antibody preparations
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- NOVARTIS AG
- Filing Date
- 2025-10-30
- Publication Date
- 2026-06-12
Abstract
Description
[Technical Field]
[0001] The present invention relates to novel pharmaceutical preparations, in particular those containing human interleukin-1 beta (IL-1) as an active ingredient. novel pharmaceutical preparations containing human antibodies against β), in particular those described in WO2002 / 016436; The present invention relates to antibodies. [Background technology]
[0002] Like other protein therapeutics, antibodies are complex molecules and are generally administered intravenously in pharmaceutical formulations. To obtain a therapeutically effective dose in a species, especially in humans, large amounts of antibody must be used. The liquid formulation of a protein therapeutic should be stored in a manner that does not impair the biological activity of the protein therapeutic. , should prevent degradation of functional groups of protein therapeutics during manufacturing and shelf life. Protein degradation pathways can involve chemical or physical instability.
[0003] Initially, to address the issue of instability in protein therapeutic formulations, the drug was frozen. A method has been proposed in which the drug is lyophilized and then reconstituted immediately before or shortly before administration. The reconstituted formulation can be reproducibly administered to yield a safe formulation with effective therapeutic effect. It is required that the compound be stable and physiologically active.
[0004] For ease of use, liquid pharmaceutical formulations of protein therapeutics, i.e. antibodies, are designed to be stable over time. It should contain a safe and effective amount of the pharmaceutical compound.
[0005] A major long-standing problem with liquid formulations of protein therapeutics is the protein Aggregation is a problem where protein molecules physically stick to each other, causing, for example, undesirable immune reactions. This leads to the formation of opaque insoluble matter or precipitates that may indicate a reaction. A major problem caused by this is that the product can clog the syringe or pump during administration, causing the patient This could be dangerous for the Summary of the Invention [Problem to be solved by the invention]
[0006] Therefore, protein therapeutics, especially those that are stable over time and do not aggregate even at high antibody concentrations, are of great importance. The present invention provides a pharmaceutical composition comprising an antibody, which is free from protein aggregation and stable. and have a sufficiently low viscosity and are therefore suitable for administration to mammals, particularly human subjects. The present invention addresses the above-identified needs by providing a novel formulation.
[0007] Interleukin-1β (IL-1 beta or IL-1β or interleukin- 1β has the same meaning herein) induces a wide range of immune and inflammatory responses. Inappropriate or excessive production of IL-1β can lead to various Disease and disease conditions, such as sepsis, septic or endotoxic shock, allergies, asthma Associated with inflammatory disorders such as bronchitis, osteopenia, ischemia, stroke, rheumatoid arthritis, and other inflammatory disorders. Antibodies against IL-1β have been proposed for use in treating IL-1-mediated diseases and disorders. See, for example, WO 95 / 01997 and the discussion in its introduction, and WO 0 See US Provisional Patent Application No. 2 / 16436, the contents of which are incorporated by reference. [Means for solving the problem]
[0008] Particularly preferred antibodies against IL-1β for use in the formulations of the present invention are those shown below in SEQ ID NO: 1 and SEQ ID NO: 2. ACZ885 antibody shown in No. 2 or F(ab)2, Fab, scFv, VH domain A functional fragment of the ACZ885 antibody that retains its affinity for the antigen, such as its CDRs. be.
[0009] An object of the present invention is to provide an antibody formulation that can be stably stored and delivered. According to the study, a stable formulation is one in which the antibody therein maintains its physical and chemical stability and For example, lyophilization and storage, or in the case of liquid formulations, The range of product-related substances and product-derived impurities with storage is about 2-5%, preferably A biological activity assay may be used to measure the stability of the antibody formulation, and storage The biological activity of the preparation of the present invention during storage is approximately 80 to 125% of the original activity. The biological activity of the antibodies was determined in a reporter gene assay as described in the Examples below. It is measured using genetically modified cell lines.
[0010] A further object is to provide a stable liquid antibody formulation suitable for subcutaneous administration. Preferably, the mammalian It is also an object to provide formulations that are stable during administration, particularly to human subjects.
[0011] Generally, pharmaceutical preparations for subcutaneous injection are used in small volumes (usually up to 1.0 mL to 1.2 mL). In the case of formulations containing antibodies, e.g., high-dose antibody therapeutics, subcutaneous administration is preferred. High-concentration antibody formulations (e.g., 50 mg / ml to 150 mg / ml or more) are required. Because high antibody concentrations are required, antibody-containing formulations must be able to withstand the physical and Regarding chemical stability, aggregate formation, and difficulties associated with manufacturing, storage, and delivery of antibody formulations There are related issues.
[0012] The increased viscosity of protein formulations can have adverse effects on the drug delivery to patients, including processing, e.g., the viscosity of liquids. Processability, e.g., high viscosity means that the fluid can no longer pass through the gauge of the needle without difficulty. lack of supply and causing patient discomfort; administration time; availability of autoinjectors Furthermore, it has a low viscosity and is relatively high in concentration. It is desirable that an antibody formulation be easy to manufacture, store, and administer. The term "viscosity" as used herein may be "kinematic viscosity" or "dynamic viscosity." Generally, kinematic viscosity is expressed in centistokes (cSt). The SI unit of kinematic viscosity is mm2 / s. The absolute viscosity is expressed in centipoise units (cP). The absolute viscosity S The unit is millipascal-second (mPa-s), where 1 cP = 1 mPa-s.
