G protein

The MEGA domain addresses the limitations of existing G protein-GPCR complex crystallization by providing a high-resolution structure for drug design and efficient GPCR coupling, enabling effective signal transduction without the βγ dimer.

JP2026053553APending Publication Date: 2026-03-25NXERA PHARMA UK LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-03-25

AI Technical Summary

Technical Problem

Current methods for crystallizing G protein-GPCR complexes at high resolution are insufficient for detailed structural analysis, limiting effective structure-based drug design, and existing Gα subunits do not efficiently couple with GPCRs in the absence of the βγ dimer.

Method used

Development of a minimally engineered G protein alpha (MEGA) domain that lacks the helical domain and includes mutations for improved expression and stability, allowing it to bind to GPCRs independently of the βγ dimer, inducing conformational changes associated with high-affinity agonist binding.

Benefits of technology

The MEGA domain enables high-resolution structural analysis of G protein-GPCR complexes, enhancing the accuracy of structure-based drug design and facilitating efficient signal transduction by maintaining functional binding and stability even without the βγ dimer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026053553000001_ABST
    Figure 2026053553000001_ABST
Patent Text Reader

Abstract

This invention provides a minimally invasive G protein alpha domain design that can bind to GPCRs and induce core pharmacological and conformational changes related to high-affinity agonist binding. [Solution] The present invention provides a variant of the parent heterotrimeric G protein alpha (Gα) subunit, which (i) lacks at least one helix of the helical domain of the parent Gα subunit, (ii) can bind to a GPCR in the absence of the heterotrimeric G protein beta (Gβ) subunit and the heterotrimeric G protein gamma (Gγ) subunit, and (iii) has an amino acid sequence that includes one or more mutations compared to the amino acid sequence of the parent heterotrimeric Gα subunit, these mutations being selected from deletions, substitutions, and insertions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to mutant G proteins, specifically to mutant alpha subunits of heterotrimeric G proteins. The present invention also relates to products containing such mutants, the use of such mutants, and methods containing such mutants.

Background Art

[0002] G proteins bind to guanine nucleotides and act as molecular switches in several signal transduction pathways by interconverting between the GDP-bound inactive state and the GTP-bound active state. They consist of two main classes, monomeric low molecular weight G proteins and heterotrimeric G proteins. Both the low molecular weight G proteins and the alpha subunit (Gα) of heterotrimeric G proteins contain a GTPase domain (G-domain), while Gα contains an additional helical domain (H-domain) and forms a complex with G beta (Gβ) subunit and G gamma (Gγ) subunit. They undergo a similar signal transduction cycle, but their activation is different in one important aspect. The guanine nucleotide exchange factor (GEF) of low molecular weight G proteins is mainly a cytoplasmic protein, while the GEF of Gα subunit is usually a membrane-bound G protein-coupled receptor (GPCR). The GEF of low molecular weight G proteins interacts directly with the GDP-binding region, while the GPCR binds to Gα at a site approximately 30 Å away from GDP and allosterically induces GDP release to activate them.

[0003] GPCRs constitute a very large family of proteins that control many physiological processes and are targets for many effective drugs. Therefore, they are quite important pharmacologically. Overington et al (2006) Nature Rev. Drug Discovery 5, 993-996, which shows that more than a quarter of current drugs target GPCRs, is mentioned. A list of GPCRs is provided in Food et al (2005) Pharmacol Rev. 57, 279-288, which is incorporated herein by reference.

[0004] Thirty years of biochemical and biophysical research have generated a model for GPCR-mediated G protein activation. Agonist binding to GPCRs induces cellular changes in the receptor structure. 1~4 This allows for productive interactions with G proteins. This process may involve at least two steps: an initial docking interaction, possibly involving the G protein βγ subunit or lipid moiety, and induction of extreme C-terminal conformational changes of the α subunit. 5、6 Main receptor binding site 7 and receptor specificity 8、9 The C-terminus, which is the determinant of this interaction, can then fully associate with the receptor. This interaction causes mutually induced conformational changes in both the G protein and the receptor. 10 In G proteins, these changes are propagated to the nucleotide binding pocket, resulting in the release of GDP. 10、11 In receptors, conformational changes feed back into the ligand-binding pocket, reducing the rate of ligand dissociation, which in turn leads to a significantly increased agonist binding affinity. 12、13 The mechanism of this affinity shift is likely due to either a slight rearrangement of the ligand-binding pocket or a transition to a lower energy state of the complex resulting from conformational stabilization conferred by G protein binding. In this ternary complex, the receptor acts as a chaperone, protecting G proteins that do not contain heat-unstable nucleotides from denaturation. 14、15。In the absence of guanine nucleotides, this complex is stable, but in vivo, GTP is rapidly bound due to its high cellular concentration. 12、14 。This induces a conformational change and dissociation of the G protein from the receptor. 16、17 and separation of the Gα subunit and the βγ subunit. 14、16 are caused. Subsequently, the activated α-GTP and βγ subunits can stimulate their respective downstream signaling pathways.

[0005] Atomic-resolution mapping of the ligand-binding pocket is quite important for the design of drugs to regulate GPCR activity. Therefore, methods for crystallizing receptors in their high-affinity agonist-binding conformations are an important prerequisite for the efficient structure-based design of agonist compounds. So far, this has been achieved by three approaches: first, crystallizing the C-terminal peptide of transducin complexed with both opsin 36 and metarhodopsin II 37 , second, crystallizing the camelid antibody (Nb80) that induces the high-affinity agonist-binding state complexed with the β2AR 38 complex, and third, crystallizing the heterotrimeric G complexed with the β2AR 10 . Despite the valuable insights into GPCR activation provided by these structures, they have several major disadvantages for broader structure-based drug design applications. The opsin and metarhodopsin II complexes were solved at 3.2 Å and 2.85 Å, respectively, and in both cases, the electron density around the chromophore-binding pocket was strong. 36、37 . However, the use of the G protein C-terminal peptide to stabilize the active conformations of other GPCRs has been unsuccessful. 10 . Furthermore, the conformational changes induced by the transducin peptide are much smaller than those observed in the β2AR-G complex, 10 indicating that these structures represent intermediate conformations along the activation pathway. The Nb80-β2AR complex was solved at a resolution of 3.5 Å and showed good electron density around the ligand-binding pocket. 38However, the conformational changes induced by Nb80 are smaller than those observed in the β2AR-G complex. 10 This suggests that this structure may also represent an intermediate three-dimensional structure. Furthermore, an Nb80 that specifically binds to β2AR is obtained, and therefore may efficiently couple to other closely related GPCRs (e.g., β1AR), although a novel nanobody may need to be produced for more distally related receptors. The β2AR-G complex was solved at a resolution of 3.2 Å, but the electron density around the ligand-binding pocket was very poor in this structure. Moreover, the complexity of the crystallized G protein-GPCR complex means that this strategy is limited to broader structure-based drug design applications. All of the aforementioned complexes were solved at medium to high resolution, but they provided insufficient detail around the ligand-binding pocket to accurately define the structural changes related to the high-affinity agonist binding three-dimensional structure. Therefore, there is a strong need to solve the structures of G protein-GPCR complexes at a resolution greater than 2 Å in order to accurately define these changes and enable optimal structure-based drug design.

[0006] The GTPase and helical domains of the stimulating G protein (Gαs) have been previously transfected into COS-7 cells. 41 However, individually, none of the proteins increased cellular cAMP production. Furthermore, the ability of GTPases to bind to GPCRs was not investigated.

[0007] The Gα subunit interacts with GPCRs in a βγ-independent manner and has also been shown to undergo nucleotide exchange in the presence of a large excess of the receptor, albeit at a much slower reaction rate than the holoenzyme. 43、45、46 However, all structures contained intact helical domains.

[0008] Any list or discussion of previously published documents in this specification should not necessarily be considered an endorsement that such documents are part of cutting-edge technology or common general knowledge. [Overview of the project]

[0009] In this specification, we describe the design of a minimally engineered G protein alpha (MEGA) domain capable of binding to GPCRs and inducing core pharmacological and conformational changes associated with high-affinity agonist binding. The MEGA domain can be considered a minimal version of the Gα subunit lacking some or all of the helical domain, capable of coupling to GPCRs even in the absence of the βγ dimer. We identified mutations that improve both the expression and stability of the MEGA domain while retaining basic guanine nucleotide binding properties and protein functionality. The mutations we discovered are well conserved among heterotrimeric G proteins and are thought to be introduced into members of all four classes of the α subunit. Therefore, this approach can be used to produce a repertoire of GTPase domains capable of coupling to different GPCRs. An alternative description of the MEGA domain is mini-G protein, and both of these definitions are used to describe the mutant G proteins of this invention.

[0010] Accordingly, a first aspect of the present invention provides a variant of the parent heterotrimeric G protein alpha (Gα) subunit, which (i) lacks at least one helix of the helical domain of the parent Gα subunit, (ii) can bind to a GPCR in the absence of the heterotrimeric G protein beta (Gβ) subunit and the heterotrimeric G protein gamma (Gγ) subunit, and (iii) has an amino acid sequence that includes one or more mutations compared to the amino acid sequence of the parent heterotrimeric Gα subunit, wherein these mutations are selected from deletions, substitutions, and insertions.

[0011] A heterotrimeric G protein refers to a protein constructed from three subunits: a guanylate-nucleotide-linked alpha subunit (Gα), a beta subunit (Gβ), and a gamma subunit (Gγ). Such heterotrimeric proteins transmit signals from GPCRs to downstream effectors, as described above. Any Gα subunit of a heterotrimeric G protein can be used in the implementation of the present invention. Typically, the Gα subunit has an amino acid length of 350–400 and a molecular weight in the range of 40–45 kDa. There are four families of Gα subunits, comprising a total of 17 Gα subunits grouped based on both sequence similarity and function, and any of these can be used to implement the present invention. Gα s : Gα s Gα olf (Sense of smell) Gα i / o : Gα i1 Gα i2 Gα i3 Gα o1 Gα o2 Gα z Gα t1 Gα t2 Gα t3 (Gast Deucen) Gα q / 11 : Gα q Gα 11 Gα 14 Gα 15 (Sometimes referred to as 16) Gα 12 / 13 : Gα 12 Gα 13

[0012] G s Family and G i While the family regulates adenylyl cyclase activity, G q It activates phospholipase Cβ, G 12 / 13 It can activate the low molecular weight GTPase family.

[0013] There are also fungal and plant classes of the alpha subunit. For example, yeast is known to use the GPCR / G protein pathway, and conjugation factor signaling in Saccharomyces cerevisiae is mediated by the G protein alpha-1 subunit (GP-1). Urano et al. outline G protein signaling in plants, which has been studied mainly in two model organisms, Arabidopsis thaliana and rice (Oryza sativa) (Urano et al Open Biol. 2013 Mar;3(3): 120186). All such Gα subunits are included within the scope of this invention. Further details regarding suitable Gα subunits and their classification are well known in the art and can be found at http: / / www.ebi.ac.uk / interpro / entry / IPR001019, as well as Flock et al 2015 (Nature 524:173) and Anantharanman et al, 2011 (Gene 475: 63-78). Information on which Gα subunit a given GPCR is coupled to can also be found in scientific literature and available online databases, for example, by browsing http: / / www.guidetopharmacology.org / GRAC / ReceptorFamiliesForward?type=GPCR (see also Alexander et al, (2015) The Concise Guide to PHARMACOLOGY 2015 / 16: G protein-coupled receptors. Br J Pharmacol. 172: 5744-5869). Further details regarding which GPCRs the mutant Gα subunit of the present invention can bind to, including examples of specific GPCRs, are provided below with respect to a fourth aspect of the present invention.

[0014] The amino acid sequences (and nucleotide sequences of the corresponding cDNAs) of many Gα subunits are readily available, for example, by referring to GenBank or UniProt. Specifically, Flock et al, 2015 (Nature 524: 173) provide human gene IDs for all human Gα paralogs from UniProt (http: / / www.uniprot.org / uniprot). It should also be noted that, as more and more genomes are being sequenced, the amino acid sequences of Gα subunits can be inferred from them.

[0015] Gα can originate from any source, but it is particularly preferred that it originate from a eukaryotic source. It is particularly preferred that it originate from an animal source such as a mammal or bird (e.g., a vertebrate). It is particularly preferred that the Gα subunit originates from a rat, mouse, rabbit, or dog, or a non-human primate, or a chicken or chicken. To avoid misunderstanding, "originating from" means that the cDNA or gene was originally obtained using genetic material from the source, but the protein can subsequently be expressed in any host cell. Therefore, eukaryotic Gα (such as bird or mammalian Gα) can be expressed in prokaryotic host cells such as E. coli, but in some cases it may be considered to originate from a bird or mammal.

[0016] The Gα subunit contains two domains: a GTP-binding domain and a helical domain. The GTP-binding domain is homologous to that of a Ras-like low molecular weight GTPase and includes switch regions I and II, which undergo conformational changes during activation. These switch regions are alpha-helix loops with a guanine nucleotide-sensitive conformation.

[0017] The helical domain of the Gα subunit refers to the helical insertion domain that is inserted into the GTP-binding domain prior to switch region I and is unique to heterotrimeric G proteins. This helical domain functions to segregate guanine nucleotides at the interface with the GTP-binding domain and must be displaced to allow nucleotide dissociation. Flock et al. (2015) performed structural and sequence alignments of Gα subunits from various organisms and demonstrated that the helical domain of the Gα subunit contains six alpha helices represented by helix A, helix B, helix C, helix D, helix E, and helix F. Therefore, the helical domain can be considered as the region between the first amino acid residue of helix A and the last amino acid residue of helix F in the amino acid sequence of the Gα subunit. However, since the boundary of the helical domain is not absolute, it is understood that the helical domain can also extend beyond these alpha helices to encompass the surrounding loop regions, namely the loop prior to helix A and the loop after helix F.

[0018] In one embodiment, the mutant Gα subunit lacks at least one of the alpha helices A, B, C, D, E, or F of the parent heterotrimer Gα subunit, for example, at least two, three, four, five, or all six of alpha helices A, B, C, D, E, or F. If the mutant Gα subunit lacks more than one of alpha helices A, B, C, D, E, or F, the mutant Gα subunit also typically lacks an intervening loop. For example, if the mutant Gα subunit has helix A and helix B, the mutant Gα typically lacks the loop connecting helix A and helix B.

[0019] In a preferred embodiment, the mutant Gα subunit lacks the alpha helices A, B, C, D, and E of the helical domain of the parent Gα subunit, as well as the intervening loop region.

[0020] In another preferred embodiment, the mutant Gα subunit lacks the alpha helices A, B, C, D, E, and F of the helical domain of the parent Gα subunit, as well as the intervening loop region.

[0021] The positioning of alpha helices A-F within the amino acid sequences of 17 human Gα paralogs is illustrated in Figure 25 (corresponding to the extended version of Figure 1 in Flock et al. 2015 (Nature 524: 173)), and those skilled in the art will understand that their positions within other Gα proteins can be easily determined, for example, by using computer algorithms that predict protein alignment and / or secondary structure (e.g., Flock et al. (See al., 2015). For example, helix A in a second Gα protein would be an alpha helix similar to helix A in one of the human Gα paralogs listed in Figure 25. Similar hexes in a second Gα subunit can be identified, for example, by searching for similar amino acids that define helix A in the sequence of one of the human Gα subunit paralogs, using sequence alignment. Furthermore, computer-based algorithms that can be used to predict the presence of protein motifs based on amino acid sequences are widely available in the art. Similar helices can be easily identified based on the relative position of a particular alpha helix in the amino acid sequence and its position relative to other motifs and alpha helices.

[0022] To enable the comparison of any amino acid residue / position between different Gα proteins, Flock et al, 2015 (Nature 524: 173) devised a common Gα numbering (CGN) system. CGN provides every residue with an "address" in DSP format that points to (1) the domain (D), (2) the consensus secondary sequence (S), and (3) the position within the secondary structure element (P). For example, Gα i1 Phenylalanine 336 is the eighth amino acid residue in the consensus helix H5 of the G-domain, Phe336 G.H5.8 It is represented as Gα s2The corresponding location within is Phe376 G.H5.8 The loops are labeled with the lowercase letters of their adjacent secondary structural elements (SSEs), for example, s6h5 refers to loop-connecting chain S6 having helix H5 (see Figure 25). The CGN mapping web server is available at http: / / mrc-lmb.cam.ac.uk / CGN.

[0023] It is understood that CGN can be used to identify the boundaries of each helix A-F within any Gα subunit. For example, the first residue of helix A within Gαs (H.HA) is Asp85 H.HA.1 Therefore, the last residue of helix F within Gαs (H.HF) is Arg199 H.HF.6 Therefore, mutant Gα subunits may lack the helical domain of the parent Gα subunit that corresponds to the region defined by amino acid Asp85 to amino acid residue Arg199 in the long isoforms of human Gαs shown in Figures 1 and 25.

[0024] "Corresponding region" means a region in the amino acid sequence of the second Gα subunit that aligns with a region in the first Gα subunit when the first and second Gα subunits are compared by alignment, for example, using MacVector and Clustal W (e.g., the region defined by amino acid residues Asp85 to Arg199 of the long isoform of human Gαs). For example, Figure 25 shows all the alignments of human Gα subunits, from which a region corresponding to the region defined by amino acid Asp85 to Arg199 of the long isoform of human Gαs in another human Gα subunit can be identified. It is understood that regions in other human Gα subunits can also be identified that correspond to different regions in the long isoform of human Gα subunits.

[0025] In certain embodiments, the mutant Gα subunit lacks the helical domain region of the parent heterotrimer Gα subunit corresponding to amino acid residues 70–193, 71–193, 85–193, or 85–199, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1.

[0026] If the mutant Gα subunit lacks the entire helical domain, the mutant Gα subunit of the present invention may be considered to be an isolated GTPase domain or Gα subunit without its helical domain.

[0027] Whether a given mutant Gα subunit lacks at least one helix of the helical domain of the parent Gα subunit can be determined by a person skilled in the art, for example, by aligning the amino acid sequence of the mutant Gα subunit with the amino acid sequence of the parent Gα subunit and evaluating whether an amino acid sequence corresponding to at least one helix of the helical domain of the parent Gα subunit exists in the amino acid sequence of the mutant Gα subunit. A similar analysis can be performed at the nucleotide sequence level.

[0028] The ability to bind to a GPCR in the absence of heterotrimeric G protein beta (Gβ) subunits and heterotrimeric G protein gamma (Gγ) subunits means that the Gα subunit does not require the presence of the Gβ and Gγ subunits to bind to the GPCR. In other words, the mutant Gα subunit of the present invention can bind to a GPCR in a βγ independent manner. Preferably, the mutant Gα subunit of the present invention should bind to the GPCR with similar affinity (i.e., typically within 1 to 3 times) because the parent Gα subunit binds to the same GPCR when the parent Gα subunit binds in combination with the βγ subunit. In other words, the mutant Gα subunit should bind to the GPCR with similar affinity because the parent heterotrimeric G protein binds to the same GPCR. Binding to a GPCR means binding to the GPCR when it is bound by its agonist.

[0029] For example, the binding between a GPCR and a test compound can be determined using a variety of methods, including size exclusion chromatography, enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance assay, chip-based assay, immunocytofluorescence, yeast 2-hybrid technology, and phage display. These methods are common practice in the art and are described, for example, in Plant et al (1995) Analyt Biochem, 226(2), 342-348, and Sambrook et al (2001) Molecular Cloning A Laboratory Manual. Third Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Other methods for detecting the binding between a test compound and a GPCR include ultrafiltration by ion spray mass spectrometry / HPLC or other physical and analytical methods. For example, when the binding of two fluorescently labeled entities is in close proximity to each other, the fluorescence energy resonance transfer (FRET) method, which can be measured by measuring the interaction of the fluorescent labels, can be used. Further methods are described in WO2009 / 081136.

[0030] In one embodiment, the mutant Gα subunit can functionally bind to a GPCR in the absence of the Gβ and Gγ subunits. "Functional binding" means that the mutant Gα subunit can bind to a GPCR expressed on the cell surface, thereby enabling the GPCR (bound to a modulator, such as a receptor ligand) to transmit signals to the cell via components of the cell's signaling pathway. Another term for such functional binding is coupling. As described above, heterotrimeric G proteins couple with GPCRs to effectively transmit signals from the GPCR to downstream effectors. Specifically, the binding of ligands such as hormones and neurotransmitters to a GPCR activates the receptor by causing a conformational change, which in turn activates the bound G protein on the intracellular side of the membrane. The activated receptor then facilitates the exchange of bound GDP to GTP on the GTP subunit. GTP binding alters the three-dimensional structure of the switch region within Gα, allowing the bound trimer G protein to be released from the receptor and dissociate into an active Gα subunit (GTP-bound) and a βγ dimer. The Gα subunit and βγ dimer continue to activate distinct downstream effectors such as adenylyl cyclase, phosphodiesterase, phospholipase C, and ion channels. These effectors then regulate the intracellular concentrations of secondary messengers such as cAMP, cGMP, diacylglycerol, sodium, or calcium cations, ultimately leading to a physiological response, usually through downstream regulation of gene transcription. This cycle is completed by the hydrolysis of alpha subunit-bound GTP to GDP, resulting in the reassignment of the alpha and beta / gamma subunits and their binding to the receptor, thereby terminating the signal.

[0031] Functional binding between a mutant Gα subunit and a GPCR can be considered to result in activation of the Gα subunit, thereby enabling the production of a Gα protein signal within the cell. Therefore, in one embodiment, a mutant Gα subunit can bind to a GPCR in the absence of Gβ and Gγ subunits, thereby enabling the Gα subunit to be activated by the GPCR, as evidenced, for example, by the generation of a Gα protein signal or an increase in the baseline level of the Gα protein signal. A Gα protein signal refers to any downstream signal typically associated with signal transduction mediated by the particular Gα subunit in question, and can therefore be used as a marker for the activation of the Gα subunit. This signal may be any of the signals described herein and can be assayed using any suitable technique in the art.

[0032] Functional binding can be evaluated by cell assays, in which a GPCR capable of transmitting a signal to a cell comes into contact with a mutant Gα subunit, and the Gα protein signal is evaluated after stimulation of the GPCR (e.g., with a ligand). Preferably, cells co-express the mutant Gα subunit and the GPCR to enhance the signal, and more preferably, the expression of the GPCR or mutant Gα subunit is controlled by an inducible promoter, many examples of which have been described in the art and are generally available. However, any assay format may be used that allows the Gα protein signal to be measured after the binding of Gα to its GPCR, and after the GPCR has been stimulated. Preferably, this signal is detectable. This signal may correspond to the guanylate-nucleotide binding state of the Gα subunit (e.g., GDP binding or GTP binding), which can be biochemically evaluated against purified or concentrated protein fractions, for example, if the amount of radiolabeled GTPγS is detected. This signal may correspond to the GTPase activity of the Gα subunit, or to the level of a secondary messenger, or reflect the state of a downstream effector (e.g., the phosphorylation state or activity of a cellular protein). Alternatively, readout may be provided through the use of a reporter gene, the expression of which is regulated by the signal transmitted via the Gα subunit. Another method is to measure the affinity of a GPCR for its ligand. Yet another method is to measure the phenotype of a cell (e.g., cell growth or morphology) that is known to be regulated by signaling via the Gα subunit. Further details are provided below.

[0033] Typically, mutant Gα subunits functionally bind to their GPCRs in a βγ-independent manner with similar or greater potency than in the presence of the βγ dimer. Typically, the Gα protein signals produced when a Gα subunit binds to a GPCR in the presence and absence of the βγ dimer are within 5 to 10 times each other, such as within 2 to 3 times. Typically, the Gα protein signal produced when a Gα subunit binds to a GPCR in the absence of the βγ dimer is not more than 5 times weaker than the Gα protein signal produced when a Gα subunit binds to a GPCR in the presence of the βγ dimer.

[0034] It is understood that specific Gα protein signals generated from functional binding between Gα and GPCRs (e.g., Gα activation) often depend on the type of Gα subunit in question. For example, Gα-type Gα subunits mediate signaling to effectors that stimulate intracellular cyclic AMP (cAMP) production. Conversely, Gαi-type Gα subunits mediate signaling to effectors that inhibit intracellular cyclic AMP production. Another class of Gα subunits, Gαq-type, activates the phospholipase C (PLC) pathway, which results in the hydrolysis of phosphoinositides, producing two distinct classes of different second messengers: diacylglycerol (DAG) and inositol phosphate. Diacylglycerol activates certain protein kinase C (PKC), and certain inositol phosphates stimulate the recruitment of calcium from intracellular stores. A wide variety of intracellular effectors have been identified as being under the control of Gα subunits, including cAMP, cGMP, phosphodiesterases, phospholipase C, and phospholipase A2. In addition, Gα activation can modulate the range of ion channels, inhibit certain voltage-sensitive calcium transients, and stimulate cardiac potassium channels. Those skilled in the art will be able to select an appropriate assay for a given Gα subunit (e.g., Neves et al (2002) Science 296: 1636-1639, and Cabrera-Vera See et al (2013) Endocrine Reviews 24: 765-781.

[0035] When Gα subunits that modulate cAMP are being tested, functional binding can be evaluated using standard techniques for detecting cAMP, such as competitive assays that quantify [3H]cAMP in the presence of unlabeled cAMP.

[0036] The GTPase enzyme activity of the Gα subunit can be measured, for example, in plasma membrane preparations by determining the degradation of γ32P GTP using techniques well known in the art (see, for example, Signal Transduction: A Practical Approach: G Milligan, Ed. Oxford University Press, Oxford, England).

[0037] When the Gα subunit that modulates phospholipase C is tested, inositol lipids can be extracted and analyzed using standard lipid extraction techniques. DAG can also be measured using thin-layer chromatography. All three water-soluble derivatives of inositol lipids (IP1, IP2, IP3) can also be quantified using radiolabeling techniques or HPLC. DAG can also be produced from phosphatidylcholine. The degradation of this phospholipid in response to Gα activation can also be measured using radiolabeling techniques.

[0038] Intracellular calcium recruitment or extracellular calcium influx can be measured using standard techniques. The selection of an appropriate calcium indicator, fluorescence, bioluminescence, metallic chromium, or calcium-sensitive microelectrode depends on the cell type under study as well as the scale and time constant of the event (Borle (1990) Environ Health Perspect 84: 45-56). As an exemplary method for calcium detection, cells are loaded with the calcium-sensitive fluorescent dyes Fura-2 or Iodine-1 using a standard method, and any changes in calcium are measured using a fluorophotometer.

[0039] Further examples of suitable assays include calcium mobilization (Gonzalez JE, Maher MP. Cellular fluorescent indicators and voltage / ion probe reader (VIPR) tools for ion channel and receptor drug discovery. Receptors Channels. 2002;8(5-6):283-95; Dupriez VJ, Maes K, Le Poul E, Burgeon E, Detheux M. Aequorin-based functional assays for G-protein-coupled receptors, ion channels, and tyrosine kinase receptors. Receptors Channels. 2002;8(5-6):319-30), and changes in cAMP levels (Weber M, Ferrer M, Zheng W, Inglese J, Strulovici B, Kunapuli PA 1536-well cAMP assay for Gs- and Gi-coupled receptors using enzyme fragmentation complementation. Assay Drug Dev Technol. 2004). Feb;2(1):39-49., activation kinase pathway (Leroy D, Missotten M, Waltzinger C, Martin T, Scheer AG protein-coupled receptor-mediated ERK1 / 2 phosphorylation: toward a generic sensor of GPCR activation. J Recept Signal Transduct Res. 2007;27(1):83-97), regulation of gene transcription by the use of reporter genes, for example (Liu B, Wu D. Analysis of the coupling of G12 / 13 to G protein-coupled receptors using a luciferase reporter assay. Methods Mol Biol.)2004;237: 145-9, Kent TC, Thompson KS, Naylor LH. Development of a generic dual-reporter gene assay for screening G-protein-coupled receptors J Biomol Screen. 2005 Aug;10(5):437-46, β-arrestin recruitment (Hudson CC, Oakley RH, Sjaastad MD, Loomis CR. High-content screening of known G protein-coupled receptors by arrestin translocation Methods Enzymol. 2006;414:63-78), G protein activation such as measurement of GTPase activity (Jameson EE, Roof RA, Whorton MR, Mosberg HI, Sunahara RK, Neubig RR, Kennedy RT. Real-time detection of basal and stimulated G protein GTPase activity using fluorescent GTP analogues. J Biol Chem. 2005 Mar Examples include 4;280(9):7712-9), or measurement of [35S]GTP gamma(γ)S binding (Rodgers G, Hubert C, McKinzie J, Suter T, Statnick M, Emmerson P, Stancato L. Development of displacement binding and GTPgammaS scintillation proximity assays for the identification of antagonists of the micro-opioid receptor. Assay Drug Dev Technol. 2003 Oct;1(5):627-36).

[0040] In general, the binding of a G protein to a GPCR has been shown to increase the GPCR's affinity for its agonist (e.g., Leff (1995) TiPS 16:89). Therefore, in addition to evaluating the activation of a mutant Gα subunit by, for example, evaluating Gα protein signaling, a preferred method for evaluating functional binding between a mutant Gα subunit and a GPCR is by measuring the GPCR's affinity for its ligand. Thus, functional binding may be characterized by an increase in the affinity of the GPCR for its agonist when the GPCR is bound to a Gα subunit, compared to the affinity of the GPCR for its agonist when the GPCR is not bound to a Gα subunit. Such an increase in affinity can be measured using any technique preferred in the art, including competitive binding assays (optionally, one or both of the competing ligands are detectably labeled). An example of such an assay is described in the Examples and measures competition for binding to the beta-adrenergic receptor between the antagonist 3H-dihydroalprenolol (3H-DHA) and the agonist isoprenaline in the presence and absence of Gαs. To increase the sensitivity of such assays, it may be desirable to expose the GPCR and / or Gα subunits to known agents by stabilizing the Gα subunit or agonist conformation. Examples of such agents include antibodies (e.g., nanobodies) or other proteins whose function mimics that of the natural agonist. Specific examples are Nanobody 35 (Ref 40) and Nanobody 80 (Ref 38), and further examples are provided in WO2012007593, WO2015121092, and WO2014122183. It is understood that other such antibodies / nanobodies may be selected, for example, by injecting purified GPCRs or GPCRs overexpressed in whole cells into mice or llamas, by washing for antibodies / nanobodies that bind to GPCRs, and by selecting antibodies / nanobodies that activate GPCRs in whole cells (for example, by screening for increased production of downstream effects of the GPCR activation signaling pathway).

[0041] Where the binding of a G protein to a GPCR is known to increase the GPCR's affinity for an agonist, typically, the binding of a mutant Gα subunit to a GPCR in the absence of the Gβ and Gγ subunits increases the GPCR's affinity for the agonist by at least 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold. Preferably, the binding of a mutant Gα subunit to a GPCR in the absence of the Gβ and Gγ subunits increases the GPCR's affinity for the agonist by at least 10-fold, 50-fold, or 100-fold.

[0042] Some G proteins may reduce the affinity of GPCRs for their antagonists, and in this case, it is understood that the functional binding between the mutant Gα subunit and the GPCR can be evaluated by measuring this decrease in affinity. The decrease in affinity for the antagonist can be measured using assays similar to those described above for measuring the increase in affinity for the agonist. If the binding of a G protein to a GPCR is known to reduce the affinity of the GPCR for its antagonist, the binding of the mutant Gα subunit to the GPCR in the absence of the Gβ and Gγ subunits reduces the affinity of the GPCR for its antagonist by at least 1-fold, 2-fold, 3-fold, 4-fold, or 5-fold. Preferably, the binding of the mutant Gα subunit to the GPCR in the absence of the Gβ and Gγ subunits reduces the affinity of the GPCR for its antagonist by at least 10-fold, 50-fold, 100-fold, or 150-fold.

[0043] As described above, the interaction between GPCRs and heterotrimeric G proteins induces conformational changes in both the G protein and the receptor. Specifically, the cytoplasmic terminus of transmembrane helix 6 of the GPCR moves more than 10 Å away from the receptor core. Therefore, functional binding of a mutant Gα subunit to a GPCR in the absence of the Gβ and Gγ subunits is expected to induce one or more of these conformational changes that are evident when the parental Gα subunit binds to the GPCR together with the Gβ and Gγ subunits. In other words, binding of the mutant Gα subunit is expected to cause the GPCR to adopt its G protein-binding conformation. Thus, in one embodiment, binding of a mutant Gα subunit to a GPCR in the absence of the Gβ and Gγ subunits results in the movement of the cytoplasmic terminus of transmembrane helix 6 of the GPCR to a distance of more than 10 Å away from the receptor core, for example, at least 11 Å, 12 Å, 13 Å, 14 Å, 15 Å, or 16 Å away from the receptor core. Therefore, it is understood that this provides yet another method for determining whether the Gα subunit functionally binds or couples to a GPCR. Various methods for exploring protein structures are known in the art, and any suitable method can be used. For example, any structural biology technique such as X-ray crystallography can be used. Other methods include electron microscopy, NMR, direct measurements by EPR spectroscopy, or FRET.

[0044] Another method for evaluating functional binding or coupling between mutant Gα subunits and GPCRs is to assess the stability of the GPCR / agonist / mutant Gα subunit complex under denaturing conditions and compare it to the stability of the GPCR / agonist complex under denaturing conditions. If the stability of the GPCR / agonist / mutant Gα subunit complex (e.g., thermal stability) is higher than that of the GPCR / agonist complex, this would indicate functional binding. When the thermal stability of the GPCR / G protein complex is measured, it is understood that the experimental temperature should be within a temperature range tolerable by the mutant Gα subunit (e.g., to ensure that ligand binding can be detected). Typically, this means performing the experiment below 35°C, but for some particularly unstable Gα subunits, it may be necessary to keep the temperature very low (e.g., below 10°C). Needless to say, it is also understood that stability measurements may be performed in the presence of βγ subunits. For example, any preferred method for measuring stability described below and in the examples may be used (see also Figures 10, 11, and 17).

[0045] Examples of assays that can be used to evaluate whether the mutant Gα subunit functionally binds to or couples with a GPCR are also described in Example 5, and these assays include (i) an agonist affinity shift assay, (ii) a thermal stability assay, (iii) fluorescence detection size exclusion chromatography (FSEC), (iv) fluorescence-based saturated binding analysis, and (v) size exclusion chromatography (SEC). Thus, one or more of these assays can be used alone or in combination with one or more of the assays described above to determine the functional binding or coupling between the mutant Gα subunit and the GPCR.

[0046] In preferred embodiments, the mutant Gα subunit has increased stability under denatured conditions compared to the parental Gα subunit and / or is expressed at a higher level than the parental Gα subunit when expressed intracellularly. Therefore, it is understood that the mutant Gα subunit contains one or more mutations that increase the stability of the mutant Gα subunit under denatured conditions compared to the parental Gα subunit and / or increase the expression level of the mutant Gα subunit when expressed intracellularly compared to the parental Gα subunit.

