Glu Gly Lys Ala Gly Tyr Ile Ser Gln Tyr Gly Lys 645 650 655 Gln Arg Val Glu Thr Leu Glu Asn Thr Thr Asn Gln Gln Ala Glu Leu 660 665 670 Thr Ala Ile Lys Met Ala Leu Glu Asp Ser Gly Pro Asn Val Asn Ile 675 680 685 Val Thr Asp Ser Gln Tyr Ala Met Gly Ile Leu Thr Ala Gln Pro Thr 690 695 700 Gln Ser Asp Ser Pro Leu Val Glu Gln Ile Ile Ala Leu Met Ile Gln 705 710 715 720 Lys Gln Gln Ile Tyr Leu Gln Trp Val Pro Ala His Lys Gly Ile Gly 725 730 735 Gly Asn Glu Glu Ile Asp Lys Leu Val Ser Lys Gly Ile Arg Arg Val 740 745 750 Leu Phe Leu Glu Lys Ile Glu Glu Ala Gln Glu Glu His Glu Arg Tyr 755 760 765 His Asn Asn Trp Lys Asn Leu Ala Asp Thr Tyr Gly Leu Pro Gln Ile 770 775 780 Val Ala Lys Glu Ile Val Ala Met Cys Pro Lys Cys Gln Ile Lys Gly 785 790 795 800 Glu Pro Val His Gly Gln Val Asp Ala Ser Pro Gly Thr Trp Gln Met 805 810 815 Asp Cys Thr His Leu Glu Gly Lys Val Val Ile Val Ala Val His Val 820 825 830 Ala Ser Gly Phe Ile Glu Ala Glu Val Ile Pro Arg Glu Thr Gly Lys 835 840 845 Glu Thr Ala Lys Phe Leu Leu Lys Ile Leu Ser Arg Trp Pro Ile Thr 850 855 860 Gln Leu His Thr Asp Asn Gly Pro Asn Phe Thr Ser Gln Glu Val Ala 865 870 875 880 Ala Ile Cys Trp Trp Gly Lys Ile Glu His Thr Thr Gly Ile Pro Tyr 885 890 895 Asn Pro Gln Ser Gln Gly Ser Ile Glu Ser Met Asn Lys Gln Leu Lys 900 905 910 Glu Ile Ile Gly Lys Ile Arg Asp Asp Cys Gln Tyr Thr Glu Thr Ala 915 920 925 Val Leu Met Ala Cys His Ile His Asn Phe Lys Arg Lys Gly Gly Ile 930 935 940 Gly Gly Gln Thr Ser Ala Glu Arg Leu Ile Asn Ile Ile Thr Thr Gln 945 950 955 960 Leu Glu Ile Gln His Leu Gln Thr Lys Ile Gln Lys Ile Leu Asn Phe 965 970 975 Arg Val Tyr Tyr Arg Glu Gly Arg Asp Pro Val Trp Lys Gly Pro Ala 980 985 990 Gln Leu Ile Trp Lys Gly Glu Gly Ala Val Val Leu Lys Asp Gly Ser 995 1000 1005 Asp Leu Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Lys Asp 1010 1015 1020 Tyr Glu Pro Lys Gln Arg Val Gly Asn Glu Gly Asp Val Glu Gly 1025 1030 1035 Thr Arg Gly Ser Asp Asn 1040 [Example]

[0246] The present invention will now be described with reference to the following examples. These are not intended to limit the scope of the invention, and those skilled in the art will recognize that appropriate equivalents may be used within the scope of the invention. The examples can therefore be considered as constituent parts of the invention, and the individual aspects described in the examples can be considered to be disclosed independently or in any combination. [Example]

[0247] "Transduction efficiency in human bronchial epithelial cells (HBEC, F508del / F508del, class II) grown in air-liquid interface (ALI) culture" To analyze the transduction efficiency of HBECs (basal cells) subsequently expanded in ALI cultures, cells were transduced in submerged culture with GFP-expressing rSIV.F / HN (vFM107, rSIV.F / HN-GFP) at different multiplicities of infection (MOI) of 3, 10, 30, and 90, followed by airlift 2 days after transduction (Figure 2A). Three to four weeks after airlift, cells were analyzed in their fully differentiated state. Twenty-one days after airlift, the percentage of GFP-positive cells was measured by flow cytometry. Cells transduced at MOIs of 3, 10, 30, and 90 resulted in a significant (p<0.001, p<0.0001) dose-dependent increase in transduction efficiency: 7.8±1.1%, 17.6±1.0%, 25.8±1.8%, and 28.3±1.8%, respectively (Figure 2B).

[0248] Next, we examined the cellular profile of ALI derived from transduced basal cells by applying immunofluorescence staining for various epithelial cell markers 28 days after transduction. GFP colocalization with ACTUB (ciliated cells), KRT5 (basal cells), SCGB1A1 (club cells), and MUC5AC (goblet cells) was detectable, confirming that rSIV.F / HN elicited expression in multiple cell types after basal cell transduction (Figure 2C). These findings support the conclusion that KRT5 + , ACTUB + and SCGB1A1 + This was further confirmed by flow cytometry measurement of the percentage of GFP-positive cells. At an MOI of 10, approximately 20% of cells in each cell population were transduced by the virus, whereas at an MOI of 30, this increased to 30–40% (Fig. 2D).

