Methods to reduce HTT expression

Abstract

The present invention provides a method for mitigating Huntington's disease (HD), and a method for reducing HTT RNA and / or HTT protein in human subjects requiring a reduction in HTT RNA and / or HTT protein. [Solution] A method for reducing HD in a human subject requiring reduction of HD is provided, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide or a salt thereof.

Description

Technical Field

[0003] , , ,

[0001] Sequence Listing This application is filed in electronic format together with a sequence listing. This sequence listing is provided as a file named BIOL0380WOSEQ_ST25.txt with a size of 268 KB created on February 18, 2021. The information in the electronic format of this sequence listing is hereby incorporated by reference in its entirety into this specification.

[0002] Provided herein is a method of administering ISIS 443139 to a human subject who needs to reduce Huntington's disease, reduce HTT RNA, reduce mHTT RNA, reduce HTT protein, or reduce mHTT protein, in order to reduce Huntington's disease, reduce HTT RNA, reduce mHTT RNA, reduce HTT protein, or reduce mHTT protein. In certain cases, the method is useful for reducing at least one symptom of Huntington's disease. Such symptoms of Huntington's disease include, but are not limited to, brain atrophy, muscle atrophy, neurodegeneration, uncontrollable movement, dysphagia, dysarthria, anxiety, and depression.

Background Art

[0003] Huntington's disease (HD) is a fatal autosomal dominant neurodegenerative disease characterized by progressive chorea, mental changes, and intellectual decline. HD affects both males and females equally and occurs in all races (Gusella and MacDonald, Curr. Opin. Neurobiol. 1995 5:656-62). Selective cell loss and fibrillary astrocytoma are observed in the brains of HD patients, particularly in the caudate nucleus and putamen of the striatum, as well as in the cerebral cortex (Vonsattel, JP. et al., Neuropathol. Exp. Neurol. 1985, 44:559-577), and, less likely, in the hippocampus (Spargo, E. et al., J. Neurol. Neurosurg. Psychiatry 1993, 56:487-491) and the ventral thalamus (Byers, RK et al., Neurology 1973, 23:561-569). The symptoms of HD are due to neuronal death in many brain regions, but are most evident in the striatum, especially the caudate nucleus, where patients suffer from a progressive, gradual gradual loss of cells that ultimately kills the entire structure.

[0004] HD is caused by an expansion of the cytosine-adenine-guanine (CAG) trinucleotide repeat region in IT15, the gene encoding the huntingtin protein (HTT protein). The resulting expanded CAG repeat region encodes an abnormally long polyglutamine (PolyQ) tract within the HTT protein, leading to the expression of the mutant HTT (mHTT) protein. As a result of the excessive polyglutamine length, the mHTT protein forms aggregates in the cytoplasm and nucleus of CNS neurons (Davies). (et al., Cell 1997, 90:537-548). Due to its genomic instability, the expanded CAG repeat region may expand further with age and during meiotic transmission, potentially containing additional CAG repeats. Individuals with 27–35 CAG repeats typically do not develop HD, but their children are at risk of HD progression. Individuals with 35–60 CAG repeats typically experience HD that begins in adulthood. Individuals with more than 60 CAG repeats typically experience adolescent HD progression, with HD symptoms being experienced before the age of 20. Individuals with a normal number of CAG repeats (<27) are not considered to be at risk of HD progression. [Brief explanation of the drawing]

[0005] [Figure 1A] This shows the mean reduction in cerebrospinal fluid (CSF) mHTT protein trough concentration, as a percentage of baseline, at multiple time points in human subjects treated every four weeks with the modified oligonucleotide ISIS 443139. [Figure 1B] This shows the mean reduction in cerebrospinal fluid (CSF) mHTT protein trough concentration, as a percentage of baseline, at multiple time points in human subjects treated every 8 weeks with the modified oligonucleotide ISIS 443139. [Overview of the project]