[0013] Thus, the present invention provides a method for the preparation of a composition comprising an IL-1β antibody, which is stable and does not become viscous even at high antibody concentrations. The viscosity is sufficiently low and aggregation-free.
[0014] Liquid pharmaceutical antibody formulations should exhibit a variety of predefined properties. The substance is prone to forming soluble and insoluble aggregates during manufacturing and storage, making it difficult to One of the main concerns in pharmaceuticals is stability. Furthermore, various chemical reactions occur in solution. occurs in the decomposition products (deamidation, oxidation, clipping, isomerization, etc.) This may result in increased risk of infection and / or loss of biological activity. The shelf life of liquid antibody formulations is 18 The expiration date for the liquid ACZ885 formulation is preferably greater than 24 months. The shelf life and activity of the IL-1β antibody are most preferably determined by the biological activity assay in the Examples. The activity of these compounds is between 80% and 125% of the original activity. It should be preserved.
[0015] Antibody preparations, especially ACZ885 antibody preparations, have a shelf life of approximately 36 to 60 months at 2 to 8°C. Preferably, the shelf life of ACZ885 liquid is approximately 24-36 months at 2-8°C. The expiration date for ACZ885 lyophilized tablets should preferably be stored at 2-8°C for up to 12 months. It should show about 60 months.
[0016] The main factors that determine shelf life are usually the formation of by-products and degradation products and biological activity. The formulations of the present invention achieve these desired stable levels.
[0017] Apart from sufficient physical and chemical stability, the formulation has acceptable p The H value and osmolality should be between 250 and 500 mOsm / kg. and high-weight osmolybdenum phosphate-soluble ... It has been reported in the literature that formulations with high concentrations (up to 1100 mOsm / kg) can be administered subcutaneously. High antibody concentrations are also known to increase viscosity and aggregation of the formulation. Suitable pharmaceutical formulations according to the present invention have a viscosity of less than about 16 mPas, preferably between 3 and 16 mPas. The viscosity is preferably 3 to 10 mPas.
[0018] According to the present invention, the antibody has advantageous properties for preserving antibody activity during long-term storage, A particularly stable antibody formulation that prevents aggregation and has appropriate viscosity despite high antibody concentrations is desired. It has surprisingly been discovered that in its broadest aspect, the present invention provides an active Pharmaceutical formulations (of the present invention) comprising an antibody as the active ingredient, and a buffer system, stabilizers and surfactants. The formulations of the present invention may be liquid or lyophilized, and may be subsequently subjected to antibody concentration. The reconstituted formulations are also suitable for reconstitution into solutions with lower, equal, or higher pH. A formulation prepared from a lyophilized product such that the antibody in the formulation is dispersed within the reconstituted formulation. be.
[0019] The present invention relates to a novel formulation comprising an antibody against IL-1β as the active ingredient and a buffer system. Regarding the above, the pH value of the formulation is 5.5 to 7.5, preferably 5.5 to 7, and more preferably 6. More specifically, the present invention provides a method for treating a pulmonary arthritis (PTA) comprising administering to a patient a therapeutically effective amount of an ACZ885 antibody as an active ingredient, and and a buffer system, the pH value of the formulation is 5.5 to 7.5, preferably 5. 0.5 to 7, and preferably 6.2 to 6.8.
[0020] The present inventors have now discovered that the pH is 5.5 to 7.5, preferably 5.5 to 7, and more preferably A stable formulation can be prepared using a buffer system that can yield a formulation with a pH of 6.2-6.8. In certain embodiments, the pH may be any of the pH values listed above. Examples include 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, and 6.8.
[0021] A preferred buffer system according to the present invention is citrate, histidine, sodium succinate, or and sodium and / or potassium phosphate buffer systems, and other organic acids, or Inorganic acids are preferred, preferably histidine or citrate, with best results achieved with histidine. was obtained using
[0022] The concentration of a suitable buffer system for use in a formulation according to the invention will depend, for example, on the desired concentration of the buffer and the formulation. Depending on the stability of the compound, the concentration may be about 10 mM to about 50 mM, or about 10 mM to about 40 mM. do.
[0023] In a preferred embodiment, the buffer system is histidine, and the histidine is 10 to 50 mM It is used at a concentration of 15 to 40 mM, preferably 20 to 30 mM. is preferred.
[0024] The formulation of the present invention may preferably further comprise a stabilizer. Contains sugar, trehalose, mannitol, sorbitol and arginine hydrochloride. Best results are obtained when cellulose or mannitol is used. The concentration of the suitable stabilizer used is about 50 to 300 mM, preferably 180 to 300 mM. and most preferably about 270 mM sucrose or mannitol. In this study, the lyophilized and reconstituted solution contained sucrose or mannitol as a stabilizer. In another particular embodiment, the liquid formulation comprises mannitol as a stabilizer.
[0025] The formulations of the present invention further comprise a compound selected from the group comprising a bulking agent, a salt, a surfactant and a preservative. One or more excipients may optionally be included.
