Agents and methods for regulating creatine kinase expression

Abstract

This technology provides a way to regulate the expression of creatine kinase (CK). [Solution] A CK expression regulator comprising chondroitin sulfate oligosaccharide as an active ingredient. The expression regulator according to the present invention may be used to reduce CK in the blood, to suppress CK expression in the kidney, or to promote CK expression in muscle tissue. According to the present invention, it is expected that excessive or inappropriate enhancement of CK, or excessive or inappropriate reduction, can contribute to the prevention or improvement of diseases and ill health conditions in which the onset or worsening of these conditions is a factor.

Description

Technical Field

[0001] The present invention relates to an agent and method for regulating the expression of creatine kinase using chondroitin sulfate oligosaccharide as an active ingredient, and the use of chondroitin sulfate oligosaccharide for producing an agent for regulating the expression of creatine kinase.

Background Art

[0002] Creatine kinase (EC 2.7.3.2) is a dimeric enzyme with a molecular weight of about 82,000 consisting of two subunits. Creatine kinase (CK) is also called creatine phosphokinase (CPK), and catalyzes the production of creatine and ATP (adenosine-5'-triphosphate) from creatine phosphate and ADP (adenosine-5'-diphosphate), as well as the reverse reaction. CK is abundantly present in muscles and the brain in vivo, and supplies a large amount of ATP required when these tissues undergo metabolic turnover. That is, CK synthesizes creatine phosphate, which is a storage substance of high-energy compounds, when the ATP concentration is high during rest / quiet, and resynthesizes ATP from ADP and creatine phosphate during metabolic turnover.

[0003] The direct energy source for muscle contraction is ATP, and the supply routes of this ATP include production by oxidative phosphorylation during aerobic respiration and resynthesis from creatine phosphate and ADP during anaerobic conditions. CK is responsible for the latter route, and the rate of transfer of the phosphate group from creatine phosphate to ADP by CK is higher than the maximum rate of ATP production by oxidative phosphorylation, enabling rapid supply of ATP in tissues.

[0004] There are two types of CK subunits: type B (brain type) and type M (muscle type), and humans possess the genes that encode each. Combinations of these two subunits result in three types of CK isozymes (CK-MM, CK-MB, and CK-BB) present in the cytoplasm. CK-MM is abundant in skeletal muscle, CK-MB in cardiac muscle, and CK-BB in brain and smooth muscle. Additionally, mitochondria contain mitochondral CK (MtCK), which has two isoforms: sarcomeric MtCK (sMtCK) and ubiquitous MtCK (uMtCK).

[0005] Because CK leaks into the bloodstream when the muscle tissue in which it is distributed is damaged, the amount (activity level) or type of CK in the blood is used as an indicator of certain diseases. Diseases that show high levels of CK in the blood include rhabdomyolysis, hypothyroidism, diabetes mellitus, mental and behavioral disorders due to alcohol use, muscular dystrophy, acute myocardial infarction, myocarditis, polymyositis, dermatomyositis, hypoparathyroidism, and cerebrovascular disease. Diseases that show low levels of CK in the blood include hyperthyroidism, rheumatoid arthritis, systemic lupus erythematosus, and Sjögren's syndrome (Non-patent Literature 1).

[0006] Furthermore, it has been reported that high blood CK activity may increase the risk of blood coagulation disorders or bleeding because CK in the blood reduces ADP (which is necessary for platelet aggregation) by consuming it as a substrate (Non-Patent Literature 2). Abnormal bleeding is a particularly significant risk for people using antiplatelet drugs, for example, in the treatment of thrombosis. According to Non-Patent Literature 2, when CK was added to human plasma, ADP-induced platelet aggregation was suppressed in a dose-dependent manner, and in the plasma of healthy men, the higher the endogenous CK activity, the less ADP-induced platelet aggregation was observed. It has also been shown that ADP-induced platelet aggregation disappeared in plasma with high blood CK activity after strenuous exercise, while ADP-induced platelet aggregation recovered to the normal range in plasma with normal CK activity after rest.

[0007] On the other hand, chondroitin sulfate (CS) is a type of glycosaminoglycan that has a structure in which sulfate groups are attached to a long sugar chain consisting of a disaccharide repeat structure of uronic acid and N-acetyl-D-galactosamine. Due to the presence of numerous sulfate groups, it is strongly negatively charged and has excellent water retention and elastic properties. In the body, it is widely distributed not only in cartilage but also in connective tissue such as skin and all kinds of tissues such as the brain, and interacts with cell growth factors and extracellular matrix components to control various cellular activities such as cell adhesion, migration, proliferation, differentiation, and morphogenesis. In particular, it is known to play an important role in the cushioning effect in cartilage. The present inventors have succeeded in developing a technology to produce chondroitin sulfate oligosaccharide (CS oligosaccharide) with excellent solubility and absorption into the body by hydrolyzing CS under high temperature and high pressure conditions to reduce its molecular weight (Patent Document 1). [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] Patent No. 6146733 [Non-patent literature]

[0009] [Non-Patent Document 1] PHC Group, LSI Medience, HOME > Products & Services > Clinical Tests > WEB Comprehensive Test Guide > Biochemical Tests > Enzymes > CK (CPK), [online], [Searched October 11, 2024], Internet<https: / / data.medience.co.jp / guide / guide-01030008.html> [Non-Patent Document 2] Horjus, DL et al., Creatine kinase inhibits ADP-induced platelet aggregation., Scientific Reports 4 : 6551, 2014, DOI: 10.1038 / srep06551 [Overview of the Initiative] [Problems that the invention aims to solve]

[0010] As mentioned above, CK is an enzyme that plays an important role in energy metabolism, and both excessive increases and decreases in its expression or activity are undesirable for the body. This is evident from the fact that both high and low levels of blood CK are used as indicators of disease. In other words, if the activity or expression of CK can be regulated to an appropriate range, beneficial effects on the body can be expected through metabolic regulation. Therefore, the present invention aims to provide a technology that can regulate the expression of CK. [Means for solving the problem]

[0011] The inventors diligently conducted research to explore novel applications for CS oligosaccharides and discovered that CS oligosaccharides can regulate CK expression. Based on this finding, they completed the following inventions.