[0047] The mutant Gα subunit may have increased stability to any denaturing factor or condition, such as heat, detergents, chaotropic agents, or extreme pH. Therefore, it is understood that the mutant Gα may have an extended lifespan under destabilizing conditions compared to its parent.

[0048] In relation to increased stability to heat (i.e., thermal stability), this can be readily determined by measuring binding to a known binding partner (e.g., GPCR) or by using spectroscopic methods such as fluorescence, CD, or light scattering at a specific temperature. Typically, if the Gα subunit binds to a binding partner (e.g., GPCR), the thermal stability of the mutant can be determined using the ability of the Gα subunit to bind to that binding partner (e.g., GPCR) at a specific temperature. mIn other words, it may be advantageous to determine the temperature at which 50% of the Gα subunits are inactivated under specified conditions after incubation for a given period (e.g., 30 minutes). More thermally stable mutant Gα subunits have an increased quasi-Tm compared to their parent. Alternatively, thermal stability can be assessed by measuring stability at a given temperature as a function of time. For example, the period at a given temperature at which the binding partner (e.g., GPCR) binding level decreases to 50% of the binding partner (e.g., GPCR) binding level at time zero can be determined (Shibata et al, 2009 J Mol Biol). However, in either case, it is understood that temperature is the denaturing factor.

[0049] In relation to increased stability to detergents or chaotropic agents, typically the Gα subunit is incubated for a defined time in the presence of a test detergent or test chaotropic agent, and stability is determined, for example, using the aforementioned binding partner bonding or spectroscopy.

[0050] In relation to extreme pH levels, a typical test pH will be selected (e.g., a range of 4.5–5.5 (low pH) or 8.5–9.5 (high pH)).

[0051] Since relatively coarse detergents are used during the crystallization procedure, it is preferable that the mutant Gα subunit is stable in the presence of the detergent. The order of "coarseness" of certain detergents is DDM, C 11 →C 10 The derivatives are C9→C8 maltoside or glucoside, lauryldimethylamine oxide (LDAO), and SDS. It is particularly preferable that the mutant Gα subunit is more stable with respect to any of C9 maltoside or glucoside, C8 maltoside or glucoside, LDAO, and SDS, and therefore these detergents are preferred for use in stability testing.

[0052] For ease of determination, it is preferable that the mutant Gα has increased thermal stability compared to its parent protein. It is understood that heat acts as a denaturing factor, which can be easily removed by cooling the sample, for example, by placing it on ice. It is also thought that thermal stability may be an indicator of stability against other denaturing factors or conditions. Therefore, increased thermal stability may translate to stability in denaturing detergents, particularly those that denaturate more than DDM, such as detergents with smaller head groups and / or shorter alkyl chains and / or charged head groups.

[0053] When extreme pH is used as a denaturing condition, it is understood that this can be rapidly removed by adding a neutralizing agent. Similarly, when chaotrope is used as a denaturing factor, the denaturing effect can be removed by diluting the sample to a concentration below which the chaotrope exerts its chaotropic effect.

[0054] The mutant Gα subunit may be expressed intracellularly at a higher level than its parent Gα subunit. Preferably, the mutant Gα subunit is expressed intracellularly at a level at least 1-fold higher than the level of its parent Gα subunit expressed intracellularly under the same conditions, for example, at least 2-fold, 3-fold, 4-fold, or 5-fold higher, more preferably at least 10-fold or 50-fold higher. Suitable expression systems are described in more detail below and in the examples, and include constitutive or inductive expression systems in bacteria or yeast, viral expression systems such as baculovirus, Semryki forest fever virus, and lentivirus, or transient transfection in insect or mammalian cells. Methods for evaluating protein expression are well known in the art and include techniques such as ELISA, SDS-PAGE analysis, Western blotting, gel filtration, and HPLC.

[0055] Some mutant Gα subunits of the first aspect of the present invention may be expressed at lower levels in cells and / or may be less stable under denaturing conditions than their parental Gα subunits, but it is understood that such mutant Gα subunits can form complexes with GPCRs, and that these complexes are more stable under denaturing conditions than the complexes formed between their parental Gα subunits and GPCRs.

[0056] GPCRs exist in multiple distinct conformations related to different pharmacological classes of ligands, such as agonists and antagonists, and are thought to cycle between these conformations in order to function (Kenakin T. (1997) Ann NY Academia). (Sci 812, 116-125). Switching between conformations contributes to the difficulty in obtaining the crystal structure of the receptor. Therefore, the ability to stabilize a specific conformation is highly desirable for crystallization studies. As discussed in the examples, the inventors have found that the mutant Gα subunit described herein increases the thermal stability of the GPCR in agonist-bound form. Therefore, in further embodiments, the mutant Gα subunit of the first aspect of the present invention can stabilize a specific conformation of the GPCR upon binding to the GPCR. Stabilizing a specific conformation means that the conformation is stabilized under denaturing conditions. In other words, this conformation has an extended lifetime, which is evident from its ability to retain ligand-binding capacity under denaturing conditions. Preferably, the specific conformation is the agonist conformation. Methods for evaluating stability under denaturing conditions include those described above and are well known in the art (see, for example, WO2008 / 114020). In short, these methods may involve subjecting GPCRs to denaturing conditions, either in the absence or presence of a ligand, and then measuring the retention of ligand binding. When GPCRs are subjected to denaturing conditions in the absence of a ligand, the GPCRs come into contact with the ligand, and the degree to which the GPCRs still bind to the ligand is assessed. To measure the stability of a particular conformation, it is necessary to use a ligand of that conformational class in the stability experiment (e.g., using an agonist for an agonist conformation). Since the stabilized conformation is typically an agonist conformation, the ligand used to measure its stability is typically an agonist, although partial agonists may also be used.

[0057] Typically, mutant Gα subunits of the first aspect of the present invention should retain the ability to bind to nucleotides (e.g., guanine nucleotides such as GDP, GTP, or nucleotide derivatives such as GTPγS or GppNp) so as their parental Gα subunits retain the ability to bind to nucleotides. Similarly, mutant Gα subunits should retain the ability to bind to Gβ and / or Gγ subunits so as their parental Gα subunits retain the ability to bind to Gβ and / or Gγ subunits. Retaining these abilities is particularly desirable for structural analysis of G protein-GPCR complexes (e.g., by cryo-electron microscopy), as binding to nucleotides can stabilize the mutant Gα subunits, as described further below.

[0058] However, to avoid misunderstanding, mutant Gα subunits that do not retain one or more of these activities are still included in the mutant Gα subunits of the present invention.

[0059] The switch I region of the Gα subunit consists of a loop (CGN: G.hfs2) between the helical domain and beta chain 2 of the GTPase domain, but also overlaps with helix F of the helical domain. Switch I is a region located between the first amino acid residue of helix F (H.HF) and the first amino acid residue of beta chain 2 (G.S2) using the CGN system (for example, in human Gαs, this is D194, which contains these two specific amino acid residues). H.HF.1 -I207 G.S2.1 It can be defined as:

[0060] In one embodiment, the mutant Gα subunit retains the switch I region of its parent Gα subunit, for example, the region corresponding to amino acid residues Asp 194 to Ile 207 according to the numbering of the long isoform of human Gαs shown in Figure 1. It is understood that this embodiment may correspond to an embodiment in which the region corresponding to helices A to E of the helical domain of the parent Gα subunit is deleted. The inventors have found that the switch I region is important in the absence of other mutations that increase the stability and / or expression level of the mutant Gα subunit compared to its parent Gα subunit. However, the switch I region may be cleaved or deleted in the presence of one or more mutations that increase the stability and / or expression level of the mutant Gα subunit compared to its parent Gα subunit. Thus, in another embodiment, the mutant Gα subunit is deleting the switch I region of its parent Gα subunit (for example, the region corresponding to amino acid residues Asp 194 to Ile 207 according to the numbering of the long isoform of human Gαs shown in Figure 1) or a portion thereof. This part refers to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acid residues in the region corresponding to amino acid residues Asp 194 to Ile 207 according to the numbering of the long isoform of human Gαs shown in Figure 1. Preferably, the deleted part of the switch I region includes a series of deleted amino acid residues.

[0061] In another embodiment, the switch I region of the parent heterotrimeric G protein alpha subunit is replaced by the switch I region of a low molecular weight GTPase. The switch I region of the low molecular weight GTPase can be easily identified, for example, by the structural and sequence alignments described herein.

[0062] In a particularly preferred embodiment of the mutant Gα subunit according to the first aspect of the present invention, the helical domain, switch I region, and linker 1 region that annexes the GTPase domain to the N-terminus of the helical domain of the parent Gα domain are all deleted. The length of the linker 1 region (CGN: G.s1h1) differs among the different Gα subunits, but the CGN system is used to define the region between the first and last residues of the helix 1 / helix A loop (G.h1ha), for example, human Gαs V65 G.h1ha.1 ~S84 G.h1ha.20 It can be defined as (including these two specific residues). Alternatively, it can be defined as the region located between the last residue of helix 1 (G.H1) and the first residue of helix A (H.HA), for example, human Gαs H64. G.H1.12 ~D85 H.HA.1 It can be defined as (excluding these two specific residues).

[0063] Therefore, the mutant Gα subunit may be one in which the region of the parent Gα subunit corresponding to amino acid residues 65-207, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1, is deleted.

[0064] However, it is understood that it may be desirable to retain one or more (e.g., two, three, four, or five) amino acid residues at either or both ends of this region. For example, a mutant Gα subunit may have a deletion in the parent Gα subunit region corresponding to amino acid residues 66-207, 67-207, 68-207, 69-207, 70-207, 65-206, 65-205, 65-204, 65-203, or 65-202, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1.

[0065] In a particularly preferred embodiment of the mutant Gα subunit according to the first aspect of the present invention, the mutant Gα subunit is characterized by a deletion of the region of the parent Gα subunit corresponding to amino acid residues 65-203 according to the numbering of the long isoform of the human Gα-s subunit shown in Figure 1. Alternatively, this region is the region between the last residue of helix 1 (G.H1) and the three N-terminal amino acid residues of the first amino acid residue of the beta sheet (G.S2), for example, human GαS H64 G.H1.12 ~T204 G.hfs2.5 This region can be defined as (including these two specific residues). It is particularly preferable that this region be substituted with an amino acid linker, as further described below. Preferred examples include 8-amino acid linkers such as GGSGGSGG or GGGGGGGG.

[0066] It is also understood that it may be desirable to delete one or more additional amino acid residues (e.g., two, three, four, or five) at either or both ends of this region. For example, a mutant Gα subunit may have a deletion in the parent Gα subunit region corresponding to amino acid residues 60-207, 61-207, 62-207, 63-207, 64-207, 65-208, 65-209, 65-210, 65-211, or 65-212, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1.

[0067] In another embodiment of the mutant Gα subunit according to the first aspect of the present invention, the linker 1 region that links the helical domain and GTPase domain of the parent Gα subunit to the N-terminus of the helical domain is deleted, but the switch I region of the parent Gα subunit is deleted or replaced by the switch I region of a low molecular weight GTPase.

[0068] To facilitate the crystallization, expression, and / or purification of the mutant Gα subunit, it may be desirable to delete one or more amino acids from the N-terminus of the parent Gα subunit. Thus, in one embodiment, the mutant Gα subunit of the first aspect of the present invention has an N-terminal cleavage amino acid sequence compared to the parent Gα subunit. For example, up to 10 amino acids, e.g., up to 9, 8, 7, 6, 5, 4, 3, or 2 amino acids, or 1 amino acid may be deleted from the N-terminus. In another example, up to 15, 20, 25, 30, 35, or 40 amino acids may be deleted from the N-terminus. Typically, the deletion from the N-terminus is 5 to 20 amino acids. Since the N-terminal deletion is considered particularly suitable for crystallization purposes, it may be desirable to delete up to 40 amino acids from the N-terminus of the parent Gα subunit when the mutant Gα subunit is to be crystallized. In contrast, if binding to a βγ dimer is desired, the N-terminus should not be deleted, or at most five N-terminal residues should be deleted (e.g., residues 1, 2, 3, 4, or 5 of the N-terminus). In particularly preferred embodiments, the parent Gα subunit may have five N-terminal amino acids deleted, or 20 N-terminal amino acids deleted, or 21 N-terminal amino acids deleted, or 25 N-terminal amino acids deleted.

[0069] In a more preferred embodiment, the mutant Gα subunit is the amino acid residue Ile / Leu as shown in Figure 29. HN43 This is a deletion of all amino acid residues at the N-terminus. For example, if the mutant Gα subunit is a mutant Gαs subunit, this corresponds to the deletion of the first 25 amino acids corresponding to the first 25 amino acids of human Gαs, according to the numbering of human Gαs shown in Figure 29.

[0070] It is understood that mutant Gα subunits may contain any of the N-terminal cleavages defined herein in combination with any of the deletions of the helical domain, linker 1 region, and switch I region described above. For example, a mutant Gα subunit may contain any of the N-terminal cleavages defined herein and may be a mutant Gα subunit in which a region of the parent Gα subunit corresponding to amino acid residues 65-203, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1, is deleted.

[0071] In an embodiment of the first aspect of the present invention, in which the switch I region or part thereof of the parental Gα subunit is maintained, the inventors have found that individual substitutions of the following amino acid residues in the parental Gα subunit: Leu 197 and Cys 200 of the long isoform of human Gαs shown in Figure 1 result in increased expression. Thus, in one embodiment, the mutant Gα subunit contains one or more mutations in the switch I region compared to the parental Gα subunit, and in a more specific embodiment, the mutant Gα subunit has different amino acids compared to the parental Gα subunit, at positions corresponding to one or more of the following positions according to the numbering of the long isoform of human Gα-s subunit shown in Figure 1: Leu 197 and Cys 200. Using the CGN system, these amino acid residues are L197 H.HF.4 and C200 G.hfs2.1 It is identified as L197. H.HF.4 If the amino acid residue at position C200 is leucine, it is preferably substituted with an alanine residue. G.hfs2.1 If the amino acid residue at position 1 is cysteine, it is preferably substituted with a serine residue.

[0072] In another embodiment, the mutant Gα subunit is characterized by a deletion of the switch III region or a portion thereof of the parent heterotrimeric G protein alpha subunit. The switch III region is located between the last residue of beta sheet 4 (G.S4) and the first residue of helix 3 (G.H3) using the CGN system, for example, human Gαs Ala249G.S4.7 ~Arg265 G.H3.1 It can be defined as (excluding these two specific residues). Thus, it may be a region or part of the parent Gα subunit corresponding to amino acid residues Ser 250~Asn 264 according to the numbering of the long isoform of human Gα-s shown in Figure 1, which is deleted. The part means at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acid residues in the region corresponding to amino acid residues Ser 250~Asn 264 according to the numbering of the long isoform of human Gαs shown in Figure 1. Preferably, the deleted part of the switch III region includes a sequence of deleted amino acid residues. For example, the inventors define Asn254 G.s4h3.5 ~Thr263 G.s4h3.14We have found that deleting a sequence of amino acids corresponding to the above can provide a mutant Gα subunit with particularly favorable properties (e.g., in terms of GPCR coupling and improved stability / expression levels), and therefore, in certain embodiments, the mutant Gα subunit is one in which the region of the parent Gα subunit corresponding to amino acid residues 254-263, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1, is deleted. However, it is understood that it may be desirable to retain one or more (e.g., 2, 3, 4, or 5) amino acid residues at either or both ends of this region. For example, a mutant Gα subunit may have a deletion in the parent Gα subunit region corresponding to amino acid residues 255-263, 256-263, 257-263, 258-263, 259-263, 254-262, 254-261, 254-260, 254-259, or 254-258, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1. Similarly, it is understood that it may be desirable to delete one or more additional amino acid residues (e.g., 2, 3, 4, or 5) at either or both ends of this region. For example, a mutant Gα subunit may have a deletion in the parent Gα subunit region corresponding to amino acid residues 253-263, 252-263, 251-263, 250-263, 249-263, 254-264, 254-265, 254-266, 254-267, or 254-268, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1.

[0073] It is understood that mutant Gα subunits may be those in which the switch III region or part thereof of the parent Gα subunit is deleted, as defined above, and may include any of the N-terminal cleavages defined herein, as well as any of the deletions of the helical domain, linker 1 region, and switch I region described above. For example, a mutant Gα subunit may include any of the N-terminal cleavages defined herein and may be a mutant Gα subunit in which the regions of the parent Gα subunit corresponding to amino acid residues 65-203 and 254-263, according to the numbering of the long isoform of the human Gα-s subunit shown in Figure 1, are deleted.

[0074] In another embodiment, the mutant Gα subunit is characterized by a deletion of the switch II region or a portion thereof of the parent heterotrimeric G protein alpha subunit. The switch II region is the region between the last amino acid residue of beta sheet 3 (G.S3) and the first amino acid residue of beta sheet 4 (G.S4), e.g., Gαs Val224, using the CGN system. G.S3.8 ~Ala243 G.S4.1 (Excluding these two specific residues) can be defined as follows: The mutant Gα subunit follows the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1, starting with amino acid residues Gly 225~T. The mutant Gα subunit may have a deletion in the region or part thereof of the parent Gα subunit corresponding to hr 242. This part refers to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 amino acid residues in the region corresponding to amino acid residues Gly 225 to Thr 242 according to the numbering of the long isoform of human Gαs shown in Figure 1. Preferably, the deleted part of the switch II region contains a sequence of deleted amino acid residues. In a preferred embodiment, the mutant Gα subunit has a deletion in the region of the parent Gα subunit corresponding to amino acid residues 227 to 230 according to the numbering of the long isoform of human Gα-s subunit shown in Figure 1. Preferably, the switch II region or part thereof (e.g., the region corresponding to amino acid residues 227 to 230 according to the numbering of the long isoform of human Gα-s subunit shown in Figure 1) is replaced by a linker sequence, which is further described below, although such a linker is not optional.

[0075] It is understood that it may be desirable to retain one or more (e.g., 2, 3, 4, or 5) amino acid residues at either or both ends of the switch II region. For example, a mutant Gα subunit may have a deletion in the parent Gα subunit region corresponding to amino acid residues 226-242, 227-242, 228-242, 229-242, 230-242, 225-241, 225-240, 225-239, 225-238, or 225-237, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1. Similarly, it is understood that it may be desirable to delete one or more additional (e.g., 2, 3, 4, or 5) amino acid residues at either or both ends of this region. For example, a mutant Gα subunit may have a deletion in the parent Gα subunit region corresponding to amino acid residues 224-242, 223-242, 222-242, 221-242, 220-242, 225-243, 225-244, 225-245, 225-246, or 225-247, following the numbering of the long isoform of the human Gα-s subunit shown in Figure 1.

[0076] A mutant Gα subunit may be one in which the switch II region or part thereof of the parent Gα subunit is deleted, as defined above, and may include any of the N-terminal cleavages defined herein, as well as any of the helical domain, linker 1 region, switch I region, and switch III region described above. For example, a mutant Gα subunit may include any of the N-terminal cleavages defined herein, and may be a mutant Gα subunit in which the regions of the parent Gα subunit corresponding to amino acid residues 65-203 and 227-230 according to the numbering of the long isoform of the human Gα-s subunit shown in Figure 1 are deleted, and optionally the regions of the parent Gα subunit corresponding to amino acid residues 254-263 are also deleted.

[0077] If any part of the parent Gα subunit (e.g., at least one helix of the helical domain, or any or part of the switch I, switch II, or switch III region) is deleted, the remaining parts of the Gα subunit (i.e., the part corresponding to the N-terminus of the deletion and the part corresponding to the C-terminus of the deletion) can be joined together by a linker sequence. “Linker sequence” means any chemical part that joins together the two parts created by the deletion. Preferably, the linker is a peptide. A suitable linker peptide typically employs a random coil structure, and for example, the peptide may contain glycine residues, serine residues, or a mixture of glycine and serine residues. Preferably, the linker contains 2 to 50, more preferably 2 to 30, and even more preferably 3 to 20, for example, 3 to 8 amino acid residues. Examples of suitable linkers are provided in Table 2 below. It is preferable that any of the helical domain, switch I region, and switch II region are substituted by the linker. The requirements for the linker may depend on the size of the deletion. For example, small deletions in regions of 10 amino acids or less may not require a linker, and the two resulting parts can be directly joined together. However, larger deletions in regions of more than 10 amino acids generally require a linker.

[0078] As demonstrated in the examples, the inventors have identified various mutations that increase the stability of mutant Gα subunits under denatured conditions and / or increase the expression of mutant Gα subunits when expressed intracellularly, compared to their parental Gα subunits. Therefore, it is preferable that the mutant Gα subunits of the first aspect of the present invention contain one or more mutations that increase such stability and / or expression. Examples of such mutations are listed in Tables 2-5 below, and therefore, the mutant Gα subunits may contain one or more of the mutations listed in Tables 2-5 below.

[0079] In one embodiment, the mutant Gα subunit has different amino acids compared to the parent Gα subunit, at one or more of the following positions according to the numbering of the long isoform of the human Gα-s subunit shown in Figure 1: Val 36, His 41, Ala 48, Gly 49, Glu 50, Met 60, Leu 63, Leu 197, Lys 200, Arg 201, Phe 208, Asn 218, Gly 226, Glu 230, Ala 249, Ser 252, Leu 272, Ile 372, Val 375 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17). Preferably, each of these amino acids is substituted with a specific amino acid residue shown in Tables 2-5. For example, valine at position 36 may be substituted with aspartate, and histidine at position 41 may be substituted with isoleucine or valine. However, it is understood that these may be substituted with any other amino acid, provided that the mutant Gα subunit can bind to the GPCR in the absence of the Gβ and Gγ subunits.

[0080] In any aspect of the present invention, the amino acid used to substitute a given amino acid at a specific position is typically a naturally occurring amino acid, typically a “coding” amino acid, but it may be a non-natural amino acid (in which case the protein is typically produced by chemical synthesis or by the use of non-natural amino-acyl-tRNA). A “coding” amino acid is one that is incorporated into a polypeptide by translation of mRNA. It is also possible to produce a non-natural amino acid or to introduce a non-peptide bond at a given position by covalent chemical modification, for example, by post-translational treatment or semi-synthesis of the protein. Post-translational modifications such as phosphorylation, glycosylation or palmitoylation, or synthesis or biosynthesis may be natural.

[0081] In certain embodiments, the mutant Gα subunit is a mutant Gα subunit having an amino acid sequence having one or more of the following mutations, compared to the amino acid sequence of the parent Gα subunit, according to the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1: V36D, H41I or H41V, A48L, G49D, E50N, M60A or M60C, L63Y or L63R or L63K, L297A, C200S, R201A, F208N, N218K, G226A, E230A, A249D or A249E, S252D or S252E, L272D or L272E, I372A or I372C, and V375I.

[0082] In specific embodiments, the mutant Gα subunit has an N-terminal cleavage of 5-20 or 5-25 amino acid residues in length compared to the parent Gα subunit, has a deletion in the switch III region, and has different amino acids at one or more (e.g., 2, 3, 4, or 5) of the following positions according to the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1: His 41, Leu 197, Cys 200, Ala 249, and Leu 272.

[0083] In more specific embodiments, the mutant Gα subunit has an N-terminal cleavage of 5-20 or 5-25 amino acid residues in length compared to the parent Gα subunit, has a deletion in the switch III region, and has different amino acids at positions corresponding to one or more (e.g., at least 2, 3, 4, 5, 6, 7, or 8) of the following positions according to the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1: Gly 49, Glu 50, Leu 63, Ala 249, Ser 252, Leu 272, Ile 372, and Val 375.

[0084] In yet another specific embodiment, the mutant Gα subunit has different amino acids at one or more positions corresponding to the following positions: Gly 49, Glu 50, Gly 226, and Ser 252, according to the numbering of the long isoform of the human Gα-s subunit described in FIG. 1, as compared to the parental Gα subunit.

[0085] In still another specific embodiment, the mutant Gα subunit, as compared to the parental Gα subunit, (i) has a deletion of all amino acid residues at the N-terminus of Ile / Leu HN43 , (ii) has a deletion of the region between the last residue of helix 1 (G.H1) and three residues of the N-terminal amino acid residues of the first amino acid residue of beta sheet (G.S2), optionally, this region is replaced by an amino acid linker (e.g., an 8-amino acid linker such as GGSGGSGG or GGGGGGGG), (iii) has a deletion of 10 amino acid residues between Tyr S4H3.4 and Asn / Ser S4H3.15 , (iv) has different amino acids at any one or more (e.g., at least 1, 2, 3, 4, 5, 6, or 7) of the following positions: Gly49 S1H1.3 , Glu50 S1H1.4 , Ala249 S4.7 , Ser252 S4H3.3 , Leu272 H3.8 , Ile372 H5.4 , and Val375 H5.7 (optionally, these residues are mutated to D49 S1H1.3 , N50 S1H1.4 , D249 S4.7 , D252 S4H3.3 , D272 H3.8 , A372 H5.4 , and I375 H5.7 respectively).

[0086] Typically, the mutant Gα subunit of the first aspect of the present invention has at least 20% sequence identity with the amino acid sequence of the long isoform of the human Gα-s subunit shown in Figure 1 (SEQ ID NO: 91), for example, at least 30%, 40%, 50%, 60%, or 70% sequence identity, more typically at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0087] In more specific embodiments, the mutant Gα subunit has at least 20% sequence identity with any of the amino acid sequences in Figure 26 corresponding to SEQ ID NOs. 1 to 45, for example, at least 30%, 40%, 50%, 60%, or 70% sequence identity, more preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. Preferably, the mutant Gα subunit contains any of the amino acid sequences in Figure 26 corresponding to SEQ ID NOs.

[0088] In more specific embodiments, the mutant Gα subunit has at least 20% sequence identity with any of the amino acid sequences in Figures 29, 35, 36, 37, 38, and 40, for example, at least 30%, 40%, 50%, 60%, or 70%, more preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. Preferably, the mutant Gα subunit contains any one of the amino acid sequences in Figures 29, 35, 36, 37, 38, and 40.

[0089] The sequence identity percentage between two polypeptides can be determined using any suitable computer program, for example, the GAP program from the University of Wisconsin Genetic Computing Group, and it is understood that the identity percentage is calculated in relation to the optimally aligned polypeptide. Alternatively, alignment can be performed using the Clustal W program (Thompson et al., 1994 Nucleic Acids Res. 22(22):4673-80). The parameters used are as follows: Fast pair alignment parameters: K-tuple (word) size 1, window size 5, gap penalty 3, number of upper diagonals 5. Scoring method: x percent. Multiple alignment parameters: gap opening penalty 10, gap stretching penalty 0.05. Scoring matrix: BLOSUM.

[0090] Numerous dominant-negative mutations result in heterotrimeric G proteins (Barren & Artemyev 49 (as outlined by) and low molecular weight G proteins (Feig 50 Both (as outlined by) have been reported. Dominant-negative mutants can inhibit G protein signaling by sequestrating the βγ subunit, activated GPCRs (e.g., GPCRs capable of binding to G proteins), or downstream binding partners. 49、50 Mutants that sequester GPCRs are particularly desirable for designing the MEGA domain because they can help prevent the dissociation of the ternary complex (i.e., between the Gα subunit, the GPCR, and the βγ subunit). Therefore, in one embodiment, the mutant Gα subunit of the first aspect of the present invention contains one or more dominant-negative mutations compared to the parental Gα subunit. Any such dominant-negative mutations known in the art may be incorporated into the mutant Gα subunit of the present invention, some specific examples of which are included below.

[0091] The S17N mutation is one of the first dominant-negative mutations described for ras. 51, the corresponding mutation is (S54N) 52~54 and Gαt (S43N) 55、56 characterized in. Thus, in one embodiment, the mutant Gα subunit has a different amino acid at a position corresponding to Ser 54 according to the numbering of the long isoform of human Gα-s described in FIG. 1 as compared to the parental Gα subunit. When the mutant Gα subunit is a Gαs subunit, the mutant preferably contains the mutation S54N, and when the mutant Gα subunit is a Gαt subunit, the mutant preferably contains the mutation S43N.

[0092] The N338D mutation located within the NKXD motif was identified as a dominant negative mutant in the yeast G protein Gpa1 58 . Similar to Ras S17N, the Gpa1 N338D mutant appears to form an irreversible empty-binding pocket complex with the receptor, which showed resistance to dissociation by guanine nucleotides 58 . The authors noted that the mutant protein was thermally unstable and that receptor binding provided protection against denaturation 58 . Simon and colleagues similarly reported that the D273N mutation located within the NKXD motif resulted in nucleotide-depleted Gαo, Gα11, and Gα12 subunits that exhibit a receptor-sequestering dominant negative phenotype (βγ-dependent) 62~64 . Thus, in another embodiment, the mutant Gα subunit has one or more different amino acids within the NKXD motif as compared to the parental Gα subunit, optionally with the Asn of the NKXD motif replaced by Asp and / or the Asp of the NKXD motif replaced by Asn. The NKXD motif belongs to a group of G-box motifs that are highly conserved in all G proteins and are described in detail in the scientific literature. The CGN code of the NKXD motif in Gαs is N292 G.S5.7 , K293 Gshg.1 , Q294 G.HG.1 , and D295 G.HG.2If the mutant Gα subunit is yeast Gpa1, the mutant preferably contains mutant N338D, and if the mutant Gα subunit is any of Gαo, Gα11, or Gα12, the mutant preferably contains mutant D273N.

[0093] Simon and colleagues also found that the addition of a second mutation, Q205L, to Gαo switched the nucleotide specificity of the Gα subunit from guanosine to xanthine nucleotide. 62~64 These dual mutant Gα subunits (D273N / Q205L) also acted as receptor segregation-dominant-negative mutants under physiological conditions where xanthine nucleotides are essentially absent. However, when xanthine nucleotides are supplemented, they regain full biological function, making them useful tools for studying G protein signaling pathways in vivo. Furthermore, both the D273N and D273N / Q205L mutants retained their receptor-coupled selectivity. D273 in Gαo corresponds to Q227 in Gαs. G.s3h2.3 This corresponds to the above. Therefore, in further embodiments, the mutant Gα subunit of the first aspect of the present invention has a different amino acid at the position corresponding to Gln 227 according to the Gαs numbering shown in Figure 1, compared to the parent Gα subunit, and optionally has a different amino acid at the position corresponding to Asp 295 according to the Gαs numbering shown in Figure 1. When the mutant Gα subunit is Gαo, the mutant preferably includes mutant Q205L and optionally also includes mutant D273N.

[0094] Bourne and colleagues designed a triple mutant exhibiting a dominant-negative phenotype. 65 The combination of the G226A, E268A, and A366S mutations produces the Gαs subunit, which efficiently sequesters both the receptor and the β subunit in a stable nucleotide-free ternary complex. 65Therefore, in one embodiment, the mutant Gα subunit has one or more different amino acids at positions corresponding to one or more or all of the following positions according to the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1: Gly 226, Glu 268, and Ala 366, compared to the parent Gα subunit. When the mutant Gα subunit is a mutant Gα subunit, the mutant preferably includes one or more or all of the mutants G226A, E268A, and A366S.

[0095] Pereira and Cerione reported mutations in the switch III region, which resulted in the production of a receptor segregation-dominant-negative phenotype. 59 . Gαt(Chimera 6) 44 The R238E mutation was found to exist in a nucleotide-deficient state. This mutant was also reported to be more thermally stable than other nucleotide-deficient Gα mutants, possibly because it adopted a partially active conformation. 59 However, the same mutation in Gαs also failed to produce a dominant-negative phenotype. Therefore, in one embodiment, the mutant Gα subunit is a mutant Gαt subunit (chimera 6) that has a different amino acid at the position corresponding to Arg 238, according to the numbering of the Gαt subunit (chimera 6) shown in Figure 27, compared to its parent Gα subunit.

[0096] Many nucleotide-free Gα subunits 24、25、66、67 Similarly, this triple mutant is thermally unstable. 65 Therefore, two of these mutations (G226A and A366S) were combined with additional mutations to produce more stable dominant-negative mutants. 68 Here, the α3 / β5 loop of Gαs is replaced with the corresponding region of Gαi2, as described in the previous section. 48 This construct, containing a total of seven mutations, was reported to have significantly improved thermal stability. 48 .

[0097] In addition to dominant-negative mutations, other mutations that may be desirable to incorporate into the mutant Gα subunit of the first aspect of the present invention include mutations known to increase the affinity of the Gα subunit to GPCRs. Therefore, it is understood that the mutant Gα subunit may contain one or more mutations known to increase the affinity of the Gα subunit to GPCRs compared to the parental Gα subunit. Any such affinity-increasing mutations known in the art may be incorporated into the mutant Gα subunit of the present invention, some specific examples of which are included below.

[0098] Iverson and colleagues have studied receptor binding. 29 Two Gαi1 constructs are used to mimic the rotation and dislocation of the α5 helix, which is predicted to be induced by [the specified mechanism]. 30 We designed the protein by first manipulating a disulfide bond between residues I56 and Q333 (mutating it to cysteine) to induce a shift in the α5 helix, and secondly, introducing a positive charge to the N-terminus of the α5 helix (D328R) to disrupt the local electrostatic distribution around the nucleotide. We then solved the crystal structure of the disulfide-manipulated protein and confirmed the presence of the disulfide bond and the shift in the position of the α5 helix. 30 Both mutants showed increased nucleotide exchange levels and were able to interact with rhodopsin, but the receptor was unable to further accelerate the nucleotide exchange rate. 30 The D328R mutant also showed enhanced interaction with rhodopsin compared to wild-type Gαi1. 30 Therefore, in one embodiment, the mutant Gα subunit has a cysteine ​​residue at the positions corresponding to Ile 56 and Gln 333, respectively, according to the numbering of the Gαi1 subunit shown in Figure 25, compared to the parent Gα subunit. In addition, or alternatively, the mutant Gα subunit has a different amino acid at the position corresponding to Asp 328, according to the numbering of the Gαi1 subunit shown in Figure 25, compared to the parent Gα subunit. When the mutant Gα subunit is a Gαi subunit, preferably the mutant includes mutant D328R.

