Lentiviral Vectors

Abstract

The present invention relates to lentiviral vectors encoding methylmalonic acidemia (MMA)-related polypeptides. The present invention also relates to cells and pharmaceutical compositions comprising said lentiviral vectors, and to the use of said lentiviral vectors in the treatment of methylmalonic acidemia (MMA).

Description

[Technical field]

[0001] The present invention relates to lentiviral vectors encoding methylmalonic acidemia (MMA)-related polypeptides. The present invention also relates to cells and pharmaceutical compositions comprising said lentiviral vectors, and to the use of said lentiviral vectors in the treatment of methylmalonic acidemia (MMA). [Background technology]

[0002] Methylmalonic acidemia (MMA), also known as methylmalonic aciduria, is a group of inborn errors of metabolism associated with elevated concentrations of methylmalonic acid in the blood and urine that may result from the inability to convert methylmalonyl-CoA to succinyl-CoA during propionyl-CoA metabolism in the mitochondrial matrix.

[0003] Isolated MMA (iMMA) refers to MMA with no changes in other metabolites and is characterized by the complete (mut) expression of the enzyme methylmalonyl-CoA mutase. 0 enzyme subtype) or partial (mut - It can be caused by a deficiency of MMAA, MMAB, or MMADHC; a defect in the transport or synthesis of its cofactor adenosyl-cobalamin (caused by pathogenic variants in MMAA, MMAB, or MMADHC); or a deficiency of the enzyme methylmalonyl-CoA epimerase (encoded by MCEE) (see, e.g., Manoli I, et al. 2005. Isolated Methylmalonic Acidemia. In GeneReviews).

[0004] Onset of symptoms of MMA ranges from the neonatal period to adulthood. Affected children usually present with anorexia, failure to thrive, hypotonia, developmental delay, progressive renal failure, functional immune disorders, optic atrophy, and blood abnormalities. For example, the most severe form of iMMA, mut 0Patients with MMA exhibit symptoms such as lethargy, vomiting, respiratory distress, severe ketoacidosis and hyperammonemia in the neonatal period. Patients with MMA experience significant morbidity and mortality, and the prognosis for long-term survival is poor (see, e.g., Zhou, X., et al., 2018. Intractable & rare diseases research, 7(2), pp.73-78).

[0005] Treatment of MMA typically consists of a protein-restricted diet and medical management of symptoms. Nevertheless, patients remain at risk for recurrent episodes of life-threatening metabolic crisis, as well as multi-organ disease, disability, and ultimately death (see, e.g., Fraser, JL and Venditti, CP, 2016. Current opinion in pediatrics, 28(6), pp.682-693). In particular, patients with iMMA often have earlier and more severe clinical symptoms, most of which are associated with long-term complications involving multiple organs and recurrent metabolic decompensation. Liver transplantation is currently the only effective treatment for MMA patients with recurrent metabolic decompensation (see, e.g., Jiang, YZ and Sun, LY, 2019. Frontiers in Pediatrics, 7, p.87). Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, new approaches to treating or preventing MMA, such as iMMA, are needed.

[0007] A lentiviral vector encoding methylmalonyl-CoA mutase is described in Wong, ES, et al., 2014. Human gene therapy, 25(6), pp.529-538. To test the lentiviral vector, Wong et al. - / - MUT h2Mice are used, which have knockout of mouse MUT, but express two copies of human MUT, and therefore show mild phenotype. These mice are transgenic for human MUT, so they are immune-tolerant to human MUT, and therefore the possible immune response caused by lentiviral gene transfer cannot be properly evaluated. Such immune response is a well-established problem in lentiviral gene therapy (see, for example, VandenDriessche, T., et al., 2007. Journal of Thrombosis and Haemostasis, 5(1), pp.16-24). [Means for solving the problem]

[0008] The present inventors have developed a gene therapy for treating and / or preventing MMA, such as iMMA. The lentiviral vector-mediated gene therapy described herein allows stable gene transfer even in pediatric patients at the earliest stages of the disease through lentiviral vector genome integration, thus alleviating symptoms and limiting progressive damage to hepatocytes.

[0009] The present inventors have surprisingly demonstrated that the lentiviral vector-mediated gene therapy described herein is safe and effective in a model of MMA. The present inventors have produced a lentiviral vector encoding a human codon-optimized MMUT coding sequence under the control of a hepatocyte-specific cassette. Administration of the lentiviral vector results in a significant reduction in serum methylmalonic acid, indicating an improvement in amino acid metabolism.

[0010] Immuno-shielded lentiviral vectors can reduce immune response after administration, so that there is no loss of therapeutic effect over time. By targeting transgene expression to hepatocytes (e.g., using one or more miRNA target sequences and / or hepatocyte-specific promoters), immune response can be reduced in the background of MUT knockout mice without the expression of human transgenes. In contrast, as mentioned above, Wong et al. administered lentiviral vectors to mice that are transgenic for human MUT and therefore immune-tolerant to the expression of human transgenes.

[0011] Furthermore, the present inventors have demonstrated that the lentiviral vector of the present invention is effective in juveniles. The present inventors have shown stable therapeutic effects (e.g., significant reduction in circulating MMA) up to 12 months after gene therapy after administration to young mice (2 weeks old) where hepatocyte proliferation is occurring. Even with integrating vectors, stable therapeutic effects in juveniles are not always expected. If the integrating vector does not transduce hepatocytes responsible for generating adult liver after growth and / or there is counter-selection of corrected hepatocytes, stable therapeutic effects may not be obtained. In contrast, Wong et al. treated adult mice.

[0012] Thus, in contrast to Wong et al., the present inventors have demonstrated that the lentiviral vectors of the present invention are effective in juveniles, a model that exhibits a more severe phenotype and is not immune tolerant to the expression of a human transgene.

[0013] In one aspect, the present invention provides a lentiviral vector comprising a nucleotide sequence encoding a methylmalonic acidemia (MMA)-related polypeptide. The lentiviral vector may be an immunoshielded lentiviral vector.

[0014] The MMA-related polypeptide may be selected from methylmalonyl-CoA mutase (MMUT) or a fragment thereof, methylmalonic aciduria type A (MMAA) or a fragment thereof, methylmalonic aciduria type B (MMAB) or a fragment thereof, methylmalonic aciduria and homocystinuria type D (MMADHC) or a fragment thereof, and methylmalonyl-CoA epimerase (MCEE) or a fragment thereof. In a preferred embodiment, the MMA-related polypeptide is MMUT or a fragment thereof.

[0015] Suitably, the MMA-related polypeptide comprises or consists of an amino acid sequence that is at least 70% identical to one of SEQ ID NOs: 37, 40, 42, 44, or 46, or a fragment thereof. In some embodiments, the MMA-related polypeptide comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 37, or a fragment thereof.

[0016] Suitably, the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence that is at least 70% identical to one of SEQ ID NOs: 38, 39, 41, 43, 45 or 47, or a fragment thereof. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence that is at least 70% identical to one of SEQ ID NOs: 38 or 39, or a fragment thereof. Suitably, the nucleotide sequence encoding the MMA-related polypeptide is codon-optimized. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 39, or a fragment thereof.

[0017] Lentiviral vectors target CD47 high It may be a lentiviral vector. Preferably, the lentiviral vector is a vector that expresses CD47 highThe lentiviral vector is derived from a host cell, preferably the host cell is genetically engineered to increase expression of CD47 on the cell surface. Suitably, the lentiviral vector has at least about two times more CD47 on its surface than a lentiviral vector derived from a non-modified host cell.

[0018] Lentiviral vectors target MHC-I free The vector may be a lentiviral vector. Preferably, the lentiviral vector is a vector that binds MHC-I free Obtained from host cell, preferably host cell is genetically engineered to destroy the expression of MHC-I on cell surface.Preferably, lentiviral vector has less than about 50% of the number of MHC-I molecules exposed on the surface that is displayed on lentiviral vector obtained from non-modified host cell.Preferably, MHC-I is not detectable on the surface of lentiviral vector.

[0019] Lentiviral vectors target CD47 high / MHC-I free It may be a lentiviral vector. Preferably, the lentiviral vector is a vector that expresses CD47 high / MHC-I free Preferably, the lentiviral vector has at least about two times more CD47 on its surface than a lentiviral vector obtained from a non-modified host cell, and MHC-I is not detectable on the surface of the lentiviral vector.

[0020] The nucleotide sequence encoding the MMA-related polypeptide may be operably linked to one or more miRNA target sequences. In some embodiments, the one or more miRNA target sequences repress transgene expression in one or more cells other than hepatocytes. In some embodiments, the one or more miRNA target sequences repress transgene expression in hematopoietic lineage cells and / or antigen-presenting cells.

[0021] In some embodiments, the one or more miRNA target sequences are selected from miR-181, miR-142, miR-223, and miR-155 target sequences. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to one or more mir-142 target sequences, two or more mir-142 target sequences, three or more mir-142 target sequences, or four or more mir-142 target sequences. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to four mir-142 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of a nucleotide sequence that is at least 90% identical to SEQ ID NO:17. In some embodiments, the one or more miRNA target sequences comprise or consist of a nucleotide sequence that is at least 90% identical to SEQ ID NO:18.

[0022] The nucleotide sequence encoding the MMA-related polypeptide may be operably linked to a liver-specific promoter. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to a hepatocyte-specific promoter. Suitably, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to a transthyretin (TTR) promoter, an alpha-1-antitrypsin (AAT) promoter, a thyroxine-binding globulin (TBG) promoter, an APoE / hAAT promoter, an HCR-hAAT promoter, an LP1 promoter, or an HLP promoter. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to a transthyretin (TTR) promoter. In a preferred embodiment, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to an Enh1mTTR (ET) promoter. In some embodiments, the nucleotide sequence encoding the MMA-related polypeptide is operably linked to a promoter comprising or consisting of a nucleotide sequence at least 70% identical to SEQ ID NO:19.

[0023] The lentiviral vector may be pseudotyped. Suitably, the lentiviral vector is VSV.G pseudotyped. The lentiviral vector may be a self-inactivating (SIN) lentiviral vector. Suitably, the lentiviral vector comprises a self-inactivating (SIN) LTR comprising or consisting of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 23 or a fragment thereof. The lentiviral vector may be an integrating lentiviral vector and / or a replication-defective lentiviral vector. The lentiviral vector may be derived from HIV.

[0024] In some embodiments, the lentiviral vector comprises a nucleotide sequence that is at least 70% identical to SEQ ID NO:36.

[0025] In one aspect, the invention provides a method for producing a lentiviral vector according to the invention.

[0026] In one aspect, the invention provides a kit or system for producing the lentiviral vector of the invention.

[0027] In one aspect, the present invention provides a cell comprising a lentiviral vector according to the invention. The cell may be an isolated cell.

[0028] In one aspect, the invention provides a pharmaceutical composition comprising a lentiviral vector or a cell according to the invention in combination with a pharma- ceutically acceptable carrier, diluent or excipient.

[0029] In one aspect, the present invention provides a lentiviral vector, a cell, or a pharmaceutical composition according to the present invention for use as a medicament.

[0030] In one aspect, the invention provides the use of a lentiviral vector, a cell, or a pharmaceutical composition according to the invention for the manufacture of a medicament.

[0031] In one aspect, the present invention provides a method comprising the step of administering a therapeutically effective amount of a lentiviral vector, a cell, or a pharmaceutical composition according to the present invention to a subject in need thereof.

[0032] In one aspect, the invention provides a lentiviral vector, a cell, or a pharmaceutical composition according to the invention for use in the prevention or treatment of methylmalonic acidemia (MMA), such as isolated MMA (iMMA).

[0033] In one aspect, the invention provides the use of a lentiviral vector, a cell, or a pharmaceutical composition according to the invention for the manufacture of a medicament for preventing or treating methylmalonic acidemia (MMA), such as isolated MMA (iMMA).

[0034] In one aspect, the present invention provides a method for preventing or treating methylmalonic acidemia (MMA), such as isolated MMA (iMMA), comprising the step of administering a therapeutically effective amount of a lentiviral vector, cell, or pharmaceutical composition according to the present invention to a subject in need thereof.

[0035] Suitably, the MMA-related polypeptide is MMUT or a fragment thereof and the MMA is mutated MMA (mut-MMA); the MMA-related polypeptide is MMAA or a fragment thereof and the MMA is cblA MMA (cblA-MMA); the MMA-related polypeptide is MMAB or a fragment thereof and the MMA is cblB MMA (cblB-MMA); the MMA-related polypeptide is MMADHC or a fragment thereof and the MMA is cblD MMA (cblD-MMA); or the MMA-related polypeptide is MCEE or a fragment thereof and the MMA is due to a MCEE deficiency. In a preferred embodiment, the MMA-related polypeptide is MMUT or a fragment thereof and the MMA is mutated MMA.

[0036] The lentiviral vectors, cells, or pharmaceutical compositions may be administered to any subject in need thereof. In some embodiments, the subject is a human subject. In some embodiments, the subject is a juvenile. In some embodiments, the subject is a pediatric patient. In some embodiments, the subject is a neonatal or infant patient.

[0037] The lentiviral vector, cell, or pharmaceutical composition may be administered by any suitable route. In some embodiments, the lentiviral vector, cell, or pharmaceutical composition is administered systemically (e.g., by intravenous or intraperitoneal injection). In some embodiments, the lentiviral vector, cell, or pharmaceutical composition is administered locally (e.g., by direct injection, intraarterial injection, or intraportal injection). In some embodiments, the lentiviral vector, cell, or pharmaceutical composition is administered locally to the liver (e.g., by intrahepatic injection, intrahepatic arterial injection, or intraportal injection).

[0038] The lentiviral vector, cell, or pharmaceutical composition may be administered at any suitable dose. In some embodiments, the lentiviral vector is administered at a dose of at least about 10 8 TU / kg, at least about 10 9 TU / kg, or at least about 10 10 In some embodiments, the lentiviral vector is administered at a dose of about 10 8 ~about 10 11 TU / kg, approx. 10 8 ~about 10 10 TU / kg, or about 10 9 ~about 10 10 It is given in a dose of TU / kg.

[0039] The lentiviral vector can be integrated into the genome of liver cells and maintained as liver cells replicate. Advantageously, the lentiviral vector is integrated into the genome of hepatocytes and maintained as hepatocytes replicate.

[0040] Following administration, the subject's plasma and / or urinary methylmalonic acid levels may be reduced and / or normalized, and / or the subject's mitochondrial function may be improved.

[0041] In one aspect, the invention provides an immunoshielded lentiviral vector for use in a method of treatment.In one aspect, the invention provides a cell for use in a method of treatment, the cell comprising an immunoshielded lentiviral vector.

[0042] In one aspect, the present invention provides the use of an immunoshielded lentiviral vector for the manufacture of a medicament for the treatment or prevention of a disease.In one aspect, the present invention provides the use of a cell, wherein the cell comprises an immunoshielded lentiviral vector, for the manufacture of a medicament for the treatment or prevention of a disease.

[0043] In one aspect, the invention provides a method of treatment comprising administering to a subject an immune-shielded lentiviral vector.In one aspect, the invention provides a method of treatment comprising administering to a subject a cell, the cell comprising an immune-shielded lentiviral vector.

[0044] In one aspect, the invention provides an immunoshielded lentiviral vector for use in a method of treatment, the method comprising administering the immunoshielded lentiviral vector to a juvenile or pediatric subject.In one aspect, the invention provides a cell for use in a method of treatment, the cell comprising an immunoshielded lentiviral vector, the method comprising administering the cell to a juvenile or pediatric subject.

[0045] In one aspect, the present invention provides the use of an immunoshielded lentiviral vector for the manufacture of a medicament for the treatment or prevention of a disease, wherein the treatment or prevention comprises administration of the immunoshielded lentiviral vector to a juvenile or pediatric subject.In one aspect, the present invention provides the use of a cell for the manufacture of a medicament for the treatment or prevention of a disease, wherein the cell comprises an immunoshielded lentiviral vector and the treatment or prevention comprises administration of the cell to a juvenile or pediatric subject.

[0046] In one aspect, the invention provides a method of treatment comprising administering an immune-shielded lentiviral vector to a juvenile or pediatric subject.In one aspect, the invention provides a method of treatment comprising administering a cell to a juvenile or pediatric subject, the cell comprising an immune-shielded lentiviral vector.

[0047] In one aspect, the invention provides an immunoshielded lentiviral vector for use in a method of treatment of a juvenile or pediatric subject.In one aspect, the invention provides a cell for use in a method of treatment of a juvenile or pediatric subject, the cell comprising an immunoshielded lentiviral vector.

[0048] In one aspect, the invention provides the use of an immunoshielded lentiviral vector for the manufacture of a medicament for the treatment or prevention of a disease in a juvenile or pediatric subject.In one aspect, the invention provides the use of a cell, wherein the cell comprises an immunoshielded lentiviral vector, for the manufacture of a medicament for the treatment or prevention of a disease in a juvenile or pediatric subject.

[0049] In one aspect, the invention provides a method of treating a juvenile or pediatric subject, the method comprising administering an immunoshielded lentiviral vector to a juvenile or pediatric subject in need thereof.In one aspect, the invention provides a method of treating a juvenile or pediatric subject, the method comprising administering a cell to a juvenile or pediatric subject in need thereof, the cell comprising an immunoshielded lentiviral vector.

[0050] In some embodiments, the subject is a neonatal subject or an infant subject.

[0051] In some embodiments, the method comprises transducing liver cells with an immune-shielded lentiviral vector. In some embodiments, the method comprises transducing hepatocytes with an immune-shielded lentiviral vector.

[0052] In some embodiments, the therapy, treatment or prevention is treatment or prevention of methylmalonic acidemia (MMA).

[0053] In some embodiments, the immunoshielded lentiviral vector comprises a nucleotide sequence encoding a methylmalonic acidemia (MMA) associated polypeptide. [Brief description of the drawings]

[0054] [Figure 1-1]Design and testing of lentiviral vectors (LV) encoding the MUT transgene. (a) Schematic diagram of third generation lentiviral vectors (provirus). LTR, long terminal repeat: 5'LTR and 3'LTR each have a near-complete deletion of the U3 region (ΔU3); ψ, psi packaging sequence; RRE, Rev response element; cPPT, central polypurine tract; ET, enhanced transthyretin promoter; MUT wt / co, MUT coding sequence (wild-type or codon-optimized); WPRE, posttranscriptional element from the genome of woodchuck hepatitis virus; 4×mir142T, four copies of tandem miR-142 target sequence. (b) Western blot analysis of MUT in Huh7 cells transduced with LV-ET.MUTwt or LV-ET.MUTco. kDa, molecular weight marker; Ctrl, non-transduced cells. (c) Western blot analysis of MUT in Huh7 cells with LV-hAAT.MUTwt or LV-hAAT.MUTco. kDa, molecular weight marker. (d) MUT protein expression determined by WB densitometry analysis and normalized to vector copy number (VCN) in Huh7 transduced with LV-ET.MUTwt / co at various MOIs. (e) MUT protein expression determined by WB densitometry analysis and normalized to vector copy number (VCN) in Huh7 transduced with LV-hAAT.MUTwt / co at various MOIs. (f) MUT protein expression determined by WB densitometry analysis and normalized to GAPDH housekeeping gene in Huh7 cells transduced with LV-ET.BSEPco_1 or LV-hAAT.BSEPco_1. [Figure 1-2] Figure 1-1 continued [Figure 1-3] Figure 1-1 continued [Figure 2-1]In vivo gene transfer with LV-ET.MUT. (a) Vector copy number per cell (VCN / cell) in livers of C57Bl / 6 mice treated with LV-ET.MUTwt or LV-ET.MUTco. (b) MUT mRNA measured as WPRE normalized to HPRT expression in mice treated with LV-ET.MUTwt or LV-ET.MUTco. (c) Western blot analysis of MUT in liver samples from C57Bl / 6 mice treated with LV-ET.MUTwt or LV-ET.MUTco. (d) MUT protein expression determined by WB densitometry analysis and normalized to beta-actin housekeeping gene in Huh7 cells transduced with LV-ET.MUTco or LV-hAAT.MUTco. UT, untreated mice. [Figure 2-2] Figure 2-1 continued [Figure 3-1] Evaluation of long-term LV gene therapy in MCK-Mut- / - mice. (a) Percentage MCK-Mut survival over time. [Mantel-Cox test p=0.0033]. (b) Measurement of MCK-Mut weight (grams) over time. ****p<000.1 by two-way ANOVA comparing MCK-Mut- / - + LV with MCK-Mut- / - group. (c) Measurement of blood methylmalonic acid (MMA) in MCK-Mut mice over time. Student's t-test for data 50 weeks after LV, p=0.00029 MCK-Mut- / - + LV vs. MCK-Mut- / -. (d) Measurement of serum FGF-21 biomarker. Multiple comparisons of experimental groups were performed by one-way ANOVA. MCK-Mut- / -, untreated KO; MCK-Mut- / - +LV, KO animals treated with LV-ET.MUTwt; MCK-Mut+ / -, heterozygous control animals (phenotypically normal). [Figure 3-2] Figure 3-1 continued [Figure 4]Vector copy number and MUT protein expression in livers of MCK-Mut- / -treated mice 12 months after LV administration. (a) Vector copy number per cell (VCN / cell) assessed in liver, (b) MUT mRNA measured as WPRE normalized to HPRT expression, and (c) Western blot analysis of MUT in liver samples from MCK-Mut mice 12 months after LV administration. KO+LV, KO animals treated with LV-ET.MUT; WT, phenotypically normal animals; KO, untreated KO (MCK-Mut- / -). [Diagram 5] Liver transduction efficiency and histopathology in MCK-Mut- / - treated mice 6 months after LV administration. (a) RNA in situ hybridization performed on liver tissue sections using a probe against the WPRE element. (b) Image quantification of liver transduction area in MCK-Mut- / - mice treated with LV-ET.MUT. (c) Liver histopathology images. KO+LV, KO animals treated with LV-ET.MUT; WT, phenotypically normal animals; KO, untreated KO (MCK-Mut- / -). [Figure 6-1] Amelioration of hepatic mitochondrial disease in MCK-Mut- / - mice. (a) Example electron microscopy images of liver samples. (b-d) Image quantification of mitochondrial shape measured as (b) mitochondrial area, (c) mitochondrial perimeter, and (d) circularity index [2-way ANOVA, p<0.0001****]. (e) Quantification of methylmalonic acid (hepatic MMA) in liver tissue. [1-way ANOVA, p<0.0001****]. KO+LV, KO animals treated with LV-ET.MUT; WT, phenotypically normal animals; KO, untreated KO (MCK-Mut- / -). [Figure 6-2] Figure 6-1 continued [Figure 7-1]Amelioration of kidney mitochondrial disease in MCK-Mut- / - mice. (a) Example electron microscopy images of kidney samples. (b) Image quantification of ring structures [two-way ANOVA, p<0.0001****]. (c) Quantification of methylmalonic acid (kidney MMA) in kidney tissue. [Kruskal-Wallis multiple comparison test, p=0.04*]. KO UT, untreated KO (MCK-Mut- / -); KO+LV, KO animals treated with LV-ET.MUT; WT, phenotypically normal animals. [Figure 7-2] Figure 7-1 continued [Figure 8] Reduction of brain MMA in MCK-Mut- / - treated mice. (a) Example electron microscopy images of brain samples. Quantification of methylmalonic acid (brain MMA) in the brain. [Kruskal-Wallis multiple comparison test, p=0.02*]. KO UT, untreated KO (MCK-Mut- / -); KO+LV, KO animals treated with LV-ET.MUT; WT, phenotypically normal animals. [Figure 9] In vivo gene therapy with CD47high / MHC-free LV.MUTwt. (a) Measurement of MCK-Mut weight (grams) over time. (b) Measurement of blood methylmalonic acid (MMA) in MCK-Mut mice over time. KO UT, untreated KO (MCK-Mut- / -); KO+LV, KO animals treated with CD47high / MHC-Ifree LV.MUTwt; WT, phenotypically normal animals. [Figure 10] Comparison of in vivo gene therapy with LV.MUTwt and LV.MUTco at matched LV dose of 2.5E10TU / kg. (a) Measurement of MCK-Mut weight (grams) over time. (b) Measurement of blood methylmalonic acid (MMA) in MCK-Mut mice over time. KO UT, untreated KO (MCK-Mut- / -); KO+LV.MUT, KO animals treated with LV-ET.MUTwt; KO+LV.MUTco, KO animals treated with LV-ET.MUTco; WT, phenotypically normal animals. [Figure 11-1]Design and testing of lentiviral vectors (LV) encoding the BSEP transgene. (a) Schematic diagram of third generation lentiviral vectors (provirus). LTR, long terminal repeat: 5'LTR and 3'LTR each have a near-complete deletion of the U3 region (ΔU3); ψ, psi packaging sequence; RRE, Rev response element; cPPT, central polypurine tract; ET, enhanced transthyretin promoter; BSEP wt / co, BSEP coding sequence (wild type or codon optimized); WPRE, posttranscriptional element from the genome of woodchuck hepatitis virus; 4×mir142T, four copies of tandem miR-142 target sequence. (b) Flow cytometry analysis of Huh7 cells transduced with LV-ET.BSEPwt, LV-ET.BSEPco_1 or LV-ET.BSEPco_2 at various MOIs. UT, non-transduced Huh7 cells. MFI, mean fluorescence intensity. (c) Histogram reporting vector copy number (VCN) per cell (VCN / cell) in Huh7 transduced with LV-ET.BSEPwt, LV-ET.BSEPco_1 or LV-ET.BSEPco_2 at various MOIs. (d) Histogram reporting vector copy number (VCN) per cell (VCN / cell) in Huh7 transduced with LV-ET.BSEPco_1 or LV-hAAT.BSEPco_1 at various MOIs. (e) Western blot analysis of BSEP protein expression on Huh7 cell lysates. UT, non-transduced Huh7; hAAT, cells transduced with LV-hAAT.BSEPco; ET, cells transduced with LV-ET.BSEPco. (f) BSEP protein expression determined by WB densitometry analysis and normalized to the GAPDH housekeeping gene in Huh7 cells transduced with LV-ET.BSEPco or LV-hAAT.BSEPco. [Figure 11-2] Figure 11-1 continued [Figure 11-3] Figure 11-1 continued [Figure 11-4] Figure 11-1 continued [Figure 12]Immunofluorescence analysis of LV-ET.BSEPco_1 in transduced Huh7 cells. Top left panel, Huh7 cells transduced with LV-ET.BSEPco_1 and stained with Hoechst. Top right panel, non-transduced (Cntrl-) Huh7 cells stained with Hoechst. Bottom left panel, Huh7 cells transduced with LV-ET.BSEPco_1 and stained with anti-BSEP antibody. Bottom right panel, non-transduced (Cntrl-) Huh7 cells stained with anti-BSEP antibody. [Figure 13-1] Evaluation of LV gene therapy in Abcb11- / - mice. (a) Serum bile acids in Abcb11- / - animals treated with LV-ET.BSEPco (KO+LV) compared to Abcb11- / - untreated animals (KO UT) and WT untreated animals (WT UT). (b) Serum total bilirubin in Abcb11- / - animals treated with LV-ET.BSEPco (KO+LV) compared to Abcb11- / - untreated animals (KO UT). The dotted line indicates the upper limit of bilirubin levels (mg / dL) measured in WT control mice. (c) Serum alkaline phosphatase (ALP) levels (IU / L) in Abcb11- / - animals treated with LV-ET.BSEPco (KO+LV) compared to Abcb11- / - untreated animals (KO UT) and WT untreated animals (WT UT). The dotted line indicates the upper limit of ALP levels measured in a cohort of WT control mice. [Figure 13-2] Figure 13-1 (continued) [Figure 14-1]Design and testing of lentiviral vectors (LV) encoding the BSEP transgene. (a) Schematic diagram of third generation lentiviral vectors (provirus). LTR, long terminal repeat: 5'LTR and 3'LTR each have a near-complete deletion of the U3 region (ΔU3); ψ, psi packaging sequence; RRE, Rev response element; cPPT, central polypurine tract; ET, enhanced transthyretin promoter; DBT wt / co, DBT coding sequence (wild type or codon optimized); WPRE, posttranscriptional element from the genome of woodchuck hepatitis virus; 4×mir142T, four copies of tandem miR-142 target sequence. (b) Western blot analysis of DBT in Huh7 cells transduced with LV-ET-DBTwt or LV-ET-DBTco. kDa, molecular weight marker; Ctrl, non-transduced cells. (c) Western blot analysis of DBT in Huh7 cells transduced with LV-hAAT-DBTwt or LV-hAAT-DBTco. kDa, molecular weight marker; Ctrl, non-transduced cells. (d) DBT protein expression determined by WB densitometry analysis and normalized to vector copy number (VCN) in Huh7 cells transduced with LV-ET.DBTwt / co at various MOIs. (e) VCN in Huh7 cells transduced with LV-hAAT.DBTwt / co at various MOIs. (f) DBT protein expression determined by WB densitometry analysis and normalized to GAPDH housekeeping gene in Huh7 cells transduced with LV-ET.DBTwt / co or LV-hAAT.DBTwt / co. [Figure 14-2] Figure 14-1 (continued) [Figure 14-3] Figure 14-1 (continued) [Figure 14-4] Figure 14-1 (continued) [Figure 15-1]In vivo gene transfer with LV-ET.DBT. (a) Vector copy number (VCN) in livers of C57Bl / 6 WT mice administered LV-ET.DBTwt or LV-ET.DBTco LV. (b) DBT mRNA normalized to HPRT expression in mice treated with LV-ET.DBTwt or LV-ET.DBTco. UT, untreated mice. (c) Western blot analysis of DBT in liver samples from C57Bl / 6 mice treated with LV-ET.DBTwt or LV-ET.DBTco. (d) DBT protein expression determined by WB densitometry analysis and normalized to the β-actin housekeeping gene. [Figure 15-2] Figure 15-1 (continued) [Figure 16-1] Evaluation of LV gene therapy in iMSUD mice. (a) Survival of iMSUD mice treated with LV-ET.DBTco (KO+LV) compared to iMSUD untreated (KO UT) and WT control littermates (WT). ****p<0.0001, log-rank test. (b) Branched chain amino acid levels normalized to alanine (BCAA / Ala) in iMSUD mice treated with LV-ET.DBTco (KO+LV) compared to iMSUD untreated (KO UT) and WT control littermates (WT). (c) Alloisoleucine (μM) in iMSUD mice treated with LV-ET.DBTco (KO+LV) compared to iMSUD untreated (KO UT) and WT control littermates (WT). [Figure 16-2] Figure 16-1 (continued) DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0055] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0056] The terms "comprising," "comprises," and "comprised of," as used herein, are synonymous with "including," "includes," or "containing," "contains," and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps. The terms "comprising," "comprises," and "comprised of" also include the term "consisting of."