[0026] Bulking agents add bulk to the pharmaceutical formulation and contribute to the physical structure of the formulation in lyophilized form. Suitable bulking agents according to the present invention are mannitol, glycine, polyethylene glycol, The concentrations of bulking agents used in the formulations according to the present invention include: It is 20 to 90 mM.
[0027] The use of detergents can lead to aggregation of the reconstituted protein and / or The amount of surfactant added can reduce the formation of fine particles in the formulation. An amount sufficient to reduce aggregation of the reconstituted protein and minimize the formation of particulates after reconstitution. do.
[0028] Suitable surfactants according to the present invention include polysorbates (e.g., polysorbate 20 or 80); poloxamer (e.g., poloxamer 188); Triton; sodium dodecyl sulfate Sodium lauryl sulfate; Sodium octyl glucoside; Lauryl-, Myristyl-, linoleyl-, or stearyl-sulfobetaine, lauryl-, myris thyl-, linoleyl-, or stearyl-sarcosine, linoleyl-, myristyl-, Or cetyl betaine, lauroamidopropyl, cocamidopropyl, linoleamidopropyl Dopropyl-, myristamidopropyl-, palmidopropyl-, or isostearamidopropyl Dopropyl-betaine, (e.g., lauroamidopropyl); myristamidopropyl-, Isostearamidopropyl- or isostearamidopropyl-dimethylamine, cocoyl methyl Sodium oleate, or disodium methyloleoyl taurate, and MONAQ UAT (registered trademark) series (Mona Industries, Inc., Paterson) on, New Jersey), polyethyl glycol, polypropyl glycol, and and copolymers of ethylene and propylene glycol (e.g., Pluronics, PF In a preferred embodiment, the surfactant includes polysorbate 20 and Polysorbate 80 may be selected from the group consisting of:
[0029] The concentration of surfactant used in the formulation according to the present invention is about 0.001 to 0.5% of the formulation, Or about 0.005 to 0.10%, preferably 0.01 to 0.10%, most preferably The surfactant is added in an amount of about 0.04 to 0.06% by volume. It can be added to the drug, lyophilized formulation, and / or reconstituted formulation as desired, but may not be added to the drug if previously frozen. It is preferably added to the lyophilized formulation.
[0030] Optionally, preservatives may be used in the formulations of the invention. Suitable preservatives used in the formulations of the invention are The preservatives are octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, and benzyl Ammonium chloride (alkylbenzyldimethylammonium chloride, where the alkyl group is a long-chain compound) Other types of preservatives include phenol, benzoyl perfluorooctyl benzoate ... aromatic alcohols such as methyl, butyl and benzyl alcohol; Parabens, catechol, resorcinol, cyclohexanol, 3-pentanol, and and alkylparabens such as m-cresol.
[0031] Remington's Science and Practice of Pha rmacy, 21st edition (2005) or Art, Science and Tech nology of Pharmaceutical Compounding, 3rd edition (2008) and other pharmaceutically acceptable carriers, excipients, or stabilizers. may be included in the formulations of the present invention provided that they do not adversely affect the desired properties of the formulation. The carrier, excipient, or stabilizer used is nontoxic to recipients at the dosages and concentrations employed, and is a buffer. Preservatives, co-solvents, antioxidants including ascorbic acid and methionine, chelates such as EDTA stabilizers, metal complexes (e.g., Zn-protein complexes), biodegradable polymers such as polyesters and / or further comprising a salt-forming counterion such as sodium. DETAILED DESCRIPTION OF THE INVENTION
[0032] In one embodiment, the present invention provides an antibody, preferably an antibody against IL-1β, most preferably or ACZ885, and a stable liquid, lyophilized, or reconstituted product containing a buffer system. The present invention provides a formulation that is sufficiently stable, exhibits minimal aggregation, and has acceptable viscosity. To minimize the risk of irritation, the pH of the liquid or reconstituted formulation should be between 5.5 and 7.5, preferably 5.5. The formulation according to the present invention is suitable for lyophilization. The present invention provides a method for the preparation of IL-1β-containing steroid hormones, which can be reconstituted with water in an acceptable period of time, typically less than 10 minutes. and a stable reconstituted formulation comprising an antibody, most preferably the ACZ885 antibody, and a buffer system. The reconstituted formulation is prepared from a lyophilized mixture of the antibody and buffer system, and The pH of the agent is 5.5 to 7.5, preferably 5.5 to 7, and more preferably 6.2 to 6.8. The reconstitution time is less than 10 minutes. A stable reconstituted formulation is one in which the antibody in the formulation remains stable after reconstitution. During storage from the time of purchase to use, typically from a few hours to a few days, its physical and formulations that essentially retain their inherent chemical stability and integrity.
[0033] In a further embodiment, the present invention provides (a) an antibody against IL-1β, most preferably (b) lyophilizing the formulation comprising the ACZ885 antibody and a buffer system; Reconstitute the lyophilized mixture of step (a) with a solvent such that the reconstituted formulation is stable. and b.
[0034] The formulation of step (a) may contain stabilizers, and the bulking agents, salts, surfactants and It may further comprise one or more excipients selected from the group comprising preservatives.