[0099] Grishina and Berlot identified the α3 / β5 loop of Gαs (i.e., the loop between helix 3 and beta chain 5) as a potential receptor contact site. 48 Substitution of this region in the corresponding loop of Gαi2 has been reported to increase affinity for β2AR and reduce the receptor catalytic nucleotide exchange rate. 48 Therefore, in further embodiments, the mutant Gα subunit may be a mutant Gαs subunit in which the α3 / β5 loop of the parent Gαs subunit is replaced with the α3 / β5 of the Gαi2 subunit. The α3 / β5 loop is the K249 of Gαi2. G.H3.7 ~T263 G.h3s5.3 The amino acid sequence N271 of Gαs corresponds to this sequence. G.H3.8 ~I285 G.h3s5.3 This refers to the region defined by [the specified function]. The substitution of this loop in Gαs is the following mutation: Corresponding to N271K, K274D, R280K, T284D, and I285T, it is understood that the mutant Gα subunit may have different amino acids in positions corresponding to one or more of Asn 271, Lys 274, Arg 280, Thr 284, and Ile 285, according to the numbering of the long isoforms of the human Gαs subunit shown in Figure 1, compared to the parent Gα subunit. When the mutant Gα subunit is a Gαs subunit, preferably the mutant contains one or more of the mutants N271K, K274D, R280K, T284D, and I285T.

[0100] Moller and colleagues reported that modification of Cys-347 within the C-terminal region of transducin prevented dissociation of the rhodopsin-transducin complex. 47 Interestingly, the type of modifying reagent used appears to determine the nucleotide binding state of the complex, with iodoacetic acid (IAA) carboxymethylation of Cys-347 trapping the rhodopsin-transducin empty pocket complex and conferring resistance to guanine nucleotide-mediated dissociation. 47Treatment with 2-nitro-5-thiocyanobenzoic acid (NTCBA) captured the rhodopsin-transducin complex in a GDP-bound state. 47 This may be important in the design of the MEGA domain because the nucleotide-binding ternary complex may be more stable than the nucleotide-depletion complex. Therefore, in yet another embodiment, the mutant Gα subunit may have a chemical modification of the amino acid residue at the position corresponding to Cys 347 according to the numbering of the Gαt subunit shown in Figure 25, and optionally the amino acid residue may be carboxymethylated (e.g., treated with IAA) or cyaninated (e.g., treated with NTCBA).

[0101] Mutants of the parental Gα subunit can be produced by any preferred method and provided in any preferred form. Conventional site-directed mutagenesis may be used, or polymerase chain reaction-based procedures well known in the art may be used.

[0102] A variant of a parent Gα subunit is one whose amino acid sequence contains one or more deletions, amino acid substitutions, and / or insertions compared to the amino acid sequence of the parent Gα subunit. A deletion may be within the amino acid sequence of the parent Gα subunit (i.e., not at the end of the sequence), but it is understood that a deletion may be at either the N-terminus or C-terminus, or both, of the amino acid sequence of the parent Gα subunit. Similarly, an insertion may be the insertion of one or more (e.g., two, three, four, or five or more) amino acids within the amino acid sequence of the parent Gα subunit (i.e., not at the end of the sequence), but also includes insertions at either the N-terminus or C-terminus, or both, of the amino acid sequence of the parent Gα subunit, such as fusions.

[0103] To avoid misunderstanding, the mutant Gα subunits of the present invention may also be chimeras composed of one or more parts of a first Gα subunit and one or more parts of a second Gα subunit. Chimeras may be useful for transforming one class of Gα subunits (e.g., Gαs) to behave like another class (e.g., Gq or Gi). For example, GS Substitution of the last 18 amino acids of the C-terminus of Gq with the last 18 amino acids of the C-terminus of Gq enables the Gα subunit to bind to receptors that are coupled only to Gq. Recent in vivo FRET studies have also suggested that residues distal to the five C-terminal residues, although located within the alpha 5 helix, strongly influence specificity (see also Example 5). As described in detail in Example 5, the inventors have found that introducing mutations identified in Gs into other G protein types alone does not produce mini-G proteins of those other G protein types, and an alternative approach is to create chimeras by converting the specificity of mini-Gs to the properties of the desired G protein. Thus, once a mutant Gα subunit of a first aspect of the invention is developed that can bind to a GPCR in the absence of Gβ and Gγ subunits, if the mutant Gα subunit is a mutant of a particular family or type of Gα subunit (e.g., Gαs), it may be desirable to mutate the mutant Gα subunit to further convert the specificity of the mutant Gα subunit to the specificity of a different family or type (e.g., Gαq). Examples of such chimeras are provided in Example 5 and the accompanying drawings and are within the scope of the present invention. It is understood that any of the mutations that give rise to the Gs-to-Gq specificity change identified in Example 5 can be produced in association with any of the mini-Gαs proteins described herein.

[0104] Generally, a mutant Gα subunit has at least one mutation (i.e., deletion, substitution, or insertion) compared to its parent Gα subunit, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mutations. Typically, a mutant Gα subunit has 25 or fewer mutations, for example, 24, 23, 22, 21, 20, 19, 18, 17, 16, or 15 or fewer mutations. Most typically, a mutant Gα has 5 to 15 mutations, for example, 5 to 10 mutations (e.g., 5 to 9 mutations or 5 to 8 mutations).

[0105] In one embodiment, the mutant Gα subunit contains one or two deletions and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions. Typically, the mutant Gα subunit does not contain 10 or more amino acid substitutions.

[0106] Preferably, the mutant Gα subunit contains three deletions (e.g., an N-terminal deletion, a deletion within the helical domain, and a deletion in the switch III region), but it is understood that fewer or more deletions may occur (e.g., a deletion of only one helix in the switch III region, in addition to a deletion of at least one helix in the helical domain).

[0107] The parental Gα subunit does not need to be a naturally occurring protein. Conveniently, it may be an engineered version that can be expressed in a suitable host organism such as Escherichia coli. For example, the parental Gα subunit may be a cleaved form of a naturally occurring protein (cleaved at either or both ends), or it may be a fusion of a naturally occurring protein or a fragment thereof. Alternatively, or in addition, the parental Gα may be modified to improve, for example, solubility, proteolytic stability compared to the naturally occurring Gα (e.g., by cleavage, loop deletion, glycosylation site mutation, or mutation of a reactive amino acid side chain such as cysteine). In any case, the parental Gα is a protein that can bind to one or more GPCRs known to bind to naturally occurring Gα. Therefore, both the mutant Gα subunit and the parental Gα subunit should bind to the same GPCR(s). If the parental Gα subunit is known to bind to more than one GPCR, it is preferable that the mutant Gα subunit can bind to multiple GPCRs having the same breadth and / or order of affinity as the parental Gα subunit. Preferably, the mutant Gα subunit should also bind to the same β subunit(s) and γ subunit(s) as the parent Gα subunit. It is also preferable that the mutant Gα subunit binds to the same downstream effector(s) as the parent Gα subunit. However, it is understood that the mutant Gα subunit may bind to a different GPCR than its parent Gα subunit in the chimeric situation described above (for example, when the specificity of the parent Gα subunit is converted to the specificity of the desired G protein). Similarly, the mutant Gα protein may bind to a different downstream effector than its parent Gα subunit.

[0108] Conveniently, the mutant Gα subunit is encoded by a suitable nucleic acid molecule and expressed in a suitable host cell. Suitable nucleic acid molecules encoding the mutant Gα subunit can be prepared using standard cloning techniques, site-directed mutagenesis, and PCR known in the art. Suitable expression systems include constitutive or inductive expression systems in bacteria or yeast, viral expression systems such as baculovirus, Semlik Forest Fever virus, and lentivirus, or transient transfection in insect or mammalian cells. Suitable host cells include E. coli, Lactococcus lactis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Spodoptera frugiperda, and Trichoplusiani cells. Suitable animal host cells include HEK 293, COS, S2, CHO, NSO, and DT40. Some Gα subunits are known to require specific lipids to function. In such cases, it is desirable to select host cells that perform lipidization reactions. In addition, or alternatively, the reaction may be carried out using components purified during the isolation and purification of the mutant Gα subunit. Thus, it is understood that the mutant Gα subunit of the first embodiment of the present invention may be lipid-modified. For example, Gα is known to be covalently bonded to the palmitoyl groups of Gly2 and Cys3, and therefore the mutant Gα subunit may be lipid-modified by the palmitoyl group. This may be desirable when crystallization in the liquid crystal phase or when the Gα subunit is studied in whole-cell assays. However, in other embodiments, the mutant Gα subunit of the first embodiment of the present invention is not lipid-modified, which may be preferable for structural studies of detergent solutions, drug screening, binding studies (e.g., surface plamon resonance), etc.

[0109] Molecular biological methods for cloning and manipulating genes and cDNA, and for expressing polypeptides from polynucleotides in host cells, are well known in the art, as illustrated in "Molecular cloning, a laboratory manual," third edition, Sambrook, J. & Russell, DW (eds), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, which is incorporated herein by reference.

[0110] Conveniently, the mutant Gα subunit of the present invention includes a detectable portion such as an affinity tag (e.g., histidine tag, maltose-binding protein tag, GST tag, HA tag, FLAG tag), a directly detectable label (fluorophore, radioisotope, contrast agent, or luminescence label, etc.), or an indirectly detectable label (enzyme, enzyme substrate, antibody, antibody fragment, antigen, hapten, ligand, affinity molecule, chromogenic substrate, protein, peptide, nucleic acid, carbohydrate, and lipid, etc.). An example of a detectable label is green fluorescent protein (GFP), and thus it is understood that the present invention includes a fusion protein between GFP and the mutant Gα subunit of the present invention. Examples of such fusion proteins are described in Example 5 and Figure 36. It is understood that the mutant Gα subunit may include a cleavage site, for example, to allow removal of the detectable portion during purification. Any suitable cleavage site known in the art may be used. One example is the tobacco etch virus (TEV) cleavage site.

[0111] A second aspect of the present invention provides a variant of the parent heterotrimeric G protein alpha (Gα) subunit, which (i) can bind to GPCRs in the absence of heterotrimeric G protein beta (Gβ) subunits and heterotrimeric G protein gamma (Gγ) subunits, and (ii) is located at the following positions according to the long isoform numbering of the human Gα-s subunit shown in Figure 1: Val 36, His 41, Ala 48, Gly 49, Glu 50, Met 60, Leu 63, Leu 197, Cys 200, Arg 201, Phe 208, Asn 218, Gly 226, Glu 230, Ala 249, Ser 252, Leu 272, Ile 372, and Val It has different amino acids at one or more of the 375 positions (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17).

[0112] The preferences for additional mutations that may be present in the mutant Gα subunit of the second embodiment of the present invention include those described above in relation to the first embodiment.

[0113] Therefore, the mutant Gα subunit may further include deletions of one or more of the helical domain, switch I region, switch II region, and switch III region as described above in relation to the first aspect of the present invention.

[0114] The preference for the number of mutations (e.g., deletions, insertions, and substitutions) is also defined above in relation to the first aspect of the present invention. These mutant Gα subunits may contain only one deletion (e.g., in the switch III region).

[0115] For example, mutant Gα subunits may have different amino acids at positions corresponding to one or more of the following locations (e.g., at least 2, 3, 4, or 5) in the N-terminal cleavage of 5-20 or 5-25 amino acid residues, deletion of the switch III region, and Leu 272, according to the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1: His 41, Leu 197, Cys 200, Ala 249, and Leu 272, and also have a deletion of at least one helix in the helical domain of the parent Gα subunit.

[0116] A particularly preferred N-terminal cleavage of the mutant Gα subunit is the amino acid residue Ile / Leu shown in Figure 29. HN43 This is a mutation in which all amino acid residues at the N-terminus are deleted. For example, if the mutant Gα subunit is a mutant Gαs subunit, this corresponds to the deletion of the first 25 amino acids corresponding to the first 25 amino acids of human Gαs, according to the numbering of human Gαs shown in Figure 29.

[0117] In another example, the mutant Gα subunit may have different amino acids at positions corresponding to one or more of the following locations (e.g., at least 2, 3, 4, 5, 6, 7, or 8) according to the numbering of the long isoforms of the human Gα-s subunit shown in Figure 1: Gly 49, Glu 50, Leu 63, Ala 249, Ser 252, Leu 272, Ile 372, and Val 375, and optionally also have a deletion of at least one helix in the helical domain of the parent Gα subunit. For example, the mutant Gα subunit may have different amino acids at any of the following locations according to the numbering of the long isoforms of the human Gα-s shown in Figure 1: Gly 49, Glu 50, Ala 249, Ser 252, Leu 272, Ile 372, and Val 375.

[0118] The mutant Gα subunits of the second aspect of the present invention may also include one or more dominant-negative mutations and / or one or more mutations known to increase the affinity between the Gα protein and the GPCR, as described above in relation to the first aspect of the present invention.

[0119] As shown in the examples, the inventors have identified mutant Gα subunits that have increased stability under denaturation conditions compared to their parent Gα subunits. It is also understood that the present invention enables the production of compositions comprising mutant Gα subunits of a first or second embodiment of the present invention, characterized in that the mutant Gα is exposed to stabilization conditions. Such compositions have a variety of applications, e.g., crystallization, drug screening, bioassays, and biosensor applications. Accordingly, the present invention also provides compositions comprising mutant Gα subunits of a first or second embodiment of the present invention, characterized in that the mutant Gα is exposed to stabilization conditions that are effective in destabilizing the parent Gα to a higher degree than the mutant Gα subunit.

[0120] A “destabilizing condition” refers to any condition that can shift the equilibrium of a Gα protein population from its folded native state within the cell to an unfolded state. In this way, the proportion of Gα proteins existing in the unfolded state increases, and the proportion existing in the folded native state within the cell decreases. This structural change from folded to unfolded results in a detectable change in the structure of the Gα protein population. Furthermore, this structural change may result in a detectable decrease in the biological activity of the Gα protein population. Therefore, in one embodiment, a destabilizing condition is one that is effective in causing significant disruption in the structure of the Gα protein population compared to the structure of the Gα protein population in the absence of the destabilizing condition.

[0121] "Significant disruption in the structure of the Gα subunit population" means that, when evaluated in comparison to the statistical variability of the measurements used to detect the disruption, the disruption would occur by chance less than once in 10 measurements, more preferably once in 20 measurements, and even more preferably once in 50 measurements or once in 100 measurements.

[0122] Various methods for exploring protein structures are known in the art, and any suitable method can be used. For example, structural confusion can be assayed by directly exploring the three-dimensional structure, for example, by covalently linked fluorescent labeling or ESR spin labeling, or by measuring the reachability of naturally or intentionally introduced amino acid side chains within the protein (Hubbell, W. Let al., Adv. Protein. Chem. 63, 243-290 (2003), Baneres, J. Let al., J. Biol. Chem. 280, 20253-20260 (2005), Kobilka, B. K. and Deupi, X. Trends. Pharmacol. Sci. 28, 397-406 (2007)). The conformational changes of the secondary and tertiary structures can also be measured using proteolytic stability, deuterium / hydrogen exchange measured by mass spectrometry or nuclear magnetic resonance spectroscopy, blue native gel, capillary zone electrophoresis, circular dichroism (CD) or linear dichroism (LD) spectra, and light scattering. Similarly, any suitable method for evaluating Gα activity may be used as described above in relation to the first aspect of the present invention.

[0123] A third aspect of the present invention provides a polynucleotide encoding a mutant Gα subunit according to a first or second aspect of the present invention. The polynucleotide may be DNA or RNA. Typically, it is contained in a vector, such as a vector, which can be used to express the mutant Gα subunit. A suitable vector is one that propagates and / or enables expression in bacterial cells or mammalian or insect cells. The present invention also includes cells, such as host cells, such as bacterial or eukaryotic cells, that contain the polynucleotide encoding the mutant Gα subunit. Suitable cells include E. coli cells, yeast cells, mammalian cells, and insect cells.

[0124] Examples of polynucleotides encoding the variant Gα subunit of the present invention are provided in Figure 26 and have the polynucleotide sequences listed in SEQ ID NOs. 46-90. Therefore, in one embodiment, a polynucleotide of a third aspect of the present invention has at least 20% sequence identity with any of the polynucleotide sequences from SEQ ID NOs. 46-90, for example, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. Preferably, the polynucleotide contains any of the polynucleotide sequences from SEQ ID NOs. 46-90.

[0125] A fourth aspect of the present invention provides a complex comprising (i) a mutant Gα subunit or a portion thereof according to the first or second aspect of the present invention that can bind to a GPCR, and (ii) a GPCR or a portion thereof that can bind to the mutant Gα subunit of the first or second aspect of the present invention.

[0126] The preferences for mutant Gα subunits include those described above in relation to the first and second aspects of the present invention. It is preferable that the mutant Gα subunit has at least 20% sequence identity with any amino acid of SEQ ID NOs. 1 to 45, for example, at least 30%, 40%, 50%, 60%, or 70% sequence identity, more preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. Preferably, the mutant Gα subunit contains any of the amino acid sequences in Figure 26 corresponding to SEQ ID NOs. 1 to 45. Preferably, the mutant Gα subunit has at least 20% sequence identity with any of the amino acid sequences in any of Figures 29, 35, 36, 37, 38, and 40, for example, at least 30%, 40%, 50%, 60%, or 70% sequence identity, more preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. Preferably, the mutant Gα subunit contains any one of the amino acid sequences in any of Figures 29, 35, 36, 37, 38, and 40.

[0127] It is understood that the complex may include a portion of a GPCR-binding mutant Gα subunit, such as one that can functionally bind to the GPCR as described above. Evaluating the binding between the Gα subunit and the GPCR is standard practice in the art and includes the methods described above. Generally, this portion is at least 100, 150, 200, 250, or 300 amino acids long.

[0128] GPCR refers to all seven TMRs within the GPCR superfamily. Suitable GPCRs for use in the implementation of this invention include adenosine receptors, specifically adenosine A 2A Receptor (gene name: ADORA2A), muscarinic receptor, serotonin receptor (e.g., 5HT) 2CExamples include, but are not limited to, GPCRs (gene name: HTR2C), β-adrenergic receptors (e.g., βAR-1, gene name: ADRB1), neurotensin receptors (NTS1, gene name: NTSR1), and orexin receptors (e.g., OX2, gene name: HTR2C). In addition, the International Union of Pharmacology has compiled a list of GPCRs (incorporated herein by reference, Foord et al (2005) Pharmacol. Rev. 57, 279-288; this list is regularly updated at http: / / www.iuphar-db.org / GPCR / ReceptorFamiliesForward). It should be noted that the more than 800 GPCRs in humans are divided into different classes, e.g., classes A, B, C, D, E, and F, primarily based on the similarity of their amino acid sequences, such as rhodopsin-like receptors (class A), secretin receptors (class B), metabotropic glutamate / pheromone receptors (class C), and frizzled / smoothed receptors (class F) (Fredriksson et al (2003) Mol Pharmacol 63: 1256-1272). GPCRs can also be divided into families by reference to the native ligands to which they bind. All GPCRs, specifically those known to be coupled to G proteins, are included within the scope of this invention.Therefore, GPCRs include adenosine receptor, β-adrenergic receptor, neurotensin receptor, muscarophosphate receptor, 5-hydroxytryptamine receptor, adrenergic receptor, anaphylatoxin receptor, angiotensin receptor, apelin receptor, bombesin receptor, bradykinin receptor, cannabinoid receptor, chemokine receptor, cholecystokinin receptor, dopamine receptor, endothelin receptor, free fatty acid receptor, bile acid receptor, galanin receptor, motilin receptor, ghrelin receptor, glycoprotein hormone receptor, GnRH receptor, histamine receptor, KiSS1-derived peptide receptor, leukotriene and lipoxin receptor, lysophospholipid receptor, melanin-concentrating hormone receptor, melanocortin receptor, melatonin receptor, neuromedin U receptor, neuropeptide receptor, N-formyl peptide family receptor, and nicotinic acid receptor. This may be any of the following: receptors, opioid receptors, opsin-like receptors, orexin receptors, P2Y receptors, peptide P518 receptors, platelet-activating factor receptors, prokinethicin receptors, prolactin-releasing peptide receptors, prostanoid receptors, protease-activating receptors, relaxin receptors, somatostatin receptors, SPC / LPC receptors, tachykinin receptors, trace amino receptors, thyrotropin-releasing hormone receptors, urotensin receptors, vasopressin / oxytocin receptors, orphan GPCRs, calcitonin receptors, corticotropin-releasing factor receptors, glucagon receptors (e.g., glucagon-like peptide 1 receptor, GLP1R), parathyroid receptors, VIP / PACAP receptors, LNB7™ receptors, GABA receptors, metabotropic glutamate receptors, and calcium sensor receptors (see Table 1 of Food et al (2005) Pharmacol. Rev. 57, 279-288, incorporated herein by reference).

[0129] It is understood that the complex may include a portion of a GPCR that can bind to a mutant Gα subunit, such as one that can functionally bind to the Gα subunit as described above. This portion may include only the transmembrane portion of the GPCR. Generally, this portion is at least 100, 150, 200, 250, or 300 amino acids long.

[0130] The amino acid sequences (and nucleotide sequences of the encoded cDNAs) of many GPCRs are readily available, for example, by referring to GenBank. Specifically, Food et al. (see above) provide human gene symbols from Entrez Gene (http: / / www.ncbi.nlm.nih.gov / entrez), as well as human, mouse, and rat gene IDs. It should also be noted that, since the human genome sequence is substantially complete, the amino acid sequences of human GPCRs can be inferred from it.

[0131] GPCRs can originate from any source, but it is particularly preferable that they originate from a eukaryotic source. It is particularly preferable that GPCRs originate from a vertebrate source such as a mammal or bird. It is particularly preferable that GPCRs originate from a rat, mouse, rabbit, or dog, or a non-human primate or human, or a chicken or turkey. To avoid misunderstanding, "originating from" means that the cDNA or gene was originally obtained using genetic material from the source, but the protein can subsequently be expressed in any host cell. Therefore, it is clear that eukaryotic GPCRs (such as bird or mammalian GPCRs) can be expressed in prokaryotic host cells such as E. coli, but in some cases they may be considered to originate from a bird or mammal.

[0132] In some cases, GPCRs can consist of more than one different subunit. For example, the calcitonin gene-associated peptide receptor requires a single transmembrane helic protein (RAMP1) to obtain its physiological ligand-binding properties. Effector proteins, accessory proteins, auxiliary proteins, or GPCR-interacting proteins that form or regulate functional complexes in combination with GPCRs are well known in the art and include, for example, receptor kinases, G proteins, and arrestins (Bockaert et al (2004) Curr Opinion Drug Discov and Dev 7, 649-657).

[0133] As described above, GPCRs are thought to exist in multiple distinct conformations associated with different pharmacological classes of ligands, such as agonists and antagonists, and to cycle between these conformations in order to function (Kenakin T. (1997) Ann NY Acad Sci 812, 116-125). Therefore, in one embodiment, a GPCR exists in a specific conformational state, such as an agonist conformation or an antagonist conformation. For example, a GPCR may be a mutant GPCR that has increased stability in a specific conformation (e.g., an agonist or antagonist conformation) under denaturing conditions compared to the stability of its parent GPCR in the same specific conformation under denaturing conditions. Examples of such stabilized mutant GPCRs and methods for producing them are well known in the art and are referred to in WO2008 / 114020, WO2009 / 071914, WO2009 / 081136, and WO2010 / 149964. Furthermore, or to facilitate the formation of a complex between the mutant Gα subunit and the GPCR in a specific three-dimensional structure, the GPCR may be exposed to a drug known to stabilize its three-dimensional structure. Examples of drugs that stabilize agonist three-dimensional structures include those described above in relation to the first aspect of the present invention, such as nanobodies.

[0134] It is understood that a mutant Gα subunit of the first or second aspect of the present invention forms a complex with a GPCR, and the GPCR adopts its G protein-binding state, which is such that the cytoplasmic terminal of the transmembrane helix 6 of the GPCR moves at least 10 Å away from the receptor core, for example, at least 11 Å, 12 Å, 13 Å, 14 Å, 15 Å, or 16 Å.

[0135] It is understood that it may be advantageous to detectably label one or both of the mutant Gα subunits or GPCRs, or parts thereof, to facilitate the detection of their binding. Examples of suitable labeling methods include peptide labeling, nucleic acid labeling (Kerr et al (1993) JACS vol.115, pp.2529-2531, and Brenner & Lerner (1992) Proc.Natl.Acad.Sci.USA vol.89, pp.5381-5383), chemical labeling (Ohlmeyer et al (1993) Proc.Natl.Acad.Sci.USA vol.90, pp.109222-10926, and Maclean et al (1997) Proc.Natl.Acad.Sci.USA vol.94, pp.2805-2810), and fluorescent labeling (Yamashita & Weinstock (SmithKline Beecham Corporation), WO95 / 32425 (1995), and Sebestyen et al. Examples include al (1993) Pept. Proc. Eur. Pept. Symp. 22nd 1992, pp. 63-64), or radio frequency tags (Nicolaou et al (1995) Angew. Chem. Int. Ed. Engl. vol. 34, pp. 2289-2291, and Moran et al (1995) JACS vol. 117, pp. 10787-10788). Any of the above-described detectable parts may also be used in connection with the first aspect of the present invention.

[0136] Given that ligand-binding pocket mapping is critically important for designing drugs to modulate GPCR activity, it may be desirable for the complex to contain additional GPCR ligands. The inclusion of ligands also helps stabilize specific GPCR conformations, such as agonist or antagonist conformations.

[0137] Typically, a ligand is a full agonist, capable of binding to GPCRs and inducing a complete (100%) biological response, measured by physiological outputs such as G protein coupling, downstream signaling events, or vasodilation. A ligand can also be a partial agonist, capable of binding to GPCRs and inducing a partial (less than 100%) biological response.

[0138] Ligands can also be inverse agonists, which are molecules that bind to a receptor and sometimes reduce its basal (i.e., unstimulated) activity to zero.

[0139] Ligands can also be antagonists, which are molecules that bind to receptors and block agonist binding, thereby preventing a biological response. Reverse agonists and partial agonists can be antagonists under certain assay conditions.

[0140] The ligands described above may be orthosteric, meaning they combine with the same site as the endogenous agonist; or they may be allosteric or heterozoic, meaning they combine with a site separate from the orthosteric site. The ligands may also be homozoic, meaning they interact with other ligands at the same or overlapping site. Their interactions may be reversible or irreversible.

[0141] Ligands for use in the present invention may be allosteric modulators, such as positive allosteric modulators, potentiators, negative allosteric modulators, and inhibitors. They may be active as agonists or inverse agonists on their own, or they may be active in the presence of an agonist or inverse agonist, in which case they are used in combination with such molecules to bind to GPCRs.

[0142] Neubig et al (2003) Pharmacol. Rev. 55, 597-606, incorporated herein by reference, describes various classes of ligands.

[0143] The ligand can be a small molecule, protein, peptide, protein scaffold, nucleic acid, ion, carbohydrate, or antibody.

[0144] Preferably, the ligand is a small organic or inorganic moiety, but may be a peptide or polypeptide. Typically, if the ligand is a small organic or organic moiety, it has a molecular weight of 50 to 2000, such as 100 to 1000, for example, 100 to 500 M r It has.

[0145] Typically, the ligand is K in the mM to pM range, such as μM (micromoles) to nM. d It binds to GPCRs. Generally, ligands with the lowest Kd are preferred.

[0146] Small organic molecule ligands are well known in the art; see, for example, the following examples. Other small molecule ligands include 5HT, a complete agonist of the 5HT1A receptor; ertoprazine, a partial agonist of the 5HT1A receptor (see Newman-Tancredi et al (1997) Neurophamacology 36, 451-459); (+)-butacramole and spiperone, dopamine D2 receptor reverse agonists (see Roberts & Strange (2005) Br.J. Pharmacol. 145, 34-42); and WIN55212-3, a neutral antagonist of CB2 (Savinainen et al (2005) Br.J. Pharmacol. 145, 636-645).

[0147] The ligand can be a peptide mimetic, nucleic acid, peptide nucleic acid (PNA), or aptamer. + Or Zn 2+These may be ions such as oleamide, lipids such as oleamide, or carbohydrates such as heparin.

[0148] The ligand can be a polypeptide that binds to a GPCR. Such polypeptides (which include oligopeptides) are typically M r 500~M r The number is 50,000, but can be larger. Polypeptides can be naturally occurring GPCR-interacting proteins or other proteins that interact with GPCRs, or derivatives or fragments thereof, provided that they selectively bind to GPCRs in a specific three-dimensional structure. GPCR-interacting proteins include those involved in signaling and those involved in transport, and these often act via the PDZ domain of the C-terminal portion of GPCRs.

[0149] Polypeptides known to bind to certain GPCRs include G proteins, arrestin, RGS proteins, G protein receptor kinases, RAMP, 14-3-3 proteins, NSF, periplakin, spinophilin, GPCR kinases, receptor tyrosine kinases, ion channels or their subunits, ankyrin, and Shanks or Homer proteins. Other polypeptides include NMDA receptor subunits NR1 or NR2a, calcion, or fibronectin domain frameworks. Polypeptides may bind to the extracellular domain of GPCRs such as fibrin-1. Polypeptides may be other GPCRs that bind to a selected GPCR in a heterooligomer. An overview of protein-protein interactions in GPCRs can be found in Milligan & White (2001) Trends Pharmacol. Sci. 22, 513-518, or Bockaert et al (2004) Curr. Opinion Drug Discov. Dev. 7, 649-657, which are incorporated herein by reference.

[0150] Polypeptide ligands can, conveniently, be antibodies that bind to GPCRs. The term “antibody” includes naturally occurring antibodies, monoclonal antibodies, and their fragments. It also includes engineered antibodies and molecules that are similar to antibodies in terms of their binding properties, such as single-chain Fv (scFv) molecules and domain antibodies (dAb). Camelid antibodies and engineered camelid antibodies are also referred to. Such molecules that bind to GPCRs are known in the art and can in any case be produced using well-known techniques. Suitable antibodies include those currently used in radioimmunoassays (RIA) against GPCRs because they tend to recognize structural epitopes.

[0151] Polypeptides can also be binding proteins based on a modular framework, such as ankyrin repeat proteins, armadillo repeat proteins, leucine-rich proteins, tetratriopeptide repeat proteins, or designed ankyrin repeat proteins (DARPin), or proteins based on lipocalin or fibronectin domains, or affilin scaffolds based on either human gamma crystals or human ubiquitin.

[0152] In one embodiment of the present invention, the ligand is covalently bound to a GPCR, such as a G protein or arrestin fusion protein. Several GPCRs (e.g., thrombin receptor) are cleaved at their N-terminus by a protease, and the new N-terminus binds to an agonist site. Thus, such a GPCR is a natural GPCR-ligand fusion.

[0153] It is understood that the use of antibodies or other "universal" binding polypeptides (such as G proteins known to be coupled to many different GPCRs) may be particularly advantageous for "orphan" GPCRs for which no natural ligands or small molecule ligands are known.

[0154] In one embodiment of a fourth aspect of the present invention, the complex further comprises a G protein β subunit or a G protein γ subunit or a G protein βγ subunit. Five β subunits (Gβ1, Gβ2, Gβ3, Gβ4, Gβ5) and twelve γ subunits (Gγ1, Gγ2, Gγ3, Gγ4, Gγ5, Gγ7, Gγ8, Gγ9, Gγ 10 , Gγ 11 , Gγ 12 , Gγ 13 These exist and can potentially dimerize in any combination of one Gβ subunit and one Gγ subunit, and any of these dimers can potentially bind to any Gα subunit.

[0155] In particular, preferred combinations regarding binding to different GPCRs (e.g., Gα s β1γ2 is preferably bound to β2AR, Gα s β2γ7 or Gα s β4γ5 is preferably A 2A Numerous reports exist in the literature regarding binding to (beta and / or γ subunits), and therefore, for a given Gα or GPCR, a person skilled in the art can identify preferred β and / or γ subunit binding partners. Binding between the α, β, and γ subunits of G proteins is often controlled by other factors such as tissue-specific expression or membrane localization. Any combination is possible in vivo. The amino acid sequences (and nucleotide sequences of the encoding cDNAs) of many Gβ and Gγ subunits are readily available, for example, by referring to GenBank.

[0156] In one embodiment, the complex further comprises nucleotides. For example, the complex may comprise guanine nucleotides such as GDP or GTP, or xanthine nucleotides. The nucleotides may be naturally occurring nucleotides such as GTPγS or GppNp, or derivatives of synthetic nucleotides. Thus, it is understood that the complex may comprise nucleotides and ligands. It is well known that magnesium ions may be important for nucleotide binding, and therefore, in further embodiments, the complex further comprises magnesium ions. For example, the complex may comprise magnesium ions and nucleotides.

[0157] Conveniently, the complex is produced by expressing the mutant Gα subunit or a portion thereof, separately expressing the GPCR or a portion thereof, and then adding these two proteins together under conditions suitable for complex formation after expression. Alternatively, cells can be manipulated to express or overexpress the mutant Gα subunit and the GPCR using standard molecular biology techniques so that the GPCR / mutant Gα subunit can be recovered from the cells. Thus, the present invention also provides (i) a mutant Gα subunit or a portion thereof according to a first or second aspect of the present invention that can bind to a GPCR, and (ii) a polynucleotide or expression vector that can encode a GPCR or a portion thereof that can bind to the mutant Gα subunit according to a first or second aspect of the present invention. The polynucleotide or expression vector can express (i) and (ii) as separate polypeptides, or (i) and (ii) may be part of the same polypeptide chain, i.e., (i) and (ii) may be expressed as a fusion polypeptide.

[0158] Preferably, the GPCR / mutant Gα subunit complex is soluble. Typically, the proteins are produced in E. coli or insect cells, tagged, for example, with six His tags, purified using nickel beads, and the recombinant proteins are isolated. For example, typically, the mutant Gα subunit is expressed in E. coli, and the GPCR is expressed in insect cells using a baculovirus expression system. Similarly, different epitope-tagged versions of the protein can be expressed in cells and purified from the cells. Typically, one of nucleotides, ligands, and / or magnesium ions is added to the isolated or purified complex and incubated under conditions that allow the nucleotides, ligands, and / or magnesium to bind to the complex.

[0159] As is evident from the examples, the complex of the fourth aspect of the present invention accepts crystallization, and thus it is understood that the present invention also provides the complex of the fourth aspect of the present invention in crystalline form. Specifically, Example 4 describes the structure of the G protein (mini-G414)-bound adenosine A2a receptor in its agonist (NECA)-bound form, and thus, in a preferred embodiment, the complex is a crystalline complex comprising adenosine A2a and a mutant Gα subunit, mini-G414.

[0160] The variant Gα subunits and compositions disclosed herein are useful for crystallization studies and in drug discovery programs. They can be used, for example, for biophysical measurements of receptor / ligand dynamics and thermodynamic parameters by surface plasmon resonance or fluorescence-based techniques. They can be used for ligand binding screening, high-throughput screening, or conjugated to solid surfaces for use as biosensor chips. Biosensor chips containing variant Gα subunits or complexes can be used to detect molecules, specifically biomolecules. Further details of such methods and uses are provided below.