[0249] Furthermore, we analyzed the average integration (vector copy number [VCN]) in the genome in DNA samples from ALI cultures independently transduced with either GFP- (vGM107) or CFTR- (vGM058)-expressing rSIV.F / HN. Bulk DNA analysis demonstrated a dose-related increase in VCN for both GFP- and CFTR-expressing rSIV.F / HN (30.0 ± 5.2 / 35.8 ± 4.0; 60.3 ± 11.9 / 58.6 ± 6.3; 124.2 ± 25.2 / 87.2 ± 10.5 copies / ng DNA in cells transduced with GFP / CFTR-expressing rSIV.F / HN at MOIs of 3, 10, and 90). No differences in VCN were observed between GFP-expressing rSIV.F / HN and CFTR-expressing rSIV.F / HN at any of the MOIs analyzed (Fig. 2E ).

[0250] Vector-derived woodchuck hepatitis posttranscriptional regulatory element (WPRE) mRNA expression was also analyzed on sorted single cells from the ALI transduced at an MOI of 10. Again, no differences in WPRE expression were observed between cells transduced with GFP- (vGM107) or CFTR-expressing (vGM058) rSIV.F / HN (Figure 2F). High variability in the number of WPRE copies per cell was observed, suggesting that some cells may be identified as high expressers and others as medium / low expressers. Both analyses (Figure 2E, F) suggest that the transduction efficiencies of GFP-expressing rSIV.F / HN and CFTR-expressing rSIV.F / HN are comparable.

[0251] Based on these data, the transduction rate of GFP-expressing rSIV.F / HN was used as a surrogate indicator to estimate the transduction level of CFTR-expressing rSIV.F / HN, thereby enabling correlation analysis between the transduction level and the degree of functional CFTR recovery. [Example]

[0252] "Transduction of CF ALI cultures (F508del / F508del, class II) with rSIV.F / HN-CFTR (vGM058) results in transgenic CFTR expression, restoration of CFTR chloride current, and increased ciliary beat frequency." To determine whether CF ALI transduced with rSIV.F / HN-CFTR could efficiently produce vector-derived, codon-optimized CFTR mRNA (coCFTR), quantitative ddPCR analysis was performed. Dose-dependent coCFTR expression was observed in cells transduced with rSIV.F / HN-CFTR (vGM058) at MOIs of 3 and 10, but no expression was observed in cells transduced with rSIV.F / HN-GFP (vGM107) (Figure 3A). Endogenous CFTR expression was also analyzed, and no differences were observed between untransduced samples, samples transduced with rSIV.F / HN-GFP, and samples transduced with rSIV.F / HN-CFTR at MOI 10 (Figure 3B). coCFTR mRNA expression was 10-fold higher than that of endogenous CFTR (Fig. 3C ), suggesting that a small number of transduced CFTR-high-expressing cells (17% for an MOI of 10) was sufficient to restore CFTR expression above endogenous levels.

[0253] To analyze the functionality of rSIV.F / HN-CFTR-expressing channels, rSIV.F / HN-CFTR (vGM058)-transduced ALI cultures were used to measure CFTR-mediated chloride currents in Ussing chambers. Amiloride was first used to block the sodium channel (ENaC), followed by stimulation of CFTR with forskolin. Changes in short-circuit current (ΔIsc) were calculated (both peak and plateau values). In some experiments, ivacaftor, a small molecule CFTR potentiator that increases channel open probability, was added for further stimulation of CFTR currents. Finally, chloride currents were blocked with the CFTR inhibitor 172 (Figure 3D).

[0254] As expected, untransduced cells (MOI 0) or cells transduced with rSIV.F / HN-GFP did not respond to either forskolin or the CFTR inhibitor, confirming the absence of functional CFTR channels. In contrast, a dose-related increase in CFTR chloride current was observed in ALIs transduced with rSIV.F / HN-CFTR. At an MOI of 3, a recovery of 49 ± 6% (peak, p < 0.0001) and 38 ± 4% (plateau, p < 0.01) of the non-CFTR chloride current was observed. When rSIV.F / HN-CFTR (MOI 3) was combined with the potentiator ivacaftor, a significant increase in the stimulation of chloride current was observed (61 ± 4% for both peak and plateau). When the MOI was increased to 10, we observed significantly higher recovery of non-CF chloride current (94±11% peak, 66±6% plateau, p<0.0001); combining an MOI of 10 with ivacaftor resulted in a further increase in recovery (121±11% for both peak and plateau). Higher MOIs (30 and 90) resulted in even more significant increases: 144±27 and 162±49% recovery (peak, p<0.0001) and 101±37 and 114±36% (plateau, p<0.0001), respectively.

[0255] Thus, rSIV.F / HN-CFTR can completely restore CFTR-associated chloride currents to non-CFTR values, and the combination of rSIV.F / HN-CFTR with ivacaftor amplifies this effect of gene therapy by 1.3-1.8-fold. These data compare favorably with similarly evaluated and currently approved modulator therapies. Namely, treatment with lumacaftor + ivacaftor and tezacaftor + ivacaftor resulted in 34% and 21% CFTR current recovery, respectively, while treatment with elexacaftor + tezacaftor + ivacaftor resulted in 81% recovery (Figure 3E, F; Table 1). [Table 2]

[0256] Because the transduction efficiencies of rSIV.F / HN-GFP and rSIV.F / HN-CFTR were comparable (Fig. 2E, F), we performed a correlation analysis between GFP-based transduction levels and the extent of CFTR chloride current recovery (Fig. 3G). Approximately 17% of transduced cells were sufficient to restore CFTR chloride current to physiological levels. When rSIV.F / HN-CFTR was used in combination with ivacaftor, complete recovery was achieved in approximately 14% of transduced cells.