[0006] This specification provides methods for alleviating Huntington's disease (HD), and for reducing HTT RNA and / or HTT protein in human subjects requiring a reduction in HTT RNA and / or HTT protein. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein. In certain embodiments, the method comprises administering a therapeutically effective amount of modified oligonucleotide. In certain embodiments, the modified oligonucleotide is ISIS 443139. In certain embodiments, the therapeutically effective amount is in the range of about 40 mg to about 200 mg. In certain embodiments, the therapeutically effective amount is about 120 mg. In certain embodiments, the therapeutically effective amount is administered once every 4 weeks. In certain embodiments, the therapeutically effective amount is administered once every 8 weeks. In certain embodiments, the therapeutically effective amount is administered once every 16 weeks. In certain embodiments, the method includes administering a loading dose of approximately 120 mg of ISIS 443139 approximately once every four weeks, followed by a maintenance dose of 120 mg of ISIS 443139 approximately once every eight weeks or approximately once every sixteen weeks. [Modes for carrying out the invention]

[0007] Please understand that both the general description above and the detailed description below are illustrative and descriptive only, and not limiting. In this specification, the use of the singular includes the plural unless otherwise explicitly stated. Where used herein, the use of "or" means "and / or" unless otherwise explicitly stated. Furthermore, the use of the term "including," as well as other forms such as "include" and "contained," is not limiting. Also, terms such as "element" or "component" include both elements and components containing one unit, and elements and components containing two or more subunits, unless otherwise explicitly stated.

[0008] The section headings used herein are for structural purposes only and should not be construed as limiting the subject matter described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference to the parts and in whole of the documents discussed herein.

[0009] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are well-known and commonly used in the art. Where permitted, all patents, patent applications, patent application publications, and other publications and data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0010] Unless otherwise indicated, the following terms have the meanings set forth below.

[0011] As used herein, "2'-deoxyribonucleoside" means a nucleoside containing a 2'-H(H)deoxyribosyl sugar moiety. In certain embodiments, 2'-de The oxyribonucleoside is a 2'-β-D-deoxyribonucleoside containing a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration similar to that found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxyribonucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).

[0012] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group instead of the 2'-OH group in the ribosyl sugar moiety. "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CH2OCH3 group instead of the 2'-OH group in the ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety exists in a β-D configuration. "MOE" refers to O-methoxyethyl.

[0013] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0014] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleic acid base.

[0015] As used herein, "approximately" means ±7% of the indicated value.

[0016] As used herein, “administer” means to provide a pharmaceutical drug to a human subject.

[0017] As used herein, “relief” in relation to treatment means that at least one symptom is improved compared to the same symptom without the treatment. In certain embodiments, relief is a decrease in the severity or frequency of a symptom, or a delay in the onset or progression of the severity or frequency of a symptom.

[0018] As used herein, “CAG repeat” means one of several consecutive trinucleotide units, each trinucleotide unit consisting of three consecutive nucleosides having the nucleic acid base sequence cytosine (C), adenine (A), and guanine (G) from 5' to 3'.

[0019] As used herein, "dosage" means the amount of medicinal drug being administered.

[0020] As used herein, "HTT RNA" refers to the RNA expression product of the human gene IT15. "mHTT RNA" refers to the RNA expression product of the human gene IT15 that contains 27 or more consecutive CAG repeats.

[0021] As used herein, "HTT protein" refers to the protein expression product of HTT RNA. "mHTT protein" refers to the protein expression product of mHTT.

[0022] As used herein, the term "internucleoside linkage" means a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. "Phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced by a sulfur atom.

[0023] As used herein, "IT15 gene" refers to the genomic sequence encoding HTT RNA. Generally, humans have two IT15 genes that can have the same or different nucleic acid base sequences.

[0024] As used herein, "loading dose" means a therapeutically effective amount of a pharmaceutical agent administered during an initial dosing period in which a steady-state concentration of the pharmaceutical agent is achieved. "Initial loading dose" means the first loading dose administered. "Final loading dose" means the most recently administered loading dose before administering the first maintenance dose.

[0025] As used herein, "maintenance dose" means a therapeutically effective amount of a pharmaceutical agent administered during a dosing period after a steady-state concentration of the pharmaceutical agent has been achieved.