[0161] The present invention provides mutant Gα subunits according to a first or second aspect of the present invention, or complexes according to a fourth aspect of the present invention, which are in a solubilized form (e.g., after water solubilization with detergent) and / or substantially free of other proteins. Preferably, when solubilized, the mutant Gα subunits or complexes remain in their native folded state, or the proportion of the population of mutant Gα subunits or complexes containing such mutant Gα subunits that exist in their native folded state exceeds the proportion of the population of parental Gα subunits or complexes containing parental Gα subunits. Preferably, the mutant Gα subunits or complexes containing mutant Gα subunits / GPCRs maintain their structural integrity and are in a functional form (e.g., capable of binding to a ligand or its native binding partner (e.g., a G protein or GPCR)).

[0162] The present invention provides a mutant Gα subunit according to a first or second aspect of the present invention, or a complex according to a fourth aspect of the present invention, which is immobilized on a solid support. Similarly, the present invention provides a solid support on which one or more mutant Gα subunits according to a first or second aspect of the present invention, or a complex according to a fourth aspect of the present invention, is immobilized. For example, the solid support may contain an array of mutant Gα subunits or mutant Gα / GPCR complexes (e.g., two or more, e.g., five or more, ten or more, fifty or more, ninety or more, or one hundred or more). The identities of the mutant Gα subunits and / or GPCRs in the array may be the same or different. Such a solid support is useful for binding screening and is also useful as a biosensor.

[0163] The present invention provides the use of a mutant Gα subunit according to the first or second aspect of the present invention, or a complex according to the fourth aspect of the present invention, for crystallization.

[0164] The present invention provides the use of a variant Gα subunit according to the first or second aspect of the present invention, or a complex according to the fourth aspect of the present invention, in drug discovery.

[0165] The present invention provides the use of a mutant Gα subunit according to the first or second aspect of the present invention, or a complex according to the fourth aspect of the present invention, in ligand-binding screening or assay development.

[0166] The present invention provides the use of a mutant Gα subunit according to the first or second aspect of the present invention, or a complex according to the fourth aspect of the present invention, as a biosensor. In a preferred embodiment, the biosensor may be used to measure ligand levels in vivo.

[0167] A fifth aspect of the present invention provides a method for producing crystals of a GPCR-Gα subunit complex, comprising: (i) providing a mutant Gα subunit, a GPCR, and optionally a GPCR ligand according to a first or second aspect of the present invention; (ii) forming a complex of the mutant Gα subunit, a GPCR, and optionally a GPCR ligand; and (iii) crystallizing the complex to form a crystal.

[0168] The preference for mutant Gα subunits and GPCRs includes those described above in relation to the first, second, and fourth aspects of the present invention. It is understood that steps (i) and (ii) may include providing a complex according to the fourth aspect of the present invention.

[0169] The fusion protein can be crystallized using any suitable crystallization method, such as any of those outlined in "Crystallisation of Biological Macromolecules" (Alexander McPherson; ISBN: 0-87969-617-6), which is incorporated herein by reference. Preferably, crystallization is carried out using the vapor diffusion method outlined in the Examples.

[0170] Conveniently, GPCRs are crystallized in complex with mutant Gα subunits in a specific three-dimensional structure (e.g., an agonist structure), and it is understood that this method may further involve contacting the GPCR with a suitable ligand (agonist or antagonist) or other agents known to stabilize a desired three-dimensional structure, or other agents mentioned above (e.g., nanobodies). Using the crystals, the structure of the complex can be determined, for example, by X-ray crystallography, as described below.

[0171] A sixth aspect of the present invention provides a method for determining the structure of a GPCR in a specific three-dimensional structure (e.g., an agonist three-dimensional structure), comprising providing a complex according to the fourth aspect of the present invention and determining the structure of the complex.

[0172] The structure of a protein includes its primary, secondary, tertiary, and, where applicable, quaternary structures. As used herein, determining a structure means determining the arrangement or atomic coordinates of the protein's atoms, which is often done by biophysical methods such as X-ray crystallography.

[0173] In one embodiment, the GPCR-Gα subunit complex is provided in crystalline form, and the crystalline structure of the complex is determined by biophysical methods, such as X-ray crystallography. X-ray crystallography is well known in the art. As briefly described, the X-ray diffraction pattern is obtained by diffracting X-rays from the crystal. Using the diffraction data, an electron density map of a unit cell containing the crystal can be calculated, and this map is used to establish the positions of atoms (i.e., atomic coordinates) within the unit cell. Thus, the method may further include obtaining atomic coordinates from the crystal. In an alternative embodiment, the NMR structure of the complex is determined. In this alternative embodiment, the structure is determined by cryo-electron microscopy.

[0174] A seventh aspect of the present invention provides a method for selecting a variant of a parent heterotrimeric Gα subunit, wherein the variant can bind to a GPCR in the absence of the beta and gamma subunits of the parent heterotrimeric G protein, and the method comprises (a) providing one or more variants of a parent heterotrimeric Gα subunit in the absence of the beta and gamma subunits of the parent heterotrimeric G protein, (b) providing a GPCR, and (c) determining whether the aforementioned or each of the variant Gα subunits can bind to a GPCR, and selecting a variant that can bind to a GPCR.

[0175] The mutant Gα subunits, methods for producing them, and preferences for GPCRs include those described above in relation to the first aspect of the present invention. Thus, the mutants comprise one or more mutations selected from deletions, insertions, and substitutions. Typically, the mutant Gα subunit lacks at least one helix in the helical domain. Conveniently, the GPCRs have increased stability in a particular conformation under denaturing conditions compared to the stability of their parent GPCR in the same particular conformation under denaturing conditions.

[0176] A method for evaluating the binding of mutant Gα subunits to GPCRs is also described above in relation to the first aspect of the present invention.

[0177] Step (c) preferably includes determining whether the aforementioned or each of the Gα subunits can functionally bind to (or "conjugate") a GPCR, and selecting a variant that can bind to a GPCR.

[0178] Conveniently, step (c) may include determining whether the aforementioned or each of the variant Gα subunits increases the affinity of the GPCR to an agonist upon binding to the GPCR, or whether the aforementioned or each of the Gα subunits is activated upon binding to the GPCR. Alternatively, step (c) may include determining whether the aforementioned or each of the variant Gα subunits decreases the affinity of the GPCR to an antagonist upon binding to the GPCR, or whether the aforementioned or each of the Gα subunits is activated upon binding to the GPCR.

[0179] Step (c) may include, as described above in relation to the first aspect of the present invention, one or more assays for evaluating whether the mutant Gα subunit function functionally binds or couples to a GPCR, namely (i) an agonist affinity shift assay, (ii) a thermal stability assay, (iii) a fluorescence detection size exclusion chromatography (FSEC), (iv) a fluorescence-based saturated binding analysis, and (v) a size exclusion chromatography (SEC).

[0180] The inventors have found that some mutant Gα subunits of the present invention stabilize GPCRs in specific conformations, and it is understood that it may be desirable to select such mutants. Accordingly, a method of a fifth aspect of the present invention may further include determining whether the aforementioned or each of the mutant Gα subunits can stabilize a specific conformation of the GPCR (e.g., an agonist conformation) upon binding to the GPCR, and selecting such mutants that can do so. Preferred methods for testing the stability of a specific conformation are well known in the art and include those described above and those described in WO2008 / 114020. Briefly, a complex of the mutant Gα subunit and the GPCR may be subjected to denaturing conditions (in the presence or absence of a ligand), and the extent to which the GPCR in the complex can bind to the ligand after being subjected to denaturing conditions is evaluated.

[0181] In one embodiment, prior to step (c), the GPCR is exposed to a drug that can stabilize a particular three-dimensional structure. Suitable drugs include those known in the art, ligands (e.g., agonists) or other drugs as described above (e.g., antibodies, nanobodies, or other drugs whose function mimics that of a natural agonist).

[0182] Mutant Gα subunits and / or GPCRs are conveniently provided in a solubilized form in which they maintain structural integrity and are functional (e.g., capable of binding to their respective binding partners, such as GPCRs in the case of Gα, or ligands or G proteins in the case of GPCRs). A suitable solubilization system, such as a suitable detergent (or other amphiphilic agent) and a buffer system, is used, which can be selected by those skilled in the art to be effective for a particular protein. Typical detergents that may be used include, for example, dodecyl maltoside (DDM) or CHAPS or octyl glucoside (OG) or many others. It may be convenient to include cholesterol hemisuccinate or cholesterol itself or other compounds such as heptane-1,2,3-triol. The presence of glycerol or proline or betaine may be useful.

[0183] Typically, mutant Gα subunits and / or GPCRs are provided in crude extracts (e.g., membrane fractions derived from host cells in which they are expressed, such as E. coli or mammalian cells). They may be provided in a form containing typically at least 75%, more typically at least 80%, 85%, 90%, 95%, 98%, or 99% of the proteins present in the sample. Needless to say, they are typically associated with detergent molecules and / or lipid molecules, as they are solubilized as typically discussed above.

[0184] In one embodiment, a method of the seventh aspect of the present invention further includes determining whether a mutant Gα subunit has increased stability under denatured conditions compared to its parental Gα subunit, and / or whether, when expressed intracellularly, the mutant Gα subunit is expressed at a higher level than its parental Gα subunit. The method is preferable in selecting such mutants because they are more experimentally manageable. Preferred methods for evaluating stability and expression levels are as described above and in the examples. It should be noted that some mutant Gα subunits are expressed at lower levels and / or less stable than their parental Gα subunits under denatured conditions, but when complexed with a GPCR, the complex is more stable than the corresponding complex containing the parental Gα subunit under denatured conditions. Therefore, it is understood that determining whether a mutant Gα subunit has increased stability under denatured conditions compared to its parental Gα subunit may include determining the stability of the mutant Gα subunit when it is complexed with a GPCR.

[0185] An eighth aspect of the present invention provides a method for producing a variant of a parent heterotrimeric Gα subunit, wherein the variant can be coupled to a GPCR in the absence of the beta and gamma subunits of the parent heterotrimeric G protein, the method comprising (a) performing the method of the seventh aspect of the present invention, (b) identifying the location(s) of a mutation(s) (e.g., deletion, insertion, and / or substitution) in a mutant Gα subunit(s) selected for increased stability, and (c) synthesizing a mutant Gα subunit containing a mutation(s) (e.g., deletion, insertion, and / or substitution) in one or more of the identified locations.

[0186] The present invention provides a mutant Gα subunit that can be obtained by a method according to an eighth aspect of the present invention.

[0187] As shown in the examples, the inventors have found that when the mutant Gα subunit of the present invention is bound to a GPCR, the mutant Gα subunit can stabilize a specific conformation of the GPCR. Accordingly, a ninth aspect of the present invention provides a method for stabilizing a GPCR in a specific conformation, comprising (a) providing a mutant Gα subunit and a target GPCR according to a first or second aspect of the present invention, and (b) forming a complex of the mutant Gα subunit and the GPCR, wherein the GPCR is stabilized in a specific conformation.

[0188] The preference for mutant Gα subunits includes those described above in relation to the first or second aspects of the present invention. The target GPCR may be any suitable GPCR, preferably of the same GPCR class or family as a GPCR known to bind to a Gα subunit, most preferably one known to bind to a Gα subunit. Examples of suitable GPCRs are as described above.

[0189] Conveniently, the mutant Gα subunit can be immobilized on a solid support.

[0190] Typically, the target GPCR is provided as a solution containing the GPCR in multiple conformational states. Therefore, the method may include (i) applying a solution containing the GPCR in multiple conformational states to a solid support containing one or more immobilized mutant Gα subunits; (ii) forming a complex of one or more mutant Gα subunits and the GPCR; and (iii) removing weakly bound or unbound molecules such that the GPCR is captured in a specific conformational state. Thus, it is understood that the method of the ninth aspect of the present invention can be considered a method for capturing a GPCR in a specific conformational state.

[0191] In one embodiment, the method further includes purifying the complex.

[0192] A tenth aspect of the present invention provides a method for selecting a GPCR having increased stability, comprising: (a) providing one or more variants of a parent GPCR and a variant Gα subunit according to a first or second aspect of the present invention; (b) selecting a ligand such that the ligand binds to the parent GPCR when the GPCR is present in a particular conformation; (c) determining whether the aforementioned or each of the variant GPCRs has increased stability with respect to binding to the selected ligand or the variant Gα subunit compared to the stability of the parent GPCR with respect to binding to the selected ligand or the variant Gα subunit; and (d) selecting a variant that has increased stability with respect to binding to the selected ligand or the variant Gα subunit compared to the parent GPCR, such that the particular conformation in which the GPCR exists in step (c) corresponds to a class of ligand selected in step (b).

[0193] Mutants of parental GPCRs can be produced by any preferred method and provided in any preferred form. For example, a series of specific mutants of a parental protein can be created in which each amino acid residue in all or part of the parental protein is independently changed to another amino acid residue. For example, it may be advantageous to produce mutations in those parts of a protein that are expected to become transmembrane. Therefore, conveniently, the portion of the GPCR to be mutated can be modeled. Similarly, computer programs that model the transmembrane region of GPCRs based on hydrophobicity are available (Kyle & Dolittle (1982) J.Mol.Biol.157,105-132), and such models can be used when selecting the portion of the protein to be mutated. Conventional site-directed mutagenesis may be used, or polymerase chain reaction-based procedures well known in the art may be used. While ribosome display can be used when selecting mutant proteins, it is less desirable.

[0194] Typically, each selected amino acid is substituted with Ala (i.e., Ala scanning mutagenesis), but this may be substituted with any other amino acid. If the selected amino acid is Ala, it may be conveniently substituted with Leu. Alternatively, the amino acid may be substituted with Gly (i.e., Gly scanning mutagenesis), which may allow for tighter packing of adjacent helices that lock the protein into a specific three-dimensional structure. If the selected amino acid is Gly, it may be conveniently substituted with Ala.

[0195] Alternatively, mutants may be produced by random mutagenesis procedures, and these may be of the whole protein or a selected portion thereof. Random mutagenesis procedures are well known in the art.

[0196] Conveniently, mutant GPCRs have one substituted amino acid compared to the parent protein (i.e., it is mutated at one amino acid position). In this way, the contribution of a single amino acid substitution to stability can be evaluated. However, mutant GPCRs assayed for stability may have one or more substituted amino acids compared to the parent protein, such as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 substitutions.

[0197] The parental GPCR does not need to be a naturally occurring protein. Conveniently, it may be an engineered version that can be expressed in a suitable host organism such as Escherichia coli. The parental GPCR may be a cleaved form of a naturally occurring protein (cleaved at either or both ends), or it may be a fusion of a naturally occurring protein or a fragment thereof. Alternatively, or in addition, the parental GPCR may be modified to improve, for example, solubility, proteolytic stability compared to a naturally occurring GPCR (e.g., by cleavage, loop deletion, glycosylation site mutation, or mutation in a reactive amino acid side chain such as cysteine). In any case, the parental GPCR is a protein that can bind to a selected ligand, which is a ligand known to bind to a naturally occurring GPCR. Conveniently, the parental GPCR may, with appropriate ligand addition, affect one or more of the downstream activities that are generally known to be affected by G protein activation. However, it is understood that the stability of the mutant should be compared to the parent so that the increase in stability can be assessed.

[0198] Typically, a particular three-dimensional structure is an agonist structure, and therefore, the selected ligand is an agonist. Examples of agonist ligands for a given GPCR are known in the art and include those described above and in the examples.

[0199] Considering that GPCRs are stabilized when bound to a mutant Gα subunit, it is understood that a specific conformation (e.g., an agonist conformation) is a conformation that possesses the conformational properties of G protein binding. For example, the conformation may be such that the cytoplasmic terminal of transmembrane helix 6 of the GPCR is moved more than 10 Å away from the receptor core, e.g., at least 11 Å, 12 Å, 13 Å, 14 Å, 15 Å, or 16 Å.

[0200] The mutant Gα subunits and / or mutant GPCRs are conveniently provided in a solubilized form that maintains their structural integrity, for example, in the functional form described above in relation to a seventh aspect of the present invention. However, it is understood that the mutant GPCRs are provided in a membrane-containing composition (i.e., present in a lipid membrane), come into contact with a selected ligand and mutant Gα subunit, and the membrane can then be solubilized, for example, with a detergent.

[0201] Once a ligand is selected, it is determined whether the aforementioned or each mutant GPCR has increased stability to binding to the selected ligand or the mutant Gα subunit compared to the parent GPCR's binding to that ligand or mutant Gα subunit. This step (c) is understood to be the step of determining whether the aforementioned or each mutant GPCR has increased stability (compared to its parent) with respect to a specific conformation determined by the selected ligand. Thus, the mutant GPCR has increased stability to binding to the selected ligand as measured by ligand binding or while bound to the mutant Gα subunit, or to binding to the mutant Gα subunit as measured by mutant Gα subunit binding or while bound to the selected ligand. It is particularly preferable to evaluate the increased stability while bound to the selected ligand, as will be discussed below.

[0202] Increased stability is conveniently measured by the extended lifetime of mutants under forced conditions that can induce instability (e.g., heat, harsh detergent conditions, chaotropic agents, etc.). Instability under forced conditions is typically determined by measuring structural denaturation or loss. As discussed below, this can manifest as a loss of ligand-binding ability, or a loss of Gα subunit-binding ability, or a loss of secondary or tertiary structural indicators.

[0203] When the increased binding to a selected ligand is used to determine stability, there are different assay formats that can be used to determine the stability of mutant GPCRs.

[0204] In one embodiment, the mutant GPCR may be brought into contact with a ligand before being subjected to a procedure to determine the mutant's stability (the mutant GPCR and ligand remain in contact throughout the test period). Therefore, for example, if this method is used to select a mutant GPCR that binds to a ligand in a single conformation and has improved thermal stability, the receptor can be brought into contact with the ligand before heating, and its thermal stability can then be expressed using the amount of ligand bound to the receptor after heating compared to the parent receptor. This provides a measure of the amount of GPCR that retains ligand-binding ability after exposure to denaturing conditions (e.g., heat), which, in other words, is an indicator of stability.

[0205] In an alternative (less preferred) embodiment, the mutant GPCR is subjected to a procedure in which the stability of the mutant is determined before contact with the ligand. For example, if this method is used to select a mutant membrane receptor that binds to a ligand in a single conformation and has improved thermal stability, the receptor is first heated before contact with the ligand, and then the amount of ligand bound to the receptor can be used to express the thermal stability. In this case as well, this provides a measure of the amount of GPCR that retains ligand-binding ability after exposure to denaturing conditions.

[0206] To determine increased stability using binding to the mutant Gα subunit, it is understood that the mutant GPCR and mutant Gα subunit may be brought into contact with the ligand before being subjected to the procedure for determining the mutant's stability (the mutant GPCR and ligand remain in contact throughout the test period).

[0207] In all embodiments, it is understood that the stability of the mutants is compared by referencing the parent molecule under the same conditions.

[0208] In all these embodiments, it is understood that the selected mutant has increased stability when present in a particular three-dimensional structure compared to the parent protein. An example of the tenth method of the present invention is provided in Example 4.

[0209] Preferably, mutant GPCRs are selected that have increased stability under denaturation conditions such as heat, detergent, chaotropic agents, and extreme pH.

[0210] Methods for evaluating stability under denaturation conditions include those described above in relation to the first aspect of the present invention, and are also described in WO2008 / 114020.

[0211] Conveniently, when ligand or mutant Gα subunit binding is used to assay a GPCR (i.e., to determine whether it is in a non-denatured state), the ligand or mutant Gα subunit is detected by labeling, for example, by radiolabeling or fluorescent labeling.

[0212] From the above, it is understood that the present invention includes a method for selecting mutant GPCRs having increased thermal stability, comprising: (a) providing one or more mutants of a parent GPCR, wherein one or more mutants are present in a membrane-containing composition; (b) contacting one or more mutants with a selected ligand (e.g., an agonist) that binds to the parent GPCR and a mutant Gα subunit according to a first or second aspect of the present invention; (c) solubilizing the membrane-containing composition; (d) determining whether the aforementioned or each of the mutants of the parent GPCR have increased thermal stability in the presence of the ligand (e.g., an agonist) by measuring the ability of the mutant GPCR to bind to the selected ligand (e.g., an agonist) or mutant Gα subunit at a specific temperature and after a specific time compared to the parent GPCR; and (f) selecting a mutant GPCR that binds to more of the selected ligand (e.g., an agonist) than the parent GPCR under the same conditions at the specific temperature and after the specific time. In step (d), the fixation period at the specific temperature is typically used to measure the ability of the mutant GPCR to bind to the selected ligand (e.g., agonist) or mutant Gα subunit. In step (d), a temperature and time are typically selected such that the binding of the selected ligand (e.g., agonist) or mutant Gα subunit by the parent GPCR is reduced by 50% during the fixation period at that temperature (a "quasi" Tm indicating that 50% of the receptor is inactivated).

[0213] It is understood that it may be desirable to identify further agents that stabilize GPCR / Gα subunit complexes according to a fourth aspect of the present invention. Accordingly, the present invention also provides a method for identifying one or more agents that increase the stability of a complex according to a fourth aspect of the present invention under denaturing conditions, comprising: providing a complex according to a fourth aspect of the present invention; contacting the complex with a candidate agent; and determining the effect of the candidate agent on the stability of the complex according to a fourth aspect of the present invention under denaturing conditions. The candidate agent may include a nucleotide, a phosphate analog, or a magnesium ion.

[0214] An eleventh aspect of the present invention provides a method for preparing mutant GPCRs, comprising: (a) performing the method of the tenth aspect of the present invention; (b) identifying the position(s) of a mutant amino acid residue(s) in a mutant GPCR(s) selected for increased stability; and (c) synthesizing a mutant GPCR containing one or more substituted amino acids at the identified positions.

[0215] The present invention provides mutant GPCRs that can be obtained by the method of an eleventh aspect of the present invention.

[0216] MEGA domains can also be useful tools for fragment library screening using both structural and unstructural methods. Accordingly, a twelfth aspect of the present invention provides a method for identifying a binding partner of a GPCR, comprising: a) providing a complex according to a fourth aspect of the present invention; b) providing one or more test compounds; c) determining whether the aforementioned or each of the test compounds bind to the complex; and d) isolating one or more test compounds that bind to the complex.

[0217] The preferences for composites according to the fourth aspect of the present invention include those described above.

[0218] There is strong evidence suggesting that once a ternary G protein-GPCR complex is formed, the ligand can be removed from the binding pocket without causing the complex to dissociate. Hydroxylamine treatment of a nucleotide-free rhodopsin-transducin complex induces hydrolysis of the Schiff base bond between rhodopsin and retinal, resulting in the release of retinal oxime. 14 Therefore, in one embodiment, the complex provided in step (a) does not contain a GPCR ligand. However, in other embodiments, it is understood that binding a ligand may be useful, for example, to identify other binding partners rather than to modulate ligand binding.

[0219] In one embodiment, the complex may be provided in a whole cell preparation or cell membrane fragment, solubilized in a detergent, or incorporated into a lipid monolayer, lipid bilayer, bead-bound lipid particles, another solid-supported lipid layer, or proteoliposome.

[0220] Those familiar with the present invention will recognize that high-throughput membrane complex screening is facilitated by immobilizing membranes on arrays or otherwise multiplexable beads or surfaces. Typically, membrane complexes are deposited on surfaces together with lipids in the form of proteoliposomes. The detergent-solubilized form of these complexes can be a partially or highly pure preparation. Purification, made possible by improved stability and optimization of solubilization conditions, has the advantage of removing, for example, exogenous "sticky" antigens to which phages can adhere, as well as other cell surface materials such as lipids and carbohydrates.

[0221] It is understood that the GPCR and / or mutant Gα subunits of this complex can be manipulated to include a molecular tag at the C-terminus or N-terminus, as is well known in the art. The tag may be one of the following: FLAG tag, His tag, c-Myc tag, DDDDK tag, HSV tag, Halo tag, or biotin tag. Such tags can be used to facilitate phage-based selection protocols in solution, and can also be used to impart binding to a solid support.

[0222] The increased stability of mutant Gα subunits and / or mutant GPCRs in various detergents, solubilizing buffers, and additives is particularly useful for their immobilization on solid surfaces. Therefore, in one embodiment, the complex is immobilized on a solid support. Various supports are known in the art and include, for example, beads, columns, slides, tips, or plates. Immobilization may be by covalent or non-covalent interactions.

[0223] Various formats for screening for binding partners of GPCRs are provided in WO2009 / 081136, which is incorporated herein by reference, and any such format may be used.

[0224] The test compound may be provided as a biological sample. Specifically, the sample may be any suitable sample obtained from an individual. For example, the sample may be a fluid sample such as blood, serum, plasma, or cerebrospinal fluid. Alternatively, the sample may be a tissue or cell extract.

[0225] In one embodiment, one or more test compounds are polypeptides. For example, the test compound is known to bind to a particular GPCR or Gα subunit, but may be a specific type of polypeptide if the identification of a structure-specific polypeptide is desired. Alternatively, the polypeptide may be a candidate therapeutic molecule, such as antikalin (Skerra J Biotechnol (2001) 74(4):257-75).

[0226] In one embodiment, one or more test compounds are peptides.

[0227] In one embodiment, one or more test compounds are affibody, peptide mimetic, nucleic acid, peptide nucleic acid (PNA) or aptamer, or lipid or carbohydrate.

[0228] In one embodiment, one or more test compounds are binding proteins based on a modular framework, such as ankyrin repeat proteins, armadillo repeat proteins, leucine-rich proteins, tetraliopeptide repeat proteins, or designed ankyrin repeat proteins (DARPin), or proteins based on lipocalin or fibronectin domains, or affilin scaffolds based on either human gamma crystals or human ubiquitin.

[0229] In one embodiment, one or more test compounds are small molecules, for example, molecules with less than 5000 daltons, or one or more test compounds are natural products.

[0230] In one embodiment, one or more test compounds are antibodies. For example, the test compounds may be antibodies produced against a mutant Gα subunit, a GPCR, or a mutant Gα subunit / GPCR complex.

[0231] As used herein, the term “antibody” includes, but is not limited to, polyclonal, monoclonal, chimeric, single-stranded, Fab fragments, and fragments produced by Fab expression libraries. Such fragments include fragments of whole antibodies, Fv, F(ab'), and F(ab')2 fragments that retain their binding activity to target substances, as well as genetically engineered derivatives of antibodies, such as single-stranded antibodies (scFv), fusion proteins, domain antibodies (dAb), and diabodies. For example, it is understood that recombinant DNA techniques may be used to produce further antibodies or chimeric molecules that retain the binding specificity of the original antibody. Such techniques may include fusing DNA encoding the immunoglobulin variable region or complementarity-determining region (CDR) of an antibody to the constant region or constant region and framework region of a different immunoglobulin, as described, for example, in EP-A-184187, GB2188638A, or EP-A-239400. Furthermore, the hybridomas or other cells that produce antibodies may be exposed to genetic mutations or other changes that may or may not alter the binding specificity of the produced antibodies. Therefore, since antibodies can be modified in several ways, the term “antibody” should be interpreted to encompass any particular binding member or substance having a binding domain with the desired specificity. Thus, this term includes antibody fragments, antibody derivatives, functional equivalents, and homologs, whether natural or entirely or partially synthetic, containing any polypeptide with an immunoglobulin-binding domain. Therefore, it also includes chimeric molecules containing an immunoglobulin-binding domain, or equivalents fused to another polypeptide. Furthermore, antibodies and their fragments may be human or humanized antibodies, as is well known in the art.

[0232] Antibodies against mutant Gα subunits, GPCRs, mutant Gα subunit / GPCR complexes, or fragments or fusions thereof can be produced using various procedures known in the art. For example, this includes both in vivo and in vitro immunization.

[0233] In some cases, high-throughput screening of test compounds is preferred, and it is understood that this method may be used as a “library screening” method, a term well known to those skilled in the art. Thus, the test compound may be a library of test compounds. For example, this library may be, for instance, a peptide or protein library produced by ribosome display, or an antibody library prepared in vivo, ex vivo, or in vitro. Methodologies for preparing and screening such libraries are known in the art. Conveniently, this method may be used for fragment library screening, for example, by biophysical methods or crystal immersion techniques.

[0234] The present invention includes a screening method for identifying drugs or lead compounds for use in the treatment of a disease or condition. It is understood that a screening assay capable of high-throughput operation is particularly preferred.

[0235] In the methods described herein, which may be drug screening methods, it is understood that the test compound, a term familiar to those skilled in the art, may be a drug-like compound or a lead compound for the development of a drug-like compound. Accordingly, in one embodiment, the method further includes modifying a test compound that has been shown to bind to a complex, and determining whether the modified test compound binds to a complex.

[0236] For example, various methods, including enzyme-linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast 2-hybrid technology, and phage displays, may be used to determine the binding between the mutant Gα subunit / GPCR complex and the test compound. Other methods for detecting the binding between the test compound and the complex include ultrafiltration by ion spray mass spectrometry / HPLC or other physical and analytical methods. For example, when the binding of two fluorescently labeled entities is in close proximity to each other, the fluorescence energy resonance transfer (FRET) method, which can be measured by measuring the interaction of the fluorescent labels, may be used. Further methods are described in WO2009 / 081136, which is incorporated herein by reference.

[0237] The ability to generate high-affinity specific binding partners for mutant Gα / GPCR complexes promotes the production of therapeutic binding partners. Therefore, it is understood that, in addition to establishing binding to the complex, it is also desirable to determine the functional effect of the binding partner on the complex. Accordingly, in one embodiment of the method, the method further includes determining whether the binding partner affects the function of the complex to which it binds, and isolating test compounds that affect the function of the complex.

[0238] For example, in one embodiment, it is determined whether the binding partner alters the binding of the GPCR in the complex to its ligand. For example, the binding partner may be a positive or negative allosteric modulator.

[0239] In another embodiment, it is determined whether the binding partner modulates the activation of a GPCR or a mutant Gα subunit. For example, the binding partner may be a GPCR ligand that is a positive or negative allosteric modulator. In this assay, the complex is expressed in whole cells, e.g., mammalian or insect cells, where it is permitted to be coupled to a well-known GPCR signaling pathway (Eglen R. MFunctional G protein-coupled receptor assays for primary and secondary screening. Comb Chem High Throughput Screen. 2005 Jun;8(4):311-8), and signaling through such pathways is evaluated. Further details of such assays are provided above in relation to the first aspect of the present invention.

[0240] In one embodiment, the method further comprises (i) determining whether the aforementioned or each test compound binds to a different complex according to a fourth aspect of the present invention, and (ii) isolating the aforementioned or each test compound that does not bind to a different complex according to a fourth aspect of the present invention.

[0241] Thus, it is understood that this method may be used to identify binding partners that modulate the activity of a particular GPCR-Gα subunit pair but do not modulate both the receptor and the Gα subunit in other signaling cascades. A different complex means a complex containing a different Gα subunit (e.g., of a different class or isoform) and / or a different GPCR than those contained in the complex provided in step (a) of this method. For example, a different complex may contain a Gα subunit of a different class and / or a different GPCR than the Gα subunit in the complex of step (a) of the 12th aspect of the present invention.

[0242] Examples of specific interfaces to which binding partners can bind include Arg102 (3.50), Ala105 (3.53), Ile106 (3.54), Arg107 (3.55), Pro109, Leu110, Arg111, Tyr112, Ile200 (5.61), Ala203 (5.64), Q207 (5.67), Leu208 (5.68), Q210 (5.70), Lys227 (6.29), Ala231 (6.33), Leu235 (6.37), Arg291 (7.56), Ile292 (loop between H7 and H8), Arg293 (H8), and Arg296 (H8) of the human adenosine A2a receptor. (Numbers in parentheses are Ballesteros-Weinstein numbers), as well as human Gs strains His41(s1.2), Asp215(s2s3.1), Val217(s3.1), Phe376(h5.8), Cys379(h5.11), Arg380(h5.12), Asp381(h513), Ile383(h5.15), Gln384(h5.16), Arg385(h5.17), His387(h5.19), Leu388(h5.20), Gln390(h5.22), Tyr391(h5.23), Glu392(h5.24), Leu393(h5.25), and Leu394(h5.26). The corresponding residues in other GPCRs and Gα subunits can be determined using the BW and CGN systems.

[0243] A thirteenth aspect of the present invention provides a method for identifying a binding partner of a Gα subunit, comprising: a) providing a mutant Gα subunit according to a first or second aspect of the present invention; b) providing one or more test compounds; c) determining whether the aforementioned or each of the test compounds binds to the mutant Gα subunit; and d) isolating one or more test compounds that bind to the mutant Gα subunit.

[0244] The preference for mutant Gα subunits includes those described above in relation to the first aspect of the present invention, and the preference for test compounds and assay formats / steps of this method includes those described above in relation to the twelfth aspect of the present invention.

[0245] A fourteenth aspect of the present invention provides an antibody that selectively binds to a mutant Gα subunit according to the first or second aspect of the present invention or to a complex according to the fourth aspect of the present invention. This also includes a polynucleotide encoding such an antibody.

[0246] Examples of antibodies include those described above in relation to the twelfth aspect of the present invention. Antibodies may be monoclonal or polyclonal antibodies. Antibodies may be antibody fragments such as ScFv or any of the above. Methods for producing antibodies are well known in the art. For example, in the production of polyclonal antibodies, various suitable host animals (e.g., rabbits, goats, chickens, mice, or other mammals) can be immunized with immunogen by one or more injections. Polyclonal antibody molecules directed against immunogenic proteins can be isolated from mammals (e.g., from serum or egg yolk) and further purified by well-known techniques such as affinity chromatography using protein A or protein G, which primarily provides the IgG fraction of the immunoserum. Monoclonal antibodies are Kohler They can be prepared using hybridoma methods, such as those described in Milstein, Nature, 256:495 (1975). In hybridoma methods, mice, hamsters, or other suitable host animals are typically immunized with an immunizer to produce antibodies that specifically bind to the immunizer, or to induce lymphocytes capable of producing such antibodies.

[0247] It is understood that antibodies against this complex may help stabilize the complex under denaturing conditions. Furthermore, antibodies against this complex may have therapeutic value because they are more likely to activate the receptor than antibodies produced only against GPCR / ligand complexes.

[0248] A fifteenth aspect of the present invention provides a method for evaluating the binding between a G protein and a GPCR, comprising providing a mutant Gα subunit according to a first or second aspect of the present invention and a GPCR, and evaluating the binding between the mutant Gα subunit and the GPCR.

[0249] The preference for mutant Gα subunits includes those described above in relation to the first or second aspects of the present invention. Any suitable GPCR can be used as described above.

[0250] Methods for evaluating the binding between mutant Gα subunits and GPCRs are well known in the art and include the methods described above, for example, the methods for evaluating protein binding described in the first and twelfth aspects of the present invention.

[0251] In one embodiment, the method includes evaluating the functional binding or coupling between a mutant Gα subunit and a GPCR. In this case as well, preferred methods for doing so are described above.