[0035] As reconstitution solvents, diluted organic acids or water, i.e., sterile water, bacteriostatic water for injection (BWF), I) may be used. The reconstitution solvent may be water, i.e., sterile water, bacteriostatic water for injection (BWFI), or about 50 to about 100 mM of acetic acid, propionic acid, succinic acid, sodium chloride, salt Magnesium chloride, acidic solution of sodium chloride, acidic solution of magnesium chloride, arginine The acid solution may be selected from the group consisting of:
[0036] The present invention therefore provides: a) an antibody against IL-1β, preferably used at a concentration of about 10 to 150 mg / ml ACZ885 antibody, b) It can be used at a concentration of about 10 to 50 mM, and the pH of the buffer system is 5.5 to 7.5, preferably A buffer system with any pH value in the range of 6.2 to 6.8, preferably citrate, histidine sodium succinate, or sodium and / or potassium phosphate buffer a buffer system, most preferably a histidine buffer system, and optionally c) a stabilizer, preferably sucrose, trehalose, mannitol, at a concentration of about 50 to 300 mM; tetritol, sorbitol, or arginine hydrochloride, most preferably sucrose or mannitol. Thor, optionally, d) further comprising an excipient selected from the group consisting of a bulking agent, a salt, a surfactant, and a preservative. Pharmaceutical formulations are provided.
[0037] In one embodiment of the present invention, the bulking agent (e.g., mannitol or glycine) is added in advance. It is used to prepare freeze-dried preparations. The bulking agent ensures uniform freezing without excessive pockets. A dry cake may be produced.
[0038] A preferred liquid formulation of the present invention contains mannitol at 10 to 150 mg / ml, 270 mM, histidine, Containing ACZ885 at concentrations of 20 mM thymine and 0.04% polysorbate 80 A formulation is provided, the pH of the formulation being 6.5.
[0039] A preferred reconstituted formulation of the present invention contains, in reconstituted form, 10 to 150 mg of sucrose. / ml, 270 mM, histidine 30 mM and polysorbate 80 0.06% and a lyophilized agent that produces a reconstituted formulation containing ACZ885 at 25°C, the pH of the formulation being 6. It is 5.
[0040] The present invention further provides a method for treating IL-1β with an antibody against IL-1β, most preferably ACZ885. a mammal, particularly a human subject, having a desired disease, administered a therapeutically effective amount of the compounds disclosed herein. Methods of treating mammalian, particularly human, subjects are provided, comprising administering the reconstituted formulation. For example, the formulation may be administered subcutaneously.
[0041] The formulations of the present invention are useful for treating IL-1 mediated diseases or medical conditions, such as inflammatory conditions, arthritis, and arthritis. Allergies and allergic diseases, hypersensitivity symptoms, autoimmune diseases, severe infections, and organ They are useful in preventing and treating transplant or tissue graft rejection.
[0042] An object of the present invention is to use the formulations of the present invention in the treatment of IL-1 mediated diseases or medical conditions. The key is to use it.
[0043] For example, the formulations of the present invention may be used in the treatment of cardiac, pulmonary, cardiopulmonary, and pulmonary graft rejection, including transplant or xenograft rejection. Treatment of transplant patients undergoing concurrent liver, kidney, pancreas, skin or corneal transplants, as well as bone marrow transplants and for the prevention of graft-versus-host disease, such as that associated with arteriosclerosis in organ transplantation.
[0044] The formulations of the present invention are particularly useful for treating, preventing, or ameliorating autoimmune and inflammatory diseases. and especially arthritis (e.g., rheumatoid arthritis, chronic progressive arthritis, and osteoarthritis). Inflammatory diseases caused by autoimmune factors such as rheumatic diseases including inflammatory diseases, and osteopenia Inflammatory pain, hypersensitivity (including both airway and skin hypersensitivity) and allergies Specific autoimmune diseases for which the formulations of the present invention may be used autoimmune blood disorders (e.g., hemolytic anemia, aplastic anemia, true red blood cell anemia, and systemic lupus erythematosus, polychondritis, cutaneous sclerosis, Gunner's granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Stephen J. Johnson's syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g., ulcerative colitis, clostridium moniliforme) rheumatoid arthritis, ... cis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (type 1 diabetes), uveitis ( anterior and posterior), keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis , and glomerulonephritis (nephrotic syndrome, e.g., idiopathic nephrotic syndrome or minimal glomerular nephritis) with and without modified nephrosis).
[0045] The formulations of the present invention may also be used to treat asthma, bronchitis, pneumoconiosis, emphysema, and other airway obstructive or It is useful in treating, preventing, or ameliorating airway inflammatory diseases.
[0046] The formulations of the present invention are useful for inhibiting IL-1 mediated or IL-1 production, particularly IL-1β, and is an undesirable acute and hyperacute inflammatory response involving IL-1-induced stimulation of TNF release , such as acute infections, such as septic shock (e.g., endotoxic shock and adult respiratory distress syndrome) It is useful in treating rheumatoid arthritis, meningitis, pneumonia, and severe burns, and is effective against infections, cancer, and The authors report that the cachexia or wasting syndrome associated with pathological TNF release due to organ failure, especially in HIV-infected patients, The compounds are useful in the treatment of AIDS-related cachexia associated with or accompanying AIDS infection.