[0257] To examine the downstream functional effects of coCFTR expression, ciliary beat frequency (CBF) was measured as a surrogate for mucociliary clearance. A significant decrease in CBF was demonstrated in CF ALI (6.9 ± 0.8 Hz compared with 8.2 ± 1 Hz in non-CF ALI, p < 0.05). Transduction with rSIV.F / HN-CFTR was able to restore CBF to non-CF values ​​(9.3 ± 1.5, 9.7 ± 2.6, and 9.5 ± 2.2 Hz for MOIs of 3, 10, and 30, respectively, all p > 0.0001) (Figure 3H). [Example]

[0258] "Generation of CFTR knockout hSABCi cell lines as a model for CF translational class I mutations and transduction of CFTR knockout cells with rSIV.F / HN (vGM107, vGM058)" Class I CFTR null mutations result in the complete absence of full-length CFTR protein and are therefore unamenable to functional correction by current CFTR modulators. Gene therapy offers the opportunity to establish disease-modifying treatments for patients with all mutation types, including those homozygous for these null mutations. Obtaining primary airway epithelial cells from the small number of patients with class I mutations is difficult. Therefore, to enable functional characterization of rSIV.F / HN-CFTR in a class I mutant background, we generated a mutant model via CRISPR / Cas9-mediated biallelic CFTR knockout (KO) in exon 4 of the CFTR gene using the previously described immortalized human small airway basal cell line, hSABCi-NS 1.1 (hSABCi). This cell line maintains basal cell characteristics (TP63+, KRT5+) after more than 200 cell division cycles and more than 70 passages.

[0259] When cultured under air-liquid interface conditions, hSABCi cells consistently formed tight junctions and were associated with ciliated cells (ARL13B+), club cells (SCGB1A1 + hSABCi cells differentiate into goblet cells (MUC5AC+, MUC5B+), neuroendocrine cells (CHGA+), ionocytes (FOXI1+), and surfactant protein-positive cells (SFTPA+, SFTPB+, SFTPD+). Furthermore, this cell line has been validated for the presence of ENaC and CFTR channel activity. hSABCi cells were transfected with a complex of synthetic tracr:cr RNA and recombinant Cas9. To analyze editing efficiency, the edited locus was amplified by PCR and subsequently subjected to Sanger sequencing. To estimate the CRISPR editing (ICE) scale, the editing efficiency was determined for selected single clones using established bioinformatics procedures (data not shown). A clone (clone 5) with a very high out-of-frame editing / knockout efficiency of 99.4% (data not shown) was selected for further experiments.

[0260] To further characterize the CFTR-KO phenotype, CFTR protein levels were analyzed by Western blotting using a monoclonal hCFTR antibody (R&D Systems, Minneapolis, MN, US). While a weak signal for mature CFTR was observed in the non-edited hSABCi cell line, no mature CFTR signal was detectable in the CFTR KO cells (Figure 4A), thereby confirming CFTR deficiency.

[0261] We next analyzed the efficiency of lentiviral transduction in CFTR KO cells grown in ALI culture. CFTR KO cells were transduced and analyzed as for primary F508del / F508del cells. Flow cytometry analysis revealed that transduction with rSIV.F / HN-GFP(vGM107) at MOIs of 3, 10, 30, and 90 resulted in an average of 12.2 ± 1.7 (p < 0.0001), 26.9 ± 1.2 (p < 0.0001), 36.3 ± 1.1 (p < 0.01), and 32.6 ± 2.4% GFP+ cells, respectively (Figure 4B). Furthermore, DNA VCN analysis of CFTR KO ALI cultures independently transduced with either rSIV.F / HN-GFP (vGM107) or rSIV.F / HN-CFTR (vGM058) revealed no differences in VCN between rSIV.F / HN-GFP and rSIV.F / HN-CFTR transduced cells at all MOIs analyzed, except at MOI 30, where GFP-transduced cells showed a slight increase in VCN compared with CFTR-transduced cells (p<0.01, Figure 4C). These data suggest that the transduction efficiencies of rSIV.F / HN-GFP and rSIV.F / HN-CFTR are comparable. Finally, rSIV.F / HN-GFP-mediated transduction of CFTR KO cells was analyzed at the cellular level by immunofluorescence staining for various epithelial cell markers at 28 days posttransduction. Colocalization of GFP with ACTUB, KRT5, SCGB1A1, and MUC5AC was observed, suggesting that rSIV.F / HN-GFP could transduce ciliated, basal, club, and goblet cells, respectively (Figure 2E). Furthermore, flow cytometry measurements of the percentage of GFP cells in KRT5+, ACTUB+, and SCGB1A1+ cells confirmed previous findings in class II cells (Example 2). At an MOI of 10, an average of 16.5±1.8%, 58±2.1%, and 26.3±0.8% of ciliated, club, and basal cells were transduced by the virus (Figure 4E). [Example]

[0262] "Transduction of CFTR KO ALI cultures (class I) with rSIV.F / HN-CFTR(vGM058) results in expression of coCFTR mRNA and restoration of CFTR currents, whereas ion channel modulators fail to restore CFTR currents." Expression of codon-optimized CFTR mRNA was analyzed in CFTR KO ALI transduced with rSIV.F / HN-CFTR (vGM058). A dose-dependent increase in coCFTR expression was observed in cells transduced with rSIV.F / HN-CFTR compared with untransduced cells, whereas no coCFTR expression was observed in cells transduced with rSIV.F / HN-GFP at any MOI, as expected (Figure 5A).