[0252] Conveniently, one or both of the mutant Gα and GPCR are detectably labeled, for example, fluorescently labeled. FRET can be used.

[0253] In one embodiment, the mutant Gα subunit and GPCR are provided intracellularly, and optionally, the method is performed in vivo or in vitro.

[0254] A sixteenth aspect of the present invention provides a method for evaluating the effect of a drug on the binding between a G protein and a GPCR, comprising: providing a mutant Gα subunit according to a first or second aspect of the present invention; and evaluating the effect of a drug on the coupling between the mutant Gα subunit and a GPCR.

[0255] The assay preferences include those described above in relation to the 15th aspect of the present invention. As with the 15th aspect of the present invention, the binding to be evaluated may be a functional binding or a conjugation. It is understood that this method may be useful in identifying agents that positively or negatively affect the interaction between Gα subunits and GPCRs. For example, a decrease in the signal generated from the assay would indicate an agent that inhibits complex formation. Generally, this method is performed in the presence and absence of the agent so that the effect of the agent on the interaction can be evaluated.

[0256] A 17th aspect of the present invention provides a method for selecting or designing one or more binding partners for a GPCR, G protein, or GPCR-G protein complex, comprising: (a) providing a three-dimensional structural representation of a mutant Gα subunit according to a first or second aspect of the present invention or a complex according to a fourth aspect of the present invention; and (b) using molecular modeling means for selecting or designing one or more binding partners for a GPCR, G protein, or GPCR-G protein complex, wherein the three-dimensional structural representation of at least a portion of the mutant Gα subunit or complex is compared with the three-dimensional structural representations of one or more candidate binding partners, and one or more binding partners predicted to interact with the GPCR, G protein, or GPCR-G protein complex are selected.

[0257] "Three-dimensional structural representations" include computer-generated or physical representations. Typically, these representations are computer-generated. Computer representations can be generated or displayed by commercially available software programs. Examples of such software programs, incorporated herein by reference, include, but are not limited to, QUANTA (Accelrys.COPYRIGHT.2001,2002), O (Jones et al., Acta Crystallogr.A47,pp.110-119(1991)), and RIBBONS (Carson, J.Appl.Crystallogr.,24,pp.9589-961(1991)).

[0258] "Binding partner" means any molecule that binds to a GPCR, G protein, or GPCR-G protein complex. Preferably, the molecule selectively binds to a GPCR, G protein, or GPCR-G protein complex. For example, the binding partner has a K value at least 5 or 10 times lower, preferably 100 or 500 times lower, than at least one other GPCR, G protein, or GPCR-G protein complex. d It is preferable that it has a value (dissociation constant) (i.e., has a higher affinity).

[0259] Binding partners include small molecules (e.g., those with molecular weights less than 5000 daltons, e.g., 4000, 3000, 2000, 1000, or less than 500 daltons) that bind to GPCRs, G proteins, or GPCR-G protein complexes; polypeptides; anticharin; peptides; antibodies; chimeric antibodies; single-chain antibodies; aptamers; dalpin; Fab, F(ab')2, Fv, ScFv, or dAb antibody fragments; small molecules; natural products; affibodies; peptide mimetic drugs; nucleic acids; peptide nucleic acid molecules; lipids; carbohydrates; proteins based on a modular framework, e.g., ankyrin repeats. It may be any of the following: a protein, an armadillo repeat protein, a leucine-rich protein, a tetraliopeptide repeat protein, or an engineered ankyrin repeat protein (DARPin); a lipocalin or fibronectin domain-based protein; an affilin scaffold based on either human gamma crystallin or human ubiquitin; a G protein; an RGS protein; an arrestin; a GPCR kinase; a receptor tyrosine kinase; a RAMP; an NSF; a GPCR; an NMDA receptor subunit NR1 or NR2a; a calcion; or any of these fragments or derivatives.

[0260] Methods for selecting or designing binding partners and for using molecular modeling are well known in the art and are described, for example, in WO2008 / 068534. For example, molecular modeling techniques that can be used in accordance with the present invention include, for example, NCCohen et al., “Molecular Modeling Software and Methods for Medicinal Chemistry, J.Med.Chem., 33, pp.883-894 (1990)” and MANavia and MAMurcko, “The Use of Structural See also “Information in Drug Design”, Current Opinions in Structural Biology, 2, pp.202-210 (1992), LMBalbes et al., “A Perspective of Modern Methods in Computer-Aided Drug Design”, in Reviews in Computational Chemistry, Vol.5, KBLipkowitz and DBBoyd, Eds., VCH, New York, pp.337-380 (1994), and WCGuida, “Software For Structure-Based Drug Design”, Curr. Opin. Struct. Biology, 4, pp.777-781 (1994).

[0261] The design of binding partners can generally be achieved by either stepwise assembly of binding partners or de novo synthesis of binding partners. In addition, other computer-based methods for selecting binding partners are available. Therefore, it is understood that this method can be used for fragment screening, biophysical screening methods, and screening of DNA coding libraries.

[0262] An eighteenth aspect of the present invention provides a method for analyzing the interaction between one or more binding partners and a GPCR, G protein, or GPCR-G protein complex, comprising: (a) providing a three-dimensional structural representation of a mutant Gα subunit according to a first or second aspect of the present invention or a complex according to a fourth aspect of the present invention; (b) providing a three-dimensional structural representation of one or more binding partners that fit the structure of the mutant Gα subunit or complex or a part of the structure said; and (c) fitting one or more binding partners to the structure said.

[0263] "Fitting" means determining, by automated or semi-automatic means, the interaction between one or more atoms of a candidate binding partner and at least one atom of the GPCR, G protein, or GPCR-G protein complex structure of the present invention, and calculating the degree to which such interaction is stable. Interactions include attractive and repulsive forces resulting from charge, stericity, lipophilicity, and other considerations. These types of charge and steric interactions can be modeled by computer. One example of such calculation would be via a force field such as Amber (Cornell et al. A Second Generation Force Field for the Simulation of Proteins, Nucleic Acids, and Organic Molecules, Journal of the American Chemical Society, (1995), 117(19), 5179-97), which assigns partial charges to atoms on the protein and binding partner and uses Coulomb potentials to evaluate the electrostatic interaction energy between the protein atom and the binding partner atom. The Amber force field would assign van der Waals energy terms to evaluate the attractive and repulsive steric interactions between the two atoms. Lipophilic interactions can be modeled using various means. Other methods for evaluating the hydrophobic contribution to ligand binding are available and will be known to those skilled in the art. Other methods for evaluating interactions are available and will be known to those skilled in the art who design the molecules described above. Various computer-based methods for adaptation are known in the art and are described in WO2008 / 068534.

[0264] In one embodiment of the 17th or 18th aspect of the present invention, a three-dimensional structural representation of a mutant Gα subunit according to the first or second aspect of the present invention or a complex according to the fourth aspect of the present invention is obtained by providing a mutant Gα subunit according to the first or second aspect of the present invention or a complex according to the fourth aspect of the present invention, and by determining the three-dimensional structure of the mutant Gα subunit or complex.

[0265] In one embodiment of the 17th or 18th aspect of the present invention, the method may further include modifying the structural representation of one or more binding partners to increase or decrease their interactions with GPCRs, G proteins, or GPCR-G protein complexes.

[0266] A 19th aspect of the present invention provides a pharmaceutical composition comprising a mutant Gα subunit according to a first or second aspect of the present invention, a complex according to a fourth aspect of the present invention, or an antibody according to a 14th aspect of the present invention.

[0267] The present invention also provides mutant Gα subunits according to the first or second aspect of the present invention, conjugates according to the fourth aspect of the present invention, or antibodies according to the fourteenth aspect of the present invention for use in pharmaceuticals.

[0268] It is understood that any mutant Gα subunit according to the first or second aspect of the present invention, a complex according to the fourth aspect of the present invention, or an antibody according to the fourteenth aspect of the present invention may have therapeutic value in combating diseases or conditions associated with abnormal G protein signaling (e.g., upregulatory G protein signaling). Diseases or conditions associated with abnormal G protein signaling (e.g., upregulatory G protein signaling) mean any biological or medical condition or disorder in which at least a portion of the lesion is mediated by abnormal G protein signaling (e.g., upregulatory G protein signaling). The condition may be caused by the presence of undesirable cells, or the presence of undesirable cells may be an effect of the condition. Such diseases are well known in the art and can be identified by browsing the scientific literature. An example of such a condition is cancer. Combating a disease or condition means reducing or alleviating symptoms in a patient (i.e., palliative use), preventing worsening or progression of symptoms, treating the disorder (e.g., inhibiting or eliminating the causative pathogen), or preventing the condition or disorder in a subject that is not affected.

[0269] Accordingly, the present invention also provides mutant Gα subunits according to the first or second aspect of the present invention, complexes according to the fourth aspect of the present invention, or antibodies according to the fourteenth aspect of the present invention for use in combating diseases or conditions associated with abnormal G protein signaling (e.g., upregulatory G protein signaling). Preferably, the disease or condition is cancer.

[0270] In relation to the complex according to a fourth aspect of the present invention, it is understood that this may be useful for downregulating an inappropriately high G protein response, as it can potentially be used as a high-affinity decoy receptor for mopping up excess ligands.

[0271] While the variant Gα subunit, complex, or antibody of the present invention can be administered alone, it is preferable to present it as a pharmaceutical formulation together with one or more acceptable carriers. The carrier(s) should be "acceptable" in the sense that they are compatible with the therapeutic agent and not harmful to the recipient. Typically, the carrier(s) are water or saline, sterile, and free of pyrogens.

[0272] Where appropriate, formulations may be conveniently presented in unit dosage forms and may be prepared by any of the methods well known in the art. Such methods include the step of associating an active ingredient (a drug for treating or preventing a condition characterized by undesirable cells) with a carrier constituting one or more auxiliary components. Generally, formulations are prepared by homogeneously and closely associating the active ingredient with a liquid carrier, a fine solid carrier, or both, and then, if necessary, shaping the product.

[0273] Formulations according to the present invention, suitable for oral administration, may be presented as separate units such as capsules, cachets, or tablets, each containing a predetermined amount of the active ingredient, as a powder or granules, as a solution or suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil emulsion. The active ingredient may also be presented as a bolus, lick, or paste.

[0274] A preferred unit-dose formulation contains the daily dose or unit, sub-dose, or appropriate fraction thereof of the active ingredient.

[0275] In addition to the components specifically discussed above, it should be understood that the formulations of the present invention may include other conventional agents in the art, depending on the type of formulation in question; for example, those suitable for oral administration may include flavoring agents.

[0276] The amount of the variant Gα subunit, complex, or antibody of the present invention administered to an individual is an effective amount to combat the condition of that particular individual. This amount may be determined by a physician.

[0277] Preferably, in any medical use described herein, the subject being treated is human. Alternatively, the subject may be an animal, such as livestock (e.g., a dog or a cat), a laboratory animal (e.g., a laboratory rodent, such as a mouse, rat, or rabbit), or an animal important for agriculture (i.e., livestock), such as a horse, a cow, a sheep, or a goat.

[0278] A twentieth aspect of the present invention provides a component kit comprising (i) a mutant Gα subunit according to a first or second aspect of the present invention, and (ii) a GPCR or a portion thereof that can bind to the mutant Gα subunit according to a first or second aspect of the present invention. It is understood that the present invention also comprises a component kit comprising (i) a polynucleotide encoding a mutant Gα subunit according to a first or second aspect of the present invention, and (ii) a polynucleotide encoding a GPCR or a portion thereof that can bind to the mutant Gα subunit according to a first or second aspect of the present invention.

[0279] The preferences for mutant Gα subunits, GPCRs, and encoding polynucleotides include those outlined above in relation to the first, second, third, and fourth aspects of the present invention.

[0280] Conveniently, one or both of (i) and (ii) in the parts kit are marked for detection.

[0281] In one embodiment, the kit further comprises a GPCR ligand, of which preferred examples include those described above. For example, the GPCR ligand may be a small molecule, protein, peptide, protein scaffold, nucleic acid, ion, carbohydrate, or antibody.

[0282] In further embodiments, the component kit further comprises G protein β and / or G protein γ subunits. Again, examples of suitable G protein βγ subunits are given above. For example, the kit may comprise any of the five β subunits and / or any of the twelve γ subunits. In a specific example, the kit may comprise β1 and / or γ2.

[0283] In further embodiments, the component kit further comprises a nucleotide, optionally being a guanine nucleotide such as GDP or GTP, or optionally being a xanthine nucleotide. Other possible nucleotides include those described above in relation to other aspects of the present invention (e.g., GTPγS or GppNp). [Brief explanation of the drawing]

[0284] The present invention will now be described with reference to the following drawings and embodiments.

[0285] [Figure 1] Alignment of the mini-Gs amino acid sequence with the human G-alpha sequence. The amino acid deletions and substitutions highlighted in gray were crucial for the development of the minimal GTPase domain capable of functioning in the absence of the beta and gamma subunits. N-terminal deletions, such as the helical domain deletion, were necessary for crystallization. For clarity, all numbering uses the numbers of the complete human GNASL sequence (1-394), while mini-Gs contains only 229 amino acid residues. [Figure 2] Saturation binding data for β1AR constructs. (a) The β-dissociation constant (Kd) for 3H-dihydroalprenolol (3H-DHA) binding to β1AR-WT was 5.0 ± 0.6 nM. (b) The Kd for 3H-DHA binding to β1AR-84 was 20 ± 3 nM. The data represent the mean ± standard error of three independent experiments. The curves shown are from representative experiments conducted in pairs. [Figure 3]Measurement of G protein coupling to membrane-embedded β1AR using competitive binding assays. (a) For clarity, curves representing binding reactions are shown from left to right of the graph (Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-WT + Nb80 (Ki: 5.8 ± 0.8 nM, n=2), (ii) β1AR-WT + Gs-Nb35 (Ki: 6.8 ± 0.6 nM, n=2), (iii) β1AR-WT + Gs (Ki: 17 ± 2 nM, n=2), (iv) β1AR-WT (40 ± 0 nM, n=2). (b) For clarity, the curves representing the binding reactions are shown from left to right on the graph (Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-84 + Gs-Nb35 (Ki: 16±4 nM, n=3), (ii) β1AR-84 + Nb80 (Ki: 28±1 nM, n=2), (iii) β1AR-84 + Gs (Ki: 271±54 nM, n=2), (iv) β1AR-84 (2.6±0.3 μM, n=2). (c) Experiments conducted at 20°C. For clarity, the curves representing the binding reactions are shown from left to right on the graph (the Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-84 + mini-Gs77-βγ-Nb35 (Ki: 3.6 ± 0.8 nM, n=2), (ii) β1AR-84 + mini-Gs77 (Ki: 1.9 ± 0.2 μM, n=3), (iii) β1AR-84 (Ki: 2.6 ± 0.3 μM, n=15). (d) Experiments conducted at 4°C. For clarity, the curves representing the binding reactions are shown from left to right on the graph (the Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-84 + mini-Gs77-βγ-Nb35 (Ki: 10 nM, n=2), (ii) β1AR-84 + mini-Gs77 (Ki: 117 nM, n=2), (iii) β1AR-84 (Ki: 2.1 ± 0.2 μM, n=12). [Figure 4]Crystal structure of β2AR-WT-Gs complex 10. (a) The heterotrimer Gs consists of α, β, and γ subunits and is stabilized in the GPCR-binding conformation by Nb35. (b) Only the 25 kDa GαGTPase domain from the Gs form forms a significant interaction with β1AR-WT. [Figure 5] Analysis of purified mini-Gs77 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). (1) Molecular weight marker, (2) mini-Gs77, (3) 25 ng BSA, (4) 50 ng BSA, (5) 100 ng BSA, (6) 250 ng BSA, (7) 500 ng BSA, (8) 1 μg BSA, (9) 2.5 μg BSA. Mini-Gs77 (indicated by arrows) could be partially purified with a yield of approximately 200 μg per liter of E. coli culture and a purity of approximately 10-20 percent. [Figure 6]Design of mutations to stabilize mini-Gs. (a) Structural alignment of Gαs81 (dark gray) and Arl-298 (light gray). The GαsGTPase domain aligns with Arl-2 at 1.9 Å RMSD despite sharing only 25 percent sequence identity (determined using Dali server 19). (b) Alignment between the nucleotide binding pockets of Gαs (dark gray) and Arl-2 (light gray). Mini-Gs residues (G49D, E50N, A249D, and S252D) mutated to match the corresponding residues in Arl-2 are indicated with sticks and underlines. Residues with which the mutations potentially interact are indicated with sticks. (c) Mutation to aspartate at Leu-272 located within the α3 helix enables potential interaction with the cluster of charged and polar residues (227-233) in the N-terminal region of switch II. (d) Alignment of Gαs in its GTP-binding structure (dark gray) and GPCR-binding structure (light gray). In the GPCR-binding structure, Ile-372 (α5 helix) sterically collides with Met-60 and His-64 (α1 helix), preventing tight packing of the α1 helix into the core of the GαGTPase domain. (e) The V375I mutation (modeled using the mutational function of PyMol) was designed to increase hydrophobic contact between the core of the GαGTPase domain and the α5 helix in the GPCR-binding structure. Residues interacting with Val-375 are shown as sticks, and additional contacts (less than 4.2 Å) predicted to be formed by the δ-carbon (*) of the isoleucine mutation are shown as dashed lines. These figures were generated using PyMOL (The PyMOL Molecular Graphics System, Version 1.7.4 Schrodinger, LLC). [Figure 7]A competitive binding assay of β1AR-WT using the agonist norepinephrine. This assay was performed under the same buffer conditions used for the thermal stability assay. For clarity, the curves representing the binding reactions are shown from left to right on the graph (the Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-WT + Gs-Nb35 (Ki: 0.36 ± 0.02 nM, n=2), (ii) β1AR-WT + Nb80 (Ki: 0.70 ± 0.11 nM, n=2), (iii) β1AR-WT (Ki: 158 ± 6 nM, n=2). [Figure 8] The sequence of mini-Gs393. The histidine tag (HHHHHH encoded by CACCACCATCATCACCAT) is highlighted in dark gray, the TEV protease cleavage site (ENLYFQG encoded by GAAAATCTTTATTTCCAGGGT) is highlighted in light gray, and the linker used to replace the GαAH domain is highlighted in gray (GGSGGSGG encoded by GGTGGGAGTGGCGGGAGCGGAGGT). Mutations are shown in bold and underlined. This construct was cloned into the pET15b vector using NcoI (CCATGG) and XhoI (CTCGAG) restriction sites for E. coli expression. The stop codon is also highlighted (TAATAG). [Figure 9]Validation of mini-Gs: β1AR pharmacology and mini-Gs complex, (a-c) Measurement of G protein binding to β1AR using competitive binding assays, (a) Receptor in membrane. For clarity, curves representing binding reactions are shown from left to right of the graph (Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-WT + mini-Gs393 (Ki: 4.1 ± 1.1 nM, n=2), (ii) β1AR-WT + Gs-Nb35 (Ki: 6.8 ± 0.6 nM, n=2), (iii) β1AR-WT (Ki: 40 ± 0 nM, n=2). (b) Receptor in membrane. For clarity, the curves representing the binding reactions are shown from left to right on the graph (the Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-84 + mini-Gs393 (Ki: 3.6 ± 0.0 nM, n=2), (ii) β1AR-84 + Gs-Nb35 (Ki: 16 ± 4 nM, n=2), (iii) β1AR-84 (Ki: 2.6 ± 0.3 μM, n=15). (c) Receptor solubilized in DDM. For clarity, the curves representing the binding reactions are shown from left to right in the graph (Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-84 + mini-Gs393 (Ki: 4.7 ± 0.4 nM, n=2), (ii) β1AR-84 + Gs-Nb35 (Ki: 23 ± 7 nM, n=2), (iii) β1AR-84 (Ki: 2.8 ± 0.2 μM, n=2). (d~f) Analytical gel filtration analysis of the mini-Gs complex. (d) mini-Gs393 was purified in yield of 100 mg per liter of E. coli culture (inset) and degraded by gel filtration as a single peak with a retention volume of 17.2 mL. (e) mini-Gs399 is a construct in which the N-terminal residues 6-25 are substituted and the L272D mutation is reversed, while retaining the ability to bind to Gβ1γ2. Equimolar mixtures of mini-Gs399 and Gβ1γ2 were degraded as single peaks with a retention volume of 14.6 mL, compared to 15.8 mL and 16.4 mL for Gβ1γ2 or mini-Gs399, respectively. (f) mini-Gs393 was able to bind to purified β1AR-WT in LMNG detergent.Equimolar mixtures of mini-Gs393 and β1AR-WT were resolved as dominant peaks with a retention volume of 13.2 mL, compared to 13.6 mL and 17.1 mL of β1AR-WT or mini-Gs393, respectively. [Figure 10]Verification of mini-Gs: Thermal stability and GTP responsiveness (a-b) Thermal stability of β1AR-WT complex. (a) Thermal stability in dodecyl maltoside. For clarity, the thermal stability curves are shown from left to right on the graph (apparent Tm is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-WT (Tm: 25.9±0.0℃, n=3), (ii) β1AR-WT+Nb80 (Tm: 32.0±0.0℃, n=3), (iii) β1AR-WT+mini-Gs393 (Tm: 34.1±0.5℃, n=3), (iv) β1AR-WT+Gs-Nb35 (Tm: 35.8±0.1℃, n=3). (b) Thermal stability in octyl glucoside: Unconjugated β1AR-WT could not withstand solubilization in OG detergent. For clarity, the thermal stability curves are shown from left to right on the graph (apparent Tm is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-WT + Gs-Nb35 (Tm: 13.6 ± 0.2℃, n=3), (ii) β1AR-WT + Nb80 (Tm: 14.3 ± 0.2℃, n=3), (iii) β1AR-WT + mini-Gs393 (Tm: 19.7 ± 0.5℃, n=3). (c~d) GTP-mediated dissociation of the β1AR-84 complex as measured by competitive binding assay in membrane. mini-Gs404 is the same construct as Gs393 except that the I372A and V375I mutations are reversed. (c) GTPγS was absent in this assay. For clarity, the curves representing the binding reactions are shown from left to right on the graph (Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-84 + mini-Gs393 (Ki: 3.6 ± 0.0 nM, n=3), (ii) β1AR-84 + mini-Gs404 (Ki: 18 ± 2 nM, n=2), (iii) β1AR-84 + Gs (Ki: 271 ± 54 nM, n=2), (iv) β1AR-84 (Ki: 2.6 ± 0.3 μM, n=15). (d) In the presence of 0.25 mM GTPγS in this assay.For clarity, the curves representing the binding reactions are shown from left to right on the graph (the Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-84 + mini-Gs393 (Ki: 5.2 ± 0.7 nM, n=2), (ii) β1AR-84 + mini-Gs404 (Ki: 700 ± 60 nM, n=2), (iii) β1AR-84 + Gs (Ki: 2.7 ± 0.1 μM, n=2), (iv) β1AR-84 (Ki: 3.0 ± 0.1 μM, n=2). No statistical difference was observed in the isoprenaline affinity of β1AR-WT and mini-Gs393 in the presence or absence of GTPγS. The curves shown are from representative experiments conducted in pairs. [Figure 11] Thermal stability (apparent Tm) of β1AR-WT complexes in DM or NG. (a) Thermal stability in dodecyl maltoside. For clarity, thermal stability curves are shown from left to right (apparent Tm is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-WT (Tm: 20.4±0.4℃, n=3), (ii) β1AR-WT + Nb80 (Tm: 28.6±0.3℃, n=3), (iii) β1AR-WT + mini-Gs393 (Tm: 30.5±0.4℃, n=3), (iv) β1AR-WT + Gs-Nb35 (Tm: 31.1±0.4℃, n=3). (b) Thermal stability in nonyl glucoside: Unconjugated β1AR-WT could not withstand solubilization in NG detergent. For clarity, the thermal stability curves are shown from left to right on the graph (apparent Tm is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-WT+Nb80 (Tm: 16.7±0.7℃, n=2), (ii) β1AR-WT+Gs-Nb35 (Tm: 19.0±0.2℃, n=2), (iii) β1AR-WT+mini-Gs393 (Tm: 24.7±0.4℃, n=2). The data represent the mean ± standard error of the number of independent experiments (n) indicated in the caption. The curves shown are from representative experiments conducted in pairs. [Figure 12]GTP-mediated dissociation of the β1AR-84-mini-Gs391 complex as measured by competitive binding assay. mini-Gs391 is the same construct as mini-Gs393 except that the V375II mutation is reversed. (a) Absence of GTPγS. For clarity, the curves representing the binding reaction are shown from left to right on the graph (Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also shown): (i) β1AR-84 + mini-Gs391 (Ki: 3.0 ± 0.4 nM, n=2), (ii) β1AR-84 (Ki: 2.6 ± 0.3 μM, n=15). (b) In the presence of GTPγS (0.25 mM). For clarity, the curves representing the binding reactions are shown from left to right on the graph (the Ki for isoprenaline binding is shown in parentheses, and the number of independent experiments (n) is also indicated): (i) β1AR-84 + mini-Gs391 (Ki: 4.7 ± 0.1 nM, n=2), (ii) β1AR-84 (Ki: 3.0 ± 0.1 μM, n=2). No statistical difference was observed in the isoprenaline affinity of β1AR-WT and mini-Gs391 in the presence or absence of GTPγS. The curves shown are from representative experiments conducted in pairs. [Figure 13]Competitive binding curves of β1AR in the presence of Nb80 or Gs. The affinity (IC50) of isoprenaline binding to different β1AR constructs was measured in the presence of Nb80 and Gs. (A) The adjacent wild-type β1AR construct (β6) showed high isoprenaline affinity (180 nM) in the absence of an intracellular binding partner (right curve). In the presence of Nb80 (left curve), the isoprenaline affinity increased to only 51 nM. (B) The minimally thermostabilized receptor construct (β84) showed lower isoprenaline affinity (7.1 μM) in the absence of an intracellular binding partner (right curve). In the presence of Nb80 (right curve), the isoprenaline affinity shifted dramatically to 16 nM. (C) In the presence of non-lipidized Gs, only the isoprenaline affinity of β84 increased from 6.9 μM (right curve) to 1.4 μM (left curve). (D) In ​​the presence of non-lipidized Gs and Nb35, the isoprenaline affinity of β84 dramatically shifted from 6.9 μM (right curve) to 68 nM (left curve). The data shown are from a single representative experiment, and the error bars represent the standard error between two measurements. [Figure 14] Competitive binding curves of β1AR in the presence of a GTPase domain. The affinity (IC50) of isoprenaline binding to β1AR was measured in the presence of a Gαs GTPase domain. (A) At 20°C, the isoprenaline affinity of β84 (middle curve) was 3.3 μM and did not increase in the presence of the GTPase domain (upper right curve) (3.4 μM). However, the combination of the GTPase domain, βγ dimer, and Nb35 induced a shift in isoprenaline affinity to 206 nM (left curve). (B) At 4°C, the isoprenaline affinity of β84 (right curve) was 3.9 μM in the presence of the GTPase domain (green), and the affinity increased to 253 nM (left curve). The data shown are from a single representative experiment, and the error bars represent the standard error between two measurements. [Figure 15]Ligand binding and overall structure of mini-Gs-bound A2AR. a: mini-Gs increase the affinity of agonist binding to A2AR, similar to that observed with heterotrimeric G proteins. Competitive binding curves were triplicated by measuring the displacement of the inverse agonist 3H-ZM241385 with increasing concentrations of agonist NECA (Ki values ​​are in parentheses; see Figure 16 for all data). For clarity, the curves are shown from left to right on the graph. (i) A2AR and heterotrimeric G protein and nanobody Nb35 (Ki: 340 ± 70 nM), (ii) A2AR and mini-Gs (Ki: 430 ± 80 nM), (iii) A2AR (Ki: 4.6 ± 0.3 μM). All G proteins were added to a membrane containing A2AR to a final concentration of 25 μM, and the final concentration of NaCl was 100 mM. b: The structure of A2AR is depicted in a light gray painting along with dark gray mini-Gs. The agonist NECA bound to A2AR and GDP bound to mini-Gs are depicted as a space-filling model. Related secondary structural features are labeled. [Figure 16] Competitive assays were performed using A2AR expressed on HEK293 cell membranes where the agonist NECA competes for binding to the radiolabeled inverse agonist 3H-ZM241385. Experiments were conducted in the presence of either 100 mM KCl (a, b), 100 mM NaCl (c, d), or 500 mM NaCl (e, f) to confirm the stabilization of the complex in a manner similar to that of the nanobody Nb35 of mini-Gs and heterotrimeric Gs. The results are summarized in Table (g). Data from at least three independent experiments were analyzed for statistical significance using unpaired t-tests. [Figure 17]Thermal stability of detergent-solubilized 3H-NECA-bound A2AR in the presence or absence of mini-Gs414. Unpurified A2AR was solubilized in detergent at the following concentrations: (a) 0.1% DDM, (b) 0.13% DM, (c) 0.8% OG. Samples were heated for 30 minutes and quenched on ice to determine the amount of 3H-NECA binding. In each panel, only A2AR is represented by the left curve, and A2AR bound to mini-Gs414 is represented by the right curve. The data were analyzed nonlinearly, and the apparent Tm was determined from sigmoid dose-response curve fitting analysis (d). [Figure 18] Orthogonal plots of the omit map difference density for NECA (a and b) in A2AR chain A, NECA (c and d) in A2AR chain B, and GDP (e and f) in mini-Gs chain C. The contour level is 2.5 sigma in panels a-d and 3.0 sigma in panels e and f. [Figure 19] Alignment of mini-Gs (chains C and D) to bovine GNAS2 (P04896) used in the β2AR-Gs structure referenced by the CGN system. Residues within 3.9 Å of either β2AR in the Gs-β2AR complex or A2AR in the mini-Gs-A2AR complex are highlighted in gray. [Figure 20] Packing interaction between A2AR and mini-Gs. a: Diagram of A2AR depicting its secondary structure in the A2AR-mini-Gs structure. Light gray shaded residues are disordered in either chain A and / or chain B. Disulfide bonds are depicted with black dashed lines. b: Drawing of the mini-Gs topology. c: Diagram of the contact between mini-Gs and A2AR, where line thickness represents the relative number of interactions between amino acid residues. [Figure 21]Alignment of human β2-adrenergic receptor (adrb2_human) with chains A and B of the crystallized A2AR-mini-Gs structure and human adenosine A2A receptor (AA2AR_human). Major Ballesteros-Weinstein numbers are shown above the sequence, and mutations in the crystallized A2AR that promote purification and crystallization are underlined. Light gray bars indicate the position of the alpha-helix in the β2AR-Gs structure, and dark gray bars represent these regions in the A2AR-mini-Gs structure. [Figure 22] Comparison of mini-Gs-bound A2AR and heterotrimeric Gs-bound β2AR. a: Structural alignment of β2AR-Gs (PDB ID: 3SN6)10 and A2AR-mini-Gs was performed by aligning only the receptor, A2AR (dark gray), and β2AR (light gray). The relative configuration resulting from Gαs (light gray) bound to β2AR and mini-Gs (dark gray) bound to A2AR is depicted. NECA and GDP are depicted as space-filling models. For clarity, the α-helical domain of Gαs is omitted along with Gα-bound Nb35 and Gβγ. b~e: Detailed comparison of hydrogen bonds (dashed lines) between each G protein and the receptor. The receptor is at the top of the panel where the helix is ​​labeled with H3, H5, H6, H7, and H8, while mini-Gs and Gαs are at the bottom of the panel where residues are labeled using the CGN system. The labeling of amino acid residues indicates the Ballesteros-Weinstein (BW) number of the receptor and the CGN notation of the G protein. f and g: Diagrams of the cytoplasmic surface of A2AR and β2AR, respectively, with space-filling models showing atoms in contact with their respective G proteins in dark gray. h: Comparison of residues in contact with G proteins in the mini-Gs-A2AR complex and the Gs-β2AR complex. Amino acid residues in contacting receptors are dark gray. White residues do not contact their respective G proteins but contact equivalent residues in other receptors. BW numbers are given for residues in the transmembrane α-helix, and dashes indicate residues in loops or H8. Amino acid residues 5.71-5.77 are irregular in the mini-Gs-A2AR structure. [Figure 23] Alignment of mini-Gs (chain c, dark gray) bound to A2AR with the GTPase domain (light gray) of Gαs bound to β2AR. GDP bound to mini-Gs is depicted as a space-filling model. The α5 helix interacting with the receptor is labeled. [Figure 24] Structural changes of A2AR upon G protein binding. The structural changes upon G protein binding are highlighted by aligning A2AR bound to mini-Gs (dark gray) with the A2AR (light gray) in the active intermediate structure bound to either NECA (PDB code 2YDV)1 or UK432097 (PDB code 3QAK)4. Neither structure was used for comparison because the larger elongation of ligand UK432097 compared to NECA distorted the extracellular surface compared to the NECA-bound structure, and the NECA-bound structure contained thermally stabilized mutations in the intracellular half of the receptor. a: Alignment with 2YDV, showing the extracellular half of the receptor parallel to the membrane plane. b: Alignment with 3QAK viewed from the cytoplasmic surface with mini-Gs removed for clarity. c: Alignment with 3QAK viewed parallel to the membrane. The transmembrane α-helix in A2AR is labeled with H3, H5, H6, and H7, and the mini-Gs are labeled. The residues are labeled with their Ballesteros-Weinstein numbers, and the arrows depict the direction of movement when the mini-Gs are bound. The conversion of BW and CGN numbers to amino acid residues in A2AR and mini-Gs is as follows: R3.50, Arg102;Y5.58, Tyr197;K6.29, Lys227;A3.33, Ala231 carbonyl;L6.37, Leu235;Y7.53, Tyr288;YH5.23, Tyr391;LH5.25, Leu393;C-termH5.24, and the C-terminus of the mini-Gs (Leu394), respectively. [Figure 25] Human Paralog Reference Alignment for the General Gα Numbering System 103. a: Reference alignment of human Gα paralogs for all criteria. The positions of the domain (D), consensus secondary structure (S), and human reference alignment (P) in the SSE are shown at the top of the alignment. b: Reference table of SSE definitions used in CGN nomenclature. [Figure 26-1] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-2] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-3] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-4] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-5] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-6] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-7] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-8] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-9] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-10] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-11]Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-12] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-13] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-14] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-15] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-16] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-17] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-18] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-19] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-20] Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 26-21]Mini-Gs amino acid and nucleotide sequences. The amino acid sequences are listed as SEQ ID NOs 1-45, and the nucleotide sequences are listed as SEQ ID NOs 46-90. [Figure 27] The amino acid sequence of the Galphat subunit (chimeric 6). This is a chimeric protein in which residues 216-294 of bovine Gαt1 are replaced with residues 220-298 of rat Gαi1. It is crystallized in complex with the complex βγ subunit (1GOT). [Figure 28] Phylogenetic relationships of human Gα subunits. We attempted to convert all Gα subunits, highlighted with family-specific colors, into mini-G proteins. Phylogenetic relationships were determined using TreeDyn. [Figure 29] Alignment of Gα GTPase domain protein sequences. The aligned amino acid sequence is that of the wild-type GTPase domain of the Gα subunit used in this study to construct the initial mini-G protein. The GαAH domain (not shown) was deleted and replaced by a linker (italicized GGGGGGGG or GGSGGSGG). To construct the mini-G protein, the gray-highlighted residues were deleted and the bold residues were mutated as follows (Gαs residue numbers and superscript CGN: D49S1H1.3, N50S1H1.4, D249S4.7, D252S4H3.3, D272H3.8, A372H5.4, I375H5.7). A glycine mutation (G217D, underlined) was incorporated into Gi1 only to improve expression (see Results and Discussion). The numbering above the sequence is for Gα, and the CGN system below the sequence is used for reference. [Figure 30]β1AR-mini-Gs complex and A2AR-mini-Gs complex. (a) FSEC traces of GFP-mini-Gs + β1AR (retention volume in parentheses): GFP-mini-Gs (15.1 mL), GFP-mini-Gs + β1AR bound to reverse agonist ICI118551 (15.1 mL), GFP-mini-Gs + β1AR bound to agonist isoprenaline (8 mL, 12.1 mL, and 15.1 mL). Representative chromatograms from at least two independent experiments are shown. (b) Measurement of GFP-mini-Gs affinity to DDM-solubilized β1AR using fluorescence saturation binding assay (FSBA). (c) FSEC traces of GFP-mini-Gs + DDM-solubilized A2AR (retention volume in parentheses): GFP-mini-Gs (15.1 mL), GFP-mini-Gs + A2AR bound to reverse agonist ZM241385 (15.1 mL), GFP-mini-Gs + A2AR bound to reverse agonist ZM241385 (12.5 mL and 15.1 mL). Representative chromatograms from at least two independent experiments are shown. (d) Measurement of mini-Gs affinity for DDM-solubilized A2AR using FSBA. (e) Analytical size exclusion chromatography (SEC) of mini-Gs bound to purified A2AR (retaining volume in parentheses): A2AR-mini-Gs complex: 153 kDa (13 mL), A2AR: 133 kDa (13.3 mL), mini-Gs: 22 kDa (17.2 mL). The three panels on the right of the SEC trace are Coomassie blue stained SDS-PAGE gels of fractions from three separate SEC experiments.Top panel: mini-Gs, middle panel: A2AR, bottom panel: mini-Gs mixed with NECA-bound A2AR (molar ratio of 1.2:1). [Figure 31] A2AR-mini-Golf complex. (a) Analytical SEC of mini-Golf bound to purified A2AR (retention volume in parentheses): A2AR-mini-Golf complex: 153 kDa (13 mL), A2AR: 133 kDa (13.3 mL), mini-Golf: 23 kDa (17.1 mL). The three panels on the right of the SEC trace are Coomassie blue stained SDS-PAGE gels of fractions from three separate SEC experiments. Top panel: mini-Golf, middle panel: A2AR, bottom panel: mini-Golf mixed with NECA-bound A2AR (molar ratio of 1.2:1). (b) Thermal stability of unpurified DM-solubilized 3H-NECA-bound A2AR. Data were analyzed by nonlinear regression, and apparent Tm values ​​were determined from sigmoid dose-response curve fitting analysis. Tm values ​​represent the mean ± standard error of two independent experiments, each performed in pairs. Circular shape: without mini-Golf (26.9±0.3℃), Square shape: with mini-Golf (32.5±1℃). The curves shown are from representative experiments. [Figure 32]Thermal stability assays of various complexes between mini-Gs / q chimerics and GPCRs. (a) Thermal stability of unpurified digitonin-solubilized 125I-AngII-bound AT1R (Tm values ​​are shown in parentheses). Circular: no mini-Gs / q (22.6±0.4℃), Square: mini-Gs / q 57, Inverted triangle: mini-Gs / q 70 (30.7±1℃), Triangular: mini-Gs / q 71 (30.2±0.8℃). (b) Thermal stability of unpurified DDM-solubilized 3H-NTS-bound NTSR1: circular: no mini-Gs / q (24.9±0.4℃), square: mini-Gs / q 57 (26.7±0.7℃), hexagon: mini-Gs / q 58 (25.1±0.4℃), inverted triangle: mini-Gs / q 70 (32.5±0.3℃), rhombic: mini-Gs / q 71 (28.6±1.1℃). (c) Thermal stability of unpurified DM-solubilized 3H-NECA-bound A2AR. Circular: no mini-Gs / qG (26.9±0.3℃), Square: mini-Gs / q57 (30.6±0.3℃), Hexagon: mini-Gs / q58 (26.9±0.5℃), Inverted Triangle: mini-Gs / q70 (27.5±0.2℃). For all panels, data (n=3) were analyzed by nonlinear regression, and the apparent Tm value was determined by sigmoid dose-response curve fitting analysis with the value shown as mean ± standard error. The curves shown are from representative experiments. [Figure 33]5HT1BR-mini-Gi1 complex. (a) mini-Gi1 conjugation increases agonist affinity for 5HT1BR. Competitive binding curves were performed in a double (n=2) by measuring the displacement of the antagonist 3H-GR125743 as the concentration of the agonist sumatriptan increased (apparent Ki values ​​representing the mean ± standard error are shown in parentheses). Circular: 5HT1BR (Ki: 276 ± 10 nM), Hexagonal: 5HT1BR and mini-Gi1 (Ki: 80 ± 13 nM), Square: 5HT1BR and mini-Gs / i1 (Ki: 36 ± 2 nM), Triangular: 5HT1BR and mini-Gi1β1γ2 (Ki: 15 ± 1 nM), Rhombus: 5HT1BR and mini-Gs / i1β1γ2 (Ki: 7.2 ± 0.8 nM). Error bars represent the standard error. (b) Measurement of mini-Gs / i1 chimeric affinity to DDM-solubilized donitriptan-bound 5HT1BR using FSBA. Circles: 5HT1BR and GFP-mini-Gs / i1 (total binding), squares: 5HT1BR and GFP-mini-Gs (non-specific binding), triangles: specific binding. The apparent KD of 386 ± 47 nM represents the mean ± standard error of two independent experiments. The curves shown are from representative experiments. (c) FSEC trace of GFP-mini-Gi1 + 5HT1BR in DDM. Purified GFP-mini-Gi1 and donitriptan-bound 5HT1BR in DDM (13.5 mL), GFP-mini-Gi1 (13.5 mL). (d) FSEC trace of GFP-mini-Gi1 + 5HT1BR in LMNG. (e) FSEC trace of GFP-mini-Gi1 and donitriptan-bound 5HT1BR (12.2 mL and 14.3 mL), and GFP-mini-Gi1 (14.3 mL) purified in LMNG. (f) FSEC trace of GFP-mini-Gs / i1 + 5HT1BR. GFP-mini-Gs / i1 and donitriptan-bound 5HT1BR (13.2 mL), and GFP-mini-Gs / i1 (15.1 mL) purified in DDM. (f) FSEC trace of GFP-mini-Gi1β1γ2 + 5HT1BR. GFP-mini-Gi1β1γ2 and donitriptan-bound 5HT1BR (11.8 mL), and GFP-mini-Gi1β1γ2 (14.3 mL) purified in LMNG. In panels c to f, the retention volume is shown in parentheses. [Figure 34] 5HT1BR-mini-Go1 complex. (a) Competitive binding curves were performed in a double (n=2) manner by measuring the displacement of the antagonist 3H-GR125743 with increasing concentrations of the agonist sumatriptan (apparent Ki values ​​representing the mean ± standard error are shown in parentheses). Circles: 5HT1BR (Ki: 276 ± 10 nM), Squares: 5HT1BR and mini-Go1 (Ki: 32 ± 3 nM). Error bars represent the standard error. (b) Measurement of GFP-mini-Go1 affinity to DDM-solubilized donitriptan-bound 5HT1BR using FSBA. Circles: 5HT1BR and GFP-mini-Go1 (total binding), Squares: 5HT1BR and GFP-mini-Go1 (non-specific binding), Triangles: specific binding. Apparent KD values ​​(184 ± 24 nM) represent the mean ± standard error of two independent experiments. The curves shown are from representative experiments. (c) FSEC traces of GFP-mini-Go1 + DDM-solubilized unpurified 5HT1BR bound to the following (retention volume in parentheses): antagonist SB224289 (14.9 mL), agonist donitriptan (11.3 mL and 14.9 mL). Free GFP-mini-Go1 was degraded as a dominant peak with a retention volume of 14.9 mL. (d) mini-Go1 forms a complex with purified 5HT1BR. The three panels are Coomassie blue stained SDS-PAGE gels of fractions from three separate SEC experiments. Top panel: mini-Go1, middle panel: 5HT1BR, bottom panel: mini-Go1 mixed with donitriptan-bound 5HT1BR (1:1 molar ratio). (e) FSEC traces of GFP-mini-Go1 + purified 5HT1BR. (f) 5HT1BR (13 mL) and GFP-mini-Go1 (14.8 mL) purified in GFP-mini-Go1 + DDM. (f) FSEC trace of GFP-mini-Gs + purified 5HT1BR. 5HT1BR (negative control, 15.1 mL) and GFP-mini-Gs (15.1 mL) purified in GFP-mini-Gs + DDM. Retention volume is shown in parentheses. [Figure 35]The sequence of the mini-G protein used in this study. Polyhistidine tags are underlined with dotted lines, TEV protease cleavage sites are highlighted in gray, and the linker used to substitute the GαAH domain is italicized. Mutations are shown in bold and underlined. [Figure 36] Sequences of mini-G proteins that could not be expressed in E. coli. Polyhistidine tags are underlined with dotted lines, the TEV site is highlighted in gray, and the linker used to replace the GαAH domain is italicized. Mutations are shown in bold and underlined. These constructs were cloned into plasmid pET15b for E. coli expression using NcoI and XhoI restriction sites. [Figure 37] The sequence of the GFP-mini-G protein used in this study. GFP (double underlined) was fused to the N-terminus of a mini-G protein containing a GGGGS linker (italicized). The polyhistidine tag is underlined with a dotted line, the TEV cleavage site is highlighted in gray, and the linker used to replace the GαAH domain is italicized (GGSGGSGG or GGGGGGGG). [Figure 38] Sequence alignment of selected mini-Gs / q chimeras used in this study. Bold residues are signature mutations of the mini-G protein. Gray residues are those found in Gq. Diamonds above the sequences identify amino acid residues in Gαs where the side chain is in atomic contact with residues in either β2AR (β2 stereostructure) or A2AR (2A stereostructure). Ellipses above the sequences identify amino acid residues in Gαs where only the main chain atoms are in contact with the receptor. [Figure 39]Analytical SEC and SDS-PAGE analysis of purified A2AR+mini-Gs / q chimeras. Analytical SEC of mini-Gs / q57(a), mini-Gs / q58(b), and mini-Gs / q70(c) bound to purified A2AR: A2AR-mini-Gs / q complex, A2AR, mini-Gs / q. The three panels below the SEC trace are Coomassie blue stained SDS-PAGE gels of fractions from three separate SEC experiments. Top panel: mini-Gs / q, middle panel: A2AR, bottom panel: NECA-bound A2AR mixed with mini-Gs / q (molar ratio of 1:1.2). [Figure 40] Sequence alignment of the different mini-Gi1 and mini-Go1 proteins used in this study. Residues in bold are signature mutations in the mini-G protein. Note the additional G217D mutation in mini-Gi1 (bold: residue 114 in the mini-G protein) to improve expression. Mini-Gs / i1 chimeras or mini-Gs / o1 chimeras were created by mutating residues in mini-Gs to their equivalents in mini-Gi1 or mini-Go1 (single underlined or double underlined, respectively). Note the re-insertion of the N-terminus (highlighted in gray) in the constructs used to form heterotrimers with β1γ2 (i.e., mini-Gi1_46, mini-Gs / i1_43, and mini-Gs / o1_16). [Figure 41] Stability of GLP1R in agonist stereostructures in the presence of mini-Gs. Mini-Gs increase the stability of GLP1R in the presence of mini-Gs. The Tm of GLP1R is 14.7°C, and the Tm of GLP1R + mini-Gs is 19.3°C. [Modes for carrying out the invention]