[0012] (1) The CK expression regulator according to the present invention contains CS oligosaccharide as an active ingredient.

[0013] (2) The CK expression regulator according to the present invention may also be used to reduce CK in the blood. That is, the present invention also provides a CK reducing agent in the blood, which contains CS oligosaccharide as an active ingredient.

[0014] (3) The agent in (2) above may be used to suppress muscle tissue damage. That is, the present invention also provides a muscle tissue damage inhibitor comprising CS oligosaccharide as an active ingredient.

[0015] (4) The agent in (2) above may be used to suppress abnormal bleeding. That is, the present invention also provides an agent for suppressing abnormal bleeding, which contains CS oligosaccharide as an active ingredient. In the present invention, abnormal bleeding refers to excessive bleeding caused by a failure of the hemostatic mechanism.

[0016] (5) The CK expression regulator according to the present invention may be used to suppress the expression of CK in the kidney. That is, the present invention also provides an inhibitor for suppressing the expression of CK in the kidney, which contains CS oligosaccharide as an active ingredient.

[0017] (6) The agent in (5) above may be used to suppress the decline of renal function. That is, the present invention also provides an inhibitor for suppressing the decline of renal function, which contains CS oligosaccharide as an active ingredient.

[0018] (7) The CK expression regulator according to the present invention may be used to promote the expression of CK in muscle tissue. That is, the present invention also provides an accelerator for promoting the expression of CK in muscle tissue, which contains CS oligosaccharide as an active ingredient.

[0019] (8) The agent in (7) above may be used to improve muscle strength and / or muscle endurance. That is, the present invention also provides an agent for improving muscle strength and / or muscle endurance, which contains CS oligosaccharide as an active ingredient.

[0020] (9) In the present invention, the CS oligosaccharide may have 2 to 38 constituent sugars (sugar residues).

[0021] (10) The method for regulating the expression of CK according to the present invention includes a step of regulating the expression of CK in the human or animal by administering CS oligosaccharide to the human or animal.

[0022] (11) The use according to the present invention is the use of CS oligosaccharide for manufacturing a CK expression regulator.

[0023] (12) The method for reducing CK in the blood according to the present invention comprises a step of reducing CK in the blood of a human or an animal by administering CS oligosaccharide to the human or the animal. This method may be a method for suppressing damage to the muscle tissue of a living body by reducing CK in the blood. Further, this method may be a method for suppressing abnormal bleeding in a living body by reducing CK in the blood.

[0024] (13) The method for suppressing the expression of CK in the kidney according to the present invention comprises a step of suppressing the expression of CK in the kidney of a human or an animal by administering CS oligosaccharide to the human or the animal. This method may be a method for suppressing a decline in kidney function by suppressing the expression of CK in the kidney.

[0025] (14) The method for promoting the expression of CK in the muscle tissue according to the present invention comprises a step of promoting the expression of CK in the muscle tissue of a human or an animal by administering CS oligosaccharide to the human or the animal. This method may be a method for improving muscle strength and / or muscle endurance by promoting the expression of CK in the muscle tissue.

[0026] The present invention may be implemented excluding medical acts from the viewpoint of industrial applicability.

Advantages of the Invention

[0027] According to the present invention, the expression of CK can be regulated. Thereby, it is expected that excessive or inappropriate elevation, or excessive or inappropriate decrease of CK can contribute to the prevention or improvement of diseases and unhealthy states in which the onset or exacerbation thereof is caused by such factors. The present invention can be used for all applications in which it is meaningful to regulate the expression of CK.

[0028] For example, according to the present invention, it is possible to reduce CK in the blood. As mentioned above, CK is mainly expressed in muscle and brain cells, and blood CK is an indicator of cell damage in the tissues in which it is distributed. Therefore, if blood CK can be reduced, it is expected that the effect of suppressing damage to the relevant tissues in the body and protecting those tissues will be obtained.

[0029] Furthermore, as mentioned above, high blood CK activity can increase the risk of bleeding through a decrease in blood ADP. According to the present invention, since CK in the blood can be reduced, it is expected to have the effect of reducing the risk of bleeding, that is, the effect of suppressing abnormal bleeding.

[0030] Furthermore, for example, according to the present invention, the expression of CK in the kidney can be suppressed. Excessive acceleration of energy metabolism in organs such as the kidney can lead to exacerbation of inflammatory responses and tissue damage, and organ exhaustion. In such cases, suppressing the expression of CK can be expected to suppress inflammation, damage, and exhaustion in the organ, and thus suppress the decline in organ function. In addition, it is thought that suppressing the expression of CK in the kidney can suppress the supply of ATP to Na / K-ATPase, that is, suppress the reabsorption of Na, and thus is expected to have the effect of suppressing blood pressure by suppressing plasma Na concentration and blood flow.