[0263] Functional analysis using Ussing chamber assays demonstrated a dose-related increase in CFTR current in CFTR KO ALI (class I) cells transduced with rSIV.F / HN-CFTR(vGM058) (Figure 5B, C). Untransduced cells did not show any activation of CFTR current, confirming the functional success of genome editing. Cells transduced with rSIV.F / HN-CFTR at an MOI of 3 resulted in a 58±2% recovery of CFTR current at the forskolin peak and a 54±2% recovery at the plateau (both p<0.0001). Combining an MOI of 3 with the potentiator drug ivacaftor increased this effect to 77±4%. An MOI of 10 resulted in a CFTR current recovery of 112 ± 6% at the peak (103 ± 6% at the plateau, both p<0.0001) and 138 ± 10% in combination with ivacaftor (p<0.05 for the plateau). MOIs of 30 and 90 resulted in a peak recovery of 142 ± 11% and 153 ± 12%, respectively, and a plateau recovery of 135 ± 9% and 149 ± 11%, respectively (all p<0.0001). Combination with ivacaftor increased these effects to 183 ± 13% (p<0.01 at the peak, p<0.001 at the plateau) and 161 ± 10%, respectively (Figure 5C). Thus, the combination of rSIV.F / HN-CFTR with ivacaftor increased the efficacy of gene therapy by 1.3-1.4-fold. Additionally, analysis of clinically used CFTR modulators showed no evidence of CFTR restoration, as expected ( Figures 5B,C ; Table 2 ).

[0264] Given the comparable transduction efficiencies of rSIV.F / HN-GFP and rSIV.F / HN-CFTR (Figure 4C), we inferred a correlation between the percentage of transduced cells and the degree of CFTR current recovery in CFTR KO cells (Figure 5D). Approximately 23% of transduced cells were sufficiently transduced with rSIV.F / HN-CFTR to restore CFTR current to the level of the parental hSABCi cell line. When rSIV.F / HN-CFTR was used in combination with ivacaftor, full recovery was achieved in approximately 17% of transduced cells. [Example]

[0265] "Comparison of preclinical candidate vGM058 with clinical candidate vGM244 (BI 3720931)" To compare the preclinical candidate virus (vGM058) with the clinical candidate virus (vGM244), class II HBECs were transduced with GFP-expressing rSIV.F / HN (vGM107) and CFTR-expressing rSIV.F / HN (vGM058 and vGM244) at MOIs of 3 and 10. Cells were harvested 21 days after airlift, and DNA samples from ALI cultures transduced at an MOI of 10 were analyzed for average integration in the genome (vector copy number (VCN)).

[0266] No difference in VCN levels was observed between vGM107 and vGM058. However, vGM244-transduced cells had significantly (p<0.05) lower VCN levels compared with vGM058-transduced cells (Figure 6A). Expression of codon-optimized CFTR mRNA was also analyzed. vGM244-transduced cells had a lower, non-significant (p=0.13) reduction in coCFTR expression compared with vGM058-transduced cells (Figure 6B).

[0267] To compare the functionality of vGM058 and vGM244, we measured CFTR-mediated chloride currents in Ussing chambers using class II ALI cultures transduced with both vGM058 and vGM244. At both MOIs of 3 and 10, the level of functional correction by the vGM244 virus was lower than that by the vGM058 virus, but not significantly (Fig. 6C and D).

[0268] Any differences in VCN, coCFTR, and Ussing chamber function data between vGM058 and vGM244 may be due to variability in viral titers resulting from different titration protocols between Oxford Biomedica (source of vGM244) and Oxford University (source of vGM058). [Table 3] [Example]

[0269] "Analysis of vector copy number and coCFTR expression in vGM244-transduced human bronchial epithelial cells (HBEC, F508del / F508del, class II)" For experiments with the clinical candidate virus vGM244, class II HBECs were transduced with both GFP-expressing rSIV.F / HN (vGM107, rSIV.F / HN-GFP) and CFTR-expressing rSIV.F / HN (vGM244, rSIV.F / HN-CFTR) at MOIs of 1, 3, 10, 30, and 90.

[0270] Analysis of the mean integration into the genome (vector copy number (VCN)) in DNA samples from ALI cultures showed a dose-related increase in VCN for both GFP- and CFTR-expressing rSIV.F / HN (3.8±0.6 / 8.3±0.8, 11.8±1.4 / 18.5±1.6; 25.1±3.2 / 21.1±2.1; 47.9±5.5 / 26.3±2.2; 81.0±19.8 / 17.9±2.4 copies / ng DNA in cells transduced with GFP / CFTR-expressing rSIV.F / HN at an MOI of 1, 3, 10, 30, and 90). At MOIs of 1, 3, and 10, no difference in VCN was observed between GFP-expressing rSIV.F / HN and CFTR-expressing rSIV.F / HN, whereas at MOIs of 30 and 90, the difference in VCN between GFP-transduced and CFTR-transduced cells was significant (p<0.0001) (Fig. 7A).