[0047] The formulations of the present invention are useful for treating bone metabolism disorders such as osteoarthritis, osteoporosis, and other inflammatory arthritic conditions. It is particularly useful for treating osteopenia in general, such as age-related osteopenia, and periodontal disease in particular. .
[0048] The formulations of the present invention are useful for the prevention and treatment of autoinflammatory syndromes in mammalian and particularly human patients. According to the present invention, autoinflammatory syndromes include, but are not limited to, For example, there is a group of inherited diseases characterized by recurrent inflammation, which is caused by high titers of autoantibodies or This contrasts with autoimmune diseases in which antigen-specific T cells are lacking. In autoinflammatory syndromes, increased secretion of IL-1 beta (mutated in the disease) This may be due to the loss of the negative regulatory role of pyrin, NFkB activation, and leukocyte activation. According to the present invention, autoinflammatory syndromes include Muckle-Wells syndrome, apoptosis disorders, and Mendelian syndrome (MWS), latent autoimmune diabetes in adults (LADA), familial cold autoinflammatory disease FCAS, cryopyrin-associated periodic syndrome (CAPS), neonatal-onset multisystemic Inflammatory disease (NOMID), chronic infantile-onset neurocutaneous and articular syndrome (CINCA), familial Mediterranean fever (FMF) and / or systemic juvenile idiopathic arthritis (SJIA) certain types of juvenile rheumatoid arthritis, such as systemic juvenile idiopathic rheumatoid arthritis, and / or have some form of adult rheumatoid arthritis.
[0049] The formulations of the present invention are useful for treating juvenile rheumatoid arthritis and adult rheumatoid arthritis, and / or myeloma. Preferably, it is useful for the prevention and treatment of Buckley-Wells syndrome.
[0050] The formulations of the present invention may also be useful in the treatment of type 2 diabetes, and clinical and preclinical studies have shown IL-1 blockade has been shown to improve islet function. Retinopathy, wound healing, vascular disease (including arterial restenosis after stenting or angioplasty), kidney dysfunction, chronic kidney disease, and various diabetes-related conditions such as metabolic syndrome and obesity The formulations of the present invention are also useful in the treatment of migraines, synovitis, gout, pseudogout / gouty syndrome. arthritis, or cartilage calcification, chronic obstructive pulmonary disease (COPD), ventilator-induced lung injury, various Pain conditions, such as morphine-resistant pain, neuropathic pain, preterm labor pain, discogenic pain, and inflammation IL-1 beta may be useful in treating sexual pain, headaches, or migraines. Furthermore, the formulations of the present invention are effective in treating atherosclerosis, acute renal colic, and other conditions. , biliary colic, or pain associated with these conditions.
[0051] The formulations of the present invention are useful in treating periodic fever syndrome: familial Mediterranean fever (FMF), tumor necrosis factor receptor-associated periodic fever syndrome (TRAPS), mevalonate Kinase-associated periodic fever syndrome, also known as hyperimmunoglobulin D syndrome (HIDS), a familial Cold autoinflammatory syndrome and periodic fever aphthous stomatitis pharyngitis lymphadenitis (PFAPA) IL-1 beta is the primary cytokine and may be useful in the treatment of the syndrome. Therefore, other diseases that can be treated with the formulations of the present invention include antisynthetase syndrome, macrophage activation syndrome, MAS, Behcet's disease, Blau syndrome, PAPA syndrome, Schnitzler's syndrome The present invention provides IL-1 beta ligand-receptor blockade and IL-1 beta receptor blockade. -1 beta compound is used in the treatment of giant cell arteritis (GCA), Henoch-Schönlein purpura, primary Systemic vasculitis, Kawasaki disease (mucocutaneous lymph node syndrome), Takayasu's arteritis, periarteritis nodosa, Atopic cryoglobulinemic vasculitis, microscopic polyangiitis (MPA) and Churgstromia Furthermore, the product of the present invention may be used for the treatment of urticarial syndrome (CSS), urticarial vasculitis, and urticarial vasculitis. The drug is used to treat sarcoidosis, pemphigus, ankylosing spondylitis, Alzheimer's disease, amyloidosis, and sepsis. for the treatment of autoimmune diseases such as amyloidosis and adult-onset Still's disease (AOSD) It is useful.
[0052] The formulations of the present invention can be used to treat HLA-B27-associated diseases, including but not limited to, psoriasis. The present invention may also be used to treat inflammatory bowel disease, ankylosing spondylitis, Reiter's disease and enteropathic arthritis. According to Akira, IL-1 beta compounds have been used to treat rheumatic fever, polymyalgia rheumatica, and giant cell carcinoma. Finally, the formulations of the present invention may be used to treat infections, particularly bacterial and viral infections. infections, more particularly, but not limited to, for example, hematogenous osteomyelitis, infected joints, Used to treat bacterial infections associated with the symptoms or symptoms of arthritis, such as rheumatoid arthritis and tuberculous arthritis You may do so.