[0031] Furthermore, for example, the present invention can promote the expression of CK in muscle tissue. As mentioned above, since CK is responsible for the rapid supply of ATP in muscle, this can be expected to improve muscle strength and muscle endurance. [Brief explanation of the drawing]

[0032] [Figure 1] This is a structural formula showing the disaccharide CS oligosaccharide (CS2). The left side shows the CS2 structure with a saturated non-reducing end, and the right side shows the CS2 structure with a double bond between the C4-C5 non-reducing ends. [Figure 2] This figure schematically shows the CS hydrolysis apparatus used in the example. [Figure 3]This line graph shows the change in serum creatine kinase activity before and after the ingestion of the test food or placebo food. [Figure 4] This bar graph shows the expression levels of the CK-M gene in kidney cells cultured in the absence of CS2 sugar (no-CS2 group) or in the presence of CS2 sugar (CS2 group). [Figure 5] This bar graph shows the expression levels of the CK-B gene in the kidney tissue of rats raised with or without CS oligosaccharide intake (control group) or with CS oligosaccharide intake (test group). [Figure 6] This bar graph shows the expression levels of the CK-B gene in abdominal aortic tissue of rats raised with or without CS oligosaccharide intake (control group) or with CS oligosaccharide intake (test group). [Figure 7] This bar graph shows the expression levels of the CK-M gene in abdominal aortic tissue of rats raised with or without CS oligosaccharide intake (control group) or with CS oligosaccharide intake (test group).

[0033] The present invention will be described in detail below.

[0034] A CK expression regulator refers to a composition that has the effect of regulating CK expression, or a composition used for the purpose of bringing about such an effect in a living organism.

[0035] Regulating CK expression means suppressing or promoting CK expression in any cell, tissue, or organ, whether in vivo or of living origin.

[0036] Suppressing CK expression means reducing the enzyme activity of CK, the amount of CK protein, or the transcription level of the CK gene (hereinafter sometimes referred to as "CK activity, etc.") compared to the case where the present invention is not used. In other words, suppressing CK expression includes reducing the degree of increase in CK activity, etc., even if it does not increase or change.

[0037] To promote CK expression means to increase CK activity, etc., compared to the case where the present invention is not used. In other words, promoting CK expression includes reducing the degree of decrease in CK activity, etc., even if it decreases or does not change.

[0038] Reducing CK levels in the blood means making the enzyme activity or protein amount of CK in the blood smaller compared to when the present invention is not used. In other words, reducing CK levels in the blood includes reducing the degree of increase in the enzyme activity or protein amount of CK, even if it does not increase or change.

[0039] The enzyme activity of CK can be confirmed by methods known to those skilled in the art. For example, in the case of blood CK, as shown in the examples described later, the CK in the sample generates creatine and ATP from creatine phosphate and ADP, then generates glucose-6-phosphate from this ATP and glucose in the presence of hexokinase, and then generates 6-phosphogluconate from glucose-6-phosphate and NADP in the presence of glucose-6-phosphate dehydrogenase, and simultaneously measures the increase in absorbance at 340 nm due to the NADPH produced. This method can be easily carried out using commercially available kits.

[0040] The transcription level of the CK gene can be confirmed by methods known to those skilled in the art. For example, quantitative PCR can be used as shown in the examples described later. Specifically, a test substance is added to the culture medium of cells derived from tissue known to express the CK gene, and quantitative PCR is performed using primers specific to the CK gene. Primers specific to the CK gene can be designed based on the nucleotide sequences of known CK genes. Examples of known nucleotide sequences include the human CK-B gene (NCBI Reference Sequence: NC_000014.9 (REGION: 103519667-103522830), total length 3164 bp, SEQ ID NO: 1), the human CK-M gene (NCBI Reference Sequence: NC_000019.10 (REGION: 45306413-45322875), total length 16463 bp, SEQ ID NO: 2), the mouse (house mouse) CK-B gene (NCBI Reference Sequence: NC_000078.7 (REGION: 111635789-111638772), total length 2984 bp, SEQ ID NO: 3), and the mouse (house mouse) CK-M gene (NCBI Reference Examples include Sequence:NM_007710.2 (REGION:19145019-19155508), total length 10490 bp, SEQ ID NO: 4), the CK-B gene from Norwegian rats (NCBI Reference Sequence:NC_086024.1 (REGION:136550583-136553464), total length 2882 bp, SEQ ID NO: 5), and the CK-M gene from Norwegian rats (NCBI Reference Sequence:NC_086019.1 (REGION:88189382-88199717), total length 10336 bp, SEQ ID NO: 6).

[0041] CS oligosaccharides are those that have a structure (chondroitin sulfate structure) in which a sulfate group is bonded to a sugar chain consisting of a disaccharide repeating structure of uronic acid and N-acetyl-D-galactosamine, and have fewer constituent sugars (sugar residues) than chondroitin sulfate. In this invention, chondroitin sulfate may be referred to as "high molecular weight CS" or "high molecular weight CS" in contrast to CS oligosaccharides.

[0042] Here, it is difficult to precisely determine the molecular weight and sugar content of high-molecular-weight CS, as these can vary depending on the extraction method from the raw materials. However, the following has been reported. The molecular weight of CS is 30,000 to 50,000 (approximately equivalent to 120 sugars to 200 sugars) (Chemical Dictionary (2nd edition), ISBN 978-4-627-24012-4, Morikita Publishing, December 2009). The molecular weight of CS is 20,000 (approximately equivalent to 80 sugars) (World Encyclopedia, 2nd Edition, edited by Hitachi Digital Heibonsha, ISBN 978-4-582-04101-9, Heibonsha, October 1998). The mass of chondroitin sulfate derived from bovine tracheal cartilage was 15 kDa (approximately equivalent to 60 sugars), and the mass of chondroitin sulfate derived from whale cartilage was 21 kDa (approximately equivalent to 80 sugars) (Igarashi et al., Effect of Molecular Sizes of Chondroitin Sulfate on Interaction with L-Selectin, International Journal of Carbohydrate Chemistry, Vol.2013, Article ID 856142, May 8, 2013). The mass of chondroitin sulfate derived from ray cartilage was 124 kDa (approximately equivalent to 500 units of sugar) (Hashiguchi et al., Demonstration of the hepatocyte growth factor signaling pathway in the in vitro neuritogenic activity of chondroitin sulfate from ray fish cartilage. Biochimica et Biophysica Acta - General Subjects, 1810, 406-413 (2011)). Furthermore, according to the product catalog, the molecular weight of commercially available shark-derived chondroitin sulfate sodium (Seikagaku Corporation, compliant with the Japanese Pharmacopoeia Standards for Non-Official Drugs) is approximately 20,000 (product grade: ND-K, roughly equivalent to 80 sugars) and approximately 30,000 (product grade: GK, roughly equivalent to 120 sugars). From these findings, it can be concluded that the molecular weight of high-molecular-weight CS is approximately in the range of 15,000 to 124,000, and the number of sugars is approximately in the range of 60 to 500.