[0271] Expression of codon-optimized CFTR mRNA was analyzed in class II ALI cells transduced with rSIV.F / HN-CFTR(vGM244). A dose-dependent increase in coCFTR expression was observed in cells transduced with rSIV.F / HN-CFTR compared with untransduced cells, whereas no coCFTR expression was observed in cells transduced with rSIV.F / HN-GFP at any MOI, as expected (Figure 7B). [Example]

[0272] "Transduction of CF ALI cultures (F508del / F508del, class II) with SIV.F / HN-CFTR(vGM244) results in restoration of CFTR chloride current and increased ciliary beat frequency." To analyze the functionality of rSIV.F / HN-CFTR-expressed channels, rSIV.F / HN-CFTR(vGM244)-transduced class II ALI cultures were used to measure CFTR-mediated chloride currents in Ussing chambers (Table 3). As expected, untransduced cells (MOI 0) or cells transduced with rSIV.F / HN-GFP did not respond to either forskolin or the CFTR inhibitor, confirming the absence of functional CFTR channels (Figure 8A and B). In contrast, a dose-related increase in CFTR chloride current was observed in ALI transduced with rSIV.F / HN-CFTR. At an MOI of 1, a recovery of 15 ± 1% (peak) and 14 ± 1% (plateau) of the non-CFTR chloride current was observed. When rSIV.F / HN-CFTR (MOI 1) was combined with the potentiator ivacaftor, increased stimulation of chloride current was observed (26 ± 2 / 28 ± 2% for peak / plateau). At an MOI of 3, there was a recovery of 34 ± 2% (peak, p < 0.0001) and 31 ± 2% (plateau, p < 0.001) of non-CF chloride current. When rSIV.F / HN-CFTR (MOI 3) was combined with the potentiator ivacaftor, increased stimulation of chloride current was observed (47 ± 3 / 50 ± 4% for peak / plateau). When the MOI was increased to 10, we observed a higher recovery of non-CFTR chloride currents (peak 73 ± 5%, plateau 52 ± 3%, p < 0.0001); combining an MOI of 10 with ivacaftor resulted in a further increase in recovery (85 ± 5% for peak / plateau / 90 ± 5%). Higher MOIs (30 and 90) did not result in a further increase in these experiments, which correlated with VCN and coCFTR levels (Figure 8B and C). Thus, rSIV.F / HN-CFTR can fully restore CFTR-associated chloride currents to non-CFTR values, and the combination of rSIV.F / HN-CFTR with ivacaftor amplifies this effect of gene therapy by 1.2- to 2.0-fold.Furthermore, analysis of elexacaftor + tezacaftor treatment (Trikafta without ivacaftor) resulted in a 57±4 / 59±4% recovery, whereas treatment with Trikafta (elexacaftor + tezacaftor + ivacaftor) resulted in a 72±3 / 75±3% recovery. Furthermore, analysis of the combination of rSIV.F / HN-CFTR(vGM244) with Trikafta resulted in a further increase in recovery, suggesting that not only ivacaftor but also modulator therapy including ivacaftor may confer therapeutic benefit (Figure 8, right data sets in A and B). [Table 4]

[0273] To examine the downstream functional effects of coCFTR expression, ciliary beat frequency (CBF) was measured as a surrogate for mucociliary clearance. A significant decrease in CBF was demonstrated in CF ALI (5.2 ± 0.2 Hz compared with 8.0 ± 0.2 Hz in non-CF ALI, p<0.0001). Transduction with rSIV.F / HN-CFTR was able to restore CBF to non-CF values ​​(8.2 ± 0.5, 7.5 ± 0.5, 8.8 ± 0.4, and 9.7 ± 0.5 Hz for MOIs of 1, 3, 10, and 30, respectively, p<0.001, p<0.0001) (Figure 9). [Example]

[0274] "Analysis of vector copy number and coCFTR expression in vGM244-transduced CFTR KO cells (Class I)" For experiments with the clinical candidate virus vGM244, class I cells were transduced with both GFP-expressing rSIV.F / HN (vGM107, rSIV.F / HN-GFP) and CFTR-expressing rSIV.F / HN (vGM244, rSIV.F / HN-CFTR) at MOIs of 1, 3, 10, 30, and 90. Analysis of the mean integration in the genome (vector copy number (VCN)) in DNA samples from ALI cultures showed a dose-related increase in VCN for both GFP-expressing rSIV.F / HN and CFTR-expressing rSIV.F / HN (4.0±0.4 / 10.9±1.1, 14.2±2.9 / 24.1±2.2; 47.7±7.9 / 38.5±2.2; 81.3±12.8 / 57.2±6.2; 83.2±8.5 / 49.9±3.6 copies / ng DNA in cells transduced with GFP / CFTR-expressing rSIV.F / HN at an MOI of 1, 3, 10, 30, and 90). At MOIs of 1, 3, 10, and 90, no difference in VCN was observed between GFP- and CFTR-expressing rSIV.F / HN. However, at MOI 30, the difference in VCN between GFP- and CFTR-transduced cells was significant (p<0.05) (Fig. 10A). Expression of codon-optimized CFTR mRNA was analyzed in class I CFTR KO ALI transduced with rSIV.F / HN-CFTR (vGM244). A dose-dependent increase in coCFTR expression was observed in cells transduced with rSIV.F / HN-CFTR compared with untransduced cells. However, as expected, no coCFTR expression was observed in cells transduced with rSIV.F / HN-GFP at any MOI (Fig. 10B). [Example]