[0286] Example 1: Manipulation of minimal G proteins to facilitate crystallization of G protein-coupled receptors in their active three-dimensional structures. preface G protein-coupled receptors (GPCRs) regulate cytoplasmic signaling pathways in response to stimuli such as hormones and neurotransmitters. Determining the structure of GPCRs in all activated states is essential for elucidating the precise mechanisms of signal transduction. However, due to their inherent instability, crystallization of GPCR-G protein complexes is particularly challenging. Here, we describe the design of a minimal G protein composed solely of the GTPase domain derived from adenylyl cyclase-stimulated G protein (Gs). Mini-Gs are small, soluble proteins that efficiently couple to GPCRs in the absence of the Gβγ subunit. We engineered mini-Gs to form a stable complex with the β1 adrenergic receptor (β1AR), even when solubilized in short-chain detergents. Mini-G proteins induce pharmacological and structural changes in GPCRs similar to those of heterotrimeric G proteins. Therefore, they are novel tools that facilitate high-throughput structural determination of GPCRs in their active three-dimensional structures.

[0287] result Development of a sensitivity assay to detect Gs coupling to β1AR. We developed a susceptibility-competitive binding assay that can detect interactions between different binding partners with β1AR by measuring the response in agonist binding affinity. The binding partner used in this study was Nb80. 38 (Nanobody that binds to β2AR and induces an equivalent shift in agonist affinity for lipidized Gs), Nb35 40 These were (nanobody that stabilizes Gs in its GPCR-binding three-dimensional structure), non-lipidized Gs (Gαsβ1γ2), and non-lipidized Gβγ (Gβ1γ2). The concentration of the binding protein used in these assays was standardized to 25 μM, which corresponds to β1AR 96 Equilibrium dissociation constant (K) of the Nb80 bond to D This is approximately 30 times higher than [the other value]. Although affinity data for Gs was not available, we found that this concentration is K D They predicted it would be at least 10 times higher.

[0288] Using a heterogeneous competitive binding assay, the antagonist 3 H-dihydroalprenolol ( 3 The competition between H-DHA and the agonist isoprenaline was measured. Inhibition constant (K i The values ​​were derived from saturated bond experiments (see Figure 2). 3 H-DHA dissociation constant (K d ) was used for the calculation. First, the wild-type turkey β1AR construct 97 (β1AR-WT) was assayed (see Table 1). This construct was found to contain 40±0 nM isoprenaline K in the absence of a binding partner. i It had K i These shifted to 5.8±0.8 nM (6.9x), 17±2 nM (2.4x), and 6.8±0.6 nM (5.9x), respectively, in response to Nb80, Gs, or Gs-Nb35 (Figure 3a). Because the agonist affinity shift was relatively small in the case of β1AR-WT, we then considered the aforementioned mutations. 3、96 A minimally thermally stabilized construct (β1AR-84) containing some of these was tested (see Table 1). This construct has remarkably low isoprenaline K in its unconjugated state. i It had (2.6±0.3μM), but yielded a larger shift than β1AR-WT in response to the binding partner. Conjugation to Nb80, Gs, or Gs-Nb35 resulted in K iThese were shifted to 28±1 nM (93x), 271±54 nM (9.6x), and 16±4 nM (163x), respectively (Figure 3b). The competitive binding curve best fit the single-site binding parameter. Therefore, the partial shifts in agonist affinity observed for some binding partners (Gs, etc.) are more likely to reflect incomplete stabilization of the high-affinity agonist binding state rather than indicating partial coupling or a mixed receptor population. These results indicate that non-lipidized Gs could couple to β1AR, but Nb35 was required to stabilize the complex and to elucidate a comparable response in agonist binding affinity to Nb80. The competitive binding assay using β1AR-84 was more sensitive than β1AR-WT and was therefore useful in distinguishing subtle differences in the ability of different binding partners to stabilize the high-affinity agonist binding state.

[0289] Isolation of the Gαs GαGTPase domain and measurement of its binding to β1AR-84. β2AR-Gs complex 10 The structure revealed that only the GαGTPase domain derived from Gs forms a significant interaction with the receptor (see Figure 4). We isolated the GTPase domain at the gene level by substituting the sequence corresponding to GαAH with a short glycine linker (see Table 2). mini-Gs 77 This construct, which we named, was not adequately expressed in E. coli, could not be homogeneously purified, and was shown to be very unstable. Nevertheless, we were able to prepare small amounts of protein (approximately 200 μg / L culture) with a purity of about 10-20 percent (see Figure 5). The GαAH domains derived from GαGTPase and Gαs performed guanine nucleotide binding and hydrolysis. 41 Although they have been previously expressed as independent proteins to determine their roles in GPCRs, their ability to couple to GPCRs has not been investigated. We investigated the β1AR-84-coupled mini-Gs in a competitive binding assay at 20°C, either in the presence or absence of Gβγ-Nb35. 77The ability of was tested. A significant shift in the agonist binding affinity of β1AR-84 (2.6±0.3μM) was observed in mini-Gs 77 It was not observed in the presence of (1.9±0.2μM), but mini-Gs 77 -Gβγ-Nb35 resulted in a shift to 3.6±0.8 nM (718-fold) (Figure 3c). This demonstrated that the partially purified GαGTPase domain was functional, but also suggested that it could not couple to β1AR-84 in the absence of the Gβγ subunit. However, when this assay was repeated at 4°C, mini-Gs 77 In response to the uncoupled receptor, the agonist K2 agonist was activated, reducing the concentration from 2.1±0.2 μM (4℃) to 99±12 nM (21-fold). i A significant shift was observed (Figure 3d). This was an important result as it demonstrated that the isolated GαGTPase domain was able to bind to β1AR-84 in the absence of the Gβγ subunit. It also suggested that thermal stability was a limiting factor in the receptor's ability to stabilize its high-affinity agonist binding state.

[0290] Thermal stabilization of the β1AR-mini-Gs composite. We thermally stabilized mini-Gs conjugated with β1AR. Mutants were screened using competitive binding assays at both 4°C and 20°C. Due to the low and variable expression levels of the mutants, it was not possible to standardize the concentrations used in these assays. Instead, whole mini-Gs purified from 1 L of E. coli culture were used for each competitive curve (Table 3). Approximately 100 mutants were tested during the initial screening. The agonist affinity of β1AR-84 was compared with that of the parent mini-Gs construct at either temperature (mini-Gs 77 Mutations that shifted by more than 2 times compared to the original value were classified as positive. A total of 14 mutations covering 11 unique locations were identified (Table 3).

[0291] A new parent construct (mini-Gs) including the modified N-terminus and linker region (see Table 2) 161The mutations were combined using ). Positive mutations were combined with one of the best mutations from the first screening round (A249D), and their stability when compounded with β1AR-WT was tested using a thermal stability assay in n-dodecyl-β-D-maltopyranoside (DDM) detergent. Agonist 3 H-norepinephrine ( 3 H-NE)) was used in the Tm assay, but due to the high background signal associated with this ligand, it was also possible to use the maximum concentration of 200 nM in this assay. This is because of the K of unconjugated β1AR-WT. i It was almost equal to the K of β1AR-WT complexed with Nb80 or Gs-Nb35. i This was approximately 250 times greater (see Figure 7). Therefore, the Tm value estimated for unconjugated β1AR-WT is under unsaturated agonist conditions, while the β1AR-WT complex with higher agonist affinity is under agonist-saturated conditions.

[0292] A249D variant (mini-Gs 162 ) had an apparent Tm of 25.1°C (Table 4), which was lower than the apparent Tm of unconjugated β1AR-WT (25.9°C). Double mutants (mini-Gs) including the A249D mutation and switch III deletion. 164 The mutation ) increased the apparent Tm of this complex to 28.6°C. The addition of the G49D, E50N, S252D, and L272D mutations resulted in similar apparent Tm values ​​(within 0.2°C of the double mutant). These six mutations were utilized in the final construct due to their individual positive effects on the agonist affinity of membrane-embedded β1AR-84 (Table 3). None of the other positive mutations from the first screening round further increased the Tm of this complex and were therefore rejected. As assessed by differential scanning fluorescence (DSF), all combinations except L272D also increased the Tm of the basal GDP-bound state (Table 4).

[0293] Five of the six well-combined mutations clustered around the nucleotide-binding pocket and phosphate-binding loop (P-loop) (Figure 6b). The A249D mutation was designed to interact with Lys-293 ​​and S251 to stabilize the base of the nucleotide-binding pocket. The deletion of switch III, which is irregular in the GPCR-binding conformation, allows this flexible loop to function with Arl-2 98 Defined secondary structural elements (α-helix, 3) can be seen in 10 The mini-Gs were intended to be stabilized by substitutions (helices and beta turns). The S252D mutation was also designed to stabilize the region around switch III through latent interaction with Arg-265. The G49D and E50N mutations located in the P-loop were designed to reduce flexibility and structurally constrain this region through latent interactions with Arg-265 and Lys-293, respectively. A sixth mutation (L272D) was designed to structurally constrain switch II through latent interactions with a cluster of charged and polar residues (227-233) in its N-terminal region (Figure 6c).

[0294] Screening for mutations that stabilize the β1AR-WT-mini-Gs complex in detergents mini-Gs containing six stabilizing mutations from the first screening round 183 The detergent-solubilized β1AR-WT could not be completely stabilized. The Nb80 or Gs-Nb35 composites were mini-Gs, respectively. 183 They had higher apparent Tm values ​​of 3.3°C or 7.1°C (Table 4). Therefore, a second panel of approximately 150 mutants was examined using mutagenesis to determine the structure of Gs in their receptor-binding conformation. 10The design was based on the above. These mutations were screened against the parent construct with the modified linker region (see Table 2). We identified four further mutations that increased the stability of the complex in detergent (Table 4). The best mutant (I372A) increased the apparent Tm of the complex from 29.2°C to 34.0°C, and when combined with V375I, it yielded an apparent final Tm of 35.0°C. This was 3.0°C higher than Nb80 and only 0.8°C lower than Gs-Nb35. All detergent-stabilizing mutations reduced the stability of mini-Gs in the GDP-bound conformation (Table 4).

[0295] Detergent-stabilizing mutations were located around the α1-α5 helix interface. GTP binding structure 81 GPCR binding structure 10 The alignment of Gαs in revealed a steric collision between Ile-372 (within the α5 helix) and residues Met-60 and His-64 (within the α1 helix) (Figure 6d). This collision appears to prevent close packing of the C-terminal region of the α1 helix to the core of the GαGTPase domain, exposing the protein core to the solvent. The I372A mutation was designed to eliminate this collision and promote better packing in this region. The V375I mutation was designed to improve packing between the α5 helix and the protein core in the GPCR binding conformation (Figure 6e). During the course of this study, the I372A mutation also appeared in rhodopsin-G i1 complex 92 It was independently reported to stabilize it.

[0296] mini-Gs verification Detergent stabilization structure (mini-Gs 345 The ) was modified for crystallographic applications by altering the linker and shortening the N-terminus (see Table 2). The final stabilized construct was mini-Gs 393This structure was named (see Figure 8). This construct was able to elucidate an agonist affinity shift equivalent to or greater than that of either Nb80 or Gs-Nb35 (Figures 9a-c): membrane-embedded β1AR-WT (4.1±1.1nM compared to 5.8±0.8nM or 6.8±0.6nM, respectively), membrane-embedded β1AR-84 (3.6±0.0nM compared to 28±1nM or 16±4nM, respectively), and DDM-solubilized β1AR-84 (4.7±0.4nM compared to 83±2nM or 23±7nM, respectively). These data demonstrate that mini-Gs was able to stabilize the high-affinity agonist binding state of β1AR equivalent to or better than that of either Nb80 or Gs-Nb35. Furthermore, mini-Gs 393 There was no significant difference in agonist binding affinity between membrane-embedded β1AR-84 bound to the receptor or detergent-solubilized β1AR-84. This demonstrates that the receptor's pharmacological response is identical under either a lipid or detergent environment.

[0297] mini-Gs 393 We were able to highly express mini-Gs in E. coli, purify it in a yield of 100 mg per liter of culture, and concentrate it to over 100 mg / mL (Figure 9d). Using analytical gel filtration, mini-Gs 393 We demonstrated that mini-Gs could bind to purified β1AR-WT in lauryl maltose neopentyl glycol (LMNG) detergent. 393 A 1:1 stoichiometric mixture of β1AR-WT is equivalent to either β1AR-WT or mini-Gs, respectively. 393 Compared to 13.6 mL or 17.1 mL, it was degraded as a dominant peak with a retention volume of 13.2 mL (Figure 9e). This result clearly demonstrated that these binding assays correlated with the formation of stable complexes between purified proteins in the detergent. Furthermore, mini-Gs, a construct in which N-terminal residues 6-25 were substituted and the L272D mutation was reversed, was also analyzed. 399 (See Table 2) retained its ability to form a heterotrimer with Gβγ. mini-Gs 399A 1:1 stoichiometric mixture of Gβ1γ2 is called Gβγ or mini-Gs, respectively. 399 Compared to 15.8 mL or 16.4 mL, it was resolved as a single peak with a retention volume of 14.6 mL (Figure 9f). This property may be useful for applications where larger mini-Gs heterotrimers are preferred (cryo-electron microscopy) or for studying the role of Gβγ in G protein activation.

[0298] β1AR-WT-mini-Gs 393 The stability of the complex was tested in several different detergents. In longer-chain detergents such as DDM, β1AR-WT-mini-Gs 393 The complex had an apparent Tm of 34.1°C, which was 8.2°C higher than that of the unconjugated β1AR-WT. In DDM, mini-Gs 393 The stability of was slightly lower than that of Gs-Nb35 (1.7°C) but slightly higher than that of Nb80 (2.1°C) (Figure 10a). A similar pattern was observed with n-decyl-β-D-maltopyranoside (DM), and β1AR-WT-mini-Gs 393 The complex had an apparent Tm of 30.5°C, which was 10.1°C higher than that of β1AR-WT. In Dm, mini-Gs 393 The stability of β1AR-WT-mini-Gs was slightly lower than that of Gs-Nb35 (0.6°C) but slightly higher than that of Nb80 (1.9°C) (see Figure 11a). In short-chain detergents such as n-octyl-β-D-glucopyranoside (OG), β1AR-WT-mini-Gs 393 The complex had an apparent Tm of 19.7°C, which was more stable than either Gs-Nb35 (6.1°C) or Nb80 (5.4°C) (Figure 10b). A similar pattern was observed with n-nonyl-β-D-glucopyranoside (NG) and β1AR-WT-mini-Gs 393 The complex had an apparent Tm of 24.7°C, which was more stable than either Gs-Nb35 (5.7°C) or Nb80 (8.0°C) (see Figure 11b). Unconjugated β1AR-WT became completely inert after solubilization in either NG or OG, and exhibited considerable thermal stability compared to mini-Gs. 393We demonstrated that the receptor was conjugated. Both NG and OG are suitable detergents for vapor diffusion crystallization, highlighting that this is a viable approach for determining the structure of GPCR-mini-Gs complexes.

[0299] Although the nucleotide binding characteristics of the mutants were not extensively studied in this research, mini-Gs 393 One interesting observation was made that the β1AR-84 complex containing GTPγS showed complete resistance to GTP-mediated dissociation (Figures 10c and 10d). 99 The compound was added to the competitive binding assay (after complex formation) at a concentration of 0.25 mM, which is within the physiological range of GTP. Unconjugated β1AR-84 was added to the competitive binding assay in the presence of GTPγS in the form of 3.0 ± 0.1 μM isoprenaline K i It possessed.

[0300] Treatment of this complex with GTPγS completely reversed the Gs-induced agonist binding affinity shift from 271±54 nM to 2.7±0.1 μM (Figure 10c). mini-Gs 404 Shifts in agonist binding affinity induced by (mini-Gs, except for the reversal of I372A and V375I mutations) 393 The same construct (see Table 2) was almost completely reversed by GTPγS (from 18±2 nM to 700±60 nM). However, β1AR-WT-mini-Gs in the presence or absence of GTPγS was not reversed. 393 There was no significant difference in the agonist binding affinity of the complex (3.6±0.0 nM compared to 5.2±0.7 nM). This unresponsiveness to GTPγS was traced by the I372A mutation, and mini-Gs 389 (Except for the reversal of the V375I mutation, mini-Gs 393 (The same structure as) (See Table 2) is mini-Gs 393It behaved in almost the same manner as (see Figure 12). Therefore, the I372A mutation appears to uncouple from GPCR binding to occupancy of the nucleotide binding pocket (see Discussion). This is an interesting finding as it may enable the formation of a stable GPCR-mini-Gs complex in viable cells. mini-Gs on GPCR 393 Combined with the thermal stabilization effect of conjugation, this may enable the solubilization and purification of GPCRs that are unstable to purify using conventional techniques.

[0301] Consideration Several novel approaches have been developed to stabilize and crystallize GPCRs in their active-like three-dimensional structures, and these include G protein-derived peptides. 36、37 G protein-mimicking nanobody 38、100、101 , and nanobody-stabilized heterotrimeric G proteins 10 One approach involves complexation with [a specific protein]. However, these approaches are not ideal because the G protein-derived peptides do not appear to induce the same conformational changes in the receptor as heterotrimeric G proteins, the G protein-mimicking nanobodies cannot recreate the natural GPCR-G protein interface, and heterotrimeric G protein complexes are large, dynamic, and unstable in detergents, making them particularly difficult to crystallize. Therefore, we designed minimal G proteins that are compliant with high-throughput crystallization of natural-like GPCR-G protein complexes. Recently, we have achieved crystallization of wild-type human adenosine A at a resolution of 3.4 Å. 2a The structure of mini-Gs compounded with the receptor was determined (see Example 4). 2a The molecular structure of the complex is the β2AR-Gs complex. 10 Its molecular structure is remarkably similar to that of the natural signaling complex, strongly suggesting that it is an accurate reflection of the natural signaling complex.

[0302] G protein manipulation studies have also provided unique insights into the mechanism of G protein activation. We identified a steric collision between the α1 and α5 helices within the receptor-binding structure, which appears to prevent the close packing of the α1 helix into the core of the GαGTPase domain (Figure 6d). It has been previously suggested that allosteric destabilization of the α1 helix by GPCR may be a major event in the opening of the GαGTPase-GαAH domain interface and the destabilization of the nucleotide-binding pocket. 89、90、92 We demonstrated that a mutation of Ile-372 to alanine, which was predicted to eliminate steric collisions between the α1 and α5 helices, nearly completely blocked GTP-mediated dissociation of the complex. These data indicate that Ile-372 is a key relay between the GPCR binding site and the nucleotide binding pocket, and that its mutation effectively uncouples GPCR binding from nucleotide occupation. The identification of Ile-372 as a key residue in signaling also demonstrates the versatility of mini-G proteins, specifically minimally stabilizing mutants, for studying the mechanisms of G protein activation.

[0303] Mini-G proteins are novel tools with many potential applications, including receptor pharmacological characterization, binding reaction kinetic studies, thermal stabilization of GPCRs in their active three-dimensional structures, drug discovery, and crystallization of natural-like GPCR-G protein complexes. Furthermore, all mutations reported herein are located within the conserved region of the Gα subunit. Therefore, this concept is considered transferable to all classes of heterotrimeric G proteins, which would enable the production of a panel of mini-G proteins that can be coupled to any GPCR.

[0304] Materials and methods Cloning details of all constructs used in this study are provided in Tables 1 and 2. Site-directed mutagenesis was performed using the Quick Change protocol (Stratagene). Insertions and deletions were performed using the methods described above. 102 This was done using a revised version.

[0305] Baculovirus expression of G protein. The G protein gene was cloned into the transport vector pBacPAK8 (Clontech), and baculovirus was prepared using the flashBAC ULTRA system (Oxford Expression Technologies). Trichopulsia ni cells (Expression Systems) were grown in ESF921 serum-free medium (Expression Systems) in 5 L Optimum Growth Flasks (Thompson Instrument Company). Immediately before infection, thermo-inactivated fetal bovine serum (Sigma) was added to a final concentration of 5%. Cells were infected with third passage virus at a final concentration of 3%. In cases of co-infection with multiple viruses (heterotrimer Gs or Gβγ), each virus was added to a final concentration of 3%. The final volume of culture was 3 L per flask, and the final cell density was 3 × 10⁶. 6 The cell count was cells / mL. 48 hours after infection, cells were collected by centrifugation at 5000g for 5 minutes, rapidly frozen in liquid nitrogen, and stored at -80°C.

[0306] Purification of non-lipidized Gαs. A cell pellet derived from 6 L of insect cell culture was resuspended in 400 mL of buffer A (30 mM TRIS (pH 8.0), 100 mM NaCl, 5 mM MgCl2, 5 mM imidazole, 50 μM GDP). PMSF (1 mM), pepstatin-A (2.5 μM), leupeptin (10 μM), Complete protease tablets (Roche), DNase I (50 μg / mL), and DTT (100 μM) were added. The cells were degraded by sonication (70% amplitude for 10 minutes) and purified by centrifugation (38,000 g for 1 hour). The supernatant was loaded onto a 5 mL Ni Sepharose FF column (GE Healthcare) at a rate of 5 mL / min. The column was washed continuously at 5 mL / min with 25 mL of buffer A, 50 mL of buffer B (20 mM TRIS (pH 8.0), 300 mM NaCl, 10 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP), and 25 mL of buffer C (20 mM TRIS (pH 8.0), 300 mM NaCl, 30 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP). The column was eluted with 25 mL of buffer D (20 mM TRIS (pH 9.0), 50 mM NaCl, 500 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP). The eluate was diluted in 250 mL of buffer E (20 mM TRIS (pH 9.0), 50 mM NaCl, 10% glycerol, 1 mM MgCl2, 50 μM GDP, 1 mM DTT) and loaded onto a 5 mL Q Sepharose HP column (GE Healthcare) at a rate of 5 mL / min. The column was washed with 50 mL of buffer E and eluted using a linear gradient of 50–300 mM NaCl (in buffer E). The peak fractions were pooled, and TEV protease was added to achieve a 1:20 ratio. w / wThe final ratio of (TEV:Gαs) was obtained. This sample was dialyzed overnight in 1 L of buffer F (20 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol, 1 mM MgCl2, 10 μM GDP). Imidazole (20 mM) and Ni-NTA resin (4 mL) were added to the sample and mixed for 1 hour. The mixture was poured onto a disposable column containing 1 m of Ni-NTA resin, and the transfusion was collected. The column was washed with 10 mL of buffer, and this wash was pooled together with the transfusion. The pooled sample was concentrated to 1.5 mL using a 10 kDa MWCO Amicon Ultra centrifugation filter (Millipore). This sample was loaded onto a Superdex-200 26 / 600 gel filtration column (GE Healthcare) equilibrated with buffer G (10 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol, 1 mM MgCl2, 1 μM GDP, 0.1 mM TCEP). The peak fraction was pooled and concentrated to 50 mg / mL. The pure protein was aliquoted, rapidly frozen in liquid nitrogen, and stored at -80°C. The typical yield was 6.5 mg of pure Gαs per liter of culture.