[0043] The number of sugar molecules in CS oligosaccharides should be greater than that of monosaccharides, but less than that of high-molecular-weight CS (which typically have 60 to 500 sugar molecules). Specific examples of the number of sugar molecules in CS oligosaccharides include, for example, disaccharides, trisaccharides, tetrasaccharides, pentasaccharides, sextose, heptoses, heptoses, octasaccharides, neptoses, decasaccharides, elevensaccharides, dodecoses, thrombosaccharides, quadrisaccharides, 1fteensaccharides, 1xusaccharides, 17saccharides, 18saccharides, 19saccharides, 20saccharides, 21saccharides, 22saccharides, 23saccharides, 24saccharides, 25saccharides, 26saccharides, 27saccharides, 28saccharides, 29saccharides, 30saccharides, 31saccharides, 32saccharides, 33saccharides, 34saccharides, 35saccharides, 36saccharides, 37saccharides, 38saccharides, 39saccharides, 40saccharides, 41saccharides, 42saccharides, 43saccharides, 44saccharides, 45saccharides, 46saccharides, 47saccharides, and 48saccharides.

[0044] While high molecular weight CS is not absorbed in the intestinal tract when ingested orally, CS oligosaccharides are low molecular weight and therefore have high permeability through the intestinal wall, allowing them to be absorbed directly into the body from the intestinal tract after oral ingestion (International application PCT / JP2021 / 3414, Japanese Patent No. 6146733: paragraphs

[0081] -

[0086] , [Figure 18], [Figure 19]). CS oligosaccharides absorbed into the body are thought to migrate into the bloodstream and exert CK-modulating effects in various tissues (Hiroko Mizuta et al, Quantification of orally administered chondroitin sulfate oligosaccharides in human plasma and urine, Glycobiology, Volume 33, Issue 9, September 2023, Pages 755-763, https: / / doi.org / 10.1093 / glycob / cwad054).

[0045] CS oligosaccharides may be obtained by chemical synthesis, or by decomposing high-molecular-weight CS using known methods to reduce its molecular weight. Alternatively, commercially available CS oligosaccharides (for example, "nano-type chondroitin (Marukyo Biofoods)") may be used.

[0046] Examples of methods for reducing the molecular weight of CS include hydrolysis under high temperature and high pressure conditions (175°C ≤ temperature T ≤ 220°C and 5 MPa ≤ pressure P ≤ 25 MPa) (Japanese Patent No. 6146733), hydrolysis with an acid such as hydrochloric acid (Cifonelli, Carbohydrate Res., Vol. 2, pp. 150-161, 1966), desorption or hydrolysis using enzymes such as chondroitinase ABC, chondroitinase ACII, testicular hyaluronidase, and CS-degrading enzyme (Japanese Patent Publication No. 9-168384), and maintaining an aqueous solution of CS with a pH of 2.5 to 12.0 under hydrothermal conditions of 100 to less than 160°C for 5 to less than 20 minutes (Japanese Patent Publication No. 2010-77256).

[0047] Of the methods described above, the hydrolysis method can yield CS oligosaccharides with a saturated structure at the non-reducing end (saturated type). Here, the saturated type refers to a structure in which there is no double bond between the carbon atoms at positions 4 and 5 (C4-C5) of the uronic acid residue located at the non-reducing end of the oligosaccharide, while the unsaturated type refers to a structure in which there is a double bond at C4-C5. Figure 1 shows the saturated and unsaturated structures of a disaccharide CS oligosaccharide (CS2). Saturated CS oligosaccharides are less likely to be assimilated by intestinal bacteria and can be transferred into the bloodstream while maintaining the chondroitin sulfate structure (International application PCT / JP2021 / 3414; Example 3, etc.). Therefore, saturated CS oligosaccharides are considered to be more easily absorbed by the body.

[0048] Furthermore, saturated CS oligosaccharides do not absorb ultraviolet light at a wavelength of 240 nm, while unsaturated CS oligosaccharides do absorb light at this wavelength. Therefore, by subjecting a sample to HPLC and detecting it at a wavelength of 240 nm with a UV detector, it is possible to determine whether it is saturated or unsaturated CS oligosaccharides based on whether or not a peak is detected.