[0053] Appropriate doses for the above indications will vary depending on, for example, the specific antibody to IL-1β used. It will vary depending on the organism, the host, the method of administration and the nature and severity of the condition being treated. The frequency of dosing for prophylactic use usually ranges from approximately once a week to approximately once every three months. More commonly, it ranges from about once every 2 weeks to about once every 10 weeks, e.g., once every 4–8 weeks. be.
[0054] The formulations of the present invention may be suitably administered to a patient at one time or over a series of treatments, and at any time after diagnosis. may also be administered to a patient at any time, either as the sole treatment or as described herein. It may also be administered in combination with other agents or therapies useful in treating the condition.
[0055] In preventive therapy, the preparation of the present invention is generally administered once a month to once every 2 to 3 months, or involves administering it less frequently.
[0056] The formulations of the present invention containing ACZ885 are administered by intravenous, subcutaneous or intramuscular injection, preferably. For such purposes, it is preferable to administer the formulation by injecting it using a syringe. For example, a formulation containing ACZ885 may be administered in an autoinjector, optionally in a sterile package. It is administered using a conventional syringe, which may be prefilled, optionally equipped with a safety device. Microneedles and reservoir-type coated patches are also contemplated as suitable administration devices.
[0057] The formulation of the present invention is administered to a mammal in need of treatment with an antibody against IL-1β, i.e., ACZ885. Administered to humans, preferably by known methods, such as bolus injection or continuous infusion over a period of time. By intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, and topical administration It may also be administered by the oral or inhaled route.
[0058] Formulations to be used for in vivo administration must be sterile. Alternatively, the solution can be easily sterilized by filtration through a sterile filtration membrane. The entire mixture is sterilized by autoclaving the components of (a) at about 120° C. for about 30 minutes. can be done.
[0059] The formulation of the present invention containing ACZ885 is effective for the treatment of adult rheumatoid arthritis (RA), juvenile rheumatoid arthritis (JRA), and Uromatologic (SJIA, pJIA), chronic obstructive pulmonary disease (COPD), CAPS, Muckle of MWS, osteoarthritis (OA), and potential type 2 diabetes and gout It is preferably administered subcutaneously during treatment.
[0060] The present invention further provides an isotonic solution obtained by diluting the reconstituted formulation with an infusion solution. do.
[0061] The term treatment refers to both therapeutic treatment and prophylactic or preventative measures.
[0062] The term mammal of interest refers to any animal classified as a mammal, including humans. Domestic animals such as dogs, horses, cats, and cows, as well as animals used for zoos, sports, or as pets. Preferably, the mammal is a human.
[0063] The disease is any condition that would benefit from treatment with antibodies to IL-1β. Chronic and acute forms of disease or illness in mammals, including conditions that predispose to the disease in question Non-limiting examples of diseases to be treated herein include the diseases mentioned above and Diseases include:
[0064] A therapeutically effective amount is at least that which produces a measurable improvement or prevention in a particular disease. This is the minimum concentration required to [Example]
[0065] Preparation of liquid formulation and its freeze-drying Can be administered both intravenously after reconstitution and subsequent dilution and subcutaneously after reconstitution Develop ACZ885 formulation.
[0066] Four different buffer systems (citrate, histidine, sodium succinate, and phosphate sodium / potassium phosphate buffer system, each concentration 40 mM) was selected, and ACZ885 formulation The suitability for was checked.
[0067] Shaking and freeze-thaw cycles were used as stress tests to assess the suitability of protein aggregation. The buffer systems were ranked according to their reactivity.
[0068] Histidine or citrate buffers were used in the pH range of 5.0 to 7, as shown in Table 1. This resulted in the most effective prevention of protein aggregation.
[0069] [Table 1]
[0070] The pH range from 3.5 to 8.0 was investigated in increments of 0.5. After 4 weeks of storage at 40°C, different pH values ranging from 6.2 to 6.8 were analyzed using different analytical techniques. Based on the results, it was concluded that this was optimal.
[0071] [Table 2]
[0072] The results for the histidine and citrate buffer samples were similar. However, the pain sensation after administration was increased, which may not be suitable for a subcutaneous formulation. , histidine may be preferable to citrate for subcutaneous application.
[0073] After selecting an appropriate buffer system, the effect of stabilizers on protein aggregation was investigated. Formulations containing lysine, mannitol, sorbitol, or trehalose were incubated at 5°C and 40°C. The samples were analyzed after storage at 40°C for 6 and 16 weeks. This was observed in preparations containing cellulose, possibly due to the interaction of amino or histidine groups with proteins. The reaction is caused by the Maillard reaction between gin and reducing sugars. Formulations containing mannitol were selected for lyophilization and reconstitution. was selected for the agent.
[0074] To evaluate the effect of surfactant concentration on the physical-chemical stability of the formulation of the present invention Further investigation was carried out on the fine particulate matter data below for surfactant-free formulations. The highest value was 0.10, indicating that Tween is beneficial to the physical stability of the sample. Particulate matter data for % Tween concentrations tend to be higher compared to lower concentrations.