[0307] Purification of non-lipidized Gs heterotrimers. Purification of non-lipidized heterotrimer Gs was carried out essentially as described for non-lipidized Gαs, except that the Ni Sepharose column was washed with 50 mL of buffer C instead of 25 mL, buffer D contained 300 mM imidazole instead of 500 mM, the pH of buffers D and E was 8.5 instead of 9.0, the Q Sepharose column was eluted with a linear gradient of 50–200 mM NaCl instead of 50–300 mM, the fraction derived from the Q Sepharose column was concentrated and loaded onto a Superdex-200 column, and the TEV cleavage step was omitted. Typical yield was 7 mg of pure Gs per liter of culture.

[0308] Purification of non-lipidized Gβγ dimers. The purification of non-lipidized Gβγ dimers was carried out essentially as described for non-lipidized Gαs, except that the TEV cleavage step was omitted, instead of eluting the Q Sepharose column with a linear gradient of 25–200 mM NaCl instead of 50–300 mM, concentrating the fraction derived from the Q Sepharose column, and loading it onto a Superdex-200 column. The typical yield was 7.5 mg of pure Gβγ per liter of culture.

[0309] Expression and purification of nanobody. Synthetic genes for Nb80 and Nb35 (Integrate DNA Technologies was cloned into pET26b (Novagen) for periplasmic expression in E. coli strain BL21(DE3)RIL (Agilent Technologies). Cells were lysed by sonication (70% amplitude for 10 minutes). Nb80 was purified by IMAC and gel filtration, with a typical yield of 12 mg of pure protein per liter of culture. Nb35 was purified by IMAC, cation exchange chromatography, and gel filtration, with a typical yield of 26 mg of pure protein per liter of culture.

[0310] Expression and purification of mini-G protein (for screening). Mini-G protein mutants were cloned in pET15b (Novagen). Expression was performed in E. coli strain BL21 (DE3) RIL. Cells were grown in 2TY medium supplemented with glucose (0.1%). Cultures were induced with IPTG (100 μM) at 15°C for 20 hours. Cells were lysed by sonication (70% amplitude for 2 minutes). The mutants were partially purified by IMAC. Imidazole was removed on a PD10 column (GE Healthcare), and the sample was concentrated to 20 mg / mL. Partially pure protein was aliquoted, rapidly frozen in liquid nitrogen, and stored at -80°C.

[0311] Mini-G protein expression and purification (final protocol). BL21(DE3)RIL cells transformed with the mini-G protein construct were grown in TB medium supplemented with glucose (0.2%), MgSO4 (5mM), and antifoaming agent (0.01%). Cells were cultured in a 2 L baffled flask (Simax) and shaken at 140 rpm. OD 600 The cultures were grown at 30°C until the expression level reached 0.8. Expression was induced with IPTG (50 μM), and the temperature was reduced to 25°C. Twenty hours after induction, the cells were collected by centrifugation at 5000 g for 10 minutes, rapidly frozen in liquid nitrogen, and stored at -80°C.

[0312] A cell pellet derived from 1 L of culture was resuspended in 200 mL of buffer A (40 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol, 10 mM imidazole, 5 mM MgCl2, 50 μM GDP). PMSF (1 mM), pepstatin-A (2.5 μM), leupeptin (10 μM), complete protease tablets, DNase I (50 μg / mL), and DTT (100 μM) were added. The cells were degraded by sonication (70% amplitude for 10 minutes) and purified by centrifugation (38,000 g for 45 minutes). The supernatant was loaded onto a 10 mL Ni Sepharose FF column at a rate of 5 mL / min. The column was washed at 5 mL / min with 100 mL of buffer H (20 mM HEPES (pH 7.5), 500 mM NaCl, 40 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP). The column was eluted with 30 mL of buffer I (20 mM HEPES (pH 7.5), 100 mM NaCl, 500 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP). TEV protease was added, and the mixture was eluted at a ratio of 1:20. w / w The final ratio of (TEV:Gαs) was obtained. DTT (1 mM) was added, and the sample was dialyzed overnight in 2 L of buffer J (20 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol, 1 mM MgCl2, 10 μM GDP). Imidazole (20 mM) and Ni-NTA resin (4 mL) were added to the sample and mixed for 1 hour. The mixture was poured onto a disposable column containing 1 m of Ni-NTA resin, and the transfusion was collected. The column was washed with 10 mL of buffer, and this wash was pooled together with the transfusion. The pooled sample was concentrated to 1.5 mL and loaded onto a Superdex-200 26 / 600 gel filtration column equilibrated with buffer K (10 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol, 1 mM MgCl2, 1 μM GDP, 0.1 mM TCEP). The peak fraction was pooled and concentrated to 100 mg / mL. The pure protein was aliquoted, rapidly frozen in liquid nitrogen, and stored at -80°C. The typical yield was 100 mg of pure protein per liter of culture.

[0313] Saturation binding assay. Insect cells expressing β1AR were resuspended in 1 mL of assay buffer (20 mM HEPES (pH 7.5), 100 mM NaCl) supplemented with a complete EDTA-free protease inhibitor (Roche). The cells were degraded by passing a bent 26G needle through 10 times. Cell debris was removed by centrifugation (4°C and 3000 g for 5 minutes). The supernatant was diluted to obtain 2 × 0.96 mL aliquots for each sample. Alprenolol (120 μL) was added to the negative sample (final concentration 1 mM), and assay buffer (120 μL) was added to the positive sample. The samples were aliquoted into PCR plates (12 × 10⁸ μL). 3 12 μL of ¹H-dihydroalprenolol was added to each well (final concentrations ranging from 2.5 nM to 2.56 μM were obtained). The samples were mixed and incubated at 20°C for 2 hours. The samples (2 × 50 μL double samples) were vacuum filtered through a 96-well glass fiber filtration plate (Merck Millipore) pre-soaked in PEI (0.1%). Each well was washed with assay buffer (3 × 200 μL). The filters were dried, perforated, and placed in scintillation vials, and 4 mL of Ultima Gold scintillant (Perkin Elmer) was added. Radioactivity was quantified by scintillation counting (1 minute per sample) using a Tri-Carb counter (Perkin Elmer). Data from negative samples were subtracted from positive samples. The data were plotted on a graph (Prism), and K d The values ​​were derived from single-site saturated bond analysis.

[0314] Competitive binding assay. Insect cells expressing β1AR were resuspended in 1 mL of assay buffer (25 mM HEPES (pH 7.5), 100 mM NaCl, 1 mM MgCl2, 1 mM ascorbate) supplemented with a complete EDTA-free protease inhibitor (Roche). The cells were degraded by passing a bent 26G needle through 10 times. Cell debris was removed by centrifugation (4°C and 3000 g for 5 minutes). The supernatant was diluted to obtain 1.68 mL single aliquots for each sample. Binding partner (240 μL) was added (final concentration 25 μM). The mixture was aliquoted into a 0.2 mL PCR plate at 20°C (17 × 96 L). Isoprenaline (12 μL) prepared in a buffer containing 1 U / mL apirase (Sigma-Aldrich) was added to each well (final concentration ranging from 1 pM to 10 mM). Alprenolol (12 μL) was added to the negative sample (final concentration 100 μM). The samples were mixed and incubated at 20°C for 1.5 hours. 3 12 μL of 1H-dihydroalprenol was added to each well (final concentration 5 nM (β1AR-WT) or 20 nM (β1AR-84)). The samples were mixed and incubated at 20°C for 1.5 hours. The samples (2 × 50 μL doubles) were vacuum filtered as described in the saturated binding assay protocol. The data were plotted on a graph, and K i The value is suitable for one part K i This was derived from the analysis.

[0315] A competitive binding assay using detergent-solubilized β1AR-84 was performed using the same protocol, except that all steps were carried out at 4°C, the membrane was solubilized with DDM (final concentration 0.1%) for 30 minutes before adding the binding partner, and the binding and separation from the free ligand (by gel filtration) was performed as described in the thermal stability assay protocol.

[0316] Thermal stability measurement of the β1AR-WT-mini-Gs complex. Insect cells expressing wild-type β1AR-WT were resuspended in 1 mL of assay buffer (25 mM HEPES (pH 7.5), 400 mM NaCl, 1 mM MgCl2, 1 mM ascorbate, 0.1% BSA, 0.004% bacitracin) supplemented with a complete EDTA-free protease inhibitor (Roche). Cells were degraded by passing a bent 26G needle through 10 times. Cell debris was removed by centrifugation (4°C and 3000 g for 5 minutes). The supernatant was diluted to obtain 2 × 0.78 mL aliquots for each sample. Norepinephrine (120 μL) was added to negative samples (final concentration 200 μM), and assay buffer (120 μL) was added to positive samples. The binding partner (120 μL) was added to both samples (final concentration 25 μM). Preparations were made in a buffer containing 1 U / mL of apirase (Sigma-Aldrich). 3120 μL of H-norepinephrine was added to both samples (final concentration 200 nM). The samples were mixed and incubated at 4°C for 1 hour. 60 μL of detergent was added to both samples (final concentrations: DDM=0.1%, DM=0.13%, OG=0.8%). The samples were mixed and incubated on ice for 1 hour. Insoluble material was removed by centrifugation (4°C and 17000 g for 5 minutes). The supernatant was aliquoted into 0.2 mL PCR tubes (9 × 120 μL). Each sample was heated to the desired temperature (4–50°C) for exactly 30 minutes, and then quenched on ice for 30 minutes. The sample (2 × 50 μL double sample) was pre-equilibrated (25 mM HEPES (pH 7.5), 100 mM NaCl, 1 mM MgCl2, 0.025% DDM) and applied to Toyopearl HW-40F resin packed into a 96-well filtration plate (Merck Millipore) (bed volume 225 μL). The plate was centrifuged (4°C and 1800 rpm for 5 minutes). The filtrate was transferred to Isoplates (Perkin Elmer), and 200 μL of Optiphase Supermix scintillant (Perkin Elmer) was added to each well. Radioactivity was quantified by scintillation counting (1 minute per well) using a MicroBeta counter (Perkin Elmer). Data from negative samples were subtracted from positive samples. The data were plotted graphically, and the apparent melting temperature (Tm) value was derived from sigmoid dose-response (variable gradient) analysis.

[0317] Thermal stability of GDP-bound mini-Gs mutants was measured by differential scanning fluorescence (DSF). 30 μg of mini-Gs mutant was diluted to 135 μL in assay buffer (10 mM HEPES (pH 7.5), 100 mM NaCl, 1 mM MgCl2, 1 mM GDP, 2 mM DTT). SYPRO-orange (15 μL) was added from a 20-fold stock solution to obtain a 2-fold final concentration. The samples were mixed, and 2 × 50 μL aliquots were transferred to 0.2 mL PCR tubes (Qiagen). Thermal stability was measured using Rotor- The analysis was performed using Gene Q (Qiagen). The sample was equilibrated at 25°C for 90 seconds, then the temperature was increased from 25°C to 99°C at a rate of 4 seconds / °C. The melting temperature (Tm) corresponding to the inflection point of the curve was derived from the analysis using Rotor-Gene Q software. The Tm values ​​were calculated as the mean ± standard error from three independent experiments.

[0318] Gel filtration analysis of mini-G protein complexes. mini-Gs-βγ complexes are analyzed by mini-Gs 399 Prepared using a construct in which N-terminal residues 6-25 are substituted and the L272D mutation is reversed (see Table 2). Purified mini-Gs 399 The non-lipidized Gβ1γ2 subunit was mixed with the non-lipidized Gβ1γ2 subunit in equimolar proportions (6.7 nmol each), diluted to 200 μL with buffer L (10 mM HEPES (pH 7.5), 100 mM NaCl, 1 mM MgCl2, 1 μM GDP, 0.1 mM TCEP), and incubated on ice for 4 hours. The entire sample (200 μL) was loaded onto a Superdex-200 10 / 300 gel filtration column equilibrated with buffer L.

[0319] The β1AR-mini-Gs complex was prepared using wild-type β1AR-WT purified in LMNG detergent. The purified β1AR-WT and mini-Gs were mixed in equimolar ratios (3.3 nmol each), diluted to 200 μL with buffer M (10 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol, 1 mM MgCl2, 1 μM ascorbic acid, 1 μM isoprenaline, 0.002% LMNG), and incubated on ice for 4 hours. The entire sample (200 μL) was loaded onto a Superdex-200 10 / 300 gel filtration column equilibrated with buffer M.

[0320] Example 2: Introduction to the Development of an Assay for Detecting Conjugation of Non-Lipidized Gs to β1AR Numerous structural and biophysical data provide clues as to why obtaining high-resolution structures of G protein-GPCR complexes has proven difficult, with flexibility within nucleotide-free G proteins appearing to be the primary issue.7、24、42、61 We manipulated minimal GPCR-binding proteins that still couple to GPCRs but remove much of the flexibility that made crystallization of this complex so difficult. First, we developed an assay that could detect the coupling of non-lipidized Gs to β1AR. Next, we expressed isolated GTPase domains derived from Gαs and showed that they could couple to β1AR even in the absence of βγ dimers. However, the production of GTPase domains was difficult due to poor expression and severe thermal instability. Therefore, we performed mutagenesis screening and identified mutations that improved both the expression and stability of isolated GTPase domains while retaining basic guanine nucleotide binding properties and protein functionality. The mutations we discovered are well conserved among heterotrimeric G proteins and are expected to migrate to members of all four classes of the α subunit. Thus, this approach can be used to produce a repertoire of GTPase domains that can couple to almost all GPCRs. In this specification, Minimal Engineered G Protein Alpha (G pro) is a minimally engineered G protein that is coupled to an activated GPCR and induces core pharmacological and conformational changes related to the high-affinity agonist binding state. This document describes the design of the tein Alpha (MEGA) domain.

[0321] result Development of an assay to detect the coupling of non-lipidized Gs to β1AR We developed a competitive binding assay (see experimental procedure) that can detect the coupling of purified non-lipidized Gs to cell membranes containing β1AR receptors. First, we used Nb80 38To identify receptors that showed a significant increase in agonist affinity in response to binding, different β1AR constructs were screened. The adjacent wild-type β1AR construct (β6) had a relatively high affinity for isoprenaline (approximately 180 nM), which increased only 3.5-fold in response to Nb80 binding (Figure 13a). However, a series of minimally thermostabilized receptors showed a much larger shift in response to Nb80 binding. One of these constructs (β84), containing four thermostabilizing mutations (see experimental procedure), was selected to further characterize Nb80-Gs coupling. β84 had a much lower affinity for isoprenaline (approximately 7.1 μM), but showed a more significant shift upon Nb80 binding, resulting in an affinity of approximately 16 nM (Figure 13b). However, Gs coupling resulted in only a small shift in agonist affinity, from approximately 6.9 μM to 1.4 μM (Figure 13c). Therefore, we consider the β2AR-Gs complex 7 We hypothesized that the addition of Nb35, used to facilitate crystallization, could stabilize this complex and lead to a larger shift in agonist affinity. Here, we observed a shift in isoprenaline affinity from approximately 6.9 μM to 68 nM, similar to the affinity obtained with Nb80 (Figure 13d).

[0322] Expression and characterization of isolated Gαs GTPase domains Numerous constructs were tested to find the best method for isolating the GTPase domain from Gαs. This process essentially involved deletion from its location within the switch I region of the helical domain. The strategies evaluated were (1) the helical domain and the β2AR-Gs complex. 7The strategies were: (1) deletion of any relevant region (residues 57-207) that was irregular in the crystal structure; (2) deletion of the helical domain (residues 70-193) and linkage with a short terminal glycine linker resulting in the preservation of the adjacent native switch I region; (3) deletion of the helical domain and switch I (residues 65-203) and linkage with a longer terminal glycine linker; and (4) deletion of the helical domain and switch I (residues 67-205) and insertion of a structurally related switch I region derived from a low molecular weight GTPase. Since several variations of each strategy were tested, the estimated residue ranges are approximate. We found that strategy (1) was inappropriate because it removed a region of the GTPase domain essential for its stability in the absence of the receptor. Strategies 2-4 were all successful, resulting in the expression of small amounts of isolated GTPase domains in E. coli (culture at approximately 100 μg / L). Expression levels varied between different constructs, but quantification was difficult. Generally, complete removal of the helical domain and switch I (strategy 3) resulted in the highest expression levels.

[0323] The isolated GTPase domain was partially purified from E. coli, and its ability to couple to β1AR, which binds to β, was determined using the agonist shift assay described above. First, we tested the coupling of the GTPase domain, but no increase in affinity was observed (Figure 14a). Second, we tested the GTPase domain in the presence of the βγ subunit and Nb35 (Figure 14a), where an affinity shift (approximately 3.3 μM to 206 nM) was observed. Finally, we tested the coupling of the GTPase domain at 4°C (Figure 14b), where an affinity shift (approximately 3.9 μM to 253 nM) was observed. This demonstrated that the isolated GTPase domain is active and can couple to the receptor in the absence of the βγ subunit. However, this indicates that the GTPase domain is thermally unstable and needs to be manipulated to produce a stable protein suitable for crystallization applications.

[0324] Stabilization of the GTPase domain through mutagenesis An initial screening was performed for approximately 50 modifications (mutations, deletions, and chimeric structures). These modifications were designed to either remove extraneous sequences (compared to low molecular weight GTPases), stabilize nucleotide binding sites, restrict structurally dynamic switch regions, stabilize the inactive state of G proteins, or stabilize the active structure of G proteins. No modifications were made to regions that directly interact with receptors. The parental constructs used for mutagenesis consisted of a 20-amino acid deletion at the N-terminus, a complete deletion of the helical domain, and retention of a slightly modified switch I region (see experimental procedure).

[0325] Mutants were expressed in E. coli and partially purified by IMAC. To estimate the stabilizing effect of each modification, agonist shift assays were performed at 4°C and 20°C, and a summary of the assay data is presented in Table 5. Due to the wide range of mutant expression levels, it was not possible to standardize the concentration of each mutant used in this assay. Instead, the total amount of purified protein from 1 liter of culture was included in each assay. Importantly, the concentration of protein used in this assay affects the degree of agonist affinity shift. Therefore, the data must be interpreted as a combination of expression level and stabilizing effect. Four major modifications (Δ-switch III, A249D, L272D, and H41I) that dramatically improved the expression and / or stability of the isolated GTPase domain were identified (Table 5). Both the A249D mutation and the switch III deletion resulted in significantly improved expression levels (approximately 1–2 mg / L culture), while the L272D mutation and H41I mutation did not significantly improve expression levels. When assayed at 4°C (Table 5), all mutants induced a large shift in agonist affinity (final isoprenaline affinity 10–60 nM). Furthermore, when assayed at 20°C (Table 5), the A249D mutant and the Δ-switch III mutant induced a large shift in agonist affinity (final isoprenaline affinity 53 nM and 30 nM). When assayed at 20°C (Table 5), the L272D mutant and the H41I mutant also induced a shift in agonist affinity, though not as large as the A249D mutant and the Δ-switch III mutant (final isoprenaline affinity 464 nM and 589 nM). However, it should be noted that the concentrations of the A249D mutant and the Δ-switch III mutant used in this assay were approximately five times higher. Four additional mutants (G49D, E50N, G226A, and S252D) that improved the stability of the GTPase domain were also identified (Table 5). However, the proximity of these mutations to the aforementioned sites suggests that their mechanisms of action are likely similar, and therefore, their additional properties must be determined experimentally.

[0326] Consideration High-resolution structural solutions of GPCRs in their fully active three-dimensional structures are crucial for the design of novel agonist compounds. We have developed a unique strategy to manipulate the isolated GTPase domain of the G protein α subunit and couple it to a structurally active GPCR.

[0327] Heterotrimeric G proteins are their lipid-binding state. 5 This allows for efficient coupling to GPCRs. The MEGA domain contains a non-lipidized mutant Gα subunit, and its receptor binding mechanism is expected to be similar to that of the holoenzyme. Therefore, a prerequisite for designing the MEGA domain was the development of an assay capable of detecting the coupling of non-lipidized G proteins to GPCRs. Initially, we found that non-lipidized Gs induced only a slight shift in agonist affinity to minimally thermally stabilized β1AR. However, the β2AR-Gs complex... 7 The addition of Nb35, which was used to facilitate crystallization, resulted in a much greater response. Nb35 appears to inhibit the dissociation of the G protein heterotrimer by structurally constraining the switch II region and stabilizing the α / β subunit interface. Therefore, Nb35 may reduce the structural dynamics of the GPCR-G protein ternary complex and may mimic the stabilizing effect of membrane anchoring, albeit through a different mechanism.

[0328] We evaluated several different strategies for isolating the GTPase domain from Gs. We found that complete removal of the helical domain and switch I resulted in slightly better expression and stability. Initially, we found that the GTPase domain induced a significant shift in agonist affinity only in the presence of the βγ dimer and Nb35, suggesting that the βγ subunit was still required for efficient coupling. However, we found that the βγ dimer and Nb35 simply do not affect the thermally unstable GTPase domain. 28We hypothesized that it could act to stabilize the receptor. Therefore, we repeated the assay at 4°C and found that the GTPase domain could efficiently couple to the receptor in a βγ-independent manner. GPCRs can catalyze low levels of nucleotide exchange at the Gα subunit. 4 However, the βγ dimer is necessary to facilitate rapid exchange and, consequently, signal amplification. 56、57 The deletion of the helical domain enables efficient coupling of the GTPase domain to the receptor in a βγ-independent manner. This is likely due to more rapid GDP dissociation from the GTPase domain, resulting in more efficient coupling to the receptor. Overall, these data suggest that the mechanism of interaction between the receptor and the isolated GTPase domain is similar to that of the holoenzyme. Therefore, the MEGA domain may induce a native-like conformational change in the receptor, thus representing a true mimicry of G protein coupling.

[0329] We used mutagenesis to improve the stability and expression of the GTPase domain. We identified several key mutations that dramatically improved the expression level and / or stability of the GTPase domain, and their mechanisms are discussed below. The A249D mutation improved both the expression and stability of the GTPase domain. In low molecular weight GTPases, aspartate is often found at this position, where it stabilizes the lysine of the NKXD motif by a salt-crosslinking interaction. This lysine residue forms the base of the nucleotide-binding pocket and is involved in π-cation stacking interactions with the guanine ring. 92This position is not exclusively occupied by aspartate in low molecular weight GTPases, but within each class, it is generally conserved or non-conserved, indicating that it may be specific to the stability of a particular GTPase family. In heterotrimeric G proteins, this position is occupied by either an alanine or serine residue, where a glutamate residue is present. However, lysine derived from the NKXD motif is stabilized by salt-crosslinking interactions with aspartate (Asp-173 in Gαs) or glutamate derived from the helical domain. This interaction is disrupted when the domain interface separates during activation. 7 The A249D mutation, although not previously tested, is thought to stabilize the nucleotide binding pocket and increase GDP binding affinity.

[0330] Deletion of switch III improved both the expression and stability of the GTPase domain. In heterotrimeric G proteins, switch III is involved in mediating GTP-induced conformational changes and is required for effector binding. 93 In low molecular weight GTPases, switch III is absent, and the corresponding region consists of separate secondary structural elements, with the β4 chain terminating in a type I turn and preceding the α3 helix. 10 Directly linked to the helical segment (secondary structure attribution was performed using the STRIDE web server). 94、95 The improved stability achieved by the deletion of switch III is likely a result of replacing the highly flexible loop with more regular secondary structural elements. The increased expression level is likely due to the combination of improved stability and a more energetically favorable folding pathway.

[0331] The H41I mutation significantly improved the stability of the isolated GTPase domain. Histidine 41 has been reported to significantly contribute to the increased level of basal nucleotide exchange observed in Gαs compared to Gt. 96It has been previously reported that a mutation of histidine 41 to valine at this position in Gt halves the level of basal nucleotide exchange in Gαs. 96 We showed that the H41V mutation improved the stability of the MEGA domain (see Table 5), but the H41I mutation was optimal at this location. This mutation improves the stability of the GTPase domain by enhancing the interaction between the α5 helix and the αN / β1 loop. The tight packing in this region stabilizes the α5 helix, thereby reducing the GDP dissociation rate. 96 .

[0332] The L272D mutation located in the α2 helix (adjacent to switch II) significantly improved the stability of the isolated GTPase domain. Switch II dramatically alters the structure between the GDP-bound and GTP-bound states. 97 In the GDP-bound state, switch II is more dynamic and often irregular in the crystal structure. 98 In the GTP-coupled state, switch II is highly regular. 30、99 In Gs, this region forms the main effector coupling site. 100 The L272D mutation may directly interact with switch II and structurally constrain the entire region. Interestingly, it can form a salt cross-linking interaction with a highly conserved arginine residue (Arg-231) in switch II, and ideally, it is positioned in the GTP-bound state for such an interaction. 30 This may improve the stability of the GTPase domain by limiting the exposure of the hydrophobic residue below switch II to the aqueous environment.

[0333] In summary, we demonstrated that GTPase domains isolated from Gαs can efficiently couple to β1AR in a βγ-independent manner, despite being unstable and poorly expressed. We performed extensive mutagenesis screening and identified four key mutations that dramatically increase domain expression and / or stability.

[0334] Methods and materials β1AR constructs. The β84 constructs used in the G protein binding assay included several modifications: N-terminal MBP fusion protein, N-terminal cleavage (residues 1-32), intracellular loop 3 deletion (residues 244-271), C-terminal cleavage at residue 367, C-terminal hexanehistidine tag, C116L mutation, modified disulfide bond (M40C-L103C), and four thermally stabilized mutations (M90V, D322K, F327A, and F338M). The receptor was expressed in Trichopulsia ni (High Five) cell lines (Life Technologies) using the BaculoGold baculovirus expression system (BD Bioscience).

[0335] Gαs GTPase domain constructs. The parental GTPase domains used in the initial mutagenesis screening are listed below (all numbering refers to the long isoform of Gαs). These constructs consisted of an N-terminal hexahistidine tag, an N-terminal deletion (residues 1-20), a helical domain deletion (residues 71-193), retention of the adjacent native switch I intact, linking to the terminal Gly2 linker, and two mutations in the switch I region (L197A and C200S) to remove undesirable surface residues exposed by the removal of the helical domain.

[0336] Expression and purification of heterotrimer Gs. The non-lipidized heterotrimer Gs used in this study contained four amino acid deletions at the N-terminus to remove all potential palmitoylation sites. 101 Human Gαs (long form: including the variably spliced ​​region in linker 1), human Gβ1 (including the N-terminal hexahistidine tag), and prenylation sites are removed. 102The strain consisted of human Gγ2 containing the C68S mutation. Baculovirus constructs encoding each individual subunit were constructed using the flashBAC ULTRA system (Oxford Expression Technologies). The Gs heterotrimer was expressed in Spodoptera frugiperda (SF9) cells grown in TNM-FH medium (Sigma) containing 10% fetal calf serum (Gibco) and 1% lipid (BD Bioscience). The cells were infected with P3 virus at a concentration of 2% per subunit in a 1:1:1 ratio. The cells were incubated at 27°C for 48 hours. The cells were collected by centrifugation at 4000g for 10 minutes and washed with PBS (15% of the culture volume). The cell pellet was rapidly frozen in liquid nitrogen and stored at -80°C.

[0337] A cell pellet derived from 3 liters of culture was resuspended in 150 mL of lysis buffer containing a complete EDTA-free protease inhibitor (30 mM Tris, 100 mM NaCl, 10% glycerol, 5 mM MgCl2, 100 μM GDP, 0.5 mM PMSF, 2.5 μM pepstatin-A, 10 μM leupeptin, 50 μg / mL DNase I, 50 μg / mL RNase A (pH 8.0)), and DTT was added to a final concentration of 0.1 mM. The cells were degraded by sonication, and insoluble material was removed by centrifugation at 38000 g for 40 minutes. The supernatant was filtered (0.45 μM) and diluted with 5 mL of Ni. -Sepharose fast flow HisTrap column (GE Healthcare) was loaded at 5 mL / min. The column was washed with 10 column volumes of lysis buffer, and then with 10 column volumes of washing buffer (20 mM Tris, 250 mM NaCl, 5 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP (pH 8.0)) at 5 mL / min. The column was eluted with 25 mL of elution buffer (20 mM Tris, 50 mM NaCl, 200 mM imidazole, 10% glycerol, 1 mM MgCl2, 50 μM GDP (pH 8.3)) at 2 mL / min. The eluate was diluted with 225 mL of Q buffer (20 mM Tris, 50 mM NaCl, 10% glycerol, 0.5 mM MgCl2, 50 μM GDP, 1 mM DTT (pH 8.3)). The mixture was directly loaded onto a 5 mL Q-Sepharose HP HiTrap column (GE Healthcare) at 5 mL / min. The column was washed with 10 column volumes of Q buffer at 5 mL / min. Gs was eluted over 40 column volumes at 2 mL / min with a linear NaCl gradient from 50 mM to 250 mM (Q buffer containing 250 mM NaCl). The fractions containing Gs were pooled and concentrated to 5–10 mg / mL using a 10 kDa cutoff Amicon Ultra concentrator (Millipore). Concentrated Gs was loaded at 1 mL / min onto a Superdex-200 (16 / 60) gel filtration column (GE Healthcare) equilibrated with GF buffer (20 mM Tris, 100 mM NaCl, 10% glycerol, 0.2 mM MgCl2, 2 μM GDP, 0.1 mM TCEP (pH 8.0)). The fraction containing pure Gs was pooled, concentrated to 10 mg / mL, rapidly frozen in liquid nitrogen, and stored at -80°C. Typical yields were 1–2 mg of pure Gs per liter of culture.

[0338] Expression and purification of Nb35. Nb35 10The gene was synthesized (Integrated DNA Technologies) and cloned into the pET26b vector (Merck). Nb35 was expressed in BL21(DE3)-RIL cells (Merck). The culture was incubated in Terrific Broth medium supplemented with glucose (0.1%) and MgSO4 (2mM) at 37°C until it reached an OD of 0.8. 600nm The cells were grown to this size. Expression was induced with IPTG (50 μM) at 28°C for approximately 18 hours. The cells were collected by centrifugation at 4000 g and stored at -80°C.

[0339] A cell pellet derived from 6 liters of culture was resuspended in 200 mL of lysis buffer containing a complete EDTA-free protease inhibitor (40 mM Hepes, 100 mM NaCl, 5 mM imidazole, 5 mM MgCl2, 1 mM PMSF, 100 μg / mL lysozyme, 50 μg / mL DNase A (pH 7.5)). The cells were incubated on ice for 30 minutes, then degraded by sonication, and insoluble material was removed by centrifugation at 38,000 g. The supernatant was filtered (0.45 μM) and refractory to 5 mL of Ni-S. The epharose was loaded onto a GE Healthcare fast-flow HisTrap column at a rate of 5 mL / min. The column was washed with 15 column volumes of washing buffer (20 mM Hepes, 300 mM NaCl, 40 mM imidazole (pH 7.5)) at a rate of 5 mL / min. The column was eluted with 25 mL of elution buffer (20 mM Hepes, 500 mM imidazole (pH 7.0)) at a rate of 2 mL / min. The eluate was diluted with 225 mL of SP buffer (20 mM Hepes (pH 7.0)) and 5 mL of SP-Seph Nb35 was directly loaded onto an arose HP HiTrap column (GE Healthcare) at 5 mL / min. The column was washed with 10 column volumes of SP buffer at 5 mL / min. Nb35 was eluted over 40 column volumes at 2 mL / min with a linear NaCl gradient from 0 mM to 250 mM (SP buffer containing 250 mM NaCl). The fraction containing Nb35 was pooled and dialyzed overnight with 500 mL of GF buffer (20 mM Tris, 100 mM NaCl, 10% glycerol (pH 7.5)), with the external buffer changed twice. Nb35 was concentrated to 20 mg / mL using a 3 kDa cutoff Amicon Ultra concentrator (Millipore). The concentrated Nb35 was loaded onto a Superdex-200 (16 / 60) gel filtration column (GE Healthcare) equilibrated with GF buffer at 1 mL / min. The fraction containing pure Nb35 was pooled, concentrated to 20 mg / mL, rapidly frozen in liquid nitrogen, and stored at -80°C. The typical yield was 5 mg of pure Nb35 per liter of culture.

[0340] Partial purification of Gαs GTPase domains for use in agonist shift assays. The GTPase domain was expressed in BL21(DE3)-RIL cells. The cultures were then cultured in 2TY medium supplemented with glucose (0.1%) at 25°C until the OD was 0.5-0.8. 600nm The cells were grown to this size. Expression was induced with IPTG (100 μM) at 15°C for approximately 16 hours. The cells were collected by centrifugation at 4000 g and stored at -80°C.

[0341] A cell pellet derived from 2 liters of culture was resuspended in 22 mL of lysis buffer containing a complete EDTA-free protease inhibitor (30 mM Tris, 100 mM NaCl, 10 mM imidazole, 20% glycerol, 5 mM MgCl2, 3 mM ATP, 100 μM GDP, 0.5 mM PMSF, 2.5 μM peptastatin-A, 10 μM leupeptin, 50 μg / mL lysozyme, 20 μg / mL DNase I (pH 7.5)). DTT (0.1 mM) was added, and the cells were incubated on ice for 30 minutes. The cells were degraded by sonication, and insoluble material was removed by centrifugation at 50,000 g for 40 minutes. The supernatant was filtered (0.45 μM) and added to 1 mL of Ni-Sephar The GE Healthcare fast flow resin was added, and the suspension was mixed at 4°C for 1.5 hours. The mixture was poured into an empty GE Healthcare PD10 column and washed with 20 mL of washing buffer (20 mM Tris, 300 mM NaCl, 40 mM Imidazole, 20% glycerol, 1 mM MgCl2, 50 μM GDP (pH 7.5)). The column was eluted with 2.5 mL of elution buffer (20 mM Tris, 100 mM NaCl, 400 mM Imidazole, 20% glycerol, 1 mM MgCl2, 50 μM GDP (pH 7.5)). Partially purified proteins were desalted using a PD10 column (GE Healthcare) in GF buffer (20 mM Tris, 100 mM NaCl, 10% glycerol, 1 mM MgCl2, 50 μM GDP, 0.1 mM DTT (pH 7.5)). The desalted proteins were concentrated to a final volume of 400 μL using a 10 kDa cutoff Amicon Ultra concentrator (Millipore). The concentrated proteins were rapidly frozen in liquid nitrogen and stored at -80°C.