[0057] Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, any nucleic acid sequence is written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

[0058] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that any publication constitutes prior art to the claims appended hereto.

[0059] A person skilled in the art understands that he can combine all features of the invention disclosed herein without departing from the scope of the invention disclosed.

[0060] Lentiviral Vectors In one aspect, the present invention provides a lentiviral vector comprising a protein coding sequence, wherein the protein coding sequence is a nucleotide sequence encoding a methylmalonic acidemia (MMA) associated polypeptide.

[0061] "Lentiviral vector" may refer to an enveloped lentiviral genome (i.e., lentiviral particle). For example, the pharmaceutical composition of the present invention preferably comprises a lentiviral vector in the form of a lentiviral particle, and the lentiviral vector is preferably administered in the form of a lentiviral particle. In other embodiments, "lentiviral vector" may comprise a lentiviral genome, and optionally, the lentiviral genome is enveloped. As used herein, "lentiviral genome" may refer to a genome that comprises at least one element that is obtained or obtainable from a lentiviral genome. Advantageously, the lentiviral genome comprises at least one element that is involved in the mechanism by which lentivirus infects cells, expresses genes, and / or replicates.

[0062] Lentiviruses are a genus of retroviruses that contain an RNA genome that is converted to DNA in transduced cells by virally encoded reverse transcriptase. Lentiviral vectors can transduce a wide range of cell types and integrate into the host genome in both dividing and postmitotic cells, resulting in long-term expression of protein-coding sequences both in vitro and in vivo (see, for example, Tiscornia, G., et al., 2006. Nature protocols, 1(1), pp.241-245).

[0063] The basic genes required for lentivirus survival and function are the gag, pol, and env genes: gag encodes structural proteins; pol encodes enzymes required for reverse transcription and integration into the host cell genome; env encodes viral envelope glycoproteins (see, e.g., Milone, MC and O'Doherty, U., 2018. Leukemia, 32(7), pp.1529-1541). Lentiviruses may also have additional cis-acting elements, such as the rev response element (RRE), which allows efficient transport of integrated proviral RNA transcripts from the nucleus to the cytoplasm of infected target cells; the retroviral psi packaging element, which is involved in regulating the essential process of packaging retroviral RNA genomes into viral capsids during replication; the primer binding site (PBS), where reverse transcription is initiated; the TAT activation region (TAR); splice donor and acceptor sites; and central and terminal polypurine tracts, which allow initiation of plus-strand synthesis.

[0064] In lentiviral genomes, these elements are typically flanked at both ends by regions called long terminal repeats (LTRs). LTRs are responsible for integration and transcription. LTRs may also function as enhancer-promoter sequences and can control the expression of lentiviral genes. The LTRs themselves are typically identical or nearly identical sequences that can be divided into three regions: U3, R, and U5. LTRs may be naturally occurring or modified. For example, modifications of U3 and U5 are described in Iwakuma, T., et al., 1999. Virology, 261(1), pp.120-132.

[0065] The lentiviral vector of the present invention may comprise a minimal lentiviral genome. As used herein, "minimal lentiviral genome" may mean that the lentiviral genome has been engineered to remove non-essential elements and retain essential elements to provide the functionality required to infect, transduce, and deliver a nucleotide sequence of interest to a target host cell (see, for example, Kim, VN, et al., 1998. Journal of virology, 72(1), pp.811-816 and Sertkaya, H., et al., 2021. Scientific reports, 11(1), pp.1-15).

[0066] The lentiviral genome may comprise, from 5' to 3', a 5'LTR, one or more lentiviral derived cis-acting elements, and a 3'LTR. Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, an RRE, and a 3'LTR. Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, a retroviral psi packaging element ... a cPPT, and a 3'LTR. Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, a PBS, a retroviral psi packaging element, an RRE, a cPPT, and a 3'LTR.

[0067] The lentiviral genome may further comprise a protein coding sequence, and optionally one or more regulatory elements (e.g., operably linked to the protein coding sequence). Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, an RRE, a protein coding sequence, and a 3'LTR. Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, a retroviral psi packaging element, an RRE, a protein coding sequence, and a 3'LTR. Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, a retroviral psi packaging element, an RRE, a protein coding sequence, and a 3'LTR. Preferably, the lentiviral genome may comprise, from 5' to 3', a 5'LTR, a retroviral psi packaging element, an RRE, a cPPT, a protein coding sequence, and a 3'LTR.

[0068] The lentiviral vector of the present invention may be replication-deficient. Typically, at least a part of one or more protein coding regions essential for replication may be removed from the lentiviral genome. This makes the lentiviral vector "replication-deficient" or "replication-incompetent". Preferably, one or more of the gag, pol, rev and env genes are (at least partially) deleted in the replication-deficient lentiviral vector. Preferably, each of the gag, pol, rev and env genes is (at least partially) deleted in the replication-deficient lentiviral vector. Optionally, the lentiviral vector lacks functional gag-pol and / or env genes and / or other genes essential for replication.

[0069] The lentiviral vector of the present invention may be derived from any lentivirus. As used herein, "lentivirus-derived" or "lentivirus-based" may mean that the lentivirus genome comprises one or more elements from said lentivirus. For example, the coding region of viral protein may be deleted, but one or more cis-acting elements may be retained from said lentivirus.

[0070] Lentiviral vectors may be derived from primate lentiviruses. Examples of "primate" lentiviruses include, but are not limited to, human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). Lentiviral vectors may be derived from non-primate lentiviruses (i.e., lentiviruses that do not primarily infect primates, especially humans). Examples of "non-primate" lentiviruses include, but are not limited to, the prototype "slow virus" Visna / Maedi virus (VMV), Caprine Arthritis-Encephalitis Virus (CAEV), Equine Infectious Anemia Virus (EIAV), Feline Immunodeficiency Virus (FIV), and Bovine Immunodeficiency Virus (BIV).

[0071] Suitably, the lentiviral vector of the present invention is an HIV-derived lentiviral vector. As used herein, "HIV-derived" or "HIV-based" may mean that the lentiviral genome comprises one or more elements from HIV. For example, the coding region of an HIV viral protein may be deleted, and one or more HIV cis-acting elements may be retained in the lentiviral genome (see, for example, Johnson, NM, et al., 2021. Molecular Therapy-Methods & Clinical Development, 21, pp.451-465). The HIV-derived lentiviral genome may comprise, from 5' to 3', a 5'LTR, one or more HIV-derived cis-acting elements (e.g., RRE and / or cPPT), and a 3'LTR.

[0072] Advantageously, the lentiviral vector of the present invention is an HIV-1 derived lentiviral vector. Prototypic lentiviral vector systems are based on HIV-1 (see, for example, Merten, OW, et al., 2016. Molecular Therapy-Methods & Clinical Development, 3, p.16017). It has been shown that sequences extending into the gag open reading frame may be important for HIV-1 packaging. Thus, HIV-1 vectors often contain relevant portions of gag in which the translation initiation codon is mutated. In addition, HIV-1 vectors often also contain a portion of the env gene, including the RRE. Rev binds to the RRE, which allows the transport of full-length or single-spliced ​​mRNA from the nucleus to the cytoplasm. In the absence of rev and / or RRE, full-length HIV-1 RNA may accumulate in the nucleus. Alternatively, constitutive transport elements from certain simple retroviruses, such as the Mason-Pfizer monkey virus, can be used to alleviate the need for rev and RRE. An HIV-1 derived lentiviral genome can include, from 5' to 3', a 5'LTR, one or more HIV-1 derived cis-acting elements (eg, PBS, retroviral psi packaging element, RRE and / or cPPT), and a 3'LTR.

[0073] The lentiviral vector of the present invention may be a self-inactivating lentiviral vector. As used herein, a "self-inactivating" or "SIN" lentiviral vector may comprise a lentiviral genome in which lentiviral enhancer and promoter sequences have been deleted (see, for example, Zufferey, R., et al., 1998. Journal of virology, 72(12), pp.9873-9880 and Miyoshi, H., et al., 1998. Journal of virology, 72(10), pp.8150-8157). SIN lentiviral vectors can be generated and transduce non-dividing cells in vivo with potency similar to that of wild-type vectors. Transcriptional inactivation of the long terminal repeats (LTRs) in the SIN provirus may prevent recruitment by replication-competent viruses. This may also allow regulated expression of genes from internal promoters by eliminating any cis-acting effect of LTRs.

[0074] The lentiviral vector of the present invention may be integrative.As used herein, "integrative" lentiviral vector can be integrated into the genome of host cell.In contrast to integrative lentiviral vector, integration-defective lentiviral vector can be produced, for example, by packaging lentiviral vector with catalytically inactive integrase (for example, HIV integrase with D64V mutation at catalytic site), or by modifying or deleting essential att sequence from lentiviral genome LTR, or by the above combination (for example, see Wanisch, K. and Yanez-Munoz, RJ, 2009.Molecular Therapy, 17(8), pp.1316-1332).

[0075] The lentiviral vector of the present invention may be replication-deficient and integrating. The lentiviral vector of the present invention may be replication-deficient, integrating, and self-inactivating. The lentiviral vector of the present invention may be replication-deficient, integrating, self-inactivating, and derived from HIV.

[0076] The lentiviral vector of the present invention may be a lentiviral particle. "Lentiviral particle" may refer to enveloped lentiviral genome. Lentiviral particles can be produced by co-transfecting a plasmid (e.g., "transfer vector") containing a lentiviral genome with a helper plasmid (e.g., "packaging vector" encoding gag-pol and / or rev, and "envelope vector" encoding env) into a host cell, and then harvesting the lentivirus-containing supernatant.

[0077] The lentiviral vector of the present invention may be pseudotyped. Pseudotyped lentiviral vectors using naturally occurring or engineered lentiviral envelopes can allow targeted transduction of specific cell types (see, for example, Joglekar, AV and Sandoval, S., 2017. Human Gene Therapy Methods, 28(6), pp.291-301). Advantageously, lentiviral vectors are pseudotyped to allow transduction of liver cells (e.g., hepatocytes).

[0078] The lentiviral vector of the present invention may be pseudotyped with VSV-G. Vesicular stomatitis virus G protein (VSV-G) is an envelope protein commonly used for pseudotyping. VSV-G is a trimeric protein that binds to phosphatidylserine and low-density lipoprotein receptors on the cell surface for endocytosis into cells. VSV-G pseudotyped lentiviral vectors can efficiently transduce liver cells (e.g., hepatocytes).

[0079] The lentiviral vector of the present invention may be replication-deficient, integrating, and VSV-G pseudotyped. The lentiviral vector of the present invention may be replication-deficient, integrating, self-inactivating, and VSV-G pseudotyped. The lentiviral vector of the present invention may be replication-deficient, integrating, self-inactivating, HIV-derived, and VSV-G pseudotyped.

[0080] Immuno-shielded lentiviral vectors The lentiviral vector of the present invention may be an immunoshielded lentiviral vector.

[0081] As used herein, an "immuno-shielded lentiviral vector" can refer to a lentiviral vector that is modified to reduce immune responses after administration. For example, immune shielding can reduce activation of acute inflammatory responses after administration.

[0082] In some embodiments, the lentiviral vector of the invention comprises: (i) CD47 high (ii) lentiviral vector; free and / or (iii) comprises one or more miRNA target sequences (e.g., to suppress transgene expression in antigen-presenting cells). In a preferred embodiment, the lentiviral vector of the invention is a CD47 high / MHC-I free It is a lentiviral vector and contains one or more miRNA target sequences (e.g., to suppress transgene expression in antigen-presenting cells). Each of these modifications can act to reduce immune responses following administration.

[0083] The immune-shielded lentiviral vector may be "phagocytosis-shielded" to reduce uptake by professional phagocytes. In some embodiments, the lentiviral vector is a phagocytosis-shielded lentiviral vector. For example, the lentiviral vector is a phagocytosis-shielded lentiviral vector that inhibits the expression of CD47 high It may be a lentiviral vector.

[0084] CD47 high Lentiviral Vectors The lentiviral vector of the present invention is a vector that expresses CD47 high As used herein, "CD47 high A "lentiviral vector" may refer to a lentiviral vector that has elevated levels of CD47 (or a fragment thereof) on its surface. high Lentiviral vectors may have reduced uptake by professional phagocytes.

[0085] CD47 (cluster of differentiation 47), also known as integrin-associated protein (IAP), is a transmembrane protein that in humans is encoded by the CD47 gene. Phagocytosis is physiologically inhibited by CD47, a ubiquitously expressed ligand of the signal regulatory protein alpha (SIRP-α) receptor, expressed by professional phagocytes. CD47 can be incorporated into lentiviral vectors as they bud off from the producer cell.

[0086] The lentiviral vector of the present invention may comprise one or more CD47 polypeptides (or fragments thereof) on its surface. The amount of CD47 (or fragments thereof) on the surface may be sufficient to reduce uptake by professional phagocytes. Any suitable assay can be used to quantify the amount of CD47 polypeptide (or fragments thereof) present on the surface of the lentiviral vector.

[0087] In some embodiments, the density of the CD47 polypeptide (or fragment thereof) may be determined by immunostaining for CD47 and total internal reflection fluorescence microscopy, e.g., as described in US2010 / 0316570A1. The CD47 polypeptide (or fragment thereof) is at least about 20 molecules / μm 2 , at least about 25 molecules / μm 2 , at least about 30 molecules / μm 2 , at least about 35 molecules / μm 2, at least about 40 molecules / μm 2 , at least about 45 molecules / μm 2 , at least about 50 molecules / μm 2 , at least about 60 molecules / μm 2 , at least about 70 molecules / μm 2 , at least about 80 molecules / μm 2 , at least about 90 molecules / μm 2 , at least about 100 molecules / μm 2 , at least about 150 molecules / μm 2 , at least about 200 molecules / μm 2 , at least about 250 molecules / μm 2 , at least about 300 molecules / μm 2 , at least about 350 molecules / μm 2 , at least about 400 molecules / μm 2 , at least about 450 molecules / μm 2 , at least about 500 molecules / μm 2 , at least about 600 molecules / μm 2 , at least about 700 molecules / μm 2 , at least about 800 molecules / μm 2 , at least about 900 molecules / μm 2 , or at least about 1000 molecules / μm 2 The CD47 polypeptide (or fragment thereof) may be present at a density of about 1000 molecules / μm 2 , approximately 500 molecules / μm or less 2 or less than about 250 molecules / μm 2 The CD47 polypeptide (or fragment thereof) may be present at a density of about 20 molecules / μm 2 ~ approx. 1000 molecules / μm 2 , about 20 molecules / μm 2 ~About 500 molecules / μm 2 , or about 20 molecules / μm 2 ~ approx. 250 molecules / μm 2 It may be present at a density of

[0088] In some embodiments, the amount of CD47 polypeptide (or fragment thereof) may be determined by immunostaining for CD47 and electron microscopy as described in Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325. The CD47 polypeptide (or fragment thereof) may be detected in an amount of at least about 10 gold particles / lentiviral particle, at least about 15 gold particles / lentiviral particle, or at least about 20 gold particles / lentiviral particle. The CD47 polypeptide (or fragment thereof) may be detected in an amount of about 100 or less gold particles / lentiviral particle, about 80 or less gold particles / lentiviral particle, or about 60 or less gold particles / lentiviral particle. The CD47 polypeptide (or fragment thereof) may be detected in an amount of about 10 to about 100 gold particles / lentiviral particle, about 15 to about 80 gold particles / lentiviral particle, or about 20 to about 60 gold particles / lentiviral particle.

[0089] The lentiviral vector of the present invention is a vector that expresses CD47 high As used herein, "CD47 high "Host cell" may refer to a host cell that has elevated levels of CD47 (or a fragment thereof) on its surface.

[0090] CD47 high A host cell can be genetically engineered to increase expression of CD47 (or a fragment thereof) on the cell surface. For example, the host cell can contain a vector encoding CD47 (or a fragment thereof) or can be edited to introduce a nucleotide sequence encoding CD47 (or a fragment thereof) into its genome. Suitably, the host cell is transduced with a viral vector encoding a CD47 polypeptide (or a fragment thereof).

[0091] CD47 highThe host cell may have a higher concentration of CD47 (or a fragment thereof) on its surface than an unmodified host cell (e.g., an unmodified producer or packaging cell as described herein). Suitably, the host cell has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, or at least about 30-fold more CD47 on its cell surface than an unmodified host cell. Suitably, the host cell has from about 5-fold to about 30-fold more CD47 (or a fragment thereof) on its cell surface than an unmodified host cell.

[0092] Suitably, lentiviral vectors of the invention have a higher concentration of CD47 (or fragments thereof) on their surface than lentiviral vectors obtained from unmodified host cells (e.g., unmodified producer or packaging cells as described herein). Suitably, lentiviral vectors have at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, or at least about 50-fold more CD47 (or fragments thereof) on their surface than lentiviral vectors obtained from unmodified host cells. Suitably, lentiviral vectors have about 5-fold to about 30-fold more CD47 (or fragments thereof) on their surface than lentiviral vectors obtained from unmodified host cells.

[0093] CD47 is a member of the immunoglobulin (Ig) superfamily of membrane proteins with a single IgV-like domain at its N-terminus, a highly hydrophobic stretch with five transmembrane segments, and an alternatively spliced ​​cytoplasmic C-terminus ranging from 3 to 36 amino acids in length. Mouse, rat, bovine and human CD47 molecules have been cloned and show approximately 70% overall amino acid identity (see, e.g., Brown, EJ and Frazier, WA, 2001. Trends in cell biology, 11(3), pp.130-135).

[0094] The CD47 polypeptide (or fragment thereof) may be a human CD47 polypeptide (or fragment thereof). The CD47 polypeptide may have the amino acid sequence of Q08722.

[0095] Exemplary CD47 polypeptides are provided by SEQ ID NOs: 1-4. Suitably, the CD47 polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to any of SEQ ID NOs: 1-4. Suitably, the CD47 polypeptide comprises or consists of the amino acid sequence of any of SEQ ID NOs: 1-4.

[0096] TIFF2025513891000001.tif27160

[0097] Exemplary CD47 Polypeptides (SEQ ID NO:1)

[0098] TIFF2025513891000002.tif25159TIFF2025513891000003.tif10159

[0099] Exemplary CD47 Polypeptides (SEQ ID NO:2)

[0100] TIFF2025513891000004.tif23159

[0101] Exemplary CD47 Polypeptides (SEQ ID NO:3)

[0102] TIFF2025513891000005.tif29159

[0103] Exemplary CD47 Polypeptides (SEQ ID NO:4)

[0104] Exemplary CD47 polypeptides, excluding the signal peptide, are provided by SEQ ID NOs: 5-8. Suitably, the CD47 polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to any of SEQ ID NOs: 5-8. Suitably, the CD47 polypeptide comprises or consists of the amino acid sequence of any of SEQ ID NOs: 5-8.

[0105] TIFF2025513891000006.tif29159

[0106] Exemplary CD47 Polypeptide Excluding the Signal Peptide (SEQ ID NO:5)

[0107] TIFF2025513891000007.tif26159

[0108] Exemplary CD47 Polypeptide Excluding the Signal Peptide (SEQ ID NO:6)

[0109] TIFF2025513891000008.tif26159

[0110] Exemplary CD47 Polypeptide Excluding the Signal Peptide (SEQ ID NO:7)

[0111] TIFF2025513891000009.tif26159

[0112] Exemplary CD47 Polypeptide Excluding the Signal Peptide (SEQ ID NO:8)

[0113] Those skilled in the art will be able to generate variants and / or fragments based on conservative substitutions and / or known structural and functional characteristics of CD47, as described, for example, in Fenalti, G., et al., 2021. Nature communications, 12(1), pp.1-14.

[0114] Suitably, the CD47 fragment and / or CD47 variant retains the ability to inhibit phagocytosis. Suitably, the CD47 fragment and / or CD47 variant may comprise the extracellular domain of CD47. The extracellular domain of human CD47 may interact with SIRP-α and inhibit phagocytosis. Optionally, the CD47 fragment and / or CD47 variant comprises the transmembrane domain of CD47. The domains may be linked by interdomain linker(s). The fragment and / or variant may have at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of the full-length CD47 polypeptide.

[0115] Suitably, the variant of SEQ ID NO: 1 is selected from the group consisting of V5I, C14W, C15R, F22L, S27F, F30L, F32Y, T36S, V38L, V38I, F42V, T44A, N50S, T51A, T52S, T52A, V56I, R63K, A71T, S75Y, T76A, P78L, P78S, P78A, S82R. , S82N, S83T, K85N, K85E, V88A, V88L, V88I, Q90R, L91F, K93N, M100I, M100V, D101G, K1 02R, K102T, S107L, I126F, I127V, K130Q, R132H, S138F, V146I, I150V, I153V, S169A, G 170R, G170S, G171S, D173Y, I177V, A178G, V181I, V185A, I186V, V188A, I189T, I191V, V198I, A207S, T215I, I219M, Y226C, A231S, T235A, S236F, A240V, A240T, I241V, V243I , I244T, V246L, Y249F, A252S, A252T, V254A, S257T, I264M, I264L, M266I, M266T, M266V, V287I, V292A, N295S, N295D, Q296L, P302S, N304S, and N304D, which are considered to be tolerated, mild, and / or likely mild changes as predicted by SIFT, PolyPhen, CADD, REVEL, and MetaLR.

[0116] Suitably, the variants of SEQ ID NO:2 are P3L, A6P, F22L, S27F, F30L, F32Y, T36S, V38L, V38I, F42V, N50S, T51A, T52S, T52A, V56I, R63K, A71T, S75Y, T76A, P78L, P78S, P78A, S8 2R, S82N, S83T, K85N, K85E, V88A, V88L, V88I, Q90R, L91F, K93N, M100I, M100V , D101G, K102R, K102T, S107L, I126F, I127V, K130Q, R132H, S138F, V146I, I150 The alterations may include one or more changes selected from V, I153V, S169A, G170R, G170S, G171S, I177V, A178G, V181I, I186V, V188A, I189T, I191V, V198I, A207S, T215I, I219M, Y226C, A231S, T235A, A240V, A240T, I241V, V243I, I244T, V246L, Y249F, A252S, A252T, V254A, I264M, I264L, M266I, M266T, M266V, V287I, V292A, N295S, N295D, and Q296L. These are considered to be tolerated, mild, and / or likely mild changes as predicted by SIFT, PolyPhen, CADD, REVEL, and MetaLR.

[0117] An exemplary CD47 fragment is provided by SEQ ID NO: 9. Suitably, the CD47 fragment comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to SEQ ID NO: 9. Suitably, the CD47 fragment comprises or consists of the amino acid sequence of SEQ ID NO:9.