[0049] Examples of structures (disaccharide unit structures) that CS possesses include the glucuronic acid-N-acetyl-D-galactosamine 4-sulfate structure (so-called chondroitin sulfate A structure), the glucuronic acid-N-acetyl-D-galactosamine 6-sulfate structure (so-called chondroitin sulfate C structure), the iduronic acid-N-acetyl-D-galactosamine 4-sulfate structure (so-called chondroitin sulfate B structure, also called dermatan sulfate), the glucuronic acid 2-sulfate-N-acetyl-D-galactosamine 6-sulfate structure (so-called chondroitin sulfate D structure), the glucuronic acid-N-acetyl-D-galactosamine 4,6-sulfate structure (so-called chondroitin sulfate E structure), the glucuronic acid 2-sulfate-N-acetyl-D-galactosamine 4,6-sulfate structure (so-called chondroitin sulfate T structure), and the O structure, which lacks a sulfate group bond. Even within a single polymer CS, the bonding of sulfate groups is heterogeneous; therefore, in many cases, a single polymer CS is thought to possess multiple structures. In the present invention, CS mainly containing any of the above structures can be used.

[0050] When obtaining CS oligosaccharides by decomposing CS, commercially available raw material CS extracted from animal cartilage, etc., may be used. The composition ratio of disaccharide units in CS contained in animal cartilage (the ratio of disaccharide units of a specific structure to the total number of disaccharide units contained in CS) is known to vary depending on the source animal. Chondroitin sulfate derived from the cartilage of cartilaginous fish such as rays, sharks, chimaeras, and whale sharks is mainly composed of chondroitin sulfate C, but also contains chondroitin sulfates A, D, E, and O. On the other hand, chondroitin sulfate derived from the cartilage of mammals such as cows, whales, rabbits, sheep, and pigs, and birds such as chickens, is mainly composed of chondroitin sulfate A, but also contains chondroitin sulfates C and O. Chondroitin sulfate derived from the cartilage of mollusks such as squid is mainly composed of chondroitin sulfate E, but also contains chondroitin sulfates A, C, and O. The disaccharide unit composition ratio of chondroitin sulfate in cartilaginous fish is, for example, chondroitin sulfate C:chondroitin sulfate D = 50-70:1-10, and it also contains chondroitin sulfate O, A, E, etc.

[0051] The disaccharide unit composition ratio of CS can be quantified by treating CS with chondroitinase to produce unsaturated disaccharides, separating them by high-performance liquid chromatography (HPLC), and detecting the peaks corresponding to each disaccharide unit (A, C, etc.) of CS (see JHFA Product Description: Chondroitin Sulfate Foods, published August 20, 2015, Japan Health & Nutrition Food Association, pp. 13-18). Furthermore, the origin of CS can be determined by "animal-derived DNA testing" or "animal-derived protein testing" based on the DNA or proteins remaining in CS (for example, see Japan Food Research Laboratories, http: / / www.jfrl.or.jp / item / allergens / post-62.html).

[0052] CS oligosaccharides can be used by administering them to the living body of a human or animal. Examples of administration methods include oral administration, subcutaneous injection, intravenous injection, intramuscular injection, intrathecal injection, sublingual administration, oral mucosal administration, rectal administration, vaginal administration, eye drops, ear drops, nasal administration, oral inhalation, spray inhalation, and transdermal administration.

[0053] Since CS oligosaccharides exhibit a CK-regulating effect, they can be used to manufacture CK regulators. Furthermore, since CS oligosaccharides exhibit an effect of reducing blood CK levels, they can be used to manufacture agents that reduce blood CK levels. Furthermore, since the reduction in blood CK levels is thought to be due to the suppression of damage to biological tissues such as muscles, CS oligosaccharides can be used to manufacture muscle tissue damage inhibitors. Furthermore, since CS oligosaccharides exert an effect of suppressing CK expression in the kidneys, they can be used to manufacture agents that suppress CK expression in the kidneys. Furthermore, because CS oligosaccharides are expected to suppress the decline in renal function and protect it by inhibiting CK expression in the kidneys, they can be used to manufacture agents that suppress the decline in renal function. Furthermore, since CS oligosaccharides have the effect of promoting CK expression in muscle tissue, they can be used to produce CK expression promoters in muscle tissue. Furthermore, since promoting CK expression in muscle tissue leads to smoother and faster ATP supply, and is expected to improve muscle strength and endurance, CS oligosaccharides can be used to manufacture agents that improve muscle strength and / or endurance.

[0054] The formulations according to the present invention can take the form of CS oligosaccharides, which are the active ingredient, or other forms of ordinary food and beverages such as confectionery, beverages, processed foods, health foods, and infant foods, as well as animal feed, pet food, and beverages for livestock, racehorses, and companion animals (animal feed, etc.), pharmaceuticals, quasi-drugs, supplements, food additives, feed additives, and cosmetics. These can be manufactured by methods known to those skilled in the art.

[0055] The CS oligosaccharide content in food and beverages (food compositions) varies depending on the form of the food or beverage, but can be, for example, 0.001 to 99% by mass, 0.01 to 80% by mass, or 1 to 80% by mass (measured by HPLC) based on dry mass. Since animal feed, etc., is almost the same as food and beverages except that the target is animals, the descriptions of food and beverages in this specification can also be applied to animal feed, etc.

[0056] The CS oligosaccharide content in pharmaceuticals, quasi-drugs, supplements, food additives, and feed additives varies depending on the dosage form, but can be, for example, 0.001 to 90% by mass, 0.01 to 85% by mass, or 0.1 to 80% by mass (measured by HPLC) based on dry mass.

[0057] Furthermore, the amount of CS oligosaccharide in cosmetics varies depending on the dosage form, but can be, for example, 0.0001 to 80% by mass, 0.001 to 60% by mass, or 0.01 to 50% by mass (measured by HPLC method) based on dry mass.

[0058] The recommended daily dose (intake) of CS oligosaccharide can be appropriately determined depending on the product form of the agent according to the present invention, the age, weight, sex of the recipient, the method of administration, and based on non-clinical or clinical test results. Specifically, examples of recommended daily doses of CS oligosaccharide include 10 mg / day or more, 20 mg / day or more, 30 mg / day or more, 40 mg / day or more, 50 mg / day or more, 60 mg / day or more, 70 mg / day or more, 80 mg / day or more, 90 mg / day or more, 100 mg / day or more, and 2000 mg / day or less.