[0342] Agonist shift assay. A cell pellet derived from approximately 2 mL of High Five culture expressing a β84 receptor construct was resuspended in 1 mL of lysis buffer containing a complete EDTA-free protease inhibitor (Roche) (20 mM Tris, 100 mM NaCl, 1 mM MgCl2, 1 mM ascorbic acid (pH 7.5)). Cells were lysed by passing a bent 26G needle 10 times, and insoluble material was removed by centrifugation (3000 g for 5 minutes). The supernatant containing the crude membrane fraction was diluted to 8 mL in lysis buffer (0.8 mL was required per competitive curve). G protein, MEGA domain, Nb80, or buffer (200 μL) was added to the crude membrane (0.8 mL) and homogenized by passing a bent 26G needle 3 times. The final concentration of the G protein or Nb80 used in the assay was approximately 1 mg / mL, and the final concentration of the MEGA domain used depended on their expression levels. Nine aliquots (88 μL each) were transferred to a 96-well PCR plate (on ice). Isoprenaline (11 μL) was added to seven of the samples, and 1 × 10⁶ solutions were prepared. -3 ~1~10 -9 The final competitive ligand concentration curve for M was obtained, and isoprenaline dilutions were prepared in lysis buffer containing 1 U / mL apirase (Sigma). Buffer (11 μL) was added to one of the remaining samples to determine the overall signal, and alprenolol (11 μL) was added to the last sample to determine the background signal (final concentration 100 μM). The samples were incubated at 4°C for 2 hours (or at 20°C for 1 hour). 3H-dihydroalprenolol (Perkin Elmer) was added to each well (11 μL) to obtain a final concentration of 10 nM (β84 Kd < ). The sample was incubated at 4°C for 2 hours (or at 20°C for 1 hour). The sample was filtered on a 96-well GF / B filtration pre-auto (Millipore) and pre-immersed in lysis buffer containing 0.1% PEI. The plate was washed three times (200 μL) with ice-cold washing buffer (20 mM Tris, 100 mM NaCl, 1 mM MgCl2 (pH 7.5)). The plate was dried, the filter was perforated and placed in a scintillation vial. Scintillant (4 mL) was added, the sample was incubated overnight, and then tritium was measured using a liquid scintillation counter. The data was counted using a Beckmann-Coulter scanner. The data was analyzed using the "1-site-logIC50 fit" function in Prism (GraphPad).

[0343] Example 3: Application MEGA domains have a wide range of applications in the design of therapeutic agents for regulating GPCR and G protein activity.

[0344] Stabilization of GPCRs during purification GPCRs are structurally dynamic and contribute to their poor thermal stability in detergents. 69 The MEGA domain has the potential to stabilize GPCRs structurally and thermally, thus improving the efficiency of the purification procedure.

[0345] Thermal stabilization of GPCRs in their fully active three-dimensional structures MEGA domains may significantly improve the thermal stability of the GPCRs they bind to. However, a further dramatic improvement in stability may be achieved through mutagenic thermal stabilization of the receptor while it is encompassed with the MEGA domain. 88The resulting MEGA-StaR complex is highly stable and suitable even for the most demanding applications. Furthermore, GPCRs thermally stabilized in this manner adopt a fully active conformation even in the absence of the MEGA domain or ligand, offering unique opportunities for drug design.

[0346] Structural determination of GPCRs in their fully active three-dimensional structures The stabilizing properties of the MEGA domain enable high-resolution structural determination of the high-affinity agonist-bound state of GPCRs using both X-ray crystallography and NMR.

[0347] Fragment library screening for appropriately activated GPCRs MEGA domains may also be a useful tool for fragment library screening using both structural and non-structural methods. There is strong evidence suggesting that once a ternary G protein-GPCR complex is formed, the ligand can be removed from the binding pocket without causing complex dissociation, and that hydroxylamine treatment of a nucleotide-free rhodopsin-transducin complex induces hydrolysis of the Schiff base bond between rhodopsin and retinal, resulting in the release of retinal oxime. 14 However, this does not cause dissociation of the complex or decay to the inactive opsin of the Meta-II photochemical state, and furthermore, the chromophore moiety appears to remain in its open three-dimensional structure. 14 Therefore, it may be possible to produce ligand-free MEGA-GPCR complexes in which the empty ligand-binding pocket maintains a high-affinity agonist-binding conformation. Ligand-free complexes represent ideal substrates for fragment library screening using biophysical methods or crystal immersion techniques. These complexes are also crucial for the design of agonists to target orphan receptors.

[0348] Screening for compounds that block specific G protein-GPCR interfaces While the ligand-binding pockets and extracellular surfaces of GPCRs are primary targets used in drug design, downstream signaling proteins also possess significant therapeutic potential. Several peptides and small molecules that modulate the G protein α subunit have been reported. 70~72 While these molecules generally target a single class of G proteins, the irregular nature of G protein signaling means they are not suitable for therapeutic applications. The structure of MEGA-GPCR complexes allows for the design of small molecules that target specific G protein-receptor interfaces. Thus, signaling through a particular G protein-receptor pair can be inhibited while simultaneously preserving the activity of both the receptor and the G protein in other signaling cascades.

[0349] Development of cell-based assays Due to their monomeric properties, MEGA domains are useful for developing fluorescence assays to test receptor / G protein coupling in vivo.

[0350] Understanding the molecular mechanisms of receptor specificity The MEGA domain may also allow us to determine the molecular mechanisms of receptor specificity beyond the Gα-GPCR interface. The MEGA domain can be reconstituted with different combinations of βγ subunits, and these GPCR-MEGA-βγ complexes may be more compliant with crystallization than complete G protein-GPCR complexes. Therefore, we can study the interaction between the receptor C-terminus and the βγ subunit. This could enable the design of allosteric modulators that can target specific GPCR-G protein complexes based on the βγ component of the G protein heterotrimer.

[0351] MEGA domain as a therapeutic agent The MEGA domain can be manipulated to sequester GPCRs, βγ subunits, or downstream effectors. These dominant-negative variants may themselves be beneficial therapeutic agents, for example, in cancer therapy.

[0352] Example 4: Adenosine A bound to the manipulated G protein 2A Receptor structure introduction G protein-coupled receptors (GPCRs) are essential components of the systemic chemocellular signaling network. To understand the molecular mechanisms of signaling, the structures of receptors in both their inactive and active configurations coupled to heterotrimeric G proteins are necessary. Here, we examine the structure of adenosine A2 bound to mini-Gs, a highly engineered G protein. 2A Receptor (A 2A We report the first structure of R) at a resolution of 3.4 Å. Mini-Gs is similar to, but not identical to, the interface between the β2-adrenergic receptor and Gs, but is a broad interface (1048 Å). 105 ) via A 2A It binds to R. A is bound to mini-Gs. 2A The structure of R identifies key amino acid residues involved in the transition of the receptor from the agonist-binding active intermediate state to the fully active G protein-binding state. This structure highlights both the diversity and similarities in GPCR-G protein coupling, suggesting the potential complexity of the molecular basis of G protein specificity.

[0353] Adenosine has four different adenosine receptors in humans: A1, A1, A2 2A , A 2B It is a signaling molecule that activates A3 and is involved in a wide range of physiological processes, including angiogenesis, immune function, and sleep regulation. 104、105 (This is outlined in [reference]). In addition, there is strong evidence that high concentrations of extracellular adenosine are harmful to cellular health and contribute to the pathological effects observed in neurodegenerative diseases, inflammatory disorders, cancer, and ischemia-reperfusion injury. 106 (This is outlined in [reference]). Therefore, there is considerable interest in the development of subtype-specific agonists and antagonists for adenosine receptors. Over the past 40 years, a wide range of compounds have been developed by conventional medicinal chemistry. 105、107 More recently, adenosine A for potential treatment of Parkinson's disease. 2A Receptor (A 2AStructural drug design is being carried out to develop novel antagonists for R). 108 A 2A R-targeting agonists (legadenoson) have been approved by the FDA for myocardial perfusion imaging. 107 A3R-specific agonists are currently under development for their anti-cancer and anti-inflammatory properties. 109 .

[0354] Reverse agonist 110~112 or agonist 1、4、113 A combined into one of the following 2A Structural comparisons of R have revealed the molecular determinants of subtype specificity and efficacy. However, the mechanism of receptor activation that enables coupling to G proteins and the criteria for G protein selectivity are not fully understood. Inactive state A 2A The structure of R is antagonist ZM241385 110~112 XAC 110 caffeine 110 , or 1,2,4-triazine 108 It has been determined that it binds to one of the following, and all of their structures are very similar. Intramembrane Na can act as an allosteric antagonist. + Ions were identified at the highest resolution structure (1.8 Å). 115 Then, homologous Na + The ions were identified using other high-resolution structures of the GPCR. 96、116、117 A 2A The four agonist binding structures of R are also adenosine 1 NECA 1 CGS21680 113 , or UK432097 4 The determination was made after co-crystallization with one of the following. All structures are very similar and are thought to represent the three-dimensional structure of the receptor's active intermediate, rather than the fully active receptor that binds to the G protein. 1 Observations supporting this conclusion include the presence of major rotational isomerization of conserved amino acid residues associated with the activation of other GPCRs, but not the absence of significant migration of the cytoplasmic terminals of transmembrane rix 6(H6) away from the receptor core. 2AThe G protein-coupled state of R exhibits higher affinity binding to agonists compared to the uncoupled state. 118 However, it is unclear whether the agonist binding structures determined to date describe the binding pocket with a high-affinity or low-affinity three-dimensional structure. 2A In contrast to R, crystallization of either β1AR or β2AR bound to the agonist resulted in an inert stereostructure that was only slightly different from the structure bound to the antagonist. 2、3 Therefore, it is clear that β2AR exists as a structural ensemble regardless of whether it is bound to an antagonist, an agonist, or not bound to a ligand at all, and that the presence of an agonist increases the possibility of forming an active state. Subsequently, the active state is formed by the binding of a G protein. 10 or G protein mimics (nanobodies) 38 It is stabilized by A. 2A To elucidate the structure of the activated state of R, we determined its structure when bound to an engineered G protein.

[0355] result G protein binding A 2A R structure The only reported structure exists for a GPCR bound to a heterotrimeric G protein, namely Gs-bound β2AR. Crystallization was a true solution requiring the development of a specific nanobody Nb35 to stabilize the Gαβγ trimer by binding at the interface between Gα and Gβ, fusion of T4-lysozyme to the N-terminus of β2AR, use of a novel monoolein derivative MAG7:7 for mesocrystalline crystallization, and complex purification and crystallization procedures. β2AR-Gs structure 10 This demonstrated that virtually all contact between the receptor and the G protein occurs at the Gα subunit, and therefore, Gβγ is unnecessary for complex formation. Accordingly, we employ an alternative approach of manipulating the Gαs subunit to make it more compliant with the formation of sufficiently regular crystals, which should, in principle, enable the crystallization of any Gs-coupled receptor in its activated state. 120We developed miniature G proteins, mini-Gs, which include cleavage forms of the GTPase domain of Gαs, containing eight point mutations to stabilize the protein in the absence of Gβγ and in the presence of detergent. 120 The cleavage involves the switch III region, 23 amino acids from the N-terminus, and the α-helical domain, all of which will be beneficial for crystallization by reducing the structural heterogeneity of the complex. Mini-Gs again bring about the increased agonist affinity that occurred during the incubation of the receptor in the presence of heterotrimeric G proteins, which is the allosteric antagonist Na + They also showed the same sensitivity to the presence of (Figures 15 and 16). In addition, mini-Gs showed A in the presence of the agonist NECA. 2A It readily forms a complex with R, and this complex is particularly effective in short-chain detergents, where NECA-bonded A 2A It was significantly more thermally stable than R (Figure 17). This complex crystallized in detergent octylthioglucoside by vapor diffusion, and data sets were collected from two crystals (see further methods). A 2A The R-mini-Gs structure is NECA bonded A 2A R structure (PDB ID: 2YDV) 1 and the Gαs GTPase domain derived from the β2AR-Gs complex (PDB ID: 3SN6) 10 The structure was determined by molecular substitution using this as a search model, and its structure was refined to 3.4 Å (Table 6).

[0356] Two mini-Gs-A per crystallographically asymmetric unit, consisting of either chains A and C (complex AC) or chains B and D (complex BD) 2A The R complex exists. Complex AC (chain A:A 2A The best electron density was observed in R, chain C:mini-Gs), A 2A Figure 18 shows the density of the agonist NECA bound to R and the density of GDP molecules bound to mini-Gs. Chain B(A) in complex BD. 2AWhile R) also contained NECA density, chain D (mini-Gs) did not contain density corresponding to GDP. The reason why the two mini-Gs molecules differ in terms of GDP occupancy is unclear from this structure, as the structures are substantially identical (rmsd 0.12 Å across 1127 atoms), and the GDP site in chain D is near extracellular loop 2 of the symmetry-associated receptor (chain A), although this loop is irregular and does not suggest that it prevents nucleotide binding. The presence of GDP in the mini-Gs structure reflects the characteristics of the engineered G protein, which becomes insensitive to GTPγS-mediated dissociation after complex formation. 120 Therefore, this structure can be considered a complex between the GPCR and the GDP-binding G protein before GDP is dissociated. Two A units within the symmetric unit 2A The R molecule is also virtually identical (rmsd 0.05 Å across 1665 atoms), but due to the outward movement of the cytoplasmic terminals of transmembrane helix 6 (H6, discussed below), the previously determined A 2A The R structure is remarkably different. The structural alignment of complex AC and complex BD indicates that the mini-Gs are slightly oriented differently between receptors due to a 3° rotation of the GTPase domain relative to the receptor, and the mini-Gs and A 2A This results in a slightly different packing between R and A (Figure 19). This may be due to the presence of GDP in the other complex rather than in one, but it appears more likely to arise from differences in lattice contact. Even if so, this is due to the flexible nature of the activating G protein and the receptor, resulting in mini-Gs and A 2A This may represent the natural variation at the interface with R. All subsequent analyses show that the electron density of complex AC is particularly low for mini-Gs and A 2A Some of the residues involved in the interaction with R have been better defined and can therefore be discussed in relation to complex AC.

[0357] A in complex AC 2A The interface between R and mini-Gs is formed between the 20 amino acid residues of the receptor and the 17 residues of the mini-Gs (Figures 19, 20, and 21), and is 1048 Å long to the receptor.105 This includes the total buried surface area. It is noteworthy that of the 20 amino acid residues in contact with mini-Gs, there are 6 Arg residues, 10 hydrophobic residues, and 2 Gln residues. The main regions within the receptor that come into contact with mini-Gs are found at the cytoplasmic terminal of H3, cytoplasmic loop 2 (CL2), the cytoplasmic terminal of H5, 3 residues in H6, and the positively charged region at the turn between H7 and H8 (Figure 20). In mini-Gs, contact is A 2A The interaction is primarily carried out by an α5 helix containing 14 amino acid residues that fill the residues in H3, CL2, H5, H6, H7, and H8 of R. Additional interactions are carried out by A 2A His41 in β-sheet S1 contacts the residue in CL2 in R. S1.2 Val217 during S3 S3.1 , and Asp215 in the loop between S2 and S3 S2S3.1 Includes (Figure 22, superscripts indicate the CGN system of G proteins) 103 ). A 2A The amino acid residues in R and mini-Gs fill the interface together through six polar interactions and primarily van der Waals interactions, forming a complementary surface (approximately 90% contact). This complementarity is such that Leu110 is His41 S1.2 Val217 S3.1 , Phe376 H5.8 Cys379 H5.11 , and Arg380 H5.12 Located within the pocket formed from, A for residues in S1, S3, S2-S3 loop, and α5 2A This is particularly evident in the filling of the sequence PLRY within CL2 of R. Helix α5 is formed by the outward migration of the cytoplasmic terminal of H6. 2A Tyr391, which protrudes into the mid-crack within the cytoplasmic surface of R and is the tip of the α5 helix. H5.23 However, Arg102 forms the entire upper surface of the central crack. 3.50 This generates widespread van der Waals interactions (superscripts refer to the Ballesteros-Weinstein numbering system for GPCRs). 121(Figure 22). The overall orientation of the α5 helix can also be facilitated by a favorable helical dipole between the receptor H8 and α5, which form nearly adjacent refractive helices.

[0358] AR-Gs structure and A 2A Comparison of the receptor-G protein interface in β2 with the R-mini-Gs structure. A 2A Superposition of the R-mini-Gs complex receptor and the β2AR-Gs complex receptor. 10 This shows that these receptors have very similar structures (rmsd 1.7 Å across 1239 atoms), with most of the differences occurring in the extracellular region where the amino acid sequences differ most (Figure 22). In contrast, the intracellular surfaces of these receptors align very well and include a large outward shift of the cytoplasmic terminal of H6. However, the mini-Gs do not precisely overlap the Gα subunit of the heterotrimeric G protein bound to β2AR (Figure 22), exhibiting an orientation difference of approximately 15°, whereas in the case of the α5 helix, this difference is smaller (approximately 10°). This is in comparison to β2AR. 2A This is a result of different amino acid residues in R (Figures 18 and 22), which leads to slightly different filling of the G protein into the receptor. However, the alignment of mini-Gs and Gαs bound to β2AR shows that they are essentially identical (rmsd 0.92 Å across 1158 atoms), with the most significant difference being the 8° tilt between the respective α5 helices, resulting in a 3.7 Å displacement of Cα at Tyr391 in mini-Gs away from the G protein core (Figure 23). Impressively, mini-Gs-A compared to the Gs-β2AR interface. 2A The most significant difference at the R interface also occurs in this region as a result of different amino acid sequences at the H7-H8 boundary. 2A In R, H7 is a sequence S at an equivalent position in β2AR where none of these residues are in contact with Gαs. 7.56 Compared to PDFRI, Arg291 7.56 Terminates with array R 7.56Forms IREFR (the italicized amino acid residue does not come into contact with mini-Gs), A 2A In R, Arg291 7.56 is a carbonyl group Tyr391 H5.23 It forms hydrogen bonds with Arg291, and van der Waals contacts also occur. 7.56 In mini-Gs, this occurs at helix α5 by Ile292 and Arg293. Another region of the receptor that differs in the presence / absence of contact with each of their respective G proteins is at the end of H5. In β2AR, H5 is A, where this region is irregular in structure. 2A Compared to R, it extends the number of turns, and probably A 2A This is because the Cl3 loop in R is 18 amino acid residues shorter than that in β2AR. Therefore, in β2AR, A 2A An additional contact that is not present in the R-mini-Gs structure is present in the receptor (Ile233) 5.72 Lys235 5.74 , Ser236 5.75 , and Arg239 5.78 ) and Gαs(Asp323 H4.3 Asp343 H4.23 , Leu346 H4.26 Arg347 H4.27 T350 H4S6.3 , and Y358 H4S6.11 This takes place between (Figures 17 and 18).

[0359] There are significant differences in receptor-G protein contact, but many similarities also exist (Figure 3). For example, at the cytoplasmic terminal of H3, A 2A Carbonyl group lle in both R and β2AR 3.54 and Arg 3.55 (Thr in β2AR) 3.55 ) hydrogen bond Ile 3.54 -Gln H5.16 and Arg 3.55 -Arg H5.12 It forms a complex, but in the β2AR-Gs complex, Gln H5.16 is, A 2A In R, Ala is Glu 5.64 It creates additional hydrogen bonds in the side chain of Gln.5.68 While G proteins form two hydrogen bonds, in β2AR, the two hydrogen bo...

Claims

1. A naturally occurring variant of the parent heterotrimeric G protein alpha (Gα) subunit, wherein the variant is in a common Gα numbering (CGN) system. (i) Having the deletion of all amino acid residues at the N-terminus of HN43, (ii) Having a deletion in the region between the last residue of helix 1 (G.H1) and the three N-terminal amino acid residues of the first amino acid residue of beta sheet 2 (G.S2), (iii) Having a deletion of 10 amino acid residues between S4H3.4 and S4H3.15, (iv) The following positions: Each residue has different amino acids at the positions corresponding to S1H1.3, S1H1.4, S4.7, S4H3.3, H3.8, H5.4, and H5.7, and each residue is Asp S1H1.3 Asn S1H1.4 Asp S4.7 Asp S4H3.3 Asp H3.8 , Ala H5.4 , and Ile H5.7 It was mutated into, Furthermore, the variant of the Gα subunit is capable of binding to a GPCR in the absence of the heterotrimeric G protein beta (Gβ) subunit and the heterotrimeric G protein gamma (Gγ) subunit, and is a variant of the parent heterotrimeric Gα subunit.

2. (i) The above-mentioned mutant is Ile / Leu HN43 It has the deletion of all amino acid residues at the N-terminus, (ii) Having a deletion in the region between the last residue of helix 1 (G.H1) and the three N-terminal amino acid residues of the first amino acid residue of beta sheet 2 (G.S2), (iii) Tyr S4H3.4 and Asn / Ser S4H3.15 and having a deletion of 10 amino acid residues between them, (iv) Position below: Gly S1H1.3 , Glu S1H1.4 , Ala / Ser S4.7 , Ser / Gly / Glu S4H3.3 Leu / Ile H3.8 Ile / Val H5.4 , and Val H5.7 It has different amino acids at the corresponding positions, and each residue is Asp S1H1.3 Asn S1H1.4 Asp S4.7 Asp S4H3.3 Asp H3.8 , Ala H5.4 , and Ile H5.7 It was mutated into, Furthermore, the variant of the Gα subunit is capable of binding to a GPCR in the absence of the heterotrimeric G protein beta (Gβ) subunit and the heterotrimeric G protein gamma (Gγ) subunit, and is a variant of the parent heterotrimeric Gα subunit.

3. The aforementioned naturally occurring parental heterotrimer Gα subunit has the amino acid sequence of SEQ ID NO: 92, SEQ ID NO: 142, SEQ ID NO: 149, or SEQ ID NO:

155. A mutant of the naturally occurring parent heterotrimer Gα subunit as described in claim 1.

4. The aforementioned different amino acids are Gly49 S1H1.3 , Glu50 S1H1.4 , Ala249 S4.7 Ser252 S4H3.3 Leu272 H3.8 Ile372 H5.4 , and Val375 H5.7 Corresponding to the position, and each residue is Asp49 S1H1.3 Asn50 S1H1.4 Asp249 S4.7 Asp252 S4H3.3 Asp272 H3.8 , Ala372 H5.4 and Ile375 H5.7 A variant of the naturally occurring parent heterotrimer Gα subunit according to claim 1, which is substituted in the following way.

5. (i) The binding of the mutant Gα subunit to the GPCR increases the affinity of the GPCR for the agonist, and / or (ii) The binding of the mutant Gα subunit to the GPCR activates the Gα subunit, and / or (iii) The mutant Gα subunit has increased stability under denaturation conditions compared to its parent Gα subunit, and / or is expressed at a higher level than its parent Gα subunit when expressed in a cell, and / or (iv) The mutant Gα subunit can stabilize the agonist conformation of the GPCR upon binding to the GPCR, and / or (v) The mutant Gα subunit is capable of binding to a nucleotide and / or to the Gβ and / or Gγ subunits of a heterotrimeric G protein. A mutant of the naturally occurring parent heterotrimer Gα subunit as described in claim 1.

6. A variant of the naturally occurring parental heterotrimer Gα subunit according to claim 5, wherein the nucleotide (v) is a guanine nucleotide.

7. (i) The mutant Gα subunit has at least 20% sequence identity with the amino acid sequence of the long isoform of the human Gα-s subunit shown in Figure 1 (SEQ ID NO: 92), and / or (ii) The mutant Gα subunit contains one or more dominant-negative mutations compared to the parent Gα subunit, and / or (iii) The mutant Gα subunit is a mutant Gαt subunit in which the amino acid residue at the position corresponding to Cys 347, according to the numbering of the Gαt subunit shown in Figure 25, is chemically modified. A mutant of the naturally occurring parent heterotrimer Gα subunit as described in claim 1.

8. A variant of the naturally occurring parent heterotrimer Gα subunit according to claim 7, wherein the amino acid residue (iii) is carboxymethylated or cyanylated.

9. (i) A mutant Gα subunit according to claim 1 to 5 or 7 that can bind to a GPCR, (ii) GPCR and A complex that includes this.

10. The complex according to claim 9, wherein the GPCR is a class 1 GPCR, a class 2 GPCR, or a class 3 GPCR.

11. The complex according to claim 10, wherein the GPCR is one of a beta-adrenergic receptor, an adenosine receptor, a muscarinic receptor, or a neurotensin receptor.

12. The complex according to any one of claims 9 to 12, wherein the GPCR exists in an agonist or antagonist three-dimensional structure.

13. The complex according to any one of claims 9 to 12, wherein the GPCR is a mutant GPCR having increased stability in a particular three-dimensional structure under denaturing conditions compared to the stability of its parent GPCR in the same particular three-dimensional structure under denaturing conditions, and the particular three-dimensional structure is selected from an agonist three-dimensional structure or an antagonist three-dimensional structure.

14. The composite according to any one of claims 9 to 13, wherein one or both of (i) and (ii) are detectably labeled.

15. The complex according to any one of claims 9 to 14, further comprising a GPCR ligand.

16. The complex according to claim 15, wherein the GPCR ligand is any of a small molecule, protein, peptide, protein scaffold, nucleic acid, ion, carbohydrate, or antibody.

17. The complex according to any one of claims 9 to 16, further comprising a G protein βγ subunit.

18. The complex according to any one of claims 9 to 17, further comprising a nucleotide.

19. The complex according to claim 18, wherein the nucleotide is a guanine nucleotide.

20. The complex according to claim 19, wherein the guanine nucleotide is GDP or GTP.

21. The complex according to claim 18, wherein the nucleotide is a xanthine nucleotide.

22. (i) A variant Gα subunit according to claim 1 to 5 or 7 that can bind to a GPCR, and (ii) A polynucleotide or expression vector that can encode a GPCR.

23. The polynucleotide or expression vector according to claim 22, wherein the polynucleotide encoding the mutant Gα subunit according to claim 1 to 5 or 7 has at least 20% sequence identity with any of the polynucleotide sequences from SEQ ID NOs: 46 to 90.

24. A host cell comprising a polynucleotide encoding the mutant Gα subunit according to claim 1 to 5 or 7.

25. The host cell according to claim 24, wherein the polynucleotide has at least 20% sequence identity with any of the polynucleotide sequences from sequence numbers 46 to 90.

26. A solid support on which the mutant Gα subunit according to claim 1 to 5 or 7 or the complex according to claim 9 is immobilized.

27. A method for producing crystals of a GPCR-Gα subunit complex, (i) To provide the mutant Gα subunit and GPCR according to claim 1 to 5 or 7, (ii) Forming a complex of the mutant Gα subunit and the GPCR, (iii) Crystallizing the composite to form crystals, Methods that include...

28. A method for producing crystals of a GPCR-Gα subunit complex, (i) To provide the mutant Gα subunit, GPCR and GPCR ligand according to claim 1 to 5 or 7, (ii) Forming a complex of the mutant Gα subunit, the GPCR and the GPCR ligand, (iii) Crystallizing the composite to form crystals, Methods that include...

29. The method according to claim 27 or 28, wherein the GPCR is crystallized into an agonist or antagonist stereostructure.

30. A method for determining the structure of a GPCR in a specific three-dimensional structure, comprising providing the GPCR-Gα subunit complex described in claim 9, and determining the structure of the complex, The method wherein the aforementioned specific three-dimensional structure is selected from either an agonist structure or an antagonist structure.

31. A method for selecting a variant of the parent heterotrimer Gα subunit according to claim 1 to 5 or 7, wherein the method is (a) To provide one or more variants of the parent heterotrimeric Gα subunit in the absence of the beta and gamma subunits of the parent heterotrimeric G protein, (b) To provide GPCRs, (c) A method comprising determining whether the above or each mutant Gα subunit can bind to the GPCR in the absence of heterotrimeric G protein beta (Gβ) subunit and heterotrimeric G protein gamma (Gγ) subunit, and selecting a mutant that can bind to the GPCR.

32. The method according to claim 31, further comprising determining whether the or each mutant Gα subunit can stabilize the agonist conformation of the GPCR upon binding to the GPCR.

33. The method according to claim 31 or 32, wherein, prior to step (c), the GPCR is exposed to a drug capable of stabilizing the agonist stereostructure.

34. The method according to claim 33, wherein the drug is a nanobody.

35. The method according to any one of claims 31 to 34, wherein the GPCR is provided in a membrane-containing composition.

36. The method according to any one of claims 31 to 35, further comprising determining whether the mutant Gα subunit has increased stability under denaturation conditions compared to its parent Gα subunit, and / or determining whether, when expressed intracellularly, the mutant Gα subunit is expressed at a higher level than its parent Gα subunit.

37. The method according to any one of claims 31 to 36, wherein the GPCR is a mutant GPCR having increased stability in its agonist conformation under denaturation conditions compared to the stability of its parent GPCR in the same agonist conformation under denaturation conditions.

38. A method for stabilizing GPCRs in a specific three-dimensional structure, (a) To provide a mutant Gα subunit and a target GPCR according to claim 1 to 5 or 7, (b) A complex of the mutant Gα subunit and the GPCR, wherein the GPCR forms a complex in which it is stabilized in a specific three-dimensional structure, Includes, A method wherein the aforementioned specific three-dimensional structure is an agonist structure or an antagonist structure.

39. The method according to claim 38, wherein the mutant Gα subunit is immobilized on a solid support.

40. The method according to claim 38 or 39, wherein the target GPCR is provided as a solution containing the GPCR in multiple stereostructural states.

41. The method according to any one of claims 38 to 40, further comprising purifying the complex.

42. A method for selecting a GPCR having increased stability, (a) One or more mutants of the parent GPCR And to provide the mutant Gα subunit according to claim 1 to 5 or 7, (b) Selecting a ligand that binds to the parent GPCR when the parent GPCR exists in a specific three-dimensional structure, (c) Determining whether the above or each mutant GPCR has increased stability with respect to binding to the selected ligand or the mutant Gα subunit compared to the stability of the parent GPCR with respect to binding to the ligand or the mutant Gα subunit, (d) Selecting a mutant that has increased stability compared to the parent GPCR with respect to binding to the selected ligand or to the mutant Gα subunit, Includes, The aforementioned specific three-dimensional structure is an agonist three-dimensional structure, and the selected ligand is derived from the agonist class of the ligand, or A method wherein the aforementioned specific three-dimensional structure is an antagonist three-dimensional structure, and the selected ligand is derived from the antagonist class of the ligand.

43. The method according to claim 42, wherein one or more variants of the parent GPCR come into contact with the selected ligand before step (c).

44. The method according to claim 42 or 43, wherein a mutant GPCR having increased stability under denaturation conditions is selected.

45. The method according to claim 44, wherein the modification conditions are one or more of the following: heat, a modification detergent, a chaotropic agent, and a pH of 5.5 or less or 8.5 or more.

46. A method for identifying the binding partner of a GPCR, (a) To provide the composite according to claim 9, (b) To provide one or more test compounds, (c) Determining whether the above or each test compound binds to the complex, (d) Isolating one or more test compounds that bind to the complex, Methods that include...

47. The method according to claim 46, wherein the complex provided in step (a) does not contain a GPCR ligand.

48. The method according to claim 46 or 47, wherein the method is used for fragment library screening.

49. The method described above is (i) Determining whether the above or each test compound binds to the different complex described in claim 9, (ii) Isolating the or each test compound that does not bind to the different complex described in claim 9, The method according to any one of claims 46 to 48, further comprising:

50. The method according to claim 49, wherein the different complex comprises a Gα subunit of a different class than the Gα subunit in the complex of step (a), and / or a GPCR different from the GPCR in the complex of step (a).

51. A method for identifying the binding partner of a Gα subunit, (a) To provide the mutant Gα subunit according to claim 1 to 5 or 7, (b) To provide one or more test compounds, (c) To determine whether the above or each test compound binds to the mutant Gα subunit, (d) Isolating one or more test compounds that bind to the mutant Gα subunit, Methods that include...

52. A method for evaluating the binding between a G protein and a GPCR, To provide a mutant Gα subunit according to claim 1 to 5 or 7, and a GPCR, To evaluate the binding between the mutant Gα subunit and the GPCR, Methods that include...

53. A method for evaluating the effect of drugs on the coupling between G proteins and GPCRs, To provide a mutant Gα subunit according to claim 1 to 5 or 7, and a GPCR, A method comprising evaluating the effect of the drug on the coupling between the mutant Gα subunit and the GPCR.

54. The method according to claim 52 or 53, wherein the mutant Gα subunit is fluorescently labeled.

55. The method according to any one of claims 52 to 54, wherein the mutant Gα subunit and the GPCR are provided into the cell.

56. The method according to any one of claims 52 to 55, wherein the method is performed in vitro.

57. A method for selecting or designing one or more binding partners for a GPCR, G protein, or GPCR-G protein complex, (a) To provide a three-dimensional structural representation of the mutant Gα subunit according to claim 1 to 5 or 7 or the complex according to claim 9, (b) Using molecular modeling means for selecting or designing one or more binding partners for the GPCR, G protein, or GPCR-G protein complex, A method in which, in (b) above, the three-dimensional structural representation of at least a portion of the mutant Gα subunit or complex is compared with the three-dimensional structural representation of one or more candidate binding partners, and one or more binding partners that are predicted to interact with the GPCR, G protein, or GPCR-G protein complex are selected.

58. A method for analyzing the interaction between one or more binding partners and a GPCR, G protein, or GPCR-G protein complex, (a) To provide a three-dimensional structural representation of the mutant Gα subunit according to claim 1 to 5 or 7 or the complex according to claim 9, (b) To provide a three-dimensional structural representation of one or more binding partners that are compatible with the mutant Gα subunit or complex, (c) Adapting one or more bonding partners to the structure, Methods that include...

59. The three-dimensional structural representation of the mutant Gα subunit according to claim 1 to 5 or 7 or the complex according to claim 9 is To provide a mutant Gα subunit according to claim 1 to 5 or 7 or a complex according to claim 9, Determining the three-dimensional structure of the mutant Gα subunit or complex, The method according to claim 57 or 58, obtained by...

60. The method according to claim 57 or 58, further comprising modifying the structural representation of the one or more binding partners so as to increase or decrease the interaction between the one or more binding partners and a GPCR, a G protein, or a GPCR-G protein complex.

61. A pharmaceutical composition comprising a mutant Gα subunit according to claim 1 to 5 or 7, or the complex according to claim 9.

62. Use of the mutant Gα subunit according to claims 1 to 5 or 7 or the complex according to claim 9 for crystallization, or in cryo-electron microscopy, or in drug discovery, or in ligand-binding screen or assay development, or as a bysensor.