[0118] TIFF2025513891000010.tif17160

[0119] Exemplary CD47 Fragment (SEQ ID NO:9)

[0120] An exemplary CD47 fragment, excluding the signal peptide, is provided by SEQ ID NO: 10. Suitably, the CD47 fragment comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to SEQ ID NO: 10. Suitably, the CD47 fragment comprises or consists of the amino acid sequence of SEQ ID NO: 10.

[0121] TIFF2025513891000011.tif14161

[0122] Exemplary CD47 fragment excluding signal peptide (SEQ ID NO: 10)

[0123] MHC-I low or MHC-I free Lentiviral Vectors The lentiviral vector of the present invention is an MHC-I low Lentiviral vector or MHC-I free In a preferred embodiment, the lentiviral vector of the present invention is a lentiviral vector that is capable of binding to MHC-I. free It is a lentiviral vector.

[0124] As used herein, "MHC-I low "Lentiviral vector" may refer to a lentiviral vector that has a reduced level of one or more MHC-I molecules on its surface (i.e., has a reduced level of surface-exposed MHC-I molecules). The number of surface-exposed MHC-I molecules may be reduced such that the immune response to MHC-I is reduced to a therapeutically relevant extent.

[0125] As used herein, "MHC-I free"Lentiviral vector" may refer to a lentiviral vector that is substantially devoid of (or does not contain) one or more MHC-I molecules on its surface (i.e., substantially devoid of (or does not contain) surface-exposed MHC-I molecules).

[0126] Major histocompatibility complex class I (MHC-I) is a heterodimeric membrane protein that is presented on the outer leaflet of the cell membrane (see, e.g., Penn, DJ and Ilmonen, P., 2005. Major histocompatibility complex (MHC). eLS). MHC-I functions to bind and present peptide fragments of proteins to the extracellular environment, where they can be recognized by CD8+ cytotoxic T cells. Peptide fragments generated from normal cellular proteins do not activate cytotoxic T cells due to central and peripheral tolerance mechanisms. However, foreign peptides (e.g., peptides derived from viral proteins) trigger the activation of an immune response to destroy cells. Allogeneic MHC-I proteins themselves can be recognized by the immune system. For example, antibodies can directly bind to MHC-I epitopes. As a result, lentiviral vectors containing MHC-I molecules derived from an allogeneic source can be targeted and neutralized by the immune system.

[0127] The term "MHC-I molecule" may refer to a human MHC-I molecule. Human MHC-I, also called human leukocyte antigen class I (HLA-I), is expressed on almost all nucleated cells. HLA-I consists of two polypeptide chains, the HLA-I heavy chain (α chain) and β2 microglobulin (β2M or β chain). HLA-I α chain and β2M are non-covalently linked. HLA-I α chain is polymorphic. Six HLA-I α chains have been identified to date, including three classical, highly polymorphic α chains (HLA-A, HLA-B, and HLA-C) and three non-classical, less polymorphic α chains (HLA-E, HLA-F, and HLA-G). MHC-I molecules may include or consist of HLA-A, HLA-B, and HLA-C molecules, which contain the invariant β2M sequence.

[0128] The term "MHC-I molecule" may also include variant MHC-I sequences, such as polymorphisms of the HLA-I α-chain sequence and / or β2M sequence. For example, a variant MHC-I sequence may include an HLA-I α-chain sequence and / or β2M sequence having a single nucleotide polymorphism (SNP) or multiple SNPs.

[0129] Any suitable assay for quantifying the amount of MHC-I molecules present on the surface of a lentiviral vector can be used.

[0130] In some embodiments, the amount of MHC-I molecules can be determined by immunostaining for MHC-I and electron microscopy as described in Milani, M., et al., 2017. EMBO molecular medicine, 9(11), pp.1558-1573. MHC-I molecules can be detected in an amount of less than about 10 gold particles / lentivirus particle, less than about 9 gold particles / lentivirus particle, less than about 8 gold particles / lentivirus particle, less than about 7 gold particles / lentivirus particle, less than about 6 gold particles / lentivirus particle, less than about 5 gold particles / lentivirus particle, less than about 4 gold particles / lentivirus particle, less than about 3 gold particles / lentivirus particle, less than about 2 gold particles / lentivirus particle, less than about 1 gold particle / lentivirus particle, or about 0 gold particles / lentivirus particle. MHC-I molecules can be undetectable (e.g., the amount of gold particles detected may not be significantly higher than background levels).

[0131] The lentiviral vector of the present invention is an MHC-I low host cell or MHC-I free In a preferred embodiment, the lentiviral vector of the present invention is an MHC-I free As used herein, "MHC-I" refers to a polypeptide that is derived from a host cell. low A "host cell" may refer to a host cell that has reduced levels of one or more MHC-I molecules on its surface. freeA "host cell" may refer to a host cell that is substantially devoid of or does not contain one or more MHC-I molecules on its surface.

[0132] MHC-I low or MHC-I free The host cells can be genetically engineered to reduce expression of MHC-I on the cell surface. For example, the cells can contain a genetically engineered disruption of the gene encoding β2-microglobulin and / or a genetically engineered disruption of the gene encoding the MHC-I α chain.

[0133] Methods of genetic engineering to reduce protein expression are known in the art. For example, this may be achieved by targeted gene knockout. To reduce protein expression, the gene encoding the protein itself or its regulatory sequence (e.g., its promoter) can be knocked out. Knockout may be achieved by deletion of a part of the coding nucleic acid sequence, which may delete a part of the protein essential for expression or stability, or by base editing, which may change the reading frame of the coding sequence. Suitable methods for targeted gene knockout include the use of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas-based RNA-guided nucleases (see, for example, Gaj, T. et al., 2013. Trends Biotechnol, 31, pp.397-405). For example, CRISPR / Cas9 RNA-guided nucleases can be used to catalyze double-strand breaks at specific loci in the genome when provided with appropriate RNA guides designed to bind to those loci. Cas9 and guide RNA can be delivered to target cells by transfection of vectors encoding proteins and RNA. Cells attempt to repair any double-strand breaks in their DNA using the non-homologous end joining (NHEJ) pathway. This is an error-prone mechanism that inserts random nucleotides, often disrupting the reading frame of the targeted gene. Alternatively, genetic engineering to reduce protein expression may be achieved using RNAi techniques, microRNAs or antisense RNAs to suppress expression of the targeted gene.

[0134] Once a targeted gene knockout or silencing approach has been performed, the resulting cell population can be screened to select and enrich for cells that exhibit a phenotype of interest, e.g., reduced expression of surface-exposed MHC-I. Suitable techniques for screening and enrichment are known in the art and include flow cytometry and fluorescence-activated cell sorting (FACS).

[0135] In some embodiments, the host cell comprises a genetically engineered disruption of the gene encoding β2-microglobulin. β2-microglobulin stabilizes MHC-I, and thus cells lacking β2-microglobulin exhibit reduced expression of MHC-I on the surface of the cell. The cell may comprise a genetically engineered disruption in all copies of the gene encoding β2-microglobulin.

[0136] In another embodiment, the cell comprises an engineered disruption in one or more genes encoding the MHC-Iα chain. The cell may comprise an engineered disruption in all copies of the gene encoding the MHC-Iα chain.

[0137] The cells may contain both a genetically engineered disruption of the gene encoding β2-microglobulin and a genetically engineered disruption of the gene encoding the MHC-I α chain.

[0138] A reduction in the expression of MHC-I on the surface of a cell may refer to a reduction in the number of MHC-I molecules expressed on the surface of a genetically engineered cell compared to the number of MHC-I molecules expressed on the surface of a cell lacking genetic engineering but otherwise under substantially identical conditions. The expression of MHC-I on the surface of a cell may be reduced such that the number of MHC-I molecules exposed on the surface is, for example, less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of MHC-I molecules exposed on the surface presented in the absence of genetic engineering. In some embodiments, the expression of MHC-I on the surface of a cell is reduced such that the number of MHC-I molecules exposed on the surface is 0% of the number of MHC-I molecules exposed on the surface presented in the absence of genetic engineering.

[0139] The expression of MHC-I on the surface of the cell is preferably reduced so that the cell is substantially devoid of MHC-I molecules exposed on the surface.In this context, "substantially devoid" can mean that there is a substantial reduction in the number of MHC-I molecules expressed on the surface of the genetically engineered cell compared to the number of MHC-I molecules expressed on the surface of the cell that lacks genetic engineering, so that the immune response to the MHC-I on the lentiviral vector produced by the cell is reduced to a therapeutically useful extent.

[0140] Suitably, the lentiviral vectors of the present invention have a lower concentration of MHC-I molecules on their surface than lentiviral vectors obtained from unmodified host cells (e.g., unmodified producer or packaging cells as described herein). Suitably, the lentiviral vectors have less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed MHC-I molecules presented on lentiviral vectors obtained from unmodified host cells. In some embodiments, the lentiviral vectors have less than about 20% of the number of surface-exposed MHC-I molecules presented on lentiviral vectors obtained from unmodified host cells.

[0141] In some embodiments, the lentiviral vector of the present invention is substantially devoid of MHC-I molecules on its surface.In this context, "substantially devoid" can mean that there is no detectable immune response due to molecules on the surface of the lentiviral vector.

[0142] In some embodiments, the lentiviral vector of the present invention does not contain MHC-I molecules on its surface.In this context, "does not contain" can mean that there are no detectable molecules (e.g., by immunostaining and electron microscopy) on the surface of the lentiviral vector.As used herein, "not detectable" can refer to a level that is not statistically significantly different from background level.

[0143] In some embodiments, the lentiviral vector of the present invention has reduced HLA-A, HLA-B, and / or HLA-C molecules on its surface. Preferably, the lentiviral vector has less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed HLA-A molecules displayed on a lentiviral vector obtained from a non-modified host cell. Preferably, the lentiviral vector has less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed HLA-B molecules displayed on a lentiviral vector obtained from a non-modified host cell. Suitably, the lentiviral vector has less than about 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% of the number of surface-exposed HLA-C molecules displayed on a lentiviral vector obtained from a non-modified host cell.

[0144] In some embodiments, the lentiviral vector of the present invention is substantially devoid of HLA-A, HLA-B, and / or HLA-C molecules on its surface. In some embodiments, the lentiviral vector of the present invention is substantially devoid of HLA-A, HLA-B, and HLA-C molecules on its surface. In some embodiments, the lentiviral vector of the present invention does not include HLA-A, HLA-B, and / or HLA-C molecules on its surface. In some embodiments, the lentiviral vector of the present invention does not include HLA-A, HLA-B, and HLA-C molecules on its surface.

[0145] As mentioned above, the HLA-I molecule consists of two polypeptide chains, the HLA-I heavy chain (α chain) and β2 microglobulin (β2M or β chain). The HLA-I α chain and β2M are non-covalently linked.

[0146] A person skilled in the art would be able to readily determine the amino acid and nucleic acid sequences of the HLA-Iα chains. For example, HLA-Iα chains can be identified in genomic sequences using their location within the major histocompatibility complex region of the chromosome (see, e.g., Penn, DJ and Ilmonen, P., 2005. Major histocompatibility complex (MHC). eLS).

[0147] The HLA-A alpha chain may have the amino acid sequence of UniProtKB P04439. Exemplary HLA-A alpha chains are provided by SEQ ID NOs: 11 and 12. Suitably, the HLA-A alpha chain comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to SEQ ID NO: 11 or 12. Suitably, the HLA-A alpha chain comprises or consists of the amino acid sequence of SEQ ID NO: 11 or 12.

[0148] TIFF2025513891000012.tif30160

[0149] Exemplary HLA-A alpha chain (SEQ ID NO:11)

[0150] TIFF2025513891000013.tif30160

[0151] Exemplary HLA-A alpha chain (SEQ ID NO: 12)

[0152] The HLA-B alpha chain may have the amino acid sequence of UniProtKB P01889. An exemplary HLA-B alpha chain is provided by SEQ ID NO: 13. Suitably, the HLA-B alpha chain comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to SEQ ID NO: 13. Suitably, the HLA-B alpha chain comprises or consists of the amino acid sequence of SEQ ID NO: 13.

[0153] TIFF2025513891000014.tif12161TIFF2025513891000015.tif21160

[0154] Exemplary HLA-B alpha chain (SEQ ID NO: 13)

[0155] The HLA-C alpha chain may have the amino acid sequence of UniProtKB P10321. Exemplary HLA-C alpha chains are provided by SEQ ID NOs: 14 and 15. Suitably, the HLA-C alpha chain comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to SEQ ID NO: 14 or 15. Suitably, the HLA-C alpha chain comprises or consists of the amino acid sequence of SEQ ID NO: 14 or 15.

[0156] TIFF2025513891000016.tif29160

[0157] Exemplary HLA-C alpha chain (SEQ ID NO: 14)

[0158] TIFF2025513891000017.tif29160

[0159] Exemplary HLA-C alpha chain (SEQ ID NO: 15)

[0160] Amino acid and nucleic acid sequences encoding β2M are also known in the art, for example, the nucleic acid sequence of human β2M is deposited in GenBank under Accession No. NM_004048.

[0161] The HLA beta chain may be that of UniProtKB P61769. An exemplary HLA beta chain is provided by SEQ ID NO: 16. Suitably, the HLA beta chain comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to SEQ ID NO: 16. Suitably, the HLA beta chain comprises or consists of the amino acid sequence of SEQ ID NO: 16.

[0162] TIFF2025513891000018.tif10160

[0163] Exemplary HLA beta chain (SEQ ID NO: 16)

[0164] The lentiviral vector of the present invention is a vector that expresses CD47 high / MHC-I free Lentiviral vector or CD47 high / MHC-I low In a preferred embodiment, the lentiviral vector of the present invention is a CD47 high / MHC-I free It is a lentiviral vector.

[0165] The lentiviral vector of the present invention is a vector that expresses CD47 high / MHC-I free Host cell or CD47 high / MHC-I low In a preferred embodiment, the lentiviral vector of the present invention is a vector that expresses the CD47 high / MHC-I free Obtained from a host cell.

[0166] miRNA target sequence The lentiviral vector of the present invention may comprise one or more miRNA target sequences.One or more miRNA target sequences may be operably linked to protein coding sequence.The term "operably linked" may mean that the components described are in a relationship that allows them to function in their intended manner.

[0167] MicroRNA (miRNA) genes are scattered across all human chromosomes except the Y chromosome. Similar to protein-coding genes, miRNAs are usually transcribed from a polymerase-II promoter to generate the so-called primary miRNA transcript (pri-miRNA). From the pri-miRNA, a stem-loop of about 60 nucleotides in length, called miRNA precursor (pre-miRNA), is excised, leaving a 5' phosphate and a 2 bp long 3' overhang. The pre-miRNA is then actively transported from the nucleus to the cytoplasm. Dicer then performs a double-stranded break at the other end of the stem-loop, generating a 19-24 bp duplex consisting of the mature miRNA and the inverse strand of the duplex, called miRNA*. One strand of the duplex is selectively loaded into the RNA-induced silencing complex (RISC) and accumulates as the mature microRNA. This strand is usually the one whose 5' end is less tightly paired with its complementary strand. However, there are several miRNAs that support the accumulation of both strands of the duplex to a similar extent.

[0168] Once loaded into RISC, the guide strand of the mature microRNA interacts with mRNA target sequences that are preferentially found in the 3' untranslated regions (3'UTRs) of protein-coding genes. If the entire guide strand sequence is perfectly complementary to the mRNA target, the mRNA is endonucleolytically cleaved. If only the seed sequence (i.e., nucleotides 2-8 counting from the 5' end of the miRNA) is perfectly complementary to the target mRNA, RNAi can act through an alternative mechanism resulting in translational repression.

[0169] Expression of a protein from a protein coding sequence (i.e., "transgene expression") can be regulated by one or more endogenous miRNAs using one or more corresponding miRNA target sequences. Using this method, one or more miRNAs endogenously expressed in a cell prevent or reduce transgene expression in the cell by interacting with their corresponding miRNA target sequences located in the lentiviral genome (see, e.g., Brown, BD et al. (2007) Nat Biotechnol 25: 1457-1467).

[0170] Suitable miRNA target sequences that suppress transgene expression in specific cells are known to those skilled in the art. Determining miRNAs with desired expression profiles may be accomplished using techniques known to those skilled in the art. For example, the mammalian microRNA expression atlas is described in Landgraf, P., et al., 2007. Cell, 129(7), pp.1401-1414, and the distribution of miRNA expression across human tissues is described in Ludwig, N., et al., 2016. Nucleic acids research, 44(8), pp.3865-3877. Once a miRNA is identified, the corresponding target sequence can be easily determined using a microRNA database such as, for example, miRBase (Griffiths-Jones, S., et al., 2007. Nucleic acids research, 36(suppl_1), pp.D154-D158).

[0171] The miRNA target sequence may be fully or partially complementary to the corresponding miRNA. The term "fully complementary" as used herein may mean that the target sequence has a nucleic acid sequence that is 100% complementary to the sequence of the miRNA that recognizes it. The term "partially complementary" as used herein may mean that the target sequence is only partially complementary to the sequence of the miRNA that recognizes it, whereby the partially complementary sequence is still recognized by the miRNA. In other words, the partially complementary target sequence in the context of the present invention is effective in recognizing the corresponding miRNA and causing the prevention or reduction of transgene expression in cells that express the miRNA. Preferably, the partially complementary miRNA target sequence may be fully complementary to the miRNA seed sequence.

[0172] The effectiveness of this system may be increased by including two or more copies of the miRNA target sequence in the lentiviral vector. Also, different miRNA target sequences may be included. For example, a protein coding sequence may be operably linked to two or more miRNA target sequences, which may or may not be different. The miRNA target sequences may be in tandem, although other arrangements are also envisioned. The lentiviral vector may, for example, include 1, 2, 3, 4, 5, 6, 7 or 8 copies of the same or different miRNA target sequence. Advantageously, the lentiviral vector includes 4 miRNA target sequences of each miRNA target sequence.

[0173] The copies of the miRNA target sequence may be separated by a spacer sequence, which may comprise, for example, at least one, at least two, at least three, at least four, or at least five nucleotide bases.

[0174] Preferably, the lentiviral vector comprises one or more miRNA target sequences, two or more miRNA target sequences, three or more miRNA target sequences, or four or more miRNA target sequences. Preferably, the protein coding sequence is operably linked to one or more miRNA target sequences, two or more miRNA target sequences, three or more miRNA target sequences, or four or more miRNA target sequences. In some embodiments, the protein coding sequence is operably linked to four miRNA target sequences.

[0175] The miRNA target sequence may be a human miRNA target sequence. Suitably, the miRNA target sequence is a -5p or -3p miRNA target sequence.

[0176] One or more miRNA target sequences may repress transgene expression in one or more cells other than liver cells (eg, hepatocytes).

[0177] One or more miRNA target sequences can suppress transgene expression in hematopoietic lineage cells. Hematopoietic stem cells give rise to different types of blood cells in lineages called myeloid and lymphoid. As used herein, "hematopoietic lineage cells" can include myeloid and lymphoid cells. Myeloid cells can include monocytes, macrophages, neutrophils, basophils, and eosinophils. Lymphoid cells can include T cells, B cells, natural killer cells, and innate lymphoid cells.

[0178] One or more miRNA target sequences can suppress transgene expression in antigen-presenting cells. As used herein, "antigen-presenting cells" (APCs) can refer to cells that present antigens bound by major histocompatibility complex (MHC) proteins on their surface. APCs can be hematopoietic lineage cells. Antigen-presenting cells can be professional antigen-presenting cells. Professional APCs are specialized in presenting antigens to T cells and can include macrophages, B cells and dendritic cells. Preferably, APCs are spleen and / or liver APCs.

[0179] One or more miRNA target sequences can repress transgene expression in hematopoietic lineage antigen-presenting cells.

[0180] By preventing transgene expression in antigen-presenting cells while allowing high levels of expression in other cells, miRNA regulation may enable potent and stable gene transfer in the absence of an immune response.

[0181] As used herein, the term "suppressing expression" may refer to a reduction in expression in a relevant cell type(s) of a transgene to which one or more miRNA target sequences are operably linked, compared to transgene expression in the absence of the one or more miRNA target sequences, but under otherwise substantially identical conditions. In some embodiments, transgene expression is suppressed by at least 50%. In some embodiments, transgene expression is suppressed by at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%. In some embodiments, transgene expression is substantially prevented, e.g., not detectable.

[0182] The miRNA-mediated approach to restrict gene expression has several advantages over other strategies to regulate transgenes. By using tissue-specific promoters, expression can be successfully restricted to target cells, but leaky expression is observed in some non-target cells. This occurs because the reconstituted promoters modified for inclusion in vector systems often lose some of their cell specificity, and also because vector integration near active promoters and enhancers can activate tissue-specific promoters and drive transgene expression. In contrast, miRNA-mediated silencing occurs at the post-transcriptional level, so promoter and enhancer trapping is not involved. Therefore, miRNA regulation can be used to effectively detarget transgene expression from specific cell types while still allowing broad tissue expression. miRNA regulation may also be used in combination with tissue-specific promoters / enhancers. By including miRNA target sequences in expression cassettes that are already under the control of tissue-specific promoters, an additional layer of regulation is added that can eliminate off-target expression.

[0183] Exemplary miRNA target sequences that suppress transgene expression in hematopoietic lineage cells and / or antigen-presenting cells include, but are not limited to, miR-181, miR-142, miR-223, and miR-155 target sequences. Other miRNA target sequences that suppress transgene expression in hematopoietic lineage cells and / or antigen-presenting cells are known in the art (see, for example, Ghafouri-Fard, S., et al., 2021. Non-coding RNA research, 6(1), pp.8-14). miRNAs expressed in hematopoietic lineage cells and / or antigen-presenting cells interact with the corresponding miRNA target sequences and reduce the expression of target genes (see, e.g., Brown, BD, et al., 2006. Nature medicine, 12(5), pp.585-591 and Brown, BD, et al., 2007. Nature biotechnology, 25(12), pp.1457-1467).

[0184] Further miRNA target sequences that suppress transgene expression in hematopoietic lineage cells and / or antigen-presenting cells can be identified by any suitable method, for example by miRNA expression analysis as described in Monticelli, S., et al., 2005. Genome biology, 6(8), pp.1-15.

[0185] Suitably, the one or more miRNA target sequences comprise or consist of: (i) one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) miR-142 target sequences, (ii) one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) miR-181 target sequences, (iii) one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) miR-223 target sequences, and / or (iv) one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) miR-155 target sequences.

[0186] In some embodiments, the one or more miRNA target sequences comprise or consist of (i) two or more miR-142 target sequences, (ii) two or more miR-181 target sequences, (iii) two or more miR-223 target sequences, and / or (iv) two or more miR-155 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of (i) at least four miR-142 target sequences, (ii) at least four miR-181 target sequences, (iii) at least four miR-223 target sequences, and / or (iv) at least four miR-155 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of (i) four miR-142 target sequences, (ii) four miR-181 target sequences, (iii) four miR-223 target sequences, and / or (iv) four miR-155 target sequences. Suitably, the target sequences are separated by a spacer sequence.

[0187] In some embodiments, the one or more miRNA target sequences comprise or consist of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) miR-142 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of two or more miR-142 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of three or more miR-142 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of four or more miR-142 target sequences. In some embodiments, the one or more miRNA target sequences comprise or consist of four miR-142 target sequences. Suitably, the target sequences are separated by a spacer sequence.

[0188] The miR-142 target sequence may be a human miRNA target sequence. Preferably, the miR-142 target sequence is a miR-142-5p or miR-142-3p miRNA target sequence. In some embodiments, the miR-142 target sequence is a miR-142-3p miRNA target sequence.

[0189] In some embodiments, the miR-142 target sequence comprises or consists of a nucleotide sequence that is at least 80% identical to SEQ ID NO: 17, or a fragment thereof. Suitably, the miR-142 target sequence comprises or consists of a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 17, or a fragment thereof.

[0190] In some embodiments, the miR-142 target sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 17, or a fragment thereof.

[0191] TCCATAAAGTAGGAAACACTACA Exemplary miR-142 target sequence (SEQ ID NO: 17)

[0192] In some embodiments, the one or more miRNA target sequences comprise or consist of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 18 or a fragment thereof. Suitably, the one or more miRNA target sequences comprise or consist of a nucleotide sequence that is at least 75%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 18 or a fragment thereof.

[0193] In some embodiments, one or more miRNA target sequences comprise or consist of the nucleotide sequence of SEQ ID NO: 18, or a fragment thereof.

[0194] TIFF2025513891000019.tif12160

[0195] Exemplary 4×miR-142 target sequence (SEQ ID NO: 18):

[0196] MMA-related polypeptides The protein coding sequence delivered by the lentiviral vector of the present invention is a nucleotide sequence encoding a methylmalonic acidemia (MMA)-associated polypeptide. Once delivered to a cell, the protein encoded by the protein coding sequence can be expressed in the cell (i.e., "transgenic expression" can occur).

[0197] As used herein, "MMA-related polypeptide" can be any polypeptide associated with methylmalonic acidemia (MMA). As mentioned above, MMA is a group of inborn errors of metabolism associated with elevated blood and urinary methylmalonic acid concentrations resulting from the inability to convert methylmalonyl-CoA to succinyl-CoA during propionyl-CoA metabolism in the mitochondrial matrix (see, for example, Manoli I, et al. 2005. Isolated Methylmalonic Acidemia. In GeneReviews). MMA-related polypeptides can be any polypeptides associated with the pathway of conversion of methylmalonyl-CoA to succinyl-CoA, including polypeptides associated with intracellular cobalamin metabolism (e.g., polypeptides encoded by MMUT, MMAA, MMAB, MMACHC, MMADHC, LMBRD1, ABCD4, HCFC1, MCEE, SUCLA2 / SUCLG1, ACSF3, or ALDH6A1).

[0198] In a preferred embodiment, the MMA-related polypeptide is an iMMA-related polypeptide. As described above, isolated MMA (iMMA) is a polypeptide that contains a complete (mut) copy of the enzyme methylmalonyl-CoA mutase (encoded by MMUT). 0 enzyme subtype) or partial (mut -It can be caused by a deficiency of MMAA, MMAB, or MMADHC; a defect in the transport or synthesis of its cofactor adenosyl-cobalamin (caused by pathogenic variants in MMAA, MMAB, or MMADHC); or a deficiency of the enzyme methylmalonyl-CoA epimerase (encoded by MCEE) (see, e.g., Manoli I, et al. 2005. Isolated Methylmalonic Acidemia. In GeneReviews).