[0059] The duration of administration of CS oligosaccharides can be set as appropriate, but it is preferable to take them repeatedly over a long period of time. Specific examples of intake periods include, for example, 1 day or more, 3 days or more, 1 week or more, 2 weeks or more, 3 weeks or more, 4 weeks or more, 5 weeks or more, 6 weeks or more, 7 weeks or more, or 8 weeks or more.

[0060] The present invention will be described below based on various examples. The technical scope of the present invention is not limited to the features shown in these examples. [Examples]

[0061] <Example 1> Production of CS Oligosaccharide 280 kg of ray cartilage was placed in an oblique-axis kneader, and 300 g of papain was added while stirring. The mixture was reacted at 55°C for 3 hours. After inactivation by maintaining the temperature at 92°C for 10 minutes, the mixture was passed through a wire mesh for coarse filtration, and the filtrate was collected. The filtrate was cooled to 50°C, 10 kg of diatomaceous earth was added as a filter aid and stirred well. The mixture was then filtered using a pressurized filter to obtain a pale yellow, clear filtrate. The filtrate was subjected to a filter equipped with an ultrafiltration membrane with a molecular weight cutoff of 13000 and dialyzed for 12 hours with water added as needed. The internal solution (dialysis retained solution) was collected, heat-sterilized at 92°C, and then spray-dried using a spray dryer to obtain 10.2 kg of white powder, which was used as crude purified chondroitin sulfate (high molecular weight chondroitin sulfate).

[0062] Crudely purified chondroitin sulfate was hydrolyzed under high temperature and high pressure to obtain the oligosaccharide chondroitin sulfate. Specifically, first, an oligosaccharide production apparatus (Figure 2) described in Japanese Patent Publication No. 6146733 was prepared. That is, as shown in Figure 2, the apparatus consists of a water container for distilled water, a high-pressure pump A (Millflow controlled capacity pump M150 pulseless C24-Z3, Nikkiso), a heater (electric heater), a sensor A, a raw material container for raw materials, a high-pressure pump B (Millflow controlled capacity pump M150 pulseless C23-X1, Nikkiso), a mixing T-tube, and a reaction section (stainless steel 316 piping with a lumen diameter of 0.5 mm (internal space volume of 46,800 mm³) 3 ~191000mm 3 The system consists of a water bath, a sensor B, a sensor C, a back pressure valve (High Pressure / Back Pressure 26-1762-66-314, TESCOM), and a product container for holding the reaction products. The water container, raw material container, and product container are all connected by stainless steel piping. The inlet temperature of the reaction section is monitored by sensor B, and the outlet temperature by sensor C. The pressure is monitored by sensor D.

[0063] 10 kg of crudely purified chondroitin sulfate was dissolved in 500 L of water and adjusted to Brix 2.0 to prepare the raw material solution. Degassed distilled water was placed in a water container and continuously pumped using high-pressure pump A, then heated with a heater. The raw material solution was placed in a raw material container and continuously pumped using high-pressure pump B. The heated distilled water and the raw material solution at room temperature were mixed in a mixing T-tube at the inlet of the reaction section, and hydrolysis was carried out in the reaction section by reacting the water with the chondroitin sulfate contained in the raw material solution. The reaction conditions were a reaction section temperature of 175-220°C, a reaction section pressure of 5-25 MPa, and a reaction time of 8.8 seconds. Subsequently, the reaction was quickly terminated by directly cooling the stainless steel piping in a water bath. After that, the pressure in the stainless steel piping was reduced using a back pressure valve, and the reaction product was collected in a product container. The flow rate of the distilled water was set to at least three times the flow rate of the raw material solution.

[0064] The reaction product was subjected to a filtration apparatus equipped with an ultrafiltration membrane with a molecular weight cutoff of 450, and ultrafiltration was carried out while adding ion-exchanged water to the internal retaining liquid as appropriate several times. Finally, the internal retaining liquid, which had been concentrated and purified to a Brix of approximately 3-4, was recovered and spray-dried with a spray dryer to obtain CS oligosaccharide powder. The CS oligosaccharide obtained thereby mainly contains oligosaccharides with 2 to 12 constituent sugars (Japanese Patent Publication No. 6146733: paragraphs

[0057] ,

[0060] , [Figure 6], [Figure 7]). Furthermore, since the CS oligosaccharide was obtained by hydrolysis, it has a structure in which the non-reducing end is saturated. In addition, since ray cartilage is used as a raw material, it contains 60% or more chondroitin sulfate C.

[0065] Furthermore, the CS oligosaccharide powder obtained by the above method was dissolved in ion-exchanged water and subjected to gel filtration chromatography using a column packed with Biogel P-6 (Bio Rad) to fractionate it, and the disaccharide fraction was separated. Subsequently, it was purified by ion exchange chromatography packed with an anion exchange carrier NuviaQ (Bio Rad), then desalted by passing it through Biogel P-6 (Bio Rad), and freeze-dried to obtain a powder of disaccharide (CS disaccharide) having a chondroitin sulfate structure.