[0026] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. "Unmodified nucleobase" refers to adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). "Modified nucleobase" is a moiety other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a target nucleic acid or nucleotide, regardless of any sugar or internucleoside linkage modification.

[0027] As used herein, "nucleoside" means a compound containing a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside containing a modified nucleobase and / or a modified sugar moiety. "Linked nucleosides" are nucleosides that are linked in a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides). As used herein, "oligonucleotide" means a chain of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified.

[0028] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to human subjects. Certain such carriers enable the formulation of pharmaceutical compositions into, for example, pills, tablets, coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral administration by human subjects. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0029] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart any undesirable toxicological effects to the parent compound.

[0030] As used herein, "potassium salt" means a salt of a modified oligonucleotide, where the cation of the salt is potassium.

[0031] As used herein, "RNA" means RNA transcripts, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0032] As used herein, "sodium salt" means a salt of a modified oligonucleotide, where the cation of the salt is sodium.

[0033] As used herein, “Subject” means human or non-human animal. In certain embodiments, the subject is a human subject. “Subject requiring it” means a subject that would benefit from administering the modified oligonucleotide disclosed herein. In certain embodiments, the subject requiring it has HD.

[0034] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” means a 2'-OH(H)β-D-ribosyl moiety found in RNA (“unmodified RNA sugar moiety”) or a 2'-H(H)β-D-deoxyribosyl moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or sugar surrogate.

[0035] As used herein, “symptom” means any physical feature or test result indicating the presence or degree of a disease or disorder. In certain embodiments, the symptom is evident to the subject or to the medical professional examining or testing the subject.

[0036] As used herein, "therapeutic dose" means the amount of a medicinal drug that produces a therapeutic effect in a human subject. For example, a therapeutic dose is one that improves the symptoms of a disease.

[0037] As used herein, “trough concentration” means the concentration of the sample (e.g., mHTT) in a biological sample taken from a human subject immediately before the human subject received the subsequent dose, or the concentration of the sample on the final day of the study.

[0038] As used in this specification, "week" means 7 days.

[0039] Specific Embodiments Embodiment 1. A method for alleviating Huntington's disease (HD) in a human subject requiring alleviation of HD, wherein the method involves applying the following chemical structure to the human subject:

[0040] [ka]

[0041] The method comprising administering a therapeutically effective amount of a modified oligonucleotide or a salt thereof, in accordance with (Sequence ID 4).

[0042] Embodiment 2. The method according to Embodiment 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

[0043] Embodiment 3. A method for reducing HD in a human subject requiring HD reduction, wherein the method involves applying the following chemical structure to the human subject:

[0044] [ka]

[0045] The method comprising administering a therapeutically effective amount of a modified oligonucleotide in accordance with (SEQ ID NO: 4).

[0046] Embodiment 4. A method for reducing HD in a human subject requiring reduction of HD, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide, wherein the modified oligonucleotide has the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (SEQ ID NO: 4), A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The above method, where o = phosphodiester nucleoside bond.

[0047] Embodiment 5. The method according to any one of Embodiments 1 to 4, wherein at least one symptom of HD is alleviated.

[0048] Embodiment 6. At least one of the above symptoms is characterized by brain atrophy, decreased brain activity, and decreased brain connectivity. The method according to Embodiment 5, including muscle atrophy, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning impairment, decreased attention, impaired visual processing, impaired working memory, decreased psychomotor speed, impaired verbal motor output, decreased independence, decreased emotional blunting, decreased learning ability, impaired mental connectivity, speech impairment, depression, irritability, anger, motor dysfunction, impaired self-care, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, or a combination thereof.

[0049] Embodiment 7. A method for reducing HTT RNA in a human subject requiring a reduction in HTT RNA, wherein the method involves applying the following chemical structure to the human subject:

[0050] [ka]

[0051] The method comprising administering a therapeutically effective amount of a modified oligonucleotide or a salt thereof, in accordance with (Sequence ID 4).