[0199] Suitably, the MMA-related polypeptide is selected from methylmalonyl-CoA mutase (MMUT) or a fragment and / or variant thereof; methylmalonic aciduria type A (MMAA) or a fragment and / or variant thereof; methylmalonic aciduria type B (MMAB) or a fragment and / or variant thereof; methylmalonic aciduria and homocystinuria type D (MMADHC) or a fragment and / or variant thereof; and methylmalonyl-CoA epimerase (MCEE) or a fragment and / or variant thereof.

[0200] The protein coding sequence may be codon optimized, for example, the protein coding sequence may be codon optimized for expression in mammalian (e.g., human) cells.

[0201] Different cells differ in their use of certain codons. This codon bias corresponds to the bias in the relative abundance of a particular tRNA in a cell type. It is possible to increase expression by modifying the codons in the sequence so that they are adjusted to match the relative abundance of the corresponding tRNA. Similarly, it is possible to decrease expression by deliberately selecting codons whose corresponding tRNAs are known to be rare in a particular cell type. Thus, a further step of translational control is available. Codon usage tables are known in the art for mammalian cells (e.g., humans), as well as for a variety of other organisms.

[0202] MMUT In some embodiments, the MMA-related polypeptide is MMUT or a fragment and / or variant thereof.

[0203] "MMUT" or "MUT" is an abbreviation for the polypeptide encoded by MMUT, also known as mitochondrial methylmalonyl-CoA mutase (MCM) and methylmalonyl-CoA isomerase. MMUT catalyzes the AdoCbl-dependent transfer of methylmalonyl-CoA (mmCoA) to succinyl-CoA (sCoA). Each MMUT monomer is characterized by a two-domain structure, containing a large substrate-binding TIM barrel connected to a small AdoCbl-binding domain by an interdomain linker of about 100 aa, with the active site located at the N / C domain interface (see, for example, Froese, DS, et al., 2010. Journal of Biological Chemistry, 285(49), pp.38204-38213).

[0204] Fragments and / or variants of MMUT may retain MMUT activity (see, for example, EC 5.4.99.2). For example, fragments and / or variants of MMUT may be capable of catalyzing the translocation of mmCoA to sCoA. Suitably, fragments and / or variants of MMUT may have the same or similar activity as MMUT, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of MMUT. Assays for determining MMUT activity are described, for example, in Janata, J., et al., 1997. Human Molecular Genetics, 6(9), pp.1457-1464 and Forny, P., et al., 2014. Human mutation, 35(12), pp.1449-1458.

[0205] A "fragment of MMUT" may refer to a portion or region of full-length MMUT that has the same or similar activity as full-length MMUT, i.e., the fragment may be a functional fragment (e.g., the fragment may catalyze the translocation of mmCoA to sCoA). The fragment may have at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of full-length MMUT.

[0206] An "MMUT variant" may comprise an amino acid sequence or nucleotide sequence that may be at least 50%, at least 55%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% identical to wild-type MMUT, and optionally at least 95% or at least 97% or at least 99% identical. MMUT variants may have the same or similar activity as wild-type MMUT (e.g., MMUT variants may catalyze the translocation of mmCoA to sCoA). MMUT variants may have at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of wild-type MMUT.

[0207] Those skilled in the art will be able to generate fragments of MMUT and / or MMUT variants using conservative substitutions based on the known structural and functional characteristics of MMUT (see, for example, Froese, DS, et al., 2010. Journal of Biological Chemistry, 285(49), pp.38204-38213; Thomau, NH and Leadlay, PF, 1996. Protein Science, 5(9), pp.1922-1927; and Acquaviva, C., et al., 2005. Human mutation, 25(2), pp.167-176) and / or based on known variants (see, for example, NCBI Gene ID:4594 and NCBI HomoloGene:20097).

[0208] Suitably, the MMUT fragment and / or MMUT variant comprises the mmCoA binding domain and the AdoCbl binding domain. The MMUT fragment may also comprise a mitochondrial targeting sequence and / or a dimerization domain. The domains / sequences may be linked by an inter-domain linker(s).

[0209] The MMUT gene is conserved in chimpanzees, rhesus monkeys, dogs, cows, mice, and rats. The MMUT may be human MMUT. Suitably, the MMUT may comprise or consist of the polypeptide sequence of UniProtKB Accession P22033, or a fragment and / or variant thereof.

[0210] In some embodiments, the MMUT comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 37 or a fragment thereof. Suitably, the MMUT comprises or consists of an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 37 or a fragment thereof.

[0211] In some embodiments, the MMUT comprises or consists of SEQ ID NO: 37, or a fragment thereof.

[0212] TIFF2025513891000020.tif19160TIFF2025513891000021.tif30160

[0213] Exemplary MMUT (SEQ ID NO:37)

[0214] Suitably, the MMUT variants are N6K, N6S, Q7R, F9L, S12L, P13L, P13S, H14L, H14R, H14N, Y15N, L16V, R17S, R17K, Q18R, V19G, K20E, E21A, S22L, S22P, L27V, I28L, P38S, A44T, A45S, K48E, K49R, K54R, N55K, D58A, I60T, I60L, K75R, K 75E, R76T, R76K, R76G, T78A, M79T, M79V, M79L, L81I, L85F, L85V, V88M, R154H, R154C, I200V, P209S, K210E, E211D, E211D, K251N, K251E, H252Y, I274V, S288A, Q293R, H331R, E334K, M336I, M336V, S342A, A349T, I372V, S416T, C433W, C433Y, C433R, N436S, N436D, I449V, M452L, E461Q, R475K, A499P, A499T, A504V, A504T, N512K , K519E, K520R, I521V, K522R, S524G, A528V, A528G, E531Q, R532H, E539K, A542V, S543N, A550V, K571R, K595 The alterations may include one or more alterations selected from R, I597L, T598A, T598P, I601V, I601L, H605R, K606R, M608T, R610H, R610C, I634V, I671M, I671V, K687R, S691A, E715K, S719A, N720S, V721I, K730T, V733I, Q734R, D737H, E740K, K741R, and K746T, which are considered to be tolerated, mild, and / or likely mild alterations as predicted by SIFT, PolyPhen, CADD, and REVEL.

[0215] Suitably, the MMUT variant may include one or more changes selected from I69V, R154H, A499T, K520T, K522R, R532G, R532H, and I671V, which are considered to be mild (or potentially mild) changes based on clinical data.

[0216] Suitably, the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, may comprise or consist of the nucleotide sequence of NCBI reference sequence NM_000255, or a fragment and / or variant thereof.

[0217] In some embodiments of the invention, the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 38 or a fragment thereof. Suitably, the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 38 or a fragment thereof.

[0218] In some embodiments of the invention, the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, comprises or consists of the nucleotide sequence of SEQ ID NO: 38, or a fragment thereof.

[0219] TIFF2025513891000022.tif134160

[0220] Exemplary nucleotide sequence encoding MMUT (SEQ ID NO:38)

[0221] In some embodiments, the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, is codon-optimized. An exemplary codon-optimized sequence is provided in SEQ ID NO:39.

[0222] In some embodiments the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 39 or a fragment thereof. Suitably the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 75%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 39 or a fragment thereof.

[0223] In some embodiments, the nucleotide sequence encoding MMUT, or a fragment and / or variant thereof, comprises or consists of the nucleotide sequence of SEQ ID NO: 39, or a fragment thereof.

[0224] TIFF2025513891000023.tif11159TIFF2025513891000024.tif126159

[0225] An exemplary codon-optimized nucleotide sequence encoding MMUT (SEQ ID NO:39)

[0226] MMAA In some embodiments, the MMA-related polypeptide is MMAA or a fragment and / or variant thereof.

[0227] "MMAA" is an abbreviation for the polypeptide encoded by the MMAA gene, also known as mitochondrial methylmalonic aciduria type A protein and cobalamin-related metabolism A. MMAA mediates the transport of cobalamin (Cbl) into mitochondria for the final step of adenosylcobalamin (AdoCbl) synthesis and assists in the delivery of the AdoCbl cofactor from MMAB to methylmalonyl-CoA mutase (MMUT).

[0228] Fragments and / or variants of MMAA may retain MMAA activity. For example, fragments and / or variants of MMAA may mediate the transport of Cbl to mitochondria and / or assist AdoCbl cofactor delivery from MMAB to MMUT. Suitably, fragments and / or variants of MMAA may have the same or similar activity as MMAA, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of MMAA. Suitable assays for MMAA activity are known in the art (see, for example, Plessl, T., et al., 2017. Human Mutation, 38(8), pp.988-1001).

[0229] One skilled in the art could generate fragments and / or variants using conservative substitutions based on the known structural and functional characteristics of MMAA (see, e.g., Plessl, T., et al., 2017. Human Mutation, 38(8), pp.988-1001 and Froese, DS, et al., 2010. Journal of Biological Chemistry, 285(49), pp.38204-38213) and / or based on known variants (see, e.g., NCBI Gene ID:166785 and NCBI HomoloGene:14586).

[0230] The MMAA gene is conserved in chimpanzees, dogs, cows, mice, and rats. The MMAA may be a human MMAA. Suitably, the MMAA may comprise or consist of a polypeptide sequence of UniProtKB Accession Q8IVH4, or a fragment and / or variant thereof.

[0231] In some embodiments, the MMAA comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 40, or a fragment thereof. Suitably, the MMAA comprises or consists of an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 40, or a fragment thereof.

[0232] In some embodiments, the MMAA comprises or consists of SEQ ID NO: 40, or a fragment thereof.

[0233] TIFF2025513891000025.tif31159

[0234] Exemplary MMAA (SEQ ID NO:40)

[0235] Suitably, the MMAA variant may include Q363H, a change believed to be mild based on clinical data.

[0236] Suitably, the nucleotide sequence encoding MMAA, or a fragment and / or variant thereof, may comprise or consist of the nucleotide sequence of NCBI reference sequence NM_172250 or NM_001375644, or a fragment and / or variant thereof.

[0237] In some embodiments, the nucleotide sequence encoding MMAA, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 41 or a fragment thereof. Suitably, the nucleotide sequence encoding MMAA, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 41 or a fragment thereof.

[0238] In some embodiments, the nucleotide sequence encoding MMAA, or a fragment and / or variant thereof, comprises or consists of the nucleotide sequence of SEQ ID NO:41, or a fragment thereof.

[0239] TIFF2025513891000026.tif77159

[0240] Exemplary Nucleotides Encoding MMAA (SEQ ID NO:41)

[0241] MMAB In some embodiments, the MMA-related polypeptide is MMAB or a fragment and / or variant thereof.

[0242] "MMAB" is an abbreviation for the polypeptide encoded by the MMAB gene, also known as mitochondrial methylmalonic aciduria type B protein and corrinoid adenosyltransferase. MMAB catalyzes the final step in the conversion of vitamin B12 to adenosylcobalamin (AdoCbl) and can deliver AdoCbl to MMUT.

[0243] Fragments and / or variants of MMAB may retain MMAB activity (see, e.g., EC 2.5.1.17). For example, fragments and / or variants of MMAB may catalyze the final step in the conversion of vitamin B12 to AdoCbl and / or deliver AdoCbl to MMUT. Suitably, fragments and / or variants of MMAB may have the same or similar activity as MMAB, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of MMAB. Suitable assays for MMAB activity are known in the art (see, e.g., Forny, P., et al., 2021. Human genetics, pp.1-15).

[0244] One skilled in the art could generate fragments and / or variants using conservative substitutions based on the known structural and functional characteristics of MMAB (see, e.g., Forny, P., et al., 2021. Human genetics, pp.1-15; and Schubert, HL and Hill, CP, 2006. Biochemistry, 45(51), pp.15188-15196) and / or based on known variants (see, e.g., NCBI Gene ID:326625 and NCBI HomoloGene:12680). Suitably, the fragments and / or variants of MMAB include the cobalamin adenosyltransferase domain.

[0245] The MMAB gene is conserved in chimpanzees, rhesus monkeys, dogs, cows, mice, and rats. The MMAB may be human MMAB. Suitably, the MMAB may comprise or consist of the polypeptide sequence of UniProtKB Accession Q96EY8, or a fragment and / or variant thereof.

[0246] In some embodiments, the MMAB comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 42, or a fragment thereof. Suitably, the MMAB comprises or consists of an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 42, or a fragment thereof.

[0247] In some embodiments, the MMAB comprises or consists of SEQ ID NO: 42, or a fragment thereof.

[0248] TIFF2025513891000027.tif18159

[0249] Exemplary MMAB (SEQ ID NO:42)

[0250] Suitably, the MMAB variants may include one or more changes selected from C4R, R19H, R19Q, S52N, T62M, S69N, T222M, and M239K, which are considered to be mild (or potentially mild) changes based on clinical data.

[0251] Suitably, the nucleotide sequence encoding MMAB, or a fragment and / or variant thereof, may comprise or consist of the nucleotide sequence of NCBI reference sequence NM_052845, or a fragment and / or variant thereof.

[0252] In some embodiments, the nucleotide sequence encoding MMAB, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 43, or a fragment thereof. Suitably, the nucleotide sequence encoding MMAB, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 43, or a fragment thereof.

[0253] In some embodiments, the nucleotide sequence encoding MMAB, or a fragment and / or variant thereof, comprises or consists of the nucleotide sequence of SEQ ID NO: 43, or a fragment thereof.

[0254] TIFF2025513891000028.tif47159

[0255] Exemplary Nucleotides Encoding MMAB (SEQ ID NO:43)

[0256] MMADHC In some embodiments, the MMA-related polypeptide is MMADHC or a fragment and / or variant thereof.

[0257] "MMADHC" is an abbreviation for the polypeptide encoded by the MMADHC gene, also known as cobalamin transport protein CblD and mitochondrial methylmalonic aciduria and homocystinuria type D protein. MMADHC is involved in the metabolism and transport of cobalamin and plays an important role in processing and targeting the Cbl cofactor to the target enzyme. It has been suggested that MMACHC-bound Cbl can partner with MMADHC to transport it to methylmalonyl-CoA mutase (see, for example, Froese, DS, et al., 2015. Journal of Biological Chemistry, 290(49), pp.29167-29177).

[0258] Fragments and / or variants of MMADHC may retain MMADHC activity. For example, fragments and / or variants of MMADHC may transport Cbl to methylmalonyl-CoA mutase. Suitably, fragments and / or variants of MMADHC may have the same or similar activity as MMADHC, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of MMADHC.

[0259] The skilled artisan can identify the MMADHC gene by its known structural and functional characteristics (see, for example, Froese, DS, et al., 2015. Journal of Biological Chemistry, 290(49), pp.29167-29177; Jusufi, J., et al., 2014. Journal of inherited metabolic disease, 37(5), pp.841-849; Deme, JC, et al., 2012. Molecular genetics and metabolism, 107(3), pp.352-362; and Yamada, K., et al., 2015. Journal of Biological Chemistry, 290(49), pp.29155-29166) and / or by its known variants (see, for example, NCBI Gene ID:27249 and NCBI HomoloGene:9248), conservative substitutions could be used to generate fragments and / or variants.

[0260] The MMADHC gene is conserved in chimpanzees, rhesus monkeys, dogs, cows, mice, and rats. The MMADHC may be human MMADHC. Suitably, the MMADHC may comprise or consist of the polypeptide sequence of UniProtKB Accession Q9H3L0, or a fragment and / or variant thereof.

[0261] In some embodiments, MMADHC comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 44, or a fragment thereof. Suitably, MMADHC comprises or consists of an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 44, or a fragment thereof.

[0262] In some embodiments, the MMADHC comprises or consists of SEQ ID NO:44, or a fragment thereof.

[0263] TIFF2025513891000029.tif22159

[0264] Exemplary MMADHC (SEQ ID NO:44)

[0265] Suitably, the MMADHC variant may include one or more changes selected from K29N, E138K, S143I, R158Q, N206S, and P236L, which are considered to be mild (or potentially mild) changes based on clinical data.

[0266] Suitably, the nucleotide sequence encoding MMADHC, or a fragment and / or variant thereof, may comprise or consist of the nucleotide sequence of NCBI reference sequence NM_015702, or a fragment and / or variant thereof.

[0267] In some embodiments, the nucleotide sequence encoding MMADHC, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 45, or a fragment thereof. Suitably, the nucleotide sequence encoding MMADHC, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 45, or a fragment thereof.

[0268] In some embodiments, the nucleotide sequence encoding MMADHC, or a fragment and / or variant thereof, comprises or consists of the nucleotide sequence of SEQ ID NO: 45, or a fragment thereof.

[0269] TIFF2025513891000030.tif19159TIFF2025513891000031.tif38159

[0270] Exemplary nucleotide sequence encoding MMADHC (SEQ ID NO:45)

[0271] MCEE In some embodiments, the MMA-related polypeptide is an MCEE or a fragment and / or variant thereof.

[0272] "MCEE" is an abbreviation for the polypeptide encoded by the MCEE gene, also known as mitochondrial methylmalonyl-CoA epimerase and methylmalonyl-CoA racemase. MCEE interconverts D- and L-methylmalonyl-CoA during the degradation of branched-chain amino acids, odd-chain length fatty acids, and other metabolites.

[0273] Fragments and / or variants of MCEE may retain MCEE activity (see, e.g., EC 5.1.99.1). For example, fragments and / or variants of MCEE may convert (S)-methylmalonyl-CoA to (R)-methylmalonyl-CoA. Suitably, fragments and / or variants of MCEE may have the same or similar activity as MCEE, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the activity of MCEE. Suitable assays for MCEE activity are known in the art (see, e.g., Heuberger, K., et al., 2019. BBA-Molecular Basis of Disease, 1865(6), pp.1265-1272).

[0274] One skilled in the art could generate fragments and / or variants using conservative substitutions based on the known structural and functional characteristics of MCEE (see, e.g., Heuberger, K., et al., 2019. BBA-Molecular Basis of Disease, 1865(6), pp.1265-1272) and / or based on known variants (see, e.g., NCBI Gene ID:84693 and NCBI HomoloGene:13078).

[0275] The MCEE gene is conserved in chimpanzees, rhesus monkeys, dogs, cows, mice, and rats. The MCEE may be a human MCEE. Suitably, the MCEE may comprise or consist of the polypeptide sequence of UniProtKB Accession Q96PE7, or a fragment and / or variant thereof.

[0276] In some embodiments, the MCEE comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 46, or a fragment thereof. Suitably, the MCEE comprises or consists of an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 46, or a fragment thereof.

[0277] In some embodiments, the MCEE comprises or consists of SEQ ID NO: 46, or a fragment thereof.

[0278] TIFF2025513891000032.tif15159

[0279] Exemplary MCEE (SEQ ID NO:46)

[0280] Suitably, the MCEE variant may include one or more changes selected from A76V, R104L, and R143H, which are considered to be mild (or potentially mild) changes based on clinical data.

[0281] Suitably, the nucleotide sequence encoding MCEE, or a fragment and / or variant thereof, may comprise or consist of the nucleotide sequence of NCBI reference sequence NM_032601, or a fragment and / or variant thereof.

[0282] In some embodiments, the nucleotide sequence encoding an MCEE, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 47 or a fragment thereof. Suitably, the nucleotide sequence encoding an MCEE, or a fragment and / or variant thereof, comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 47 or a fragment thereof.

[0283] In some embodiments, the nucleotide sequence encoding an MCEE, or a fragment and / or variant thereof, comprises or consists of the nucleotide sequence of SEQ ID NO: 47, or a fragment thereof.

[0284] TIFF2025513891000033.tif34159

[0285] Exemplary nucleotide sequence encoding MCEE (SEQ ID NO:47)

[0286] Adjustment element The lentiviral vector of the present invention may further comprise one or more regulatory elements that can act pre- or post-transcriptionally.Preferably, the protein coding sequence is operably linked to one or more regulatory elements that can act pre- or post-transcriptionally.The one or more regulatory elements can promote the expression of the transgene in liver cells (e.g., hepatocytes).

[0287] As used herein, a "regulatory element" may refer to any nucleotide sequence that promotes expression of a polypeptide, for example, acts to increase expression of a transcript or to increase the stability of an mRNA. Suitable regulatory elements include, for example, promoters, enhancer elements, post-transcriptional regulatory elements, polyadenylation sites, and Kozak sequences.

[0288] promoter The lentiviral vector of the present invention may comprise a promoter, preferably a liver-specific (e.g., hepatocyte-specific) promoter. Suitably, the protein coding sequence is operably linked to a promoter, preferably a liver-specific (e.g., hepatocyte-specific) promoter.

[0289] "Promoter" can refer to a region of DNA that causes the initiation of transcription of a gene. The promoter is located upstream on the DNA (towards the 5' region of the sense strand), near the transcription start site of the gene.

[0290] As used herein, a "tissue-specific promoter" may refer to a promoter that preferentially promotes expression of a transgene in a particular type of cell or tissue. Suitably, a tissue-specific promoter may promote higher expression of a transgene in one cell type compared to other cell types. Higher expression may be measured, for example, by measuring the expression of a transgene, such as green fluorescent protein (GFP), operably linked to the promoter, where the expression of the transgene correlates with the ability of the promoter to promote expression of the gene. For example, a tissue-specific promoter may be a promoter that promotes a transgene expression level at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 100% higher, at least 200% higher, at least 300% higher, at least 400% higher, at least 500% higher, or at least 1000% higher in one cell type compared to the expression level in other cell types.

[0291] In some embodiments, the promoter is a liver-specific promoter. In some embodiments, the promoter is a hepatocyte-specific promoter.

[0292] Suitably, the promoter may be (or may be derived from) a promoter associated with a gene that has selective expression in human liver cells (e.g., hepatocytes). Suitably, the promoter may be (or may be derived from) a promoter associated with a gene that has selective expression in human hepatocyte cells. Methods for identifying promoters associated with genes are well known to those skilled in the art.

[0293] Exemplary liver-specific and / or hepatocyte-specific promoters are described in Kattenhorn, LM, et al., 2016. Human gene therapy, 27(12), pp.947-961, and include the transthyretin (TTR) promoter, the alpha-1-antitrypsin (AAT) promoter, the thyroxine-binding globulin (TBG) promoter, the APoE / hAAT promoter, the HCR-hAAT promoter, the LP1 promoter, and the HLP promoter.

[0294] Engineered promoter variants derived from any of these promoters can be used, provided they retain the ability to drive liver-specific and / or hepatocyte-specific expression of a transgene operably linked to the promoter. Those skilled in the art will arrive at such variants using methods known in the art. The variants may have at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of the promoters.

[0295] Fragments of any of these promoters (or variants thereof) can be used, provided that they retain the ability to drive liver-specific and / or hepatocyte-specific expression of a transgene operably linked to the promoter. Those skilled in the art can arrive at such fragments using methods known in the art. The fragments may be, for example, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, or at least 1000 nucleotides in length.

[0296] In some embodiments, the promoter is selected from the group consisting of a transthyretin (TTR) promoter, an alpha-1-antitrypsin (AAT) promoter, a thyroxine-binding globulin (TBG) promoter, an APoE / hAAT promoter, an HCR-hAAT promoter, an LP1 promoter, and an HLP promoter.

[0297] In some embodiments, the promoter is a TTR promoter, or a variant and / or fragment thereof. In some embodiments, the promoter is an Enh1mTTR (ET) promoter, or a variant and / or fragment thereof.

[0298] An exemplary ET promoter is provided in GenBank Accession No. AY661265. In some embodiments, the ET promoter comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 19 or a fragment thereof. Suitably, the ET promoter comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19 or a fragment thereof.

[0299] In some embodiments, the ET promoter comprises or consists of the nucleotide sequence of SEQ ID NO: 19, or a fragment thereof.

[0300] TIFF2025513891000034.tif11159TIFF2025513891000035.tif29159

[0301] Exemplary ET Promoter (SEQ ID NO:19)

[0302] In some embodiments, the promoter is the AAT promoter, or variants and / or fragments thereof. In some embodiments, the promoter is the human AAT (hAAT) promoter, or variants and / or fragments thereof.

[0303] In some embodiments, the hAAT promoter comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 20, or a fragment thereof. Suitably, the hAAT promoter comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 20, or a fragment thereof.

[0304] In some embodiments, the hAAT promoter comprises or consists of the nucleotide sequence of SEQ ID NO:20, or a fragment thereof.

[0305] TIFF2025513891000036.tif25160

[0306] Exemplary hAAT promoter (SEQ ID NO:20)

[0307] The promoter may be a constitutive promoter. As used herein, a "constitutive promoter" is a promoter that is always active.

[0308] Alternatively, the promoter may be an inducible promoter. As used herein, an "inducible promoter" is a promoter that is active only under certain conditions. For example, expression of the transgene may be induced by a small molecule or drug (e.g., binding to the promoter, regulatory sequence, or transcriptional repressor or activator molecule), or by using an environmental trigger. Types of inducible promoters include chemically inducible promoters (e.g., Tet-on system), temperature inducible promoters (e.g., Hsp70 or Hsp90 derived promoters), and light inducible promoters. Preferably, the promoter is chemically inducible. Any suitable method for engineering an inducible promoter may be used.

[0309] Enhancer elements The lentiviral vector of the present invention may comprise an enhancer, preferably a liver-specific (e.g., hepatocyte-specific) enhancer. Suitably, the protein coding sequence is operably linked to an enhancer, preferably a liver-specific (e.g., hepatocyte-specific) enhancer.

[0310] "Enhancer" or "enhancer element" may refer to a region of DNA that can be bound by a protein (activator) to increase the likelihood that transcription of a particular gene will occur. Enhancers are cis-acting. They can be located up to 1 Mbp (1,000,000 bp) away from the gene, either upstream or downstream from the start site.

[0311] As used herein, a "tissue-specific enhancer" is an enhancer that preferentially promotes the expression of a gene in a particular cell or tissue. Advantageously, a tissue-specific enhancer may promote higher expression of a gene in a particular cell type compared to other cell types. Higher expression may be measured, for example, by measuring the expression of a transgene, such as green fluorescent protein (GFP), operably linked to the enhancer, where the expression of the transgene correlates with the ability of the enhancer to promote expression of the gene. For example, a tissue-specific enhancer may be an enhancer that promotes gene expression levels at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 100% higher, at least 200% higher, at least 300% higher, at least 400% higher, at least 500% higher, or at least 1000% higher in a particular cell type compared to expression levels in other cell types.

[0312] Suitable tissue-specific enhancers are well known to those skilled in the art. The enhancer may be a liver-specific enhancer, preferably a hepatocyte-specific enhancer.

[0313] Suitably, the enhancer may be (or may be derived from) an enhancer associated with a gene that has selective expression in human liver cells (e.g., hepatocytes). Suitably, the enhancer may be (or may be derived from) an enhancer associated with a gene that has selective expression in human hepatocyte cells. Methods for identifying enhancer regions associated with genes are well known to those skilled in the art.