[0075] [Table 3]
[0076] The liquid sample contained 150 mg / mL of ACZ885, 20 mM histidine, and mannitol. The solution was 270 mM, containing 0.04% (m / v) Tween 80, and had a pH of 6.5. It was stored at 5°C, 25°C and 40°C for up to 24 months. At 5°C, a large amount of soluble and As described below, no soluble or insoluble aggregates were detected. The biological activity measured using the ELISA assay ranged from 70 to 125%. The data (see Tables 4 to 6) show that the tested formulations were stable for storage for 24 months.
[0077] [Table 4]
[0078] [Table 5]
[0079] [Table 6]
[0080] Reconstitution of lyophilized formulations The solution of ACZ885 according to the present invention is suitable for lyophilization. Lyophilization is a technical field of pharmaceutical preparation. The procedure can be carried out under normal conditions well known in the art. It may be included to add weight and visibility to the lyophilized material.
[0081] After mixing the antibody, 10-40 mM buffer, stabilizer, and surfactant, the formulation is frozen. Let it dry.
[0082] [Table 7]
[0083] Reconstitution generally occurs at a temperature of 15-25°C to ensure complete hydration. The lyophilisate is reconstituted with sterile water.
[0084] The target concentration after reconstitution is 150 mg / ml. Each formulation is lyophilized and reconstituted with water. will be returned to
[0085] stability The different formulations are stored at 2-8°C, 25°C and 40°C for 3 months.
[0086] Aggregation upon lyophilization and storage is used as an indicator of protein stability.
[0087] Reporter gene assay The biological activity of ACZ885 was assessed using genetically engineered cell lines expressing a reporter gene. This cell line is derived from human embryonic kidney cells and is expressed under the promoter NF The IL-1β-responsive promoter was fused upstream of the luciferase gene. The porter construct was stably transfected.
[0088] Transfection was performed by co-transfection with the neomycin resistance gene. Exposure to L-1β stimulated luciferase expression in a dose-dependent manner.
[0089] The addition of measured amounts of ACZ885 to conventional, submaximal levels of IL-1β resulted in a significant improvement in IL-1β activity for up to 18 hours. This caused a decrease in luciferase expression during the incubation period. At the end of the incubation, the amount of luciferase was quantified based on the enzyme activity in the cell lysate. Luciferase converts the substrate luciferin to the chemiluminescent product oxyluciferin. The conversion was catalyzed, and the resulting glow-type chemiluminescence was then measured in an appropriate luminometer.
[0090] The ability of ACZ885 standard to inhibit IL-1β-dependent induction of luciferase activity was evaluated. The biological potency of ACZ885 test samples was determined by comparing the protein content. Samples and standards were normalized based on the European Pharmacopoeia. The final result was calculated as the relative potency (percentage) of the sample compared to the standard. The time is expressed in cents.
[0091] Reagents and buffers Cell culture medium MEM + Earle's salts + L-glutamine basal medium Heat-inactivated, mycoplasma-screened fetal calf serum (FCS) Geneticin Enzyme-free, PBS-based cell dissociation buffer Assay basal medium OptiMEM-I + GlutaMAX-I Luciferase substrate for glow-type chemiluminescence Recombinant interleukin-1 beta (IL-1β)
[0092] Assay procedure steps: (1) Various concentrations of standard and test samples were tested to determine the concentration of ACZ885 at 400 ng / ml. Several 1:2 dilutions were made from the developing solution. (2) 2 × 10 resuspended in assay medium 4 Cells were plated in 96-well microtiter plates. The solution was added to each well of the plate. (3) The assay was initiated by the addition of IL-1 beta solution. Incubation in the oven was for a maximum of 18 hours. (4) After incubation, luciferase substrate solution was added to all wells. Incubate the plates for an additional 10 minutes in the dark and measure the luminescence of each well with the appropriate Measurement was performed by a microtiter plate luminescence reader. (6) The unweighted mean relative titers of the samples were calculated from parallel EP data from at least two independent experiments. Calculated using line evaluation.
[0093] [Table 8]
[0094] Formulation 3 had the lowest amount of aggregation. Formulations 1 and 3 lost approximately 100% of their original biological activity during storage. The activity was 90-105%.
[0095] Administration of the formulation An appropriate dose (i.e., a therapeutically effective amount) of ACZ885 may be determined, for example, based on the condition to be treated. , severity and course of symptoms, whether ACZ885 was administered for prophylactic or therapeutic purposes, previous treatment, It depends on the patient's medical history and response to ACZ885, as well as the discretion of the treating physician.