[0052] Embodiment 8. The method according to Embodiment 7, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

[0053] Embodiment 9. A method for reducing HTT RNA in a human subject requiring a reduction in HTT RNA, wherein the method involves applying the following chemical structure to the human subject:

[0054] [ka]

[0055] The method comprising administering a therapeutically effective amount of a modified oligonucleotide in accordance with (SEQ ID NO: 4).

[0056] Embodiment 10. A method for reducing HTT RNA in a human subject requiring a reduction in HTT RNA, the method comprising administering a therapeutically effective amount of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide has the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (SEQ ID NO: 4), A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The above method, where o = phosphodiester nucleoside bond.

[0057] Embodiment 11. A method for reducing HTT protein in a human subject requiring a reduction in HTT protein, wherein the method involves applying the following chemical structure to the human subject:

[0058] [ka]

[0059] The method comprising administering a therapeutically effective amount of a modified oligonucleotide or a salt thereof, in accordance with (Sequence ID 4).

[0060] Embodiment 12. The method according to Embodiment 11, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

[0061] Embodiment 13. A method for reducing HTT protein in a human subject requiring a reduction in HTT protein, wherein the method involves applying the following chemical structure to the human subject:

[0062] [ka]

[0063] The method comprising administering a therapeutically effective amount of a modified oligonucleotide in accordance with (SEQ ID NO: 4).

[0064] Embodiment 14. A method for reducing HTT protein in a human subject requiring a reduction in HTT protein, the method comprising administering a therapeutically effective amount of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide is chemically represented as follows (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo It has mCeo Aes mCe (SEQ ID NO: 4), A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The above method, where o = phosphodiester nucleoside bond.

[0065] Embodiment 15. The method according to any one of Embodiments 1 to 14, wherein the effective dose for the above treatment is 10 mg.

[0066] Embodiment 16. Any one of Embodiments 1 to 14, wherein the effective dose for the above treatment is 30 mg. The method used.

[0067] Embodiment 17. The method according to any one of Embodiments 1 to 14, wherein the effective dose for the above treatment is 60 mg.

[0068] Embodiment 18. The method according to any one of Embodiments 1 to 14, wherein the effective dose for the above treatment is 90 mg.

[0069] Embodiment 19. The method according to any one of Embodiments 1 to 14, wherein the amount effective for the above treatment is 120 mg.

[0070] Embodiment 20. The method according to any one of Embodiments 1 to 14, wherein the amount effective for the above treatment is approximately 10 mg.

[0071] Embodiment 21. The method according to any one of Embodiments 1 to 14, wherein the amount effective for the above treatment is approximately 30 mg.

[0072] Embodiment 22. The method according to any one of Embodiments 1 to 14, wherein the effective dose for the above treatment is approximately 60 mg.

[0073] Embodiment 23. The method according to any one of Embodiments 1 to 14, wherein the effective dose for the above treatment is approximately 90 mg.

[0074] Embodiment 24. The method according to any one of Embodiments 1 to 14, wherein the amount effective for the above treatment is approximately 120 mg.

[0075] Embodiment 25. The effective dose for the above treatment is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg. The method according to any one of Embodiments 1 to 14, wherein the amount is any one of g, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg.

[0076] Embodiment 26. The effective dose for the above treatment is approximately 5 mg, approximately 10 mg, approximately 15 mg, approximately 20 mg, approximately 25 mg, approximately 30 mg, approximately 35 mg, approximately 40 mg, approximately 45 mg, approximately 50 mg, approximately 55 mg, approximately 60 mg, approximately 65 mg, approximately 70 mg, approximately 75 mg, approximately 80 mg, approximately 85 mg, approximately 90 mg, approximately 95 mg, approximately 100 mg, approximately 105 mg, approximately 110 mg, approximately 115 mg, approximately 120 mg, approximately 125 mg, approximately 130 mg, approximately 135 mg, approximately 140 mg, approximately 145 mg, approximately 150 mg, approximately 155 mg, approximately 160 mg, approximately 165 mg, approximately The method according to any one of Embodiments 1 to 14, wherein the amount is any one of 170 mg, approximately 175 mg, approximately 180 mg, approximately 185 mg, approximately 190 mg, approximately 195 mg, approximately 200 mg, approximately 205 mg, approximately 210 mg, approximately 215 mg, approximately 220 mg, approximately 225 mg, approximately 230 mg, approximately 235 mg, approximately 240 mg, approximately 245 mg, approximately 250 mg, approximately 255 mg, approximately 260 mg, approximately 265 mg, approximately 270 mg, approximately 275 mg, approximately 280 mg, approximately 285 mg, approximately 290 mg, approximately 295 mg, and approximately 300 mg.