[0314] Exemplary liver-specific and / or hepatocyte-specific enhancers are described in Kramer, MG, et al., 2003. Molecular therapy, 7(3), pp.375-385, and include enhancer regions of the albumin, alpha 1-antitrypsin, Hepatitis B virus core protein, and hemopexin genes. Other liver-specific and / or hepatocyte-specific enhancers include the apolipoprotein E (APoE) enhancer, the hepatic control region (HCR) enhancer, and the alpha-1-antitrypsin (AAT) enhancer.

[0315] Engineered enhancer variants derived from any of these enhancers can be used, provided they retain the ability to drive liver-specific and / or hepatocyte-specific expression of a transgene operably linked to the enhancer. One skilled in the art would arrive at such variants using methods known in the art. The variants may have at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to any of the enhancers.

[0316] Fragments of any of these enhancers (or variants thereof) can be used, provided that they retain the ability to drive liver-specific and / or hepatocyte-specific expression of a transgene operably linked to the enhancer. Those skilled in the art can arrive at such fragments using methods known in the art. The fragments may be at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, or at least 1000 nucleotides in length.

[0317] The vector of the present invention may comprise a liver-specific promoter and / or a liver-specific enhancer, i.e., a liver-specific promoter and / or enhancer.Preferably, the protein coding sequence is operably linked to a liver-specific promoter and / or enhancer.Preferably, the protein coding sequence is operably linked to a hepatocyte-specific promoter and / or enhancer.The promoter and enhancer may be any combination of the above, for example, the hAAT promoter and the ApoE or HCR enhancer.

[0318] Post-transcriptional regulatory elements The lentiviral vector of the present invention may comprise one or more additional post-transcriptional regulatory elements (e.g., in addition to one or more miRNA target sequences).Preferably, the protein coding sequence is operably linked to one or more additional post-transcriptional regulatory elements.The additional post-transcriptional regulatory elements can improve gene expression.

[0319] The lentiviral vector of the present invention may include a Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE). Preferably, the protein coding sequence is operably linked to the WPRE.

[0320] Suitable WPRE sequences are well known to those skilled in the art (see, for example, Zufferey, R., et al., 1999. Journal of virology, 73(4), pp.2886-2892; and Zanta-Boussif, MA et al., 2009. Gene therapy, 16(5), pp.605-619). Suitably, the WPRE is a wild-type WPRE or a mutant WPRE. For example, the WPRE may be mutated to abolish translation of Woodchuck Hepatitis Virus X protein (WHX), for example, by mutating the WHX ORF translation initiation codon.

[0321] In some embodiments, the WPRE comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 21, or a fragment thereof. Suitably, the WPRE comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 21, or a fragment thereof.

[0322] In some embodiments, the WPRE comprises or consists of the nucleotide sequence of SEQ ID NO:21, or a fragment thereof.

[0323] TIFF2025513891000037.tif33160

[0324] Exemplary WPRE (SEQ ID NO:21)

[0325] Polyadenylation sequence The lentiviral vector of the present invention may include a polyadenylation sequence. Preferably, the protein coding sequence is operably linked to the polyadenylation sequence. The polyadenylation sequence may be inserted after the protein coding sequence to improve transgene expression.

[0326] Polyadenylation sequences typically include a polyadenylation signal, a polyadenylation site, and downstream elements: the polyadenylation signal contains a sequence motif recognized by an RNA cleavage complex; the polyadenylation site is the cleavage site where the polyA tail is added to the mRNA; the downstream elements are a GT-rich region usually immediately downstream of the polyadenylation site that is important for efficient processing.

[0327] Suitable polyadenylation sequences are well known to those skilled in the art (see, for example, Schambach, A., et al., 2007. Molecular Therapy, 15(6), pp.1167-1173; and Choi, JH et al., 2014. Molecular brain, 7(1), pp.1-10). Exemplary polyadenylation sequences include the bGH poly(A) signal sequence and the SV40pA signal sequence.

[0328] Suitably, the polyadenylation sequence may be present in the 3'LTR (ie the lentiviral vector does not contain an additional polyadenylation sequence).

[0329] Kozak sequence The lentiviral vector of the present invention may comprise a Kozak sequence. Preferably, the protein coding sequence is operably linked to the Kozak sequence. The Kozak sequence may be inserted before the start codon to improve the initiation of translation.

[0330] Suitable Kozak sequences are well known to those skilled in the art (see, for example, Kozak, M., 1987. Nucleic acids research, 15(20), pp.8125-8148).

[0331] In some embodiments, the Kozak sequence comprises or consists of a nucleotide sequence that is at least 80% identical to SEQ ID NO: 22, or a fragment thereof.

[0332] In some embodiments, the Kozak sequence comprises or consists of the nucleotide sequence of SEQ ID NO:22, or a fragment thereof.

[0333] GCCACC Exemplary Kozak sequence (SEQ ID NO:22)

[0334] Other cis-acting elements The lentiviral vectors of the present invention may also include any other suitable cis-acting elements, such as one or more of: a rev response element (RRE); a retroviral psi packaging element; a primer binding site (PBS); a TAT activation region (TAR); splice donor and acceptor sites; and central and terminal polypurine tracts.

[0335] Long terminal repeats (LTRs) The lentiviral vector of the present invention may contain one or more long terminal repeats (LTRs). As described above, LTRs are responsible for the integration and transcription of the provirus. Typically, naturally occurring LTRs include the U3, R, and U5 regions.

[0336] The lentiviral vector may comprise a 5'LTR and / or a 3'LTR. The lentiviral vector may comprise a 5'LTR and a 3'LTR. Preferably, the 5'LTR comprises an R and a U5 region, and optionally a U3 region. Preferably, the 3'LTR comprises a U3, an R, and a U5 region.

[0337] Suitable LTR sequences are well known to those skilled in the art (see, for example, Frech, K., et al., 1996. Virology, 224(1), pp.256-267).

[0338] In some embodiments, the LTR comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 23 or a fragment thereof. Suitably, the LTR comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 23 or a fragment thereof.

[0339] In some embodiments, the LTR comprises or consists of the nucleotide sequence of SEQ ID NO: 23, or a fragment thereof.

[0340] TIFF2025513891000038.tif19160

[0341] Exemplary LTR (SEQ ID NO:23)

[0342] The lentiviral vector of the present invention may contain one or more self-inactivating long terminal repeats (SIN-LTR). "SIN-LTR" may contain a deletion that eliminates the transcription of full-length virus after integration into host cells. For example, 3'SIN-LTR may contain a deletion in the U3 region that removes promoter / enhancer elements (see, for example, Zufferey, R., et al., 1998. Journal of virology, 72(12), pp.9873-9880). This deletion is copied to 5'LTR after reverse transcription, thereby making gene expression in target cells dependent on the selected internal promoter.

[0343] Suitable SIN-LTR sequences are well known to those skilled in the art (see, for example, Zufferey, R., et al., 1998. Journal of Virology, 72(12), pp.9873-9880 and Miyoshi, H., et al., 1998. Journal of Virology, 72(10), pp.8150-8157).

[0344] In some embodiments, the 5'LTR comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 24 or a fragment thereof. Suitably, the 5'LTR comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 24 or a fragment thereof.

[0345] In some embodiments, the 5'LTR comprises or consists of the nucleotide sequence of SEQ ID NO:24, or a fragment thereof.

[0346] TIFF2025513891000039.tif16160

[0347] Exemplary 5'LTR (SEQ ID NO:24)

[0348] In some embodiments, the 5'LTR and / or the 3'LTR comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 25 or a fragment thereof. Suitably, the 5'LTR and / or the 3'LTR comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 25 or a fragment thereof.

[0349] In some embodiments, the 5'LTR and / or the 3'LTR comprises or consists of the nucleotide sequence of SEQ ID NO: 25, or a fragment thereof.

[0350] In some embodiments, the 5'LTR and 3'LTR comprise or consist of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 25 or a fragment thereof. Suitably, the 5'LTR and 3'LTR comprise or consist of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 25 or a fragment thereof.

[0351] In some embodiments, the 5'LTR and the 3'LTR comprise or consist of the nucleotide sequence of SEQ ID NO: 25, or a fragment thereof.

[0352] TIFF2025513891000040.tif18160

[0353] Exemplary 3'LTR (SEQ ID NO:25)

[0354] Primer binding site (PBS) The lentiviral vector of the present invention may comprise a primer binding site (PBS), which is a cis-acting element to which a primer can bind to initiate reverse transcription of the RNA genome (see, for example, Lanchy, JM, et al., 1998. Journal of Biological Chemistry, 273(38), pp.24425-24432).

[0355] Suitable retroviral PBS are well known to those skilled in the art.

[0356] In some embodiments, the PBS comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 26 or a fragment thereof. Suitably, the PBS comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 26 or a fragment thereof.

[0357] In some embodiments, the PBS comprises or consists of the nucleotide sequence of SEQ ID NO: 26, or a fragment thereof.

[0358] TIFF2025513891000041.tif16160

[0359] Exemplary primer binding site (SEQ ID NO:26)

[0360] In some embodiments, the PBS comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 27 or a fragment thereof. Suitably, the PBS comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 27 or a fragment thereof.

[0361] In some embodiments, the PBS comprises or consists of the nucleotide sequence of SEQ ID NO: 27, or a fragment thereof.

[0362] TIFF2025513891000042.tif16160

[0363] Exemplary primer binding site (SEQ ID NO:27)

[0364] Retroviral psi packaging elements The lentiviral vector of the present invention may comprise retroviral psi packaging element.As mentioned above, retroviral psi packaging element is a cis-acting element that is involved in the regulation of the essential process of packaging retroviral RNA genome into viral capsid during replication (see, for example, McBride, MS, et al., 1997. Journal of virology, 71(6), pp.4544-4554).Retroviral psi packaging element can form part of the 5' region of gag gene.

[0365] Suitable retroviral psi packaging elements are well known to those of skill in the art.

[0366] In some embodiments, the retroviral psi packaging element comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 28, or a fragment thereof. Suitably, the retroviral psi packaging element comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 28, or a fragment thereof.

[0367] In some embodiments, the retroviral psi packaging element comprises or consists of the nucleotide sequence of SEQ ID NO:28, or a fragment thereof.

[0368] TIFF2025513891000043.tif27160

[0369] Exemplary retroviral psi packaging element (SEQ ID NO:28)

[0370] Rev response element (RRE) The lentiviral vector of the present invention may comprise a rev response element (RRE). As mentioned above, RRE is a cis-acting element that allows efficient transport of integrated proviral RNA transcripts from the nucleus to the cytoplasm of infected target cells (see, for example, Pollard, VW and Malim, MH, 1998. Annual review of microbiology, 52(1), pp.491-532).

[0371] Suitable RRE sequences are well known to those skilled in the art.

[0372] In some embodiments, the RRE comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 29 or a fragment thereof. Suitably, the RRE comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 29 or a fragment thereof.

[0373] In some embodiments, the RRE comprises or consists of the nucleotide sequence of SEQ ID NO:29, or a fragment thereof.

[0374] TIFF2025513891000044.tif21160

[0375] Exemplary rev response element (SEQ ID NO:29)

[0376] In some embodiments, the RRE comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 30, or a fragment thereof. Suitably, the RRE comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 30, or a fragment thereof.

[0377] In some embodiments, the RRE comprises or consists of the nucleotide sequence of SEQ ID NO: 30, or a fragment thereof.

[0378] TIFF2025513891000045.tif21160

[0379] Exemplary rev response element (SEQ ID NO:30)

[0380] Central Polyprint Tract (cPPT) The lentiviral vector of the present invention may comprise a central polypurine tract (cPPT).As mentioned above, the cPPT can allow the initiation of plus strand synthesis (see, for example, Follenzi, A. et al., 2000. Nature genetics, 25(2), pp.217-222).

[0381] Suitable cPPT sequences are well known to those of skill in the art.

[0382] In some embodiments, the cPPT comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 31, or a fragment thereof. Suitably, the cPPT comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 31, or a fragment thereof.

[0383] In some embodiments, the cPPT comprises or consists of the nucleotide sequence of SEQ ID NO:31, or a fragment thereof.

[0384] TIFF2025513891000046.tif12161

[0385] Exemplary central polypurine tract (SEQ ID NO:31)

[0386] Other elements The lentiviral vectors of the invention may also include any other suitable elements.

[0387] In some embodiments, lentiviral vectors of the invention comprise an element that comprises or consists of a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 32 or a fragment thereof. In some embodiments, lentiviral vectors of the invention comprise an element that comprises or consists of the nucleotide sequence of SEQ ID NO: 32 or a fragment thereof.

[0388] TIFF2025513891000047.tif14161

[0389] Exemplary Delta ENV1 (SEQ ID NO:32)

[0390] In some embodiments, lentiviral vectors of the invention comprise an element that comprises or consists of a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 33 or a fragment thereof. In some embodiments, lentiviral vectors of the invention comprise an element that comprises or consists of the nucleotide sequence of SEQ ID NO: 33 or a fragment thereof.

[0391] TIFF2025513891000048.tif30161

[0392] Exemplary Delta ENV2 (SEQ ID NO:33)

[0393] Exemplary cis-acting elements Lentiviral vectors of the invention may contain cis-acting elements including PBS, a retroviral psi packaging element, and a rev response element (RRE).

[0394] In some embodiments, the cis-acting elements, including the PBS, retroviral psi packaging element, and RRE, comprise or consist of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 34 or a fragment thereof. Suitably, the cis-acting elements, including the PBS, retroviral psi packaging element, and RRE, comprise or consist of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 34 or a fragment thereof.

[0395] In some embodiments, the cis-acting elements, including the PBS, retroviral psi packaging element, and RRE, comprise or consist of the nucleotide sequence of SEQ ID NO: 34, or a fragment thereof.

[0396] TIFF2025513891000049.tif53161

[0397] Exemplary cis-acting elements including PBS, retroviral psi packaging element, and RRE (SEQ ID NO:34)

[0398] Lentiviral vectors of the invention may comprise cis-acting elements including the PBS, a retroviral psi packaging element, a rev response element (RRE), and a central polypurine tract (cPPT).

[0399] In some embodiments, the cis-acting elements, including PBS, retroviral psi packaging elements, RRE, and cPPT, comprise or consist of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 35 or a fragment thereof. Suitably, the cis-acting elements, including PBS, retroviral psi packaging elements, RRE, and cPPT, comprise or consist of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 35 or a fragment thereof.

[0400] In some embodiments, the cis-acting elements, including the PBS, retroviral psi packaging element, RRE, and cPPT, comprise or consist of the nucleotide sequence of SEQ ID NO: 35, or a fragment thereof.

[0401] TIFF2025513891000050.tif87161

[0402] Exemplary cis-acting elements, including PBS, retroviral psi packaging element, RRE, and cPPT (SEQ ID NO:35).

[0403] Exemplary Lentiviral Genomes A lentiviral genome of the present invention can include, from 5' to 3', a 5'LTR, one or more cis-acting elements, a protein coding sequence, optionally one or more post-transcriptional regulatory sequences, and a 3'LTR.

[0404] For example, a lentiviral genome of the present invention can include, from 5' to 3', a 5'LTR, a PBS, a retroviral psi packaging element, an RRE, a cPPT, a liver-specific promoter, a protein coding sequence, a WPRE, one or more miRNA target sequences, and a 3'LTR.

[0405] The lentiviral genome of the invention may further comprise any other suitable elements, such as any other elements described herein or one or more spacer sequences. The spacer sequence(s) may comprise, for example, at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten nucleotide bases.

[0406] In some embodiments, the lentiviral genome comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 36 or a fragment thereof. Suitably, the lentiviral genome comprises or consists of a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 36 or a fragment thereof.

[0407] In some embodiments, the lentiviral genome comprises or consists of the nucleotide sequence of SEQ ID NO:36, or a fragment thereof.

[0408] TIFF2025513891000051.tif211161TIFF2025513891000052.tif101161

[0409] Exemplary Lentiviral Genome (SEQ ID NO:36)

[0410] Variants, Derivatives, Analogs, and Fragments In addition to the specific polypeptides and polynucleotides mentioned herein, the present invention also encompasses variants, derivatives, and fragments thereof.

[0411] In the context of the present invention, a "variant" of any given sequence is a sequence in which a specific sequence of residues (whether amino acid or nucleic acid residues) has been modified in such a manner that the polypeptide or polynucleotide in question retains at least one or all of its endogenous functions. Variant sequences can be obtained by addition, deletion, substitution, modification, replacement and / or change of at least one residue present in a naturally occurring polypeptide or polynucleotide.

[0412] The term "derivative", as used herein in reference to a protein or polypeptide of the invention, includes any substitution, change, modification, replacement, deletion and / or addition of one (or more) amino acid residues from or to the sequence, provided that the resulting protein or polypeptide retains at least one or all of its endogenous functions.

[0413] Typically, amino acid substitutions may be made, for example from 1, 2 or 3 to 10 or 20 substitutions, provided that the altered sequence retains the required activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues.

[0414] The polypeptides used in the present invention may also have deletions, insertions or substitutions of amino acid residues that produce silent changes and result in functionally equivalent polypeptides. Deliberate amino acid substitutions may be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the residues, so long as the intrinsic function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups with similar hydrophilicity values ​​include asparagine, glutamine, serine, threonine and tyrosine.

[0415] Conservative substitutions may be made, for example, according to the table below. Amino acids in the same row in column 2 and in the same line in column 3 may be substituted for each other:

[0416] [Table 1]

[0417] The effect of the addition, deletion, substitution, modification, replacement and / or alteration can be predicted using any suitable prediction tool, such as SIFT (Vaser, R., et al., 2016. Nature protocols, 11(1), pp.1-9), PolyPhen-2 (Adzhubei, I., et al., 2013. Current protocols in human genetics, 76(1), pp.7-20), CADD (Rentzsch, P., et al., 2021. Genome medicine, 13(1), pp.1-12), REVEL (Ioannidis, NM, et al., 2016. The American Journal of Human Genetics, 99(4), pp.877-885), MetaLR (Dong, C., et al., 2015. Human molecular genetics, 24(8), pp.2125-2137), and / or MutationAssessor (Reva, B., et al., 2011. Nucleic acids research, 39(17), pp.e118-e118), or based on clinical data, e.g., ClinVar (Landrum, MJ, et al., 2016. Nucleic acids research, 44(D1), pp.D862-D868). Suitable additions, deletions, substitutions, modifications, replacements and / or changes may be considered to be tolerated, mild, and / or likely to be mild.

[0418] Typically, the variants will have a certain identity with the wild-type amino acid sequence or the wild-type nucleotide sequence.

[0419] In the present context, a variant sequence is taken to include an amino acid sequence which may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% identical to the subject sequence, suitably at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical. Variants can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties / functions), although in the context of the present invention it is preferred to express them in terms of sequence identity.

[0420] In the present context, a variant sequence is taken to include a nucleotide sequence which may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% identical to the subject sequence, preferably at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical. Variants can also be considered in terms of similarity, although in the context of the present invention it is preferred to express them in terms of sequence identity.

[0421] Suitably, reference to a sequence having a percent identity to any one of the SEQ ID NOs detailed herein refers to a sequence having the stated percent identity over the entire length of the referenced SEQ ID NO.

[0422] Sequence identity comparisons can be performed by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percent identity between two or more sequences.

[0423] Percent identity may be calculated over a contiguous sequence, i.e., one sequence is aligned with the other sequence and each amino acid or nucleotide in one sequence is directly compared to the corresponding amino acid or nucleotide in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively small number of residues.

[0424] Although this is a very simple and consistent method, it does not take into account that, for example, in an otherwise identical sequence pair, a single insertion or deletion in an amino acid or nucleotide sequence can exclude subsequent residues or codons from the alignment, thus potentially resulting in a large reduction in the percent identity when a global alignment is performed. As a result, most sequence comparison methods are designed to produce an optimal alignment that takes into account possible insertions and deletions without unduly penalizing the overall identity score. This is achieved by inserting "gaps" in the sequence alignment in an attempt to maximize local identity.

[0425] However, these more complex methods assign a "gap penalty" to each gap that occurs in the alignment, so that a sequence alignment with as few gaps as possible, reflecting a higher relatedness between the two compared sequences for the same number of identical amino acids or nucleotides, will achieve a higher score than one with many gaps. Typically, an "affine gap cost" is used, which imposes a relatively high cost on the existence of a gap and a smaller penalty on each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties result in optimized alignments with fewer gaps. Most alignment programs allow the gap penalty to be modified. However, it is preferred to use the default values ​​when using such software for sequence comparison. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

[0426] Therefore, the calculation of maximum percent identity first requires the production of an optimal alignment, taking into account gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (see, for example, Devereux, J., et al., 1984. Nucleic acids research, 12(1), pp.387-395). Examples of other software capable of performing sequence comparisons include, but are not limited to, the BLAST package (see, e.g., Altschul, SF, et al., 1990. Journal of molecular biology, 215(3), pp.403-410), BLAST 2 (see, e.g., Tatusova, TA and Madden, TL, 1999. FEMS microbiology letters, 174(2), pp.247-250), FASTA (see, e.g., Pearson, WR and Lipman, DJ, 1988. PNAS, 85(8), pp.2444-2448), EMBOSS Needle (Madeira, F., et al., 2019. Nucleic acids research, 47(W1), pp.W636-W641) and the comparison tool of the GENEWORKS suite. In some applications, it is preferable to use the EMBOSS Needle.

[0427] Although the final percent identity can be measured, the alignment process itself is typically not based on an all-or-nothing pairwise comparison. Instead, a scaled similarity score matrix is ​​generally used that assigns a score to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix.

[0428] Once the software has produced an optimal alignment, it is possible to calculate the percent sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result. The percent sequence identity may be calculated as the number of identical residues as a percentage of the total residues in the referenced SEQ ID NO.

[0429] A "fragment" is also a variant, and the term typically refers to a selected region of a polypeptide or polynucleotide that is of interest, either functionally or, for example, in an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0430] Such variants, derivatives, and fragments may be prepared using standard recombinant DNA techniques such as site-directed mutagenesis. Where the insertion is to be made, synthetic DNA may be made that encodes the insertion, with 5' and 3' flanking regions corresponding to the naturally occurring sequence on either side of the insertion site. The flanking regions contain convenient restriction sites corresponding to sites in the naturally occurring sequence, so that the sequence can be cleaved with the appropriate enzyme(s) and the synthetic DNA ligated to the cleavage. The DNA is then expressed according to the invention to produce the encoded polypeptide. These methods are merely illustrative of the many standard techniques known in the art for the manipulation of DNA sequences, and other known techniques may also be used.

[0431] Production Method In one aspect, the invention provides a method for producing a lentiviral vector according to the invention.

[0432] Suitable methods for producing lentiviral vectors are well known to those skilled in the art (see, for example, Merten, OW, et al., 2016. Molecular Therapy-Methods & Clinical Development, 3, p.16017).

[0433] The production method may include the steps of: (a) introducing a transfer vector and one or more helper vectors into a host cell; (b) culturing the host cell under conditions suitable for producing a lentiviral vector according to the invention; and (c) obtaining the lentiviral vector from the host cell.

[0434] As used herein, a "transfer vector" may encode a lentiviral genome of the present invention. Suitably, the transfer vector used to produce the lentiviral viral genome in a host / packaging cell has sufficient lentiviral genetic information to allow packaging of the RNA genome, in the presence of packaging components (e.g., gag-pol, rev, env), into a viral particle capable of infecting a target cell but incapable of independent replication to produce an infectious viral particle in the final target cell.

[0435] The transfer vector used to produce the viral genome in the host cell / packaging cell may contain transcriptional regulatory control sequences operably linked to the lentiviral genome to direct transcription of the genome in the host cell / packaging cell. These regulatory sequences may be the native sequences associated with the transcribed viral sequence (i.e., the 5'U3 region) or they may be a heterologous promoter, such as another viral promoter (e.g., the CMV promoter). The transfer vector may be a plasmid.

[0436] As used herein, a "helper vector" may encode one or more packaging components (e.g., gag-pol, rev, env). The nucleotide sequence encoding the packaging component(s) may be operably linked to a promoter (e.g., a CMV promoter or an RSV promoter) and / or a polyadenylation signal. The term "helper vector" may include "packaging vectors" (e.g., encoding gag-pol or rev) and "envelope vectors" (e.g., encoding an env gene such as VSV-g). The helper vector, packaging vector, and / or envelope vector may be a plasmid.

[0437] The transfer vector and one or more helper vectors may be introduced into the host cell by any suitable technique known in the art, such as transfection, transduction and / or transformation. Suitably, the helper vector may be transiently transfected or transduced into the host cell, or stably maintained in the host cell (e.g., stably integrated into the cell genome or maintained episomally). Alternatively, a combination of transient transfection or transduction and stable maintenance may be used to introduce the helper vector into the host cell.

[0438] Preferably, the transfer vector and / or the helper vector are plasmids and may be introduced by transfection. Preferably, a four-plasmid system may be used, consisting of a transfer plasmid and three helper plasmids. The three helper plasmids may consist of a first helper plasmid encoding the gag-pol gene, a second helper plasmid encoding the rev gene, and a third helper plasmid encoding the env gene. Alternatively, a three-plasmid system may be used, consisting of a transfer plasmid, one helper plasmid encoding the gag-pol and rev genes, and one helper plasmid encoding the env gene. Alternatively, a two-plasmid system may be used, in which all helper functions (e.g., gag-pol, rev, and env) are encoded by one helper plasmid.

[0439] Any suitable host cell can be used to produce lentiviral vectors. Suitable host cells include producer cells and packaging cells, such as those described below (e.g., HEK293 or derivatives thereof). Suitable conditions for culturing host cells are well known to those skilled in the art. For example, host cells can be incubated in a chemically defined medium for about 1 to about 5 days (e.g., about 48 hours, about 72 hours, or about 96 hours).

[0440] The lentiviral vector may be obtained using any suitable method known in the art. For example, the culture supernatant may be harvested and the lentiviral vector may then be purified from the culture supernatant (e.g., by centrifugation, membrane filtration and / or chromatography). The production method may further include any other suitable processing steps, such as DNA reduction, concentration, formulation and / or sterilization.

[0441] Vectors, kits and systems In one aspect, the present invention provides a vector encoding the lentiviral genome of the present invention. The vector may be a transfer vector as described herein. For example, the vector may be a plasmid and / or the lentiviral genome may be operably linked to a promoter (e.g., a viral promoter, such as a CMV promoter).

[0442] In one aspect, the invention provides a kit or system for producing the lentiviral vector of the invention.

[0443] The kit or system may be a lentiviral packaging kit or system, or a lentiviral production kit or system. As used herein, a "lentiviral packaging kit or system" may include one or more components, and optionally instructions, for packaging a lentiviral vector of the present invention. As used herein, a "lentiviral production kit or system" may include one or more components, and optionally instructions, for producing a lentiviral vector of the present invention.