[0066] <Example 2> Evaluation of blood CK activity (1) Foods used in the test The CS oligosaccharide from Example 1 was mixed with crystalline cellulose and calcium stearate and compressed into tablets using a conventional method, which served as the test food. Similarly, crystalline cellulose alone was mixed with calcium stearate and compressed into tablets, which served as the placebo food. Table 1 shows the components per two tablets of each type. [Table 1]

[0067] (2) Subjects Thirty-nine Japanese men aged 40 to under 65 years (with systolic blood pressure of 130-139 mmHg and diastolic blood pressure of 89 mmHg or less at the time of screening) were randomly assigned by computer to either the test food group (20 men) or the placebo group (19 men), stratified by age and other factors using block randomization. During the study period, physicians, nurses, clinical research coordinators, and statistical analysts were unaware of the assignment information.

[0068] (3) Intake study (randomized, double-blind, parallel-group comparative study) The test food group received the test food, and the placebo group received the placebo, both at a dosage of two tablets per day for 12 weeks. Specifically, the test food provided 100 mg of CS oligosaccharide per person per day.

[0069] (4) Evaluation of serum CK activity Serum samples were prepared by collecting blood from subjects before the start of the intake period (week 0) and at the end of the intake period (week 12). CK activity (U / L) in the serum was measured using a standard method (JSCC standardized method) with a measurement kit. The measurement principle of this kit is as follows: First, creatine phosphate and ADP are used as substrates, and CK in the sample generates creatine and ATP. ATP reacts with glucose in the presence of hexokinase to produce glucose-6-phosphate. Glucose-6-phosphate is converted to 6-phosphogluconate by glucose-6-phosphate dehydrogenase, at which point NADP becomes NADPH, and the absorbance at 340 nm increases. Since the rate of increase in absorbance increases with higher CK activity, the CK activity value can be determined by measuring this. For each group, the mean value of the measured CK activity was calculated, and the p-value was calculated by testing the value at week 12 against the value at week 0 using the Wilcoxon signed-rank test. The results are shown in Figure 3.

[0070] As shown in Figure 3, serum creatine kinase activity (U / L) in the test food group (n=20) decreased significantly (P=0.013) at week 12 compared to before intake (week 0). On the other hand, no significant change was observed in the placebo group (n=19). In other words, serum creatine kinase activity decreased significantly in those who consumed the test food. From these results, it became clear that CS oligosaccharides can reduce CK in the blood.

[0071] <Example 3> Evaluation of CK gene expression levels in kidney-derived cultured cells (1) Administration to cultured cells DMEM medium (Nacalai Tesque) was supplemented with 10% fetal bovine serum (Biosera), and then MEM non-essential amino acid 100-fold concentrate (Nacalai Tesque) and antibiotic (Antibiotic Antimycotic Solution (100×)) (GIBCO) were added to create the culture medium. Normal rat kidney-derived epithelial cell-like cells NRK-52E (National Institute of Biomedical Innovation, Health and Nutrition, JCRB Cell Bank) were incubated in this medium at a rate of 0.75 × 10⁶ 5 After diluting to cells / mL, 1 mL was seeded into each well of a 12-well plate (CORNIG) and incubated in a CO2 incubator at 5% CO2 and 37°C for 24 hours. Subsequently, CS2 sugar from Example 1 was added to the culture medium to a concentration of 1 mg / mL to create the CS2-added group. A control group without the test substance was also established and designated as the no-addition group. Each group consisted of 6 wells (n=6). These were incubated for a further 24 hours under the same conditions.

[0072] (2) Analysis of gene expression levels by quantitative PCR After culturing was complete, 0.4 mL of the RNA extraction reagent "ISOGENII" (Nippon Gene) was added to each well to lyse the cells. Total RNA was extracted from the lysed cell solution according to the reagent's instructions. cDNA was synthesized from this total RNA by reverse transcription using the PrimeScript™ RT reagent Kit (Takara Bio) according to the intercalator protocol. 80 μL of ultrapure water was added to 10 μL of the reaction solution to prepare the cDNA solution.

[0073] Quantitative PCR was performed using TB Green® Fast qPCR Mix (Takara Bio) according to the attached instructions. The target genes for expression level detection were the CK-B gene encoding the B subunit of creatine kinase, the CK-M gene encoding the M subunit, and the GAPDH gene encoding glyceraldehyde 3-phosphate dehydrogenase (internal standard gene). The total volume of the reaction mixture was 10 μL, and 4 μL of cDNA solution was used as the template. The primers used were those shown in Sequence ID Nos. 1-6 below. PCR reaction and detection were performed using the LightCycler® 96 system (Roche). The reaction conditions were 40 cycles of shuttle PCR at 94°C for 5 seconds and 60°C for 10 seconds. 《Primers for CK-B gene amplification》 Forward primer: GCCGCCATGCCCTTCTC (SEQ ID NO: 7) Reverse primer: CTTAGACTTGAAGAGAGTTTC (SEQ ID NO: 8) 《Primers for CK-M gene amplification》 Forward primer: CCACAACAAGTTCAAGCTGAA (SEQ ID NO: 9) Reverse primer: AAGATCTCCTCAATCTTCTGC (SEQ ID NO: 10) Primers for amplifying the GAPDH gene Forward primer: TGATTCTACCCACGGCAAGT (SEQ ID NO: 11) Reverse primer: AGCATCACCCCATTTGATGT (SEQ ID NO: 12)

[0074] The expression levels of the CK-B and CK-M genes were calculated as a ratio (relative ratio) to the expression level of the GAPDH gene using Equation 1 below. The mean value of the relative ratio (n=6) was calculated for each test group, and Student's t-test was performed to test the test groups, with P<0.05 considered statistically significant. The quantitative results of CK-B gene expression levels are shown in Figure 4. Equation 1: Relative ratio = 2^"Cq value of CK-B gene or Cq value of CK-M gene" / 2^"Cq value of GAPDH gene"

[0075] As shown in Figure 4, the relative expression level of the CK-B gene was significantly lower (p<0.001) in the CS2-added group compared to the control group. On the other hand, the expression level of the CK-M gene was extremely low in both the CS2-added and control groups, making analysis impossible. In other words, CK-B gene expression was reduced in kidney cells cultured in the presence of CS2 sugar. From these results, it became clear that CS oligosaccharides can suppress CK expression in the kidney.