[0275] "Transduction of CFTR KO ALI cultures (class I) with SIV.F / HN-CFTR(vGM244) results in restoration of CFTR chloride." Functional analysis using Ussing chamber assays demonstrated a dose-related increase in CFTR currents in CFTR KO ALI (class I) cells transduced with rSIV.F / HN-CFTR(vGM244) (Figure 11A and B, Table 4). As expected, neither untransduced cells (MOI 0) nor cells transduced with rSIV.F / HN-GFP responded to forskolin or the CFTR inhibitor, confirming the absence of functional CFTR channels. In contrast, a dose-related increase in CFTR chloride current was observed in ALI cells transduced with rSIV.F / HN-CFTR. At an MOI of 1, a 21 ± 1% (peak) and 16 ± 1% (plateau) recovery of non-CFTR chloride current was observed. At an MOI of 3, a 43 ± 3% (peak) and 32 ± 1% (plateau) recovery of non-CFTR chloride current was observed. When rSIV.F / HN-CFTR (MOI 3) was combined with the potentiator ivacaftor, increased stimulation of chloride current was observed (61 ± 4% for both peak and plateau). When the MOI was increased to 10, we observed a higher recovery of non-CF chloride current (80 ± 9% peak, 57 ± 3% plateau, p < 0.001, p < 0.05). Combining ivacaftor with MOI 10 resulted in a further increase in recovery (102 ± 11 / 103 ± 13% for peak / plateau). MOI 30 resulted in a further increase in recovery (102 ± 13 / 84 ± 5% for peak / plateau, p < 0.0001). Combining ivacaftor with MOI 30 resulted in a 140 ± 15 / 141 ± 15% recovery for peak / plateau (p < 0.0001). Finally, an MOI of 90 resulted in a further increase in recovery (190±15 / 129±12% for peak / plateau, p<0.0001). The combination of MOI 90 with ivacaftor resulted in a recovery of 193±36 / 195±37% for peak / plateau (p<0.0001).

[0276] Thus, rSIV.F / HN-CFTR can completely restore CFTR-associated chloride currents to non-CFTR values, and the combination of rSIV.F / HN-CFTR with ivacaftor amplifies this effect of gene therapy by 1.2-2.0-fold. Additionally, we analyzed treatment with Trikafta (elexacaftor + tezacaftor + ivacaftor), but as expected, it did not produce any restorative effect on class I cells. Separately, we analyzed the combination of rSIV.F / HN-CFTR(vGM244) with Trikafta, which demonstrated a similar restorative effect to the combination of rSIV.F / HN-CFTR(vGM244) and ivacaftor. Therefore, again, this suggests that not only ivacaftor but also modulator therapy including ivacaftor may produce therapeutic effects (Figure 8, right data set).

[0277] Consideration These examples provide a thorough functional characterization of rSIV.F / HN to further prepare the vector for preclinical and clinical development. Specifically, these examples provide the first evidence that this vector can fully correct the chloride ion deficiency of CF in human bronchial tissue. [Table 5]

[0278] Notably, these experiments demonstrate that CFTR modulators, particularly CFTR potentiators, achieve greater than expected enhancement of the CFTR transgene expressed by rSIV.F / HN. In particular, the combined effect of CFTR modulators, particularly CFTR potentiators, with rSIV.F / HN-CFTR is greater than the additive effect of the individual effects of the CFTR modulators, particularly CFTR potentiators, and rSIV.F / HN-mediated CFTR expression.

[0279] The relationship between the number of transduced cells and the degree of correction was established, and the vector integration profile of such a self-inactivating lentiviral vector was evaluated in relevant cell types for lung gene therapy. These data further support the progression of this vector into first-in-human trials.

[0280] Previous studies have suggested that a range of 5-25% corrected cells should be sufficient to restore CFTR chloride current to normal. This is also supported by previous studies showing that CF individuals with certain "mild" mutations who retain 10% of normal CFTR expression per cell generally do not develop disease. Thus, without being bound by theory, this study demonstrates that even a low percentage of transduced cells, combined with a strong promoter driving CFTR expression, is sufficient to provide significant restoration of CFTR-associated chloride current.

[0281] As demonstrated for the first time herein, the efficacy of gene therapy can be further enhanced by the clinically approved CFTR potentiator ivacaftor and ivacaftor-containing products such as TRIKAFTA.

[0282] Ivacaftor and other CFTR potentiators, as well as products containing ivacaftor (e.g., TRIKAFTA) or other potentiators, act by increasing the channel open probability. Given that the typical open probability of wild-type CFTR chloride channels is approximately 0.4, this effect may be clinically significant. Combining gene therapy with potentiators reduced the number of transduced cells required to achieve full restoration of chloride current, reducing the required MOI by approximately 1.2- to 2.0-fold. This could be of significant therapeutic and economic importance, which is surprising given the unexpected enhancement of the CFTR transgene expressed by rSIV.F / HN. Given that ivacaftor is a component of currently used modulators, there may be benefits in terms of efficacy, cost of goods, and applicability to a broad CF population.