[0444] The kit or system may include a transfer vector encoding a lentiviral genome of the invention, and optionally one or more helper vectors. The kit or system may further include host cells (e.g., packaging or production cells) and / or other reagents (e.g., transfection reagents, culture media, etc.). The kit or system may further include any other suitable components, and optionally instructions, for packaging and / or producing the lentiviral vector of the invention.

[0445] cell In one aspect, the present invention provides a cell comprising the lentiviral vector of the present invention. The cell may be an isolated cell. Suitably, the cell is a mammalian cell, such as a human cell. The cell may be an isolated human cell.

[0446] Suitably, the cell may be a producer cell. The term "producer cell" includes any cell that produces viral particles after transient transfection, stable transfection or vector transduction of all the elements necessary to produce viral particles, or any cell that has been engineered to stably contain the elements necessary to produce viral particles. Suitable producer cells are well known to those skilled in the art and may include HEK293, COS-1, COS-7, CV-1, HeLa, CHO, and A549 cell lines. In some embodiments, the producer cell is a HEK293 cell or a derivative thereof (e.g., HEK293T cell, HEK293T Lenti-X, HEK293T-Rex cell, HEK293FT cell, HEK293SF-3F6 cell, HEK293SF-3F9 cell, HEK293-EBNA1 cell, or SJ293TS cell).

[0447] Suitably, the cell may be a packaging cell. The term "packaging cell" includes cells that contain some or all of the elements required to package a recombinant viral genome. Typically, such packaging cells contain one or more vectors capable of expressing viral structural proteins (e.g., gag-pol, rev, env), and / or one or more genes encoding viral structural proteins are integrated into the genome of the packaging cell. Cells that contain only some of the elements required for the production of enveloped viral particles are useful as intermediate reagents in the generation of viral particle production cell lines through subsequent steps of transient transfection, transduction or stable integration of each additional required element. These intermediate reagents are encompassed by the term "packaging cell". Suitable packaging cells are well known to those skilled in the art (see, for example, Merten, OW, et al., 2016. Molecular Therapy-Methods & Clinical Development, 3, p.16017).

[0448] Preferably, the cell may be a liver cell, such as a hepatocyte. Preferably, the cell may be an immortalized liver cell, such as an immortalized hepatocyte. Suitable cell lines are known to those skilled in the art, such as HepG2, Hep3B, HBG, and HepaRG cell lines. Methods for generating immortalized liver cells (e.g., immortalized hepatocytes) are known to those skilled in the art (see, for example, Ramboer, E., et al., 2015. Methods Mol Biol, 1250, pp.53-76). Preferably, the cell may be a stem cell.

[0449] Pharmaceutical Compositions In one aspect, the invention provides a pharmaceutical composition comprising the lentiviral vector or cell of the invention. In a preferred embodiment, the pharmaceutical composition comprises the lentiviral vector of the invention in the form of a lentiviral particle.

[0450] A pharmaceutical composition is a composition that comprises or consists of a therapeutically effective amount of a pharma- ceutical active agent, such as a lentiviral vector. A pharmaceutical composition preferably comprises a pharma- ceutical acceptable carrier, diluent or excipient (including combinations thereof).

[0451] "Pharmaceutically acceptable" includes that the formulation is sterile and pyrogen-free. The carrier, diluent, and / or excipient must be "acceptable" in the sense of being compatible with the lentiviral vector and not harmful to the recipient thereof. Typically, the carrier, diluent, and excipient is a saline solution or injection medium that is sterile and pyrogen-free, although other acceptable carriers, diluents, and excipients may be used.

[0452] Acceptable carriers, diluents, and excipients for therapeutic use are well known in the pharmaceutical art. The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical composition may comprise as (or in addition to) the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s) or solubilizing agent(s).

[0453] Examples of pharma- ceutically acceptable carriers include, for example, water, salt solutions, alcohol, silicones, waxes, petrolatum, vegetable oils, polyethylene glycol, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, flavor oils, fatty acid mono- and diglycerides, petroethral fatty acid esters, hydroxymethyl-cellulose, polyvinylpyrrolidone, and the like.

[0454] The lentiviral vector, cell or pharmaceutical composition according to the present invention may be administered in a suitable manner to treat and / or prevent the diseases described herein. Suitable routes of administration are known to those skilled in the art (see, for example, Fumoto, S., et al., 2013. Novel Gene Therapy Approaches, pp.3-31). The amount and frequency of administration can be determined by those skilled in the art depending on factors such as the subject's condition and the type and severity of the subject's disease. The pharmaceutical composition can be formulated accordingly.

[0455] The lentiviral vector, cell or pharmaceutical composition according to the invention may be administered parenterally (e.g., intravenously, intraarterially, intramuscularly, intrathecally, subcutaneously) or by infusion techniques. The lentiviral vector, cell or pharmaceutical composition may be administered in the form of a sterile aqueous solution which may contain other substances, for example sufficient salts or glucose to make the solution isotonic with blood. The aqueous solution may be suitably buffered (preferably to a pH of from 3 to 9). The pharmaceutical composition may be formulated accordingly. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.

[0456] The lentiviral vector, cell or pharmaceutical composition according to the present invention may be administered systemically, for example, by intravenous or intraperitoneal injection. In some embodiments, the lentiviral vector, cell or pharmaceutical composition according to the present invention is administered by intravenous injection. The pharmaceutical composition may be formulated accordingly.

[0457] The lentiviral vector, cell or pharmaceutical composition according to the invention may be administered locally, for example, by direct injection, intra-arterial injection, or intra-portal injection. In some embodiments, the lentiviral vector, cell or pharmaceutical composition according to the invention is administered locally to the liver. In some embodiments, the lentiviral vector, cell or pharmaceutical composition according to the invention is administered by intrahepatic injection, intrahepatic arterial injection, or intra-portal injection. The pharmaceutical composition may be formulated accordingly.

[0458] The pharmaceutical composition may comprise the lentiviral vector or cells of the invention in an injection medium, such as a sterile isotonic solution. The pharmaceutical composition may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0459] The lentiviral vector, cell or pharmaceutical composition may be administered in a single dose or multiple doses. Suitably, the lentiviral vector, cell or pharmaceutical composition may be administered in a single, one-time dose. The pharmaceutical composition may be formulated accordingly.

[0460] The lentiviral vectors, cells or pharmaceutical compositions may be administered in a variety of doses (e.g., measured in transducing units (TU) per kg). In any event, a physician may determine the actual dosage that will be most suitable for any individual subject, and dosage may vary, for example, with the age, weight and response of the particular subject. Preferably, the lentiviral vectors of the present invention are administered in a dose range of at least about 10 8 TU / kg, at least about 10 9 TU / kg, or at least about 10 10 Preferably, the lentiviral vector of the present invention is administered at a dose of about 10 13 TU / kg or less, approximately 10 12 TU / kg or less, or about 10 11 Preferably, the lentiviral vector of the present invention is administered at a dose of about 10 8 ~about 10 13 TU / kg, approx. 10 9 ~about 10 13 TU / kg, or about 10 10 ~about 10 13 Preferably, the lentiviral vector of the present invention is administered at a dose of about 10 8 ~about 10 12 TU / kg, approx. 10 9 ~about 10 12 TU / kg, or about 10 10 ~about 10 12 Preferably, the lentiviral vector of the present invention is administered at a dose of about 10 8 ~about 10 11 TU / kg, approx. 10 9 ~about 10 11 TU / kg, or about 10 10 ~about 10 11 In some embodiments, the lentiviral vector of the present invention is administered at a dose of about 10 8 ~about 10 11 TU / kg, approx. 10 8 ~about 10 10 TU / kg, or about 10 9 ~about 10 10In some embodiments, the lentiviral vector of the present invention is administered at a dose of about 10 9 ~about 10 10 It is administered in a dose of TU / kg. The pharmaceutical composition can be formulated accordingly.

[0461] The pharmaceutical composition may further comprise one or more other therapeutic agents.

[0462] The present invention further includes kits comprising the lentiviral vectors, cells and / or pharmaceutical compositions of the present invention. Preferably, said kits are for use in the methods and uses described herein, such as the therapeutic methods described herein. Preferably, said kits include instructions for use of the kit components.

[0463] Methods for Treating and / or Preventing Disease In one aspect, the present invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the present invention for use as a medicament.

[0464] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament.

[0465] In one aspect, the present invention provides a method of administering a therapeutically effective amount of a lentiviral vector, a cell or a pharmaceutical composition according to the present invention to a subject in need thereof.

[0466] The lentiviral vector-mediated gene therapy described herein may allow stable gene transfer even in pediatric patients at the earliest disease stages due to lentiviral vector genome integration.

[0467] After administration of the lentiviral vector of the present invention, the lentiviral vector can be integrated into the genome of liver cells (e.g., hepatocyte cells).Then, the lentiviral vector can be maintained in the genome of liver cells (e.g., hepatocyte cells) as they replicate.The integration of the lentiviral vector in the genome of liver cells can be determined by integration site (IS) analysis (e.g., quantitative high-throughput vector IS analysis).Suitable methods are known in the art (e.g., see Cantore, A., et al., 2015. Science translational medicine, 7(277), p.277ra28).

[0468] The lentiviral vector, cell or pharmaceutical composition may be administered to any subject in need thereof. The subject may be a mammal (e.g., a human). In some embodiments, the subject is male. In some embodiments, the subject is female. In a preferred embodiment, the lentiviral vector is administered in the form of a lentiviral particle.

[0469] In some embodiments, the subject is a juvenile, an adolescent, or a child. The term "juvenile" may refer to an individual who has not yet reached adulthood. The term "adolescent" may refer to an individual between the onset of adolescence and adulthood. The term "child" may refer to an individual between birth and the adolescent stage.

[0470] In some embodiments, the subject is a young child, toddler, or infant. The term "young child" may refer to a human subject between 3 and 5 years of age. The term "toddler" may refer to a human subject between 1 and 3 years of age. The term "infant" may refer to a human subject under the age of 12 months.

[0471] In some embodiments, the subject is a pediatric patient. The term "pediatric patient" can refer to a human subject aged about 18 to 21 years (see, for example, Sawyer, SM, et al., 2019. The Lancet Child & Adolescent Health, 3(11), pp.822-830).

[0472] In some embodiments, the subject is a neonatal patient or an infant patient. The term "neonatal patient" may refer to a human subject up to about 4 weeks of age. The term "infant patient" may refer to a human subject from about 4 weeks to about 1 year of age.

[0473] In other embodiments, the subject is an adult. The human liver is expected to be completely renewed every 5 years in humans, and therefore integrative vectors are expected to be more persistent compared to primarily episomal vectors (e.g., AAV).

[0474] The lentiviral vector-mediated gene therapy described herein may allow for long-term treatment and / or prevention (e.g., after administration of a single, one-time dose). For example, the vector-mediated gene therapy described herein may be effective for a period of at least about 6 months or more, at least about 7 months or more, at least about 8 months or more, at least about 9 months or more, at least about 10 months or more, at least about 11 months or more, or at least about 1 year or more.

[0475] Methylmalonic acidemia (MMA) The vector, cell or pharmaceutical composition according to the invention may be used for preventing and / or treating methylmalonic acidemia (MMA).

[0476] In one aspect, the invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the invention for use in the prevention or treatment of methylmalonic acidemia (MMA).

[0477] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament for preventing or treating methylmalonic acidemia (MMA).

[0478] In one aspect, the present invention provides a method for preventing or treating methylmalonic acidemia (MMA), comprising the step of administering a therapeutically effective amount of a lentiviral vector, cell or pharmaceutical composition according to the present invention to a subject in need thereof.

[0479] As mentioned above, methylmalonic acidemia (MMA), also known as methylmalonic aciduria, is a group of inborn errors of metabolism associated with elevated concentrations of methylmalonic acid in the blood and urine, resulting from the inability to convert methylmalonyl-CoA to succinyl-CoA during propionyl-CoA metabolism in the mitochondrial matrix.

[0480] In a preferred embodiment, the MMA is isolated MMA (iMMA). As used herein, "isolated MMA" or "iMMA" may refer to MMA that is not accompanied by hyperhomocysteinemia or homocystinuria, hypomethioninemia, or changes in other metabolites such as malonic acid (see, e.g., Manoli I, et al. 2005. Isolated Methylmalonic Acidemia. In GeneReviews).

[0481] MMA and iMMA can be subgrouped according to genetic defects, clinical symptoms, and / or laboratory findings (see, e.g., Horster, F., et al., 2007. Pediatric research, 62(2), pp.225-230; and Keyfi, F., et al., 2016. Reports of biochemistry & molecular biology, 5(1), pp.1-14). Subtypes can include mut-MMA, cblA-MMA, cblB-MMA, cblD-MMA, and MCEE deficiency.

[0482] Generally, the mut form of MMA is non-responsive to vitamin B12 therapy. Patients with defects in the synthesis of AdoCbl are usually responsive to vitamin B12 therapy and are classified as the "cbl" type. Definitive diagnosis of MMA can be based on urinary organic acid analysis using gas chromatography / mass spectrometry. Patients with mut-MMA may have a urinary methylmalonic acid concentration of about 1000 to about 10000 mmol / mol creatinine, patients with cbl-MMA may have a urinary methylmalonic acid concentration of about 10 to about 100 mmol / mol creatinine, and / or patients with MCEE deficiency may have a urinary methylmalonic acid concentration of about 50 to about 1500 mmol / mol creatinine. MMA subtypes may be further diagnosed by enzyme assay analysis and / or molecular studies (see, e.g., Keyfi, F., et al., 2016. Reports of biochemistry & molecular biology, 5(1), pp.1-14).

[0483] In some embodiments, the MMA is selected from mut-MMA, cblA-MMA, cblB-MMA, cblD-MMA, and MCEE-deficient. In preferred embodiments, the MMA is mut-MMA.

[0484] After administration of the lentiviral vector of the present invention to a subject in need thereof, plasma methylmalonic acid levels may be prevented from increasing or reduced. Preferably, plasma methylmalonic acid levels may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. Preferably, after administration, the subject's plasma methylmalonic acid levels may be less than about 500 μmol / L, or less than about 200 μmol / L. After administration of the lentiviral vector of the present invention to a subject in need thereof, plasma methylmalonic acid levels may be normalized. Normal plasma methylmalonic acid levels may be <0.27 μmol / L (see, for example, Manoli I, et al. 2005. Isolated Methylmalonic Acidemia. In GeneReviews). Plasma methylmalonic acid levels may be determined by any method known in the art, for example, as described in Rizzo, C., et al., 2014. Clinica chimica acta, 429, pp.30-33.

[0485] After administration of the lentiviral vector of the present invention to a subject in need thereof, the urinary methylmalonic acid level may be prevented from increasing or reduced. Preferably, the urinary methylmalonic acid level may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. Preferably, after administration, the urinary methylmalonic acid level of the subject may be less than about 5000 mmol / mol Cr, less than about 2000 mmol / mol Cr, or less than about 1000 mmol / mol Cr. After administration of the lentiviral vector of the present invention to a subject in need thereof, the urinary methylmalonic acid level may be normalized. A normal urinary methylmalonic acid level may be <4 mmol / mol Cr (see, for example, Manoli I, et al. 2005. Isolated Methylmalonic Acidemia. In GeneReviews). Urinary methylmalonic acid levels may be determined by any method known in the art, for example, as described in Rasmussen, K., 1989. Clinical chemistry, 35(2), pp.260-264.

[0486] After administration of the lentiviral vector of the present invention to a subject in need thereof, liver methylmalonic acid levels can be prevented from increasing or reduced. Preferably, liver methylmalonic acid levels can be reduced by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. Preferably, after administration, the liver methylmalonic acid levels of the subject can be less than about 50 μmol / L, less than about 10 μmol / L, or less than about 5 μmol / L. After administration of the lentiviral vector of the present invention to a subject in need thereof, liver methylmalonic acid levels can be normalized. Liver methylmalonic acid levels can be determined by any method known in the art, for example, as disclosed herein.

[0487] After administration of the lentiviral vector of the present invention to a subject in need thereof, renal methylmalonic acid levels may be prevented from increasing or reduced. Preferably, renal methylmalonic acid levels may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. Preferably, after administration, the subject's renal methylmalonic acid levels may be less than about 100 μmol / L, or less than about 50 μmol / L. After administration of the lentiviral vector of the present invention to a subject in need thereof, renal methylmalonic acid levels may be normalized. Renal methylmalonic acid levels may be determined by any method known in the art, for example, as disclosed herein.

[0488] After administration of the lentiviral vector of the present invention to a subject in need thereof, brain methylmalonic acid levels may be prevented from increasing or reduced. Preferably, brain methylmalonic acid levels may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. Preferably, after administration, the subject's brain methylmalonic acid levels may be less than about 25 μmol / L, or less than about 20 μmol / L. After administration of the lentiviral vector of the present invention to a subject in need thereof, brain methylmalonic acid levels may be normalized. Brain methylmalonic acid levels may be determined by any method known in the art, for example, as disclosed herein.

[0489] After administration of the lentiviral vector of the present invention to a subject in need thereof, the mitochondrial function of the subject may be improved. Mitochondrial function may be determined by any suitable method known in the art, for example, by measuring biochemical markers such as mitochondrial membrane potential, lactate, pyruvate, creatine kinase, acylcarnitine, and amino acids (e.g., alanine, glycine, proline, and threonine), see, for example, Hubens, WHG, et al., 2021. Mitochondrion, 62, pp.187-204. Preferably, after administration of the lentiviral vector of the present invention to a subject in need thereof, plasma FGF21 levels may be prevented from increasing or reduced. Preferably, plasma FGF21 levels may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. Preferably, after administration, the subject's plasma FGF21 levels may be less than about 1000 pg / ml. After administration of the lentiviral vector of the present invention to a subject in need thereof, plasma FGF21 level can be normalized.Normal plasma FGF21 level can be <200pg / ml.Plasma FGF21 level can be determined by any method known in the art, for example, as described in Manoli, I., et al., 2018. JCI insight, 3(23), e124351.

[0490] After administration of the lentiviral vector of the present invention to a subject in need thereof, hepatic mitochondrial disease, renal mitochondrial disease, and / or hepatorenal mitochondrial disease can be improved. After administration of the lentiviral vector of the present invention to a subject in need thereof, megamitochondria formation (e.g., in the liver) can be reduced and / or prevented. The progression of hepatic, renal, and / or hepatorenal mitochondrial disease and / or the formation of megamitochondria can be determined by any suitable method known in the art (see, for example, Chandler, RJ, et al., 2009. The FASEB Journal, 23(4), pp.1252-1261), for example, by electron microscopy analysis. Preferably, after administration of the lentiviral vector of the present invention to a subject in need thereof, mitochondrial area, perimeter and / or mitochondrial shape in the liver are normalized (e.g., any difference compared to phenotypically normal subjects may not be statistically significant). Preferably, following administration of the lentiviral vector of the present invention to a subject in need thereof, the number of circular structures in mitochondria in the kidney is normalized (e.g., any differences compared to phenotypically normal subjects may not be statistically significant).

[0491] After administration of the lentiviral vector of the present invention to a subject in need thereof, glutathione deficiency (e.g., in the liver) can be reduced and / or prevented. After administration of the lentiviral vector of the present invention to a subject in need thereof, glutathione levels (e.g., hepatic glutathione levels) can be normalized. Glutathione levels can be determined by any suitable method known in the art (see, for example, Chandler, RJ, et al., 2009. The FASEB Journal, 23(4), pp.1252-1261).

[0492] After administration of the lentiviral vector of the present invention to a subject in need thereof, growth deficiency can be reduced and / or prevented.After administration of the lentiviral vector of the present invention to a subject in need thereof, growth can be normalized.Growth can be determined by any suitable method known in the art, for example, using weight-for-age z-score and / or height-for-age z-score.

[0493] Mut-type MMA (mut-MMA) mut-MMA (MCID: MTH076, OMIM: 251000), also known as methylmalonic aciduria due to methylmalonyl-CoA mutase deficiency, is caused by various mutations in MMUT, the gene encoding mitochondrial methylmalonyl-CoA mutase.

[0494] mut-MMA is a mutant of the MMUT-encoded enzyme methylmalonyl-CoA mutase. 0 Enzyme subtype) missing or partial (mut - OH-Cbl responsiveness can be caused by mut 0 This may be used to distinguish between the mut- and mut-subtypes (see, e.g., Horster, F., et al., 2007. Pediatric research, 62(2), pp.225-230). For example, patient cells that show at least a 1.5-fold increase in propionate incorporation after administration of OH-Cbl are mut ‐ whereas patient cells with little or no increase may be classified as mut 0 It may be classified as follows.

[0495] In some embodiments, the MMA is mut-MMA and the MMA-related polypeptide is MMUT or a fragment and / or variant thereof. 0 Subtype or mut - In some embodiments, the mut-MMA may be a subtype of mut 0 It is a subtype.

[0496] In one aspect, the present invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the present invention for use in the prevention or treatment of mut-MMA.

[0497] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament for preventing or treating mut-MMA.

[0498] In one aspect, the present invention provides a method for preventing or treating mut-MMA, comprising the step of administering a therapeutically effective amount of a lentiviral vector, cell or pharmaceutical composition according to the present invention to a subject in need thereof.

[0499] cblA-MMA cblA-MMA (MCID: MTH077, OMIM: 251100), also known as methylmalonic aciduria, CblA type, is caused by various mutations in MMAA, the gene that encodes the mitochondrial methylmalonic aciduria type A protein.

[0500] In some embodiments, the MMA is cblA-MMA and the MMA-related polypeptide is MMAA or a fragment and / or variant thereof.

[0501] In one aspect, the invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the invention for use in the prevention or treatment of cblA-MMA.

[0502] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament for preventing or treating cblA-MMA.

[0503] In one aspect, the present invention provides a method for preventing or treating cblA-MMA, comprising administering a therapeutically effective amount of a lentiviral vector, cell or pharmaceutical composition according to the present invention to a subject in need thereof.

[0504] cblB MMA (cblB-MMA) cblB-MMA (MCID: MTH078, OMIM: 251110), also known as methylmalonic aciduria, CblB type, is caused by various mutations in MMAB, the gene that encodes the mitochondrial methylmalonic aciduria type B protein.

[0505] In some embodiments, the MMA is cblB-MMA and the MMA-related polypeptide is MMAB or a fragment and / or variant thereof.

[0506] In one aspect, the invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the invention for use in the prevention or treatment of cblB-MMA.

[0507] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament for preventing or treating cblB-MMA.

[0508] In one aspect, the present invention provides a method for preventing or treating cblB-MMA, comprising administering a therapeutically effective amount of a lentiviral vector, cell or pharmaceutical composition according to the present invention to a subject in need thereof.

[0509] cblD-type MMA (cblD-MMA) cblD-MMA (MCID: MTH055, OMIM: 277410), also known as methylmalonic aciduria and homocystinuria, type D, is caused by various mutations in MMADHC, the gene that encodes the mitochondrial methylmalonic aciduria and homocystinuria type D protein.

[0510] In some embodiments, the MMA is cblD-MMA and the MMA-related polypeptide is MMADHC or a fragment and / or variant thereof.

[0511] In one aspect, the invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the invention for use in the prevention or treatment of cblD-MMA.

[0512] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament for preventing or treating cblD-MMA.

[0513] In one aspect, the present invention provides a method for preventing or treating cblD-MMA, comprising administering a therapeutically effective amount of a lentiviral vector, cell or pharmaceutical composition according to the present invention to a subject in need thereof.

[0514] MCEE deficiency MCEE deficiency (MCID: MTH040, OMIM: 251120), also known as methylmalonyl-CoA epimerase deficiency, is caused by various mutations in MCEE, the gene encoding mitochondrial methylmalonyl-CoA epimerase.

[0515] In some embodiments, the MMA is MCEE-deficient and the MMA-related polypeptide is MCEE or a fragment and / or variant thereof.

[0516] In one aspect, the present invention provides a lentiviral vector, a cell or a pharmaceutical composition according to the present invention for use in the prevention or treatment of an MCEE deficiency.

[0517] In one aspect, the invention provides the use of a lentiviral vector, a cell or a pharmaceutical composition according to the invention in the manufacture of a medicament for preventing or treating an MCEE deficiency.

[0518] In one aspect, the present invention provides a method for preventing or treating an MCEE deficiency, comprising administering a therapeutically effective amount of a lentiviral vector, cell or pharmaceutical composition according to the present invention to a subject in need thereof. EXAMPLES

[0519] Preferred features and embodiments of the present invention will now be described by way of non-limiting examples.

[0520] Example 1 - Lentiviral vector (LV) encoding the MUT transgene The present inventors have generated and produced lentiviral vectors (LVs) encoding the MUT transgene and have demonstrated its efficacy in in vitro expression in hepatocyte cell lines and in wild-type (WT) mice and in the mouse model of MMA, Mut - / - ;Tg INS-MCK-Mut The expression of IL-1 in MCK-Mut- / - mice was evaluated in vivo.

[0521] result We generated and produced LVs encoding human wild-type or codon-optimized MUT transgenes under the control of a hepatocyte-specific cassette based on the enhanced transthyretin promoter (ET.MUT) or the human alpha-1 antitrypsin promoter (hAAT.MUT) (Figure 1a).

[0522] To compare between the different MUT transgenes, we transduced Huh7 cells with LV-ET.MUTwt and LV-ET.MUTco_1 at increasing multiplicities of infection (MOI). We detected higher MUT expression in cells transduced with LV-ET.MUTco_1 compared to LV-ET.MUTwt, as detected by Western blot analysis (Figure 1b). The same results were obtained by transducing Huh7 cells with LV-hAAT.MUTwt or LV-hAAT.MUTco_1 at various MOIs (Figure 1c).

[0523] By MUT protein quantification and normalization to the GAPDH housekeeper, we confirmed higher transgene expression (approximately 2-fold) from the expression cassette driven by the ET promoter compared to hAAT, and higher transgene expression with the codon-optimized transgene compared to the wt form at similar vector DNA copies per cell (vector copy number, VCN) (Figure 1d-f).

[0524] To directly compare the in vivo liver transduction efficiency of LV-ET.MUTwt and LV-ET.MUTco, we administered them to 2-week-old C57Bl / 6 WT mice at 2.5 × 10 10 The dose was 1000 ng / kg by iv injection. At the end of the experiment, 4 weeks after LV administration, the VCN in the liver was approximately 4 in the LV-ET.MUTwt-injected group and approximately 2 in the LV-ET.MUTco-injected group (Figure 2a). MUT transgene expression was higher in the LV-ET.MUTco-injected group compared to the LV-ET.MUTwt group, both in terms of mRNA expression (Figure 2b) and protein production in the liver (Figure 2c-d).