[0096] ACZ885 H chain variable region SEQ ID NO: 1 JPEG2026021446000009.jpg71170 DNA SEQ ID NO:3 atggagtttgggctgagctggggtttcctcgttgctcttttaagaggtgtccagtgtcag gtgcagctggtggagtctgggggaggcgtggtccagcctgggaggtccctgagactctcc tgtgcagcgtctggattcaccttcagtgtttatggcatgaactgggtccgccaggctcca ggcaaggggctggagtgggtggcaattattggtatgatggagataatcaatactatgca gactccgtgaagggccgattcaccatctccagagacaattccaagaacacgctgtatctg caaatgaacggcctgagagccgaggacacggctgtgtattatgtgcgagagatcttagg actgggccttttgactactggggccagggaaccctggtcaccgtctctc
[0097] 2 JPEG2026021446000010.jpg71170 DNA sequence number 4 atgttgccatcacaactcattgggtttctgctgctctgggttccagcctccaggggtgaa attgtgctgactcagtctccagactttcagtctgtgactccaaaggagaaagtcaccatc acctgccgggccagtcagagcattggtagtagcttacactggtaccagcagaaaccagat cagtctccaaagctcctcatcaagtatgcttcccagtccttctcaggggtcccctcgagg ttcagtggcagtggatctgggacagatttcaccctcaccatcaatagcctggaagctgaa gatgctgcagcgtattactgtcatcagagtagtagtttaccattcactttcggccctggg accaaagtggatatcaaa The inventions described in the original claims of this application are set forth below. [1] An antibody against IL-1β comprising the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, A pharmaceutical formulation containing a buffer system and having a pH of 5.5 to 7.5. [2] The formulation described in [1] above, having a pH of 5.5 to 7. [3] The formulation according to [1] above, having a pH of 6.2 to 6.8. [4] The buffer system is composed of citrate, histidine, sodium succinate, and sodium phosphate.
[0023] The buffer solution according to [1] above is selected from the group consisting of sodium and / or potassium phosphate buffer systems. The formulation described above. [5] The formulation according to [4] above, wherein the buffer system is a histidine buffer system. [6] The formulation according to [5] above, wherein the histidine is present in an amount of 15 to 50 mM. [7] The formulation described in [1] above, further comprising a stabilizer. [8] Stabilizers include sucrose, trehalose, mannitol, sorbitol, and hydrochloric acid. The formulation described in [7] above, wherein the compound is selected from the group consisting of arginine. [9] The stabilizer is sucrose or mannitol in an amount of 50 to 300 mM. 8] The formulation described in.
[10] One or more selected from the group including bulking agents, salts, surfactants, and preservatives. The formulation according to any one of [1] to [9] above, further comprising an excipient:
[11] The method according to any one of [1] to
[10] above, which is reconstituted from a freeze-dried agent. formulation.
[12] A freeze-dried product prepared from the formulation according to any one of [1] to
[11] . Agent.
[13] (i) freeze-drying the formulation according to any one of [1] to
[10] above. and, (ii) reconstituting the lyophilized agent with a reconstitution solvent. .
[14] 10–150 mg / ml ACZ885, 270 mM sucrose, 30 mM of histidine and 0.06% polysorbate 80, and having a pH of 6.5.
[15] 10–150 mg / ml ACZ885, 270 mM mannitol, 20 m A formulation containing M histidine and 0.04% polysorbate 80, with a pH of 6.5. .
[16] The method of any one of [1] to
[16] for treating an IL-1-mediated disease or medical condition. Use of the formulation described in any one of
[15] .
Claims
1. A liquid pharmaceutical formulation comprising 10 to 150 mg / ml of ACZ885, 90 to 300 mM of sucrose, 10 to 30 mM of histidine, and 0.01 to 0.06% of polysorbate 80, wherein the pH of the formulation is 6.2 to 6.
8.
2. The formulation according to claim 1, comprising 10 to 150 mg / ml of ACZ885, 270 mM of sucrose, 20 to 30 mM of histidine, and 0.06% of polysorbate 80, with a pH of 6.
5.
3. The formulation according to claim 1 or 2, comprising 30 mM histidine.
4. The formulation according to any one of claims 1 to 3, comprising 10 mg / ml of ACZ885.
5. The formulation according to any one of claims 1 to 3, comprising 150 mg / ml of ACZ885.
6. A lyophilized agent that provides a reconstituted formulation comprising 10 to 150 mg / ml of ACZ885, 90 to 300 mM of sucrose, 10 to 30 mM of histidine, and 0.01 to 0.06% of polysorbate 80 in a reconstituted form, wherein the pH of the formulation is 6.2 to 6.
8.
7. The lyophilized agent according to claim 6, wherein the reconstituted formulation comprises 10 to 150 mg / ml of ACZ885, 270 mM of sucrose, 20 to 30 mM of histidine, and 0.06% of polysorbate 80, and has a pH of 6.
5.
8. The lyophilized agent according to claim 6 or 7, wherein the reconstituted formulation contains 30 mM histidine.
9. The lyophilized agent according to any one of claims 6 to 8, wherein the reconstituted formulation contains 10 mg / ml of ACZ885.
10. The lyophilized agent according to any one of claims 6 to 8, wherein the reconstituted formulation comprises 150 mg / ml of ACZ885.
11. A method for preparing a formulation, comprising reconstituting a lyophilized agent according to any one of claims 6 to 10 with a reconstituting solvent.
12. The method according to claim 11, wherein the reconstitution solvent is sterile water.
13. The method according to claim 11, wherein the reconstitution solvent is bacteriostatic water for injection (BWFI).
14. A liquid pharmaceutical preparation reconstituted from a freeze-dried agent according to any one of claims 6 to 10.
15. The formulation according to claim 14, wherein the freeze-dried agent is reconstituted with sterile water.
16. The formulation according to claim 14, wherein the freeze-dried agent is reconstituted with bacteriostatic water for injection (BWFI).