[0283] The optimal airway cell type to target for successful CF gene therapy remains unclear, but recent studies provide some guidance. Using single-cell RNA-seq technology, we show that, with the exception of the rare cell type ionocytes, CFTR is expressed primarily by SCGB1A1+ club cells and, to a lesser extent, by basal cells, collectively accounting for approximately 80% of all CFTR+ cells. The rSIV.F / HN vector was able to transduce all of these relevant cell types in mouse lungs in vivo, providing further confirmation of sufficient transduction efficiency in human bronchial epithelial cells.

[0284] In addition to providing a novel and sustainable treatment option for a wide range of CFTR patients, including those with the most common F508del / F508del mutation, gene therapy is particularly attractive for patients harboring Class I mutations that result in the complete absence of CFTR protein and for whom no modulator treatments are currently available. To analyze the functional effects of rSIV.F / HN in Class I mutant cells, we generated novel CFTR knockout cell lines. Transduction of these cells with rSIV.F / HN again resulted in robust transgene expression in all relevant cell types and restoration of forskolin-stimulated CFTR currents to wild-type levels. As expected, none of the modulators had any effect on CFTR chloride currents. In contrast, rSIV.F / HN was able to fully restore CFTR function in a dose-dependent manner, as in F508del / F508del cells. Furthermore, as with Class II mutant cells, we observed an unexpected increase in the efficacy of ivacaftor and TRIKAFTA. These data suggest that rSIV.F / HN is a viable candidate for the treatment of patients who carry null mutations or who are insensitive to or intolerant of modulators, with the added potential for improved or optimized treatment if such patients tolerate the modulators.

[0285] We also evaluated the downstream effects of chloride current restoration through assessment of ciliary beat frequency (CBF) as a surrogate indicator of mucociliary clearance (MCC). Clinical data suggest that MMC is impaired with increasing disease severity, likely related to insufficient hydration of both mucus and the underlying airway surface liquid. The CF ALI used in this study demonstrated a reduction in ciliary beat frequency (CBF) that appears to be dependent on these two parameters, and rSIV.F / HN CFTR restored CBF to wild-type levels in F508del / F508del ALI. These findings further indicate that rSIV.F / HN CFTR may improve lung physiology in CF patients in vivo through its effects on MCC.

[0286] In conclusion, this study demonstrates high transduction efficiency in human ALI cells, resulting in complete functional correction of the chloride deficiency in CF, both in primary HBE cells derived from F508del / F508del patients and in a novel CFTR KO hSABCi cell line as a model for class I homozygous null mutations. The potentiator ivacaftor showed surprising and unexpected efficacy when combined with rSIV.F / HN. These data suggest that this lentiviral vector is a leading candidate for the treatment of CF patients, regardless of mutation class, and that combination therapy using this vector with one or more CFTR modulators, particularly potentiators such as ivacaftor or products containing ivacaftor (e.g., TRIKAFTA), is a promising option for treating CF, focusing for the first time on modulator-insensitive patients.

Claims

1. For use in methods of treating cystic fibrosis (CF), (i) A lentiviral vector pseudotyped with a hemagglutinin-neuraminidase (HN) fusion (F) protein derived from respiratory paramyxovirus, comprising a cystic fibrosis membrane conductance regulator (CFTR) transgene, (ii) CFTR modulator and The combination.

2. a. The lentiviral vector is an SIV vector, and the respiratory paramyxovirus is Sendai virus; b. The transgene is operably linked to a promoter selected from the group consisting of the cytomegalovirus (CMV) promoter, the elongation factor 1a (EF1a) promoter, and the hybrid human CMV enhancer / EF1a (hCEF) promoter; c. The lentiviral vector comprises a hybrid human CMV enhancer / EF1a(hCEF) promoter, and optionally, the hybrid human CMV enhancer / EF1a(hCEF) promoter comprises a nucleotide sequence having at least 90% identity with SEQ ID NO: 2 or consists of a nucleotide sequence having at least 90% identity with SEQ ID NO: 2; d. The CFTR transgene is a codon-optimized CFTR transgene, which optionally contains a nucleotide sequence having at least 90% identity with SEQ ID NO: 1 or consists of a nucleotide sequence having at least 90% identity with SEQ ID NO: 1; e. Lentiviral vectors are constructed using codon-optimized plasmids; f. The lentiviral vector is prepared using (i) pGM691 and / or (ii) pGM830 or pGM326; and preferably also using pGM299, pGM301 and / or pGM303; g. The lentiviral vector is vGM058, vGM195, or vGM244; h. The lentiviral vector is an SIV vector pseudotyped with the hemagglutinin-neuraminidase (HN) fusion (F) protein of Sendai virus, wherein the vector contains the nucleic acid sequence of SEQ ID NO: 16 or a modified retroviral RNA sequence consisting of the nucleic acid sequence of SEQ ID NO: 16; and / or i. The lentiviral vector comprises an F protein having a first subunit containing or consisting of the amino acid sequence of SEQ ID NO: 19, and a second subunit containing or consisting of the amino acid sequence of SEQ ID NO:

20. The combination for use described in claim 1.

3. The lentiviral vector is (a) p17 protein containing or consisting of the amino acid sequence of SEQ ID NO: 22, (b) p24 protein containing or consisting of the amino acid sequence of SEQ ID NO: 23 (c) p8 protein containing or consisting of the amino acid sequence of SEQ ID NO: 24 (d) A protease containing or consisting of the amino acid sequence of SEQ ID NO: 25 (e) p51 protein containing or consisting of the amino acid sequence of SEQ ID NO: 26, (f) p15 protein containing or consisting of the amino acid sequence of SEQ ID NO: 27 (g) p31 protein containing or consisting of the amino acid sequence of SEQ ID NO: 28, (h) Gag protein containing or consisting of the amino acid sequence of SEQ ID NO: 29, and / or (i) Pol protein containing or consisting of the amino acid sequence of SEQ ID NO: 30 It further includes, Optionally, the vector includes each of (a) to (g), A combination for use according to claim 1 or 2.