[0525] We performed gene therapy experiments in MCK-Mut- / - mice, a model that exhibits clinical and biochemical features of MMA, including severe growth retardation, weakness, massive elevation of serum MMA, and hepatorenal mitochondrial disease (Manoli, I., et al., 2018. JCI insight, 3(23), e12435). LV-ET.MUTwt was administered at 5 × 10 10 Administration of 100 mg / kg TU to young MCK-Mut- / - mice resulted in 100% survival and complete normalization of their growth curves (Fig. 3a, b), as well as a significant reduction in circulating MMA levels up to 12 months after LV administration (Fig. 3c), thus indicating a substantial therapeutic benefit from LV-mediated liver gene therapy.

[0526] Materials and Methods Plasmid construction The MUT coding sequences used in this study (WT or codon-optimized) were synthesized by GeneScript and cloned into third-generation self-inactivating (SIN) LV transfer plasmids (Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325) under the control of the enhanced transthyretin promoter (ET) or the human alpha-1 antitrypsin promoter (hAAT).

[0527] Vector Production Laboratory-grade VSV.G pseudotyped third generation SIN LVs were produced by calcium phosphate transient transfection into 293T cells or 293T MHC-negative CD47-high to obtain MHCfree CD47hi LVs. As previously described (Milani, M., et al., 2017. EMBO molecular medicine, 9(11), pp.1558-1573; and Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325), the cells were transfected with a solution containing a mixture of the selected LV genome transfer plasmid, packaging plasmids pMDLg / pRRE and pCMV.REV, pMD2.G and pAdvantage.

[0528] The medium was changed 14–16 h after transfection, and the supernatant was collected approximately 30 h after medium change. The LV-containing supernatant was sterilized through a 0.22 μm filter (Millipore), transferred to a sterile polyallomer tube (Beckman), and centrifuged at 20,000 g for 120 min at 20°C (Beckman Optima XL-100K Ultracentrifuge). The LV pellet was resuspended in an appropriate volume of PBS to a concentration of 500–1000×.

[0529] LV titration For LV titration, 1 x 10 5293T cells were transduced with serial LV dilutions in the presence of polybrene (8 μg / ml). Genomic DNA (gDNA) was extracted 14 days after transduction using the Maxwell 16 Cell DNA Purification Kit (Promega) according to the manufacturer's instructions. VCN was determined by ddPCR starting from 5–20 ng of template gDNA using primers (HIV fw: 5'-T ACTGACGCTCTCGCACC-3'; HIV rv: 5'-TCTCGACGCAGGACTCG-3') and probe (FAM 5'-ATCTCTCTCCTTCTAGCCTC-3') designed on the primer binding site region of LV. The amount of endogenous DNA was quantified by primer / probe sets designed on the human telomerase gene (Telo fw: 5'-GGCACACGTGGCTTTTCG-3'; Telo rv: 5'-GGTGAACCTCGTAAGTTTATGCAA-3'; Telo probe: VIC 5'-TCAGGACGTCGAGTGGACACGGTG-3' TAMRA) or the human GAPDH gene (Applied Biosystems HS00483111_cm). PCR reactions were performed with each primer (900 nM) and probe (250 nM, 500 nM for Telo) according to the manufacturer's instructions (Biorad), read on a QX200 reader and analyzed with QuantaSoft software (Biorad). Infectious titers, expressed as TU / mL, were calculated using the formula TU / mL = (VCN x 100,000 x (1 / dilution factor). LV physical particles were measured by HIV-1 Gag p24 antigen immunocapture assay (Perkin Elmer) according to the manufacturer's instructions. LV specific infectivity was calculated as the ratio between infectious titers and physical particles.

[0530] Cell culture and in vitro transduction experiments HuH7 cells were maintained in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 10% FBS (Thermo Fisher Scientific, Waltham, MA) at 37°C under 5% CO2 conditions. The cells were plated in 12-well plates (2 × 105 Cells were seeded at 1000 x 1000 cells / well and transduced with LV variants at various MOIs in the presence of polybrene (8 μg / ml). Ten days after LV transduction, cells were harvested.

[0531] Mouse experiments All animal experiments were performed in strict accordance with good animal practice, in accordance with Italian and European legislation (2010 / 63 / EU) on animal care and experimentation. Wild-type C57Bl / 6 or Mut - / - ;Tg INS-MCK-Mut Two-week-old mice were used in these studies. Animals were injected with 2.5 × 10 10 LV was administered at a dose of TU / kg. Blood samples were collected monthly for the duration of the study for analysis of metabolites (see "Blood MMA Determination"). For experiments performed in WT C57Bl / 6 mice, animals were sacrificed 4 weeks after LV administration and liver samples were collected and snap frozen for vector copy number, mRNA and protein analysis.

[0532] RNA analysis RNA samples were extracted from mouse liver using the Maxwell 16 simplyRNA Tissue Kit (Promega). cDNA was synthesized starting from 1 μg of total RNA using SuperScript IV VILO Master Mix (Invitrogen) according to the manufacturer's instructions. LV gene expression was assessed by ddPCR starting from 25–50 ng of template cDNA using a primer / probe set designed on the WPRE region of LV (WPRE: primer fw 5'-GGCTGTTGGGCACTGACAAT-3'; primer rv 5'-ACGTCCCGCGCAGAATC-3'; probe FAM 5'-TTTCCTTGGCTGCTCGCCTGTGT-3' NGB). Mouse HPRT was used as a reference gene (Bio Rad, Mmu 10031256 dMmu CPE5095493). PCR reactions were performed using each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader and analyzed with QuantaSoft software (Biorad).

[0533] Western blot analysis Protein extracts from HuH7 cells or mouse liver samples were prepared using RIPA buffer (EMD Millipore) and protease inhibitors (Roche). Protein concentrations were determined using DC Protein Assay (Bio Rad Laboratories). SDS-page electrophoresis was performed in Bis-Tris 4-12% gradient polyacrylamide gels. After transfer, membranes were blocked with 1x TBS + 5% milk and incubated with anti-MUT antibody (Abcam ab67869) or anti-β-actin (Sigma Aldrich A2228). Membranes were incubated with anti-mouse IgG secondary antibody (Jackson Immunoresearch 115-035-003) followed by clarity Western ECL substrate (Bio Rad) and visualized by Uvitec Imaging System (Cleaver Scientific). For Western blot quantification, we used Image J software.

[0534] Plasma and tissue MMA determination Blood samples were collected via the retro-orbital plexus into 0.5M EDTA-filled tubes. After collection of the samples, dried blood spots (DBS) were obtained from blood spots on filter paper (903; Whatman GmbH, Dassel, Germany). MMA measurements in DBS were performed by triple quadrupole mass spectrometry as previously described (Rizzo, C., et al., 2014. Clinica chimica acta, 429, pp.30-33). Tissue MMA was determined in protein extracts from liver, kidney or brain samples and quantified by triple quadrupole mass spectrometry as described above.

[0535] Deciding on a VCN DNA was extracted from cells or liver samples using the Maxwell 16 Cell DNA Purification Kit or Maxwell 16 Tissue DNA Purification Kit (Promega). VCN was determined in human macrophages as described above (see "LV titration"). VCN in mouse DNA was determined by ddPCR starting from 5-20 ng of template gDNA using primer / probe sets designed on the primer binding site region of LV (see "LV titration" above). The amount of endogenous mouse DNA was quantified by primer / probe sets designed on the mouse sema3a gene (Sema3A fw: 5'-ACCGATTCCAGATGATTGGC-3'; Sema3A rv: 5'-TCCATATTAATGCAGTGCTTGC-3'; Sema3A probe: HEX 5'-AGAGGCCTGTCCTGCAGCTCATGG-3' BHQ1). PCR reactions were performed using each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader and analyzed with QuantaSoft software (Biorad).

[0536] Transmission electron microscope (TEM) analysis For TEM analysis, tissues were fixed by needle injection perfusion using a fixative containing 2% formaldehyde, 2.5% glutaraldehyde in 0.15 M sodium cacodylate buffer pH 7.4 as reported (Wisse E et al., World J Gastroenterol. 2010). After initial fixation, samples were left in the same fixative overnight at 4°C. Tissues were then cut into 1 mm pieces. 3The specimens were chopped into pieces and post-fixed in 1% osmium tetroxide, 1.5% potassium ferricyanide in 100 mM sodium cacodylate buffer for 2 h on ice. The specimens were dehydrated in increasing concentrations of ethanol, washed in propylene oxide, and infiltrated overnight in a mixture of propylene oxide / epoxy resin. The resin was then replaced with fresh epoxy resin, and the specimens were embedded in silicone molds. After curing at 60 °C for 48 h, the resin blocks were then cut into ultrathin sections (70–90 nm) using an ultramicrotome (UC7, Leica microsystem, Vienna, Austria), collected on copper grids, stained with uranyl acetate and Sato's lead solution, and observed in a transmission electron microscope Talos L120C (FEI, Thermo Fisher Scientific) operating at 120 kV. Images were acquired with a Ceta CCD camera (FEI, Thermo Fisher Scientific).

[0537] Liver collection for histopathological analysis Livers were harvested from mice and fixed by immersion in buffered formalin, trimmed, embedded in paraffin wax, sectioned, mounted on slides, and stained with hematoxylin and eosin (H&E).

[0538] Electron microscopic analysis of mitochondria in the liver and kidney. For transmission electron microscopy analysis, tissues were fixed by needle injection perfusion with a fixative containing 2% formaldehyde, 2.5% glutaraldehyde in 0.15 M sodium cacodylate buffer pH 7.4 (Wisse et al. (2010) World J Gastroenterol 16: 2851-66). After initial fixation, samples were left in the same fixative overnight at 4°C. Tissues were then cut into 1 mm pieces. 3The specimens were chopped into pieces and post-fixed in 1% osmium tetroxide, 1.5% potassium ferricyanide in 100 mM sodium cacodylate buffer for 2 h on ice. The specimens were dehydrated in increasing concentrations of ethanol, washed in propylene oxide, and infiltrated overnight in a mixture of propylene oxide / epoxy resin. The resin was then replaced with fresh epoxy resin, and the specimens were embedded in silicone molds. After curing at 60 °C for 48 h, the resin blocks were then cut into ultrathin sections (70–90 nm) using an ultramicrotome (UC7, Leica microsystem, Vienna, Austria), collected on copper grids, stained with uranyl acetate and Sato's lead solution, and observed in a transmission electron microscope Talos L120C (FEI, Thermo Fisher Scientific) operating at 120 kV. Images were acquired with a Ceta CCD camera (FEI, Thermo Fisher Scientific). For each tissue region corresponding to a single cell, 15 mitochondria were measured, measuring 15 regions, for a total of more than 200 mitochondria per mouse.

[0539] statistical analysis Statistical analysis was performed with Prism 9 software. When two or more independent groups were compared over time, a two-way analysis of variance with Dunnett's multiple comparison test was performed.

[0540] Example 2 - Long-term phenotype correction of methylmalonic acidemia We administered LV.ET-MUT at a dose of 5E10 TU / kg to 2-week-old MCK-Mut- / - mice and monitored them over a 12-month period. LV treatment resulted in a complete rescue of survival curves (Fig. 3a) and normalization of growth rates comparable to those of heterozygous littermates (Fig. 3b). Importantly, we observed a rapid and significant reduction in circulating MMA compared to KO untreated controls, which was maintained over time (1 year after LV) (Fig. 3c). At the end of the experiment, we measured hepatic MMA, which was significantly reduced in MCK-Mut-treated animals compared to KO untreated controls (Fig. 3d).

[0541] We confirmed the persistence of vector and MUT transgene expression in the livers of treated mice 12 months after LV administration by vector copy number (VCN) and RNA analysis (Fig. 4a and b) and MUT protein expression in tissue lysates (Fig. 4c).

[0542] Liver transduction efficiency was quantified in two MCK-Mut treated mice by RNA ISH, resulting in approximately 10-20% of the liver area (Figure 5a-b). This data correlated with an overall correction of liver pathology in MCK-Mut mice, which was comparable to WT controls in terms of histopathological features (Figure 5c).

[0543] Electron microscopy analysis of MCKMut- / - livers confirmed the presence of large, abnormally shaped mitochondria with shortened or absent cristae. LV-treated mice showed rescue of mitochondrial structure, which was comparable to that of WT control animals (Figure 6a). Quantification of images showed rescue of shape, measured as mitochondrial area, perimeter, and circularity index (Figure 6b-d). Consistent with correction of mitochondrial disease, levels of toxic MMA in liver were significantly reduced and nearly normalized compared to KO untreated controls (Figure 6e).

[0544] In the proximal tubules of MCK-Mut- / - kidneys, mitochondria appeared disorganized, circular, and wrapped with cytoplasmic material. There was no evidence of renal mitochondrial disease in LV-treated MCK-Mut- / - mice (Fig. 7a). Quantification of images showed that the number of circular structures was comparable to that of WT control mice (Fig. 7b). Consistent with correction of mitochondrial disease, the levels of toxic MMA in the kidneys were significantly reduced compared to KO untreated controls (Fig. 7c).

[0545] Electron microscopy analysis of the cerebral cortex of MCK-Mut- / - showed some subtle changes in mitochondrial structure. LV-treated mice showed mitochondrial ultrastructure comparable to that of WT control animals (Fig. 8a). With regard to MMA in brain tissue, we showed accumulation of toxic metabolites in MCK-Mut- / - untreated animals and a three-fold reduction in brain MMA in LV-treated mice mediated by hepatic detoxification (Fig. 8b).

[0546] Administration of LV.ET-MUT to young MCK-Mut- / - mice resulted in complete rescue of survival and growth, and a significant long-term reduction in circulating MMA levels as well as in liver, kidney and brain MMA, ameliorating hepatorenal mitochondrial disease.

[0547] Juvenile MCK-Mut mice were transfected with CD47 high -MCH free In a gene therapy experiment in which LV.ET-MUT was administered at a dose of 5E10 TU / kg, a reduction in circulating MMA and rescue of the growth curve were observed (FIG. 9).

[0548] Administration of LV.ET-MUTco to young MCK-Mut− / − mice resulted in similar or slightly improved rescue of the growth curve and reduction of circulating MMA compared to LV.ET.MUTwt at the same LV dose of 2.5E10 TU / kg (FIG. 10).

[0549] Example 3 - Lentiviral vector (LV) encoding the BSEP transgene We generated lentiviral vectors (LV) encoding the BSEP transgene and evaluated them in vitro in a hepatocyte cell line and in vivo in Abcb11- / - mice, a mouse model of PFIC-2.

[0550] result We generated and produced LVs encoding human wild-type or codon-optimized BSEP transgenes under the control of a hepatocyte-specific cassette based on the enhanced transthyretin promoter (ET.BSEP) or the human alpha-1 antitrypsin promoter (hAAT.BSEP) (Figure 11a).

[0551] To compare between different BSEP transgenes, we first transduced Huh7 cells with LV-ET.BSEPwt, LV-ET.BSEPco_1 or LV-ET.BSEPco_2 at increasing multiplicities of infection (MOI). We performed flow cytometry analysis 10 days after transduction to detect BSEP overexpression in LV-ET.BSEP transduced cells. The mean fluorescence intensity increased proportionally to the MOI used and was higher for BSEPco_1 and BSEPco_2 transgenes compared to BSEPwt at similar vector copy numbers (VCN) per cell (Figure 11b, c).

[0552] We then compared the activity of the ET and hAAT promoters by transducing Huh7 cells with LV-ET.BSEPco_1 or LV-hAAT.BSEP_co1. VCN / cell was comparable in cells transduced with the two vectors at various MOIs (Fig. 11d), while BSEP protein expression was higher in LV-ET.BSEPco_1 compared to LV-hAAT.BSEPco_1 transduced cells as detected by Western blot analysis (Fig. 11e). By quantification of BSEP protein and normalization to GAPDH housekeeper, we confirmed the higher transgene expression (3-3.5-fold) obtained from the expression cassette driven by the ET promoter compared to hAAT (Fig. 11f).

[0553] Immunofluorescence analysis of LV-ET.BSEPco_1 transduced Huh7 cells confirmed the proper BSEP membrane and cytoplasmic localization, whereas no signal was detected in Huh7 non-transduced cells (FIG. 12).

[0554] We inoculated LV-ET.BSEPco_1 into juvenile Abcb11 mice at 3 × 10 10 The dose was administered by iv injection at a dose of 10000 transducing units (TU) / kg. Treatment resulted in a significant reduction in serum BA, bilirubin and ALP biomarkers up to 7 months of age, indicating prevention of progressive cholestatic damage (Figure 13a-c).

[0555] Materials and Methods Plasmid construction The BSEP coding sequences used in this study (WT or codon-optimized) were synthesized by GeneScript and cloned into third-generation self-inactivating (SIN) LV transfer plasmids (Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325) under the control of the enhanced transthyretin promoter (ET) or the human alpha-1 antitrypsin promoter (hAAT).

[0556] Vector Production Laboratory-grade VSV.G pseudotyped third generation SIN LVs were produced by calcium phosphate transient transfection into 293T cells. As previously described (Milani, M., et al., 2017. EMBO molecular medicine, 9(11), pp.1558-1573; and Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325), a solution containing a mixture of selected LV genome transfer plasmids, packaging plasmids pMDLg / pRRE and pCMV.REV, pMD2.G and pAdvantage was transfected into 293T cells.

[0557] The medium was changed 14–16 h after transfection, and the supernatant was collected approximately 30 h after medium change. The LV-containing supernatant was sterilized through a 0.22 μm filter (Millipore), transferred to a sterile polyallomer tube (Beckman), and centrifuged at 20,000 g for 120 min at 20°C (Beckman Optima XL-100K Ultracentrifuge). The LV pellet was resuspended in an appropriate volume of PBS to a concentration of 500–1000×.

[0558] LV titration For LV titration, 1 x 10 5 293T cells were transduced with serial LV dilutions in the presence of polybrene (8 μg / ml). Genomic DNA (gDNA) was extracted 10 days after transduction using the Maxwell 16 Cell DNA Purification Kit (Promega) according to the manufacturer's instructions. VCN was determined by digital droplet PCR (ddPCR) starting from 5–20 ng of template gDNA using primers (HIV fw: 5'-T ACTGACGCTCTCGCACC-3'; HIV rv: 5'-TCTCGACGCAGGACTCG-3') and probe (FAM 5'-ATCTCTCTCCTTCTAGCCTC-3') designed on the primer binding site region of LV. The amount of endogenous DNA was quantified by a primer / probe set (Applied Biosystems HS00483111_cm) designed on the human GAPDH gene. PCR reactions were performed with each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader, and analyzed with QuantaSoft software (Biorad). Infectious titers, expressed as TU / mL, were calculated using the formula TU / mL = (VCN x 100,000 x (1 / dilution factor)). LV physical particles were measured by HIV-1 Gag p24 antigen immunocapture assay (Perkin Elmer) according to the manufacturer's instructions. LV specific infectivity was calculated as the ratio between infectious titer and physical particles.

[0559] Cell culture and in vitro transduction experiments HuH7 cells were maintained in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 10% FBS (Thermo Fisher Scientific, Waltham, MA) at 37°C under 5% CO2 conditions. The cells were plated in 12-well plates (2 × 10 5 Cells were seeded at 1000 x 1000 cells / well and transduced with LV variants at various MOIs in the presence of polybrene (8 μg / ml). Ten days after LV transduction, cells were harvested for molecular analysis.

[0560] Mouse experiments All animal experiments were carried out in strict accordance with good animal practice, in accordance with Italian and European legislation (2010 / 63 / EU) on animal care and experimentation. In these studies, 2-week-old Abcb11 mice (Jackson strain n.004125) were used. Animals were injected with 3 × 10 10 LV was administered at a dose of TU / kg.Blood samples were collected monthly throughout the study for analysis of metabolites.

[0561] Deciding on a VCN DNA was extracted from cell or liver samples using Maxwell 16 Cell DNA Purification Kit or Maxwell 16 Tissue DNA Purification Kit (Promega). VCN was determined in Huh7 samples as described above (see "LV titration"). VCN in mouse DNA was determined by ddPCR starting from 5-20 ng of template gDNA using primer / probe sets designed on the primer binding site region of LV (see "LV titration" above). The amount of endogenous mouse DNA was quantified by primer / probe sets designed on the mouse sema3a gene (Sema3A fw: 5'-ACCGATTCCAGATGATTGGC-3'; Sema3A rv: 5'-TCCATATTAATGCAGTGCTTGC-3'; Sema3A probe: HEX 5'-AGAGGCCTGTCCTGCAGCTCATGG-3' BHQ1). PCR reactions were performed using each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader and analyzed with QuantaSoft software (Biorad).

[0562] Western blot analysis Protein extracts from HuH7 cells or mouse liver samples were prepared using RIPA buffer (EMD Millipore) and protease inhibitors (Roche). Protein concentrations were determined using the DC Protein Assay (Bio Rad Laboratories). SDS-page electrophoresis was performed in Bis-Tris 4-12% gradient polyacrylamide gels. After transfer, membranes were blocked with 1x TBS + 5% milk and incubated with anti-Abcb11 antibody (Sigma-Aldrich HPA019035) or anti-GAPDH (Biolegend 649201). Membranes were incubated with anti-mouse and anti-rabbit IgG secondary antibodies (Jackson Immunoresearch 115-035-003 and 111-035-144) followed by clarity Western ECL substrate (Bio Rad) and visualized by Uvitec Imaging System (Cleaver Scientific). For Western blot quantification, we used Image J software.

[0563] BSEP immunofluorescence analysis Huh7 LV transduced cells were seeded in 8-well slides (Nunc® Lab-Tek® Chamber Slide™ system) to reach 40-50% confluency. After 24 hours, cells were fixed in 4% PFA and permeabilized in PBS+Triton X-100 0.1% for 10 minutes at room temperature (RT). Cells were blocked in PBST+1% BSA for 1 hour at RT and stained with rabbit anti-BSEP (ab255605, dilution 1:100) primary antibody overnight at 4°C. After incubation with goat anti-rabbit IgG488 secondary antibody (Invitrogen, dilution 1:1000), nuclear staining was performed with Hoechst (diluted at 2ug / mL in PBS) for 5 minutes at RT. Stained slides were acquired on a Leica TCS SP8 SMD confocal microscope.

[0564] Determination of bile acids, ALP, and bilirubin Total bile acids were determined in serum samples by using the Mouse Total Bile Acid Assay Kit (Crystal Chem, 80471) according to the manufacturer's instructions. Serum ALP activity was measured on a SABA chemistry analyzer (Seac-Radim) using the International Union of Clinical Chemistry optimized kinetic UV method and is expressed as units per liter (U / L).

[0565] Example 4 - Lentiviral vector (LV) encoding the DBT transgene We generated and produced a lentiviral vector (LV) containing the DBT transgene encoding the E2 subunit of BCKDC and evaluated it in vitro in a hepatocyte cell line and in vivo in both wild-type (WT) mice and iMSUD mice, a moderate mouse model of MSUD due to E2 deficiency.

[0566] result We generated and produced LVs carrying human wild-type or codon-optimized DBT transgenes under the control of hepatocyte-specific cassettes based on the enhanced transthyretin promoter (ET.DBT) or the human alpha-1 antitrypsin promoter (hAAT.DBT) (Figure 14a).

[0567] To compare between different DBT transgenes, we transduced Huh7 cells with LV-ET.DBTwt and LV-ET.DBTco_1 at increasing multiplicity of infection (MOI). We detected higher DBT expression in cells transduced with LV-ET.DBTco_1 compared to LV-ET.DBTwt, as detected by Western blot analysis (Figure 14b). The same results were obtained by transducing Huh7 cells with LV-hAAT.DBTwt or LV-hAAT.DBTco_1 at various MOIs (Figure 14c).

[0568] By DBT protein quantification and normalization to the GAPDH housekeeper, we confirmed higher transgene expression (approximately 7-8 fold) from the expression cassette driven by the ET promoter compared to hAAT, and higher transgene expression with the codon-optimized transgene compared to the wt form at similar vector DNA copies per cell (vector copy number, VCN) (Figure S14d-f).

[0569] To directly compare the in vivo liver transduction efficiency of LV-ET.DBTwt and LV-ET.DBTco, we inoculated them into young C57Bl / 6 WT mice at 2.5 × 10 10 LV-ET.DBTwt was administered at a dose of 10 ...

[0570] We inject LV-ET.DBTco_1 into juvenile iMSUD mice at 5 × 10 10 The dose was administered by iv injection at a dose of transducing units (TU) / kg. Treatment resulted in improved survival in treated mice compared to knockout littermates (50% survival probability at 111 days and 35 days, respectively) (Fig. 16a). Measurement of circulating BCAAs and alloisoleucine showed that these biomarkers remained stable in LV-treated animals up to 12 weeks post-LV (Fig. 16b, c). At the last time point, these parameters could not be assessed in iMSUD-untreated animals, which had died earlier.

[0571] Materials and Methods Plasmid construction The DBT coding sequences used in this study (WT or codon-optimized) were synthesized by GeneScript and cloned into third-generation self-inactivating (SIN) LV transfer plasmids (Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325) under the control of the enhanced transthyretin promoter (ET) or the human alpha-1 antitrypsin promoter (hAAT).

[0572] Vector Production Laboratory-grade VSV.G pseudotyped third generation SIN LVs were produced by calcium phosphate transient transfection into 293T cells. As previously described (Milani, M., et al., 2017. EMBO molecular medicine, 9(11), pp.1558-1573; and Milani, M., et al., 2019. Science Translational Medicine, 11(493), p.eaav7325), a solution containing a mixture of selected LV genome transfer plasmids, packaging plasmids pMDLg / pRRE and pCMV.REV, pMD2.G and pAdvantage was transfected into 293T cells.

[0573] The medium was changed 14–16 h after transfection, and the supernatant was collected approximately 30 h after medium change. The LV-containing supernatant was sterilized through a 0.22 μm filter (Millipore), transferred to a sterile polyallomer tube (Beckman), and centrifuged at 20,000 g for 120 min at 20°C (Beckman Optima XL-100K Ultracentrifuge). The LV pellet was resuspended in an appropriate volume of PBS to a concentration of 500–1000×.