[0076] <Example 4> Evaluation of CK gene expression levels in kidney and muscle tissue (1) Administration to rats The standard rat feed "SP (specifications shown below *)" (Funabashi Farm) was used as the control sample. The CS oligosaccharide from Example 1 was added to this control feed at a concentration of 0.76 mg / g to prepare the test feed. *SP specifications: (Ingredients) Wheat flour, corn, bran, white fish meal, defatted soybeans, skim milk powder, soybean oil, salt, etc. (General composition) Moisture 8.0%, crude protein 20.8%, crude fat 4.8%, crude fiber 3.2%, ash 5.0%, soluble non-nitriles 58.2%.

[0077] Ten-week-old male SHR / Kpo rats (a spontaneous hypertension model) were divided into two groups: a control group (6 rats) and a treatment group (10 rats). After acclimatization until 11 weeks of age, they were reared under the following conditions for 12 weeks. Feed: The control group was given the control sample, and the treatment group was given the test feed, both of which were given free access to each other. Specifically, the dosage of CS oligosaccharide was set at 0 mg / day per animal in the control group and approximately 20 mg / day per animal in the treatment group. Drinking water: Tap water filtered with a 7μm filter was freely supplied via an automatic water dispenser. Temperature and humidity: Temperature 22±2℃. Relative humidity 50±10%. Light-dark cycle: Light period 7:00-19:00, Dark period 19:00-7:00.

[0078] During the rearing period, the amount of food and body weight were measured weekly to calculate the amount of food consumed and the intake of CS oligosaccharides. It has been reported that the dosage in rats can be converted to the dosage in adult humans using Equation 2 below (Shannon Reagan-Shaw et al., THE FASEB Journal, Vol. 22, March 2007, pp. 659-661 (especially Figure 1, TABLE 1)). Therefore, the daily CS oligosaccharide intake in rats (average value over the entire rearing period) was converted to the equivalent amount in adult humans using Equation 2. The results are shown in Table 2. Equation 2: Dosage in adult humans (g / kg body weight) = Dosage in rats (g / kg body weight) × 6 / 37 [Table 2]

[0079] (2) Analysis of gene expression levels by quantitative PCR After euthanizing the rats in each group of Example 4(1), the kidneys and abdominal aortas were promptly collected. Approximately 30 mg of each collected tissue was placed in a 1.0 mL tube, 0.4 mL of the RNA extraction reagent "ISOGENII" (Nippon Gene) was added, and the tube was flash-frozen by immersion in liquid nitrogen. The frozen tissue was stored at -78°C. For use, the frozen tissue was thawed at 4°C, one 5 mm diameter zirconia bead (Biomedical Science) was added to the tube, and the tissue was homogenized in a bead crusher for 30 seconds x 3 times. Total RNA was extracted from the homogenized tissue according to the reagent's instructions. Subsequently, cDNA was obtained by reverse transcription using the method described in Example 3(2), and then the expression levels of the CK-B gene and CK-M gene were measured by quantitative PCR. The mean relative ratio was calculated for each group, and a test interval test was performed using Student's t-test, with P<0.05 considered statistically significant. The results for the kidneys are shown in Figure 5, and the results for the abdominal aorta are shown in Figures 6 and 7, respectively.

[0080] As shown in Figure 5, in the kidney, the relative ratio of CK-B gene expression levels was significantly lower (p=0.042) in the test group compared to the control group. On the other hand, the expression level of the CK-M gene was extremely low in both the test and control groups, making analysis impossible. In other words, in rats that ingested CS oligosaccharides, CK-B gene expression in the kidneys decreased. From these results, it became clear that CS oligosaccharides can suppress CK expression in the kidneys.

[0081] On the other hand, in the abdominal aorta, as shown in Figure 6, the relative ratio of CK-B gene expression was significantly higher (p=0.020) in the test group compared to the control group. Also, as shown in Figure 7, the relative ratio of CK-M gene expression was also significantly higher (p=0.009) in the test group compared to the control group. In other words, in rats that ingested CS oligosaccharides, the expression of both CK-B and CK-M genes in the abdominal aorta increased. Here, the cells that make up arteries are endothelial cells and smooth muscle cells, and of these, it is thought that smooth muscle cells mainly express CK genes. Therefore, from these results, it is clear that CS oligosaccharides can promote CK expression in muscle tissue.

Claims

1. A creatine kinase expression regulator containing chondroitin sulfate oligosaccharide as the active ingredient.

2. The agent according to claim 1, used to reduce creatine kinase in the blood.

3. The agent according to claim 2, used to suppress damage to muscle tissue.

4. The agent according to claim 2, used to suppress abnormal bleeding.

5. The agent according to claim 1, used to suppress the expression of creatine kinase in the kidney.

6. The agent according to claim 5, used to suppress the decline in renal function.

7. The agent according to claim 1, used to promote the expression of creatine kinase in muscle tissue.

8. The agent according to claim 7, used to improve muscle strength and / or muscle endurance.

9. The agent according to any one of claims 1 to 8, wherein the number of constituent sugars of the chondroitin sulfate oligosaccharide is 2 to 38.

10. A method for regulating creatine kinase expression, comprising the step of regulating the expression of creatine kinase in a human or animal by administering chondroitin sulfate oligosaccharide to the human or animal.

11. Use of chondroitin sulfate oligosaccharides for the production of creatine kinase expression regulators.

Images