4. The CFTR modulator is a CFTR potentiator and / or a CFTR collector, preferably a CFTR potentiator. Optionally, a. The CFTR modulator is selected from ibacaftol, tezacaftol, elexacaftol, lumacaftol, or a combination thereof; and / or b. The CFTR modulator is an iBakFtol. A combination for use according to claim 1 or 2.

5. For use in a method for treating cystic fibrosis (CF), A pseudotyped SIV vector with hemagglutinin-neuraminidase (HN) and fusion (F) protein of Sendai virus, (a) The vector contains the nucleic acid sequence of SEQ ID NO: 16 or a modified retroviral RNA sequence consisting of the nucleic acid sequence of SEQ ID NO: 16, and (b) The F protein comprises a first subunit which includes or consists of the amino acid sequence of SEQ ID NO: 19, and a second subunit which includes or consists of the amino acid sequence of SEQ ID NO:

20. The aforementioned SIV vector and B. Ibakafutoru and The combination.

6. The vector is (a) p17 protein containing or consisting of the amino acid sequence of SEQ ID NO: 22, (b) p24 protein containing or consisting of the amino acid sequence of SEQ ID NO: 23 (c) p8 protein containing or consisting of the amino acid sequence of SEQ ID NO: 24 (d) A protease containing or consisting of the amino acid sequence of SEQ ID NO: 25 (e) p51 protein containing or consisting of the amino acid sequence of SEQ ID NO: 26, (f) p15 protein containing or consisting of the amino acid sequence of SEQ ID NO: 27 (g) p31 protein containing or consisting of the amino acid sequence of SEQ ID NO: 28, (h) Gag protein containing or consisting of the amino acid sequence of SEQ ID NO: 29, and / or (i) Pol protein containing or consisting of the amino acid sequence of SEQ ID NO: 30 It further includes one or two or more of the following: Optionally, the vector includes each of (a) to (g), The combination for use described in claim 5.

7. The patient to be treated has at least one class I, class II, class III, class IV, class V, or class VI CFTR mutation, Optionally, The patient being treated has at least one class I and / or class II CFTR mutation; and / or (a) The combination is suitable for use that is independent of the patient's CFTR mutation, or (b) The patient being treated, i. At least one class I CFTR mutation selected from G542X, W1282X, and / or R553C, and / or ii. Having at least one class II CFTR mutation selected from F508del, N1303K, and / or I507del, A combination for use according to claim 5 or 6.

8. a. The lentiviral vector and the CFTR modulator are administered simultaneously or sequentially; b. The lentiviral vector is administered by inhalation; c. The CFTR modulator is administered orally; d. The lentiviral vector is administered in a dose of about 88 to about 10¹⁴ transduction units (TUs), preferably about 10⁶ to about 10¹² TUs, and optionally, the lentiviral vector is administered every 3 months, every 6 months, every 12 months, every 24 months, every 36 months, or every 48 months; and / or e. The CFTR modulator is administered at or below the concentration used for monotherapy with each modulator. A combination for use according to claim 1, 2, 5, or 6.

9. a. The treatment restores CFTR activity to at least 10% of the CFTR activity in a healthy control, and optionally, the treatment restores CFTR activity to at least 50% of the CFTR activity in a healthy control; b. The treatment increases CFTR activity by at least 1.2 times compared to treatment with a lentiviral vector alone, and optionally, the treatment increases CFTR current by approximately 1.3 to 3 times, or approximately 1.3 to 1.8 times, compared to treatment with a lentiviral vector alone; c. The patient being treated has a class I CFTR mutation, and the treatment (i) restores CFTR activity to at least 10% of the CFTR activity in a healthy control, and / or (ii) increases CFTR current by approximately 1.3 to 1.8 times, or approximately 1.3 to 3 times, compared to treatment with a lentiviral vector alone; and / or d. The patient being treated has a class II CFTR mutation, and the treatment (i) restores CFTR activity to at least 10% of the CFTR activity in a healthy control, and / or (ii) increases CFTR current by approximately 1.3 to 3 times, or approximately 1.3 to 1.8 times, compared to treatment with a lentiviral vector alone; Optionally, A transduction rate of approximately 10% to approximately 20%, preferably approximately 14% to approximately 17%, is sufficient to achieve the therapeutic effect on CFTR activity described in any of a. to d. above. A combination for use according to claim 1, 2, 5, or 6.

10. The use of a lentiviral vector pseudotyped with a hemagglutinin-neuraminidase (HN) fusion (F) protein derived from a respiratory paramyxovirus in the manufacture of a pharmacopoeia for use in a method of treating CF, wherein the lentiviral vector comprises a cystic fibrosis membrane conductance regulator (CFTR) transgene, and the method further comprises the administration of a CFTR modulator.

Images