[0574] LV titration For LV titration, 1 x 10 5293T cells were transduced with serial LV dilutions in the presence of polybrene (8 μg / ml). Genomic DNA (gDNA) was extracted 10 days after transduction using the Maxwell 16 Cell DNA Purification Kit (Promega) according to the manufacturer's instructions. VCN was determined by digital droplet PCR (ddPCR) starting from 5–20 ng of template gDNA using primers (HIV fw: 5'-T ACTGACGCTCTCGCACC-3'; HIV rv: 5'-TCTCGACGCAGGACTCG-3') and probe (FAM 5'-ATCTCTCTCCTTCTAGCCTC-3') designed on the primer binding site region of LV. The amount of endogenous DNA was quantified by a primer / probe set (Applied Biosystems HS00483111_cm) designed on the human GAPDH gene. PCR reactions were performed with each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader, and analyzed with QuantaSoft software (Biorad). Infectious titers, expressed as TU / mL, were calculated using the formula TU / mL = (VCN x 100000 x (1 / dilution factor)). LV physical particles were measured by HIV-1 Gag p24 antigen immunocapture assay (Perkin Elmer) according to the manufacturer's instructions. LV specific infectivity was calculated as the ratio between infectious titer and physical particles.

[0575] Cell culture and in vitro transduction experiments HuH7 cells were maintained in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 10% FBS (Thermo Fisher Scientific, Waltham, MA) at 37°C under 5% CO2 conditions. The cells were plated in 12-well plates (2 × 10 5 Cells were seeded at 1000 x 1000 cells / well and transduced with LV variants at various MOIs in the presence of polybrene (8 μg / ml). Ten days after LV transduction, cells were harvested for molecular analysis.

[0576] Mouse experiments All animal experiments were performed in strict accordance with good animal practice, in accordance with Italian and European legislation (2010 / 63 / EU) on animal care and experimentation. Wild-type C57Bl / 6 or iMSUD juvenile mice were used for these studies. iMSUD is a moderate MSUD mouse model that is DBT KO and shows low activity of BCKAD in the liver (Homanics, GE, et al., 2006. BMC medical genetics, 7(1), pp.1-13). Animals were inoculated with 2.5–5 × 10 10 LV was administered at a dose of TU / kg. Blood samples were collected monthly for the duration of the study for analysis of metabolites. For experiments performed in WT C57Bl / 6 mice, animals were sacrificed 4 weeks after LV administration and liver samples were collected and snap frozen for vector copy number, mRNA and protein analysis.

[0577] RNA analysis RNA samples were extracted from mouse liver using the Maxwell 16 simplyRNA Tissue Kit (Promega). cDNA was synthesized starting from 1 μg of total RNA using SuperScript IV VILO Master Mix (Invitrogen) according to the manufacturer's instructions. LV gene expression was assessed by ddPCR starting from 25–50 ng of template cDNA using a primer / probe set designed on the WPRE region of LV (WPRE: primer fw 5'-GGCTGTTGGGCACTGACAAT-3'; primer rv 5'-ACGTCCCGCGCAGAATC-3'; probe FAM 5'-TTTCCTTGGCTGCTCGCCTGTGT-3' NGB). Mouse HPRT was used as a reference gene (Bio Rad, Mmu 10031256 dMmu CPE5095493). PCR reactions were performed using each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader and analyzed with QuantaSoft software (Biorad).

[0578] Deciding on a VCN DNA was extracted from cell or liver samples using Maxwell 16 Cell DNA Purification Kit or Maxwell 16 Tissue DNA Purification Kit (Promega). VCN was determined in Huh7 samples as described above (see "LV titration"). VCN in mouse DNA was determined by ddPCR starting from 5-20 ng of template gDNA using primer / probe sets designed on the primer binding site region of LV (see "LV titration" above). The amount of endogenous mouse DNA was quantified by primer / probe sets designed on the mouse sema3a gene (Sema3A fw: 5'-ACCGATTCCAGATGATTGGC-3'; Sema3A rv: 5'-TCCATATTAATGCAGTGCTTGC-3'; Sema3A probe: HEX 5'-AGAGGCCTGTCCTGCAGCTCATGG-3' BHQ1). PCR reactions were performed using each primer (900 nM) and probe (250 nM) according to the manufacturer's instructions (Biorad), read on a QX200 reader and analyzed with QuantaSoft software (Biorad).

[0579] Western blot analysis Protein extracts from HuH7 cells or mouse liver samples were prepared using RIPA buffer (EMD Millipore) and protease inhibitors (Roche). Protein concentrations were determined using DC Protein Assay (Bio Rad Laboratories). SDS-page electrophoresis was performed in Bis-Tris 4-12% gradient polyacrylamide gels. After transfer, membranes were blocked with 1x TBS + 5% milk and incubated with anti-DBT antibody (Sigma-Aldrich HPA026481) or anti-β-actin (Sigma Aldrich A2228). Membranes were incubated with anti-mouse and anti-rabbit IgG secondary antibodies (Jackson Immunoresearch 115-035-003 and 111-035-144) followed by clarity Western ECL substrate (Bio Rad) and visualized by Uvitec Imaging System (Cleaver Scientific). For Western blot quantification, we used Image J software.

[0580] Determination of blood BCAA and alloisoleucine Blood samples were collected via the retro-orbital plexus into 0.5 M EDTA-filled tubes. After collection of the samples, dried blood spots (DBS) were obtained by spotting blood on filter paper (903; Whatman GmbH, Dassel, Germany). BCAA and alloisoleucine measurements in DBS were performed by liquid chromatography tandem mass spectrometry as previously described.

[0581] statistical analysis Statistical analysis was performed by using Prism 9 software. Comparison of survival curves was performed by applying the log-rank (Mantel-Cox) test.

[0582] Embodiment Various preferred features and embodiments of the present invention will now be described with reference to the following numbered paragraphs.

[0583] 1. A lentiviral vector comprising a nucleotide sequence encoding a methylmalonic acidemia (MMA)-related polypeptide, optionally wherein the lentiviral vector is an immunoshielded lentiviral vector.

[0584] 2. The lentiviral vector of paragraph 1, wherein the MMA-related polypeptide is selected from methylmalonyl-CoA mutase (MMUT) or a fragment thereof; methylmalonic aciduria type A (MMAA) or a fragment thereof; methylmalonic aciduria type B (MMAB) or a fragment thereof; methylmalonic aciduria and homocystinuria type D (MMADHC) or a fragment thereof; or methylmalonyl-CoA epimerase (MCEE) or a fragment thereof.

[0585] 3. The lentiviral vector described in paragraph 1 or 2, wherein the MMA-related polypeptide is MMUT or a fragment thereof.

[0586] 4. The lentiviral vector of any preceding paragraph, wherein the MMA-related polypeptide comprises or consists of an amino acid sequence that is at least 70% identical to one of SEQ ID NOs: 37, 40, 42, 44 or 46, or a fragment thereof, preferably wherein the MMA-related polypeptide comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NO: 37 or a fragment thereof.

[0587] 5. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence that is at least 70% identical to one of SEQ ID NOs: 38, 39, 41, 43, 45 or 47, or a fragment thereof, preferably wherein the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence that is at least 70% identical to one of SEQ ID NOs: 38 or 39, or a fragment thereof.

[0588] 6. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding the MMA-related polypeptide is codon optimized, preferably wherein the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence that is at least 70% identical to SEQ ID NO: 39, or a fragment thereof.

[0589] 7. Lentiviral vectors target CD47 high The lentiviral vector of any preceding paragraph, which is a lentiviral vector.

[0590] 8. Lentiviral vectors target CD47 high The lentiviral vector of any preceding paragraph, obtained from a host cell, optionally wherein the host cell is genetically engineered to increase expression of CD47 on the cell surface.

[0591] 9. The lentiviral vector of any preceding paragraph, wherein the lentiviral vector has at least about two-fold more CD47 on its surface than a lentiviral vector obtained from an unmodified host cell.

[0592] 10. Lentiviral vectors target MHC-I free The lentiviral vector of any preceding paragraph, which is a lentiviral vector.

[0593] 11. Lentiviral vectors target MHC-I free The lentiviral vector of any preceding paragraph, obtained from a host cell, optionally wherein the host cell has been genetically engineered to disrupt expression of MHC-I on the cell surface.

[0594] 12. The lentiviral vector of any preceding paragraph, wherein MHC-I is not detectable on the surface of the lentiviral vector.

[0595] 13. Lentiviral vectors target CD47 high / MHC-Ifree The lentiviral vector of any preceding paragraph, which is a lentiviral vector.

[0596] 14. Lentiviral vectors target CD47 high / MHC-I free The lentiviral vector of any preceding paragraph obtained from a host cell.

[0597] 15. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to one or more miRNA target sequences.

[0598] 16. A lentiviral vector described in paragraph 15, wherein the one or more miRNA target sequences suppress transgene expression in one or more cells other than hepatocytes, preferably, the one or more miRNA target sequences suppress transgene expression in hematopoietic lineage cells and / or antigen-presenting cells.

[0599] 17. The lentiviral vector described in paragraph 15 or 16, wherein the one or more miRNA target sequences are selected from miR-181, miR-142, miR-223, and miR-155 target sequences.

[0600] 18. The lentiviral vector described in any preceding paragraph, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to one or more mir-142 targeting sequences, two or more mir-142 targeting sequences, three or more mir-142 targeting sequences, or four or more mir-142 targeting sequences.

[0601] 19. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to four mir-142 target sequences.

[0602] 20. A lentiviral vector described in any of paragraphs 15 to 19, wherein one or more miRNA target sequences comprise or consist of a nucleotide sequence that is at least 90% identical to SEQ ID NO: 17, and preferably, one or more miRNA target sequences comprise or consist of a nucleotide sequence that is at least 90% identical to SEQ ID NO: 18.

[0603] 21. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to a liver-specific promoter, preferably, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to a hepatocyte-specific promoter.

[0604] 22. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to a transthyretin (TTR) promoter, an alpha-1-antitrypsin (AAT) promoter, a thyroxine-binding globulin (TBG) promoter, an APoE / hAAT promoter, an HCR-hAAT promoter, an LP1 promoter, or an HLP promoter.

[0605] 23. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to a transthyretin (TTR) promoter, preferably wherein the nucleotide sequence encoding an MMA-related polypeptide is operably linked to an Enh1mTTR (ET) promoter.

[0606] 24. The lentiviral vector of any preceding paragraph, wherein the nucleotide sequence encoding the MMA-related polypeptide is operably linked to a promoter comprising or consisting of a nucleotide sequence that is at least 70% identical to SEQ ID NO:19.

[0607] 25. The lentiviral vector of any preceding paragraph, wherein the lentiviral vector is pseudotyped, preferably the lentiviral vector is VSV.G pseudotyped.

[0608] 26. The lentiviral vector of any preceding paragraph, wherein the lentiviral vector is a self-inactivating (SIN) lentiviral vector, preferably wherein the lentiviral vector comprises a self-inactivating (SIN) LTR comprising, or consisting of, a nucleotide sequence that is at least 70% identical to SEQ ID NO: 23, or a fragment thereof.

[0609] 27. The lentiviral vector of any preceding paragraph, wherein the lentiviral vector is an integrating lentiviral vector and / or a replication-deficient lentiviral vector.

[0610] 28. The lentiviral vector of any preceding paragraph, wherein the lentiviral vector comprises a nucleotide sequence that is at least 70% identical to SEQ ID NO:36.

[0611] 29. An isolated cell comprising the lentiviral vector described in any of paragraphs 1 to 28.

[0612] 30. A pharmaceutical composition comprising the lentiviral vector described in any of paragraphs 1 to 28 in combination with a pharma- ceutically acceptable carrier, diluent or excipient.

[0613] 31. A lentiviral vector according to any of paragraphs 1 to 28 or a pharmaceutical composition according to paragraph 30 for use as a medicament.

[0614] 32. Use of a lentiviral vector according to any of paragraphs 1 to 28 or a pharmaceutical composition according to paragraph 30 for the manufacture of a medicament.

[0615] 33. A method comprising the step of administering a therapeutically effective amount of a lentiviral vector described in any of paragraphs 1 to 28 or a pharmaceutical composition described in paragraph 30 to a subject in need thereof.

[0616] 34. The lentiviral vector described in any of paragraphs 1 to 28 or the pharmaceutical composition described in paragraph 30 for use in the prevention or treatment of methylmalonic acidemia (MMA).

[0617] 35. Use of the lentiviral vector described in any of paragraphs 1 to 28 or the pharmaceutical composition described in paragraph 30 for the manufacture of a medicament for preventing or treating methylmalonic acidemia (MMA).

[0618] 36. A method for preventing or treating methylmalonic acidemia (MMA), comprising the step of administering a therapeutically effective amount of a lentiviral vector described in any of paragraphs 1 to 28 or a pharmaceutical composition described in paragraph 30 to a subject in need thereof.

[0619] 37. The lentiviral vector or pharmaceutical composition for use according to paragraph 34, the use according to paragraph 35 or the method according to paragraph 36, wherein the MMA-related polypeptide is MMUT or a fragment thereof and the MMA is mutated MMA (mut-MMA); the MMA-related polypeptide is MMAA or a fragment thereof and the MMA is cblA MMA (cblA-MMA); the MMA-related polypeptide is MMAB or a fragment thereof and the MMA is cblB MMA (cblB-MMA); the MMA-related polypeptide is MMADHC or a fragment thereof and the MMA is cblD MMA (cblD-MMA); or the MMA-related polypeptide is MCEE or a fragment thereof and the MMA is due to an MCEE deficiency.

[0620] 38. The MMA-related polypeptide is MMUT or a fragment thereof, and the MMA is mut-MMA, preferably mut-MMA is mut 0 Subtype or mut -38. The lentiviral vector or pharmaceutical composition for use according to paragraph 34 or 37, the use according to paragraph 35 or 37, or the method according to paragraph 36 or 37, which is a subtype.

[0621] 39. The lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 38, the use according to any of paragraphs 32, 35, 37 to 38, or the method according to any of paragraphs 33, 36 to 39, wherein the subject is a human subject.

[0622] 40. The lentiviral vector or pharmaceutical composition for use according to any one of paragraphs 31, 34, 37 to 39, the use according to any one of paragraphs 32, 35, 37 to 39, or the method according to any one of paragraphs 33, 36 to 39, wherein the subject is a young person.

[0623] 41. The lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 39, the use according to any of paragraphs 32, 35, 37 to 39, or the method according to any of paragraphs 33, 36 to 39, wherein the subject is a pediatric patient, preferably wherein the subject is a neonatal or infant patient.

[0624] 42. The lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 41, the use according to any of paragraphs 32, 35, 37 to 41, or the method according to any of paragraphs 33, 36 to 41, wherein the lentiviral vector or pharmaceutical composition is administered systemically, preferably wherein the lentiviral vector or pharmaceutical composition is administered by intravenous or intraperitoneal injection.

[0625] 43. The lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 41, the use according to any of paragraphs 32, 35, 37 to 41, or the method according to any of paragraphs 33, 36 to 41, wherein the lentiviral vector or pharmaceutical composition is administered locally, preferably wherein the lentiviral vector or pharmaceutical composition is administered by direct injection, intra-arterial injection, or intraportal injection.

[0626] 44. The lentiviral vector or pharmaceutical composition for use according to paragraph 43, the use according to paragraph 43 or the method according to paragraph 43, wherein the lentiviral vector or pharmaceutical composition is administered locally to the liver, preferably the lentiviral vector or pharmaceutical composition is administered by intrahepatic injection, intrahepatic arterial injection or intraportal injection.

[0627] 45. The lentiviral vector is at least about 10 8 TU / kg, at least about 10 9 TU / kg, or at least about 10 10 The lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 44, the use according to any of paragraphs 32, 35, 37 to 43, or the method according to any of paragraphs 33, 36 to 44, administered in a dose of TU / kg.

[0628] 46. ​​Lentiviral vectors are approximately 10 8 ~about 10 11 TU / kg, approx. 10 8 ~about 10 10 TU / kg, or about 10 9 ~about 10 10 The lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 45, the use according to any of paragraphs 32, 35, 37 to 45, or the method according to any of paragraphs 33, 36 to 45, administered in a dose of TU / kg.

[0629] 47. A lentiviral vector or pharmaceutical composition for use according to any of paragraphs 31, 34, 37 to 46, a use according to any of paragraphs 32, 35, 37 to 46, or a method according to any of paragraphs 33, 36 to 46, wherein the lentiviral vector is integrated into the genome of a liver cell and maintained as the liver cell replicates, preferably wherein the lentiviral vector is integrated into the genome of a hepatocyte and maintained as the hepatocyte replicates.

[0630] 48. A lentiviral vector or pharmaceutical composition for use according to any of paragraphs 34, 37 to 47, a use according to any of paragraphs 35, 37 to 47, or a method according to any of paragraphs 36 to 47, in which plasma methylmalonic acid levels and / or urinary methylmalonic acid levels are reduced and / or normalized.

[0631] 49. A lentiviral vector or pharmaceutical composition for use according to any of paragraphs 34, 37 to 48, a use according to any of paragraphs 35, 37 to 48, or a method according to any of paragraphs 36 to 48, in which mitochondrial function is improved and preferably the plasma level of Fgf21 is reduced.

[0632] All publications mentioned in the above specification are incorporated herein by reference.Various modifications and variations of the disclosed vectors, cells, compositions, kits and uses of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention.Although the present invention has been disclosed in connection with certain preferred embodiments, it should be understood that the invention claimed should not be unduly limited to such specific embodiments.Undoubtedly, various modifications of the disclosed modes for carrying out the present invention that are apparent to those skilled in the art are intended to be within the scope of the following claims.

Claims

1. An immunoshielded lentiviral vector containing a nucleotide sequence encoding a methylmalonic acidemia (MMA)-related polypeptide.

2. The lentiviral vector according to claim 1, wherein the MMA-related polypeptide is selected from methylmalonyl-CoA mutase (MMUT) or a fragment thereof; methylmalonic aciduria type A (MMAA) or a fragment thereof; methylmalonic aciduria type B (MMAB) or a fragment thereof; methylmalonic aciduria and homocystinuria type D (MMADHC) or a fragment thereof; or methylmalonyl-CoA epimerase (MCEE) or a fragment thereof.

3. The lentiviral vector according to claim 1, wherein the MMA-related polypeptide is MMUT or a fragment thereof.

4. The lentiviral vector according to claim 1, wherein the MMA-related polypeptide comprises or consists of an amino acid sequence that is at least 70% identical to one of SEQ ID NOs. 37, 40, 42, 44, or 46 or a fragment thereof, preferably the MMA-related polypeptide comprises or consists of an amino acid sequence that is at least 70% identical to SEQ ID NOs. 37 or a fragment thereof.

5. The lentiviral vector according to claim 1, wherein the nucleotide sequence encoding the MMA-related polypeptide comprises or consists of a nucleotide sequence which is at least 70% identical to one of SEQ ID NOs. 38, 39, 41, 43, 45, or 47 or a fragment thereof, preferably comprising or consisting of a nucleotide sequence which is at least 70% identical to one of SEQ ID NOs. 38 or 39 or a fragment thereof.

6. The lentiviral vector according to claim 1, wherein the nucleotide sequence encoding the MMA-related polypeptide is codon-optimized and preferably comprises or consists of a nucleotide sequence in which the nucleotide sequence encoding the MMA-related polypeptide is at least 70% identical to SEQ ID NO: 39 or a fragment thereof.

7. The lentiviral vector is CD47 high The lentiviral vector according to claim 1, wherein the lentiviral vector is a lentiviral vector.

8. The lentiviral vector is CD47 high The lentiviral vector according to claim 1, obtained from a host cell, wherein the host cell is optionally genetically engineered to increase the expression of CD47 on its cell surface.

9. The lentiviral vector according to claim 1, wherein the lentiviral vector has at least about twice as much CD47 on its surface as a lentiviral vector obtained from an unmodified host cell.

10. Lentiviral vectors, MHC-I free The lentiviral vector according to claim 1, wherein the lentiviral vector is a lentiviral vector.

11. Lentiviral vectors, MHC-I free The lentiviral vector according to claim 1, obtained from a host cell, wherein the host cell is optionally genetically engineered to disrupt MHC-I expression on its cell surface.

12. The lentiviral vector according to claim 1, wherein MHC-I is not detectable on the surface of the lentiviral vector.

13. The lentiviral vector is CD47 high / MHC-I free The lentiviral vector according to claim 1, wherein the lentiviral vector is a lentiviral vector.

14. The lentiviral vector is CD47 high / MHC-I free A lentiviral vector obtained from host cells, according to claim 1.

15. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably ligated to one or more miRNA target sequences.

16. The lentiviral vector according to claim 15, wherein one or more miRNA target sequences suppress transgene expression in one or more cells other than hepatocytes, and preferably, one or more miRNA target sequences suppress transgene expression in hematopoietic cells and / or antigen-presenting cells.

17. The lentiviral vector according to claim 15, wherein one or more miRNA target sequences are selected from the miR-181, miR-142, miR-223, and miR-155 target sequences.

18. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably linked to one or more mir-142 target sequences, two or more mir-142 target sequences, three or more mir-142 target sequences, or four or more mir-142 target sequences.

19. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably linked to four mir-142 target sequences.

20. The lentiviral vector according to claim 15, wherein one or more miRNA target sequences include or consist of nucleotide sequences that are at least 90% identical to sequence number 17, preferably one or more miRNA target sequences include or consist of nucleotide sequences that are at least 90% identical to sequence number 18.

21. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably ligated to a liver-specific promoter, preferably, a nucleotide sequence encoding an MMA-related polypeptide is operably ligated to a hepatocyte-specific promoter.

22. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably ligated to a transthyretin (TTR) promoter, an alpha-1-antitrypsin (AAT) promoter, a thyroxine-binding globulin (TBG) promoter, an APoE / hAAT promoter, an HCR-hAAT promoter, an LP1 promoter, or an HLP promoter.

23. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably ligated to a transthyretin (TTR) promoter, preferably, a nucleotide sequence encoding an MMA-related polypeptide is operably ligated to an Enh1mTTR(ET) promoter.

24. The lentiviral vector according to claim 1, wherein a nucleotide sequence encoding an MMA-related polypeptide is operably linked to a promoter comprising or consisting of a nucleotide sequence that is at least 70% identical to SEQ ID NO:

19.

25. The lentiviral vector according to claim 1, wherein the lentiviral vector is pseudotyped, preferably the lentiviral vector is pseudotyped with VSV.G.

26. The lentiviral vector according to claim 1, wherein the lentiviral vector is a self-inactivating (SIN) lentiviral vector, and preferably the lentiviral vector comprises a self-inactivating (SIN)LTR comprising a nucleotide sequence that is at least 70% identical to SEQ ID NO: 23 or a fragment thereof.

27. The lentiviral vector according to claim 1, wherein the lentiviral vector is an embedded lentiviral vector and / or a replication-deficient lentiviral vector.

28. The lentiviral vector according to claim 1, wherein the lentiviral vector comprises a nucleotide sequence that is at least 70% identical to sequence number 36.

29. Isolated cells comprising the lentiviral vector described in claim 1.

30. A pharmaceutical composition comprising the lentiviral vector described in claim 1 in combination with a pharmaceutically acceptable carrier, diluent, or excipient.

31. A pharmaceutical composition according to claim 30, for use as a pharmaceutical.

32. Use of the lentiviral vector according to claim 1 for the manufacture of pharmaceuticals.

33. A pharmaceutical composition according to claim 30 for a method comprising the step of administering a therapeutically effective amount of the pharmaceutical composition according to claim 30 to a subject in need thereof.

34. The pharmaceutical composition according to claim 30, for use in the prevention or treatment of methylmalonic acidemia (MMA).

35. Use of the lentiviral vector according to claim 1 for the manufacture of a pharmaceutical product for the prevention or treatment of methylmalonic acidemia (MMA).

36. A pharmaceutical composition according to claim 30 for a method of preventing or treating methylmalonic acidemia (MMA), comprising the step of administering a therapeutically effective amount of the pharmaceutical composition according to claim 30 to a subject in need thereof.

37. The pharmaceutical composition according to claim 34, wherein the MMA-related polypeptide is MMUT or a fragment thereof and the MMA is mut-type MMA (mut-MMA); the MMA-related polypeptide is MMAA or a fragment thereof and the MMA is cblA-type MMA (cblA-MMA); the MMA-related polypeptide is MMAB or a fragment thereof and the MMA is cblB-type MMA (cblB-MMA); the MMA-related polypeptide is MMADHC or a fragment thereof and the MMA is cblD-type MMA (cblD-MMA); or the MMA-related polypeptide is MCEE or a fragment thereof and the MMA is due to MCEE deficiency.

38. The MMA-related polypeptide is MMUT or a fragment thereof, MMA is mut-MMA, and preferably, mut-MMA is mut 0 subtype or mut - subtype, the pharmaceutical composition according to claim 34.

39. The pharmaceutical composition according to claim 31, wherein the target is human subjects.

40. The pharmaceutical composition according to claim 31, wherein the target population is young.

41. The pharmaceutical composition according to claim 31, wherein the target is a pediatric patient, and preferably a neonatal patient or an infant patient.

42. The pharmaceutical composition according to claim 31, wherein the lentiviral vector or the pharmaceutical composition is administered systemically, preferably by intravenous injection or intraperitoneal injection.

43. The pharmaceutical composition according to claim 31, wherein the lentiviral vector or the pharmaceutical composition is administered locally, preferably by direct injection, intra-arterial injection, or intra-portal injection.

44. The pharmaceutical composition according to claim 43, wherein the lentiviral vector or the pharmaceutical composition is administered locally to the liver, preferably by intrahepatic injection, intrahepatic arterial injection, or portal vein injection.

45. The lentiviral vector is at least about 10 8 TU / kg, at least about 10 9 TU / kg, or at least about 10 10 The pharmaceutical composition according to claim 31, administered in a dose of TU / kg.

46. Lentiviral vectors, approximately 10 8 ~about 10 11 TU / kg, approximately 10 8 ~about 10 10 TU / kg, or approximately 10 9 ~about 10 10 The pharmaceutical composition according to claim 31, administered in a dose of TU / kg.

47. The pharmaceutical composition according to claim 31, wherein the lentiviral vector is incorporated into the genome of liver cells and maintained during liver cell replication, preferably the lentiviral vector is incorporated into the genome of hepatocytes and maintained during hepatocyte replication.

48. The pharmaceutical composition according to claim 34, wherein plasma methylmalonic acid levels and / or urinary methylmalonic acid levels are reduced and / or normalized.

49. The pharmaceutical composition according to claim 34, wherein mitochondrial function is improved, and preferably, plasma levels of FGF21 are reduced.

50. A composition comprising an immunoshielded lentiviral vector for use in a therapeutic method, wherein the method comprises the step of administering the immunoshielded lentiviral vector to a young or pediatric subject.

51. A composition comprising cells for use in a therapeutic method, wherein the cells comprise an immunoshielded lentiviral vector, and the method comprises the step of administering the cells to a young or pediatric subject.

52. A composition comprising an immunoshielded lentiviral vector according to claim 50, wherein the target is a neonatal or infant.

Images