[0077] Embodiment 27. The effective doses for the above treatment are 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117.0 mg, 117.1 mg, 117.2 mg, 117.3 mg, 117.4 mg, 11 7.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118.0mg, 118.1mg, 118.2mg, 118.3mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8 mg, 118.9mg, 119.0mg, 119.1mg, 119.2mg, 119.3mg, 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg, 119.9mg, 120.0mg, 120.1mg, 120.2mg, 120.3mg, 120.4mg, 120.5mg, 120.6mg, 120.7mg, 120.8mg, 120.9mg, 121.0mg, 121.1mg, 121.2mg, 121.3mg, 121.4mg, 12 1.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122.0mg, 122.1mg, 122.2mg, 122.3mg, 122.4mg, 122.5mg, 122.6mg, 122.7mg, 122.8 The method according to any one of Embodiments 1 to 14, wherein the amount is any of mg, 122.9 mg, 123.0 mg, 123.1 mg, 123.2 mg, 123.3 mg, 123.4 mg, 123.5 mg, 123.6 mg, 123.7 mg, 123.8 mg, 123.9 mg, 124.0 mg, 124.1 mg, 124.2 mg, 124.3 mg, 124.4 mg, 124.5 mg, 124.6 mg, 124.7 mg, 124.8 mg, 124.9 mg, and 125.0 mg.

[0078] Embodiment 28. The effective doses for the above treatment are approximately 115.0 mg, approximately 115.1 mg, approximately 115.2 mg, approximately 115.3 mg, approximately 115.4 mg, approximately 115.5 mg, approximately 115.6 mg, approximately 115.7 mg, approximately 115.8 mg, approximately 115.9 mg, approximately 116.0 mg, approximately 116.1 mg, approximately 116.2 mg, approximately 116.3 mg, approximately 116.4 mg, approximately 116.5 mg, approximately 116.6 mg, approximately 116.7 mg, approximately 116.8 mg, approximately 116.9 mg, approximately 117.0 mg, approximately 117.1 mg, approximately 117.2 mg, approximately 117.3 mg, approximately 117.4 mg, approximately 117.5mg, approximately 117.6mg, approximately 117.7mg, approximately 117.8mg, approximately 117.9mg, approximately 118.0mg, approximately 118.1mg, approximately 118.2mg, approximately 118.3mg, 118.4mg, approximately 118.5mg, approximately 118.6mg, approximately 118.7mg, approximately 118.8mg, approximately 118.9mg, approximately 119.0mg, approximately 119.1mg, approximately 119.2mg, approximately 119.3mg, approximately 119.4mg, approximately 119.5mg, approximately 119.6mg, approximately 119.7mg, approximately 119.8mg, approximately 119.9mg, approximately 120.0mg, approximately 120.1 mg, approximately 120.2mg, approximately 120.3mg, 120.4mg, approximately 120.5mg, approximately 120.6mg, approximately 120.7mg, approximately 120.8mg, approximately 120.9mg, approximately 121.0mg, approximately 121.1mg, approximately 121.2mg, approximately 121.3mg, approximately 121.4mg, About 121.5mg, about 121.6mg, about 121.7mg, about 121.8mg, about 121.9mg, about 122.0mg, about 122.1mg, about 122.2mg, about 122.3mg, 122.4mg, about 122.5mg, about 122.6mg, about 122.7mg, about 12 The method according to any one of Embodiments 1 to 14, wherein the amount is any one of 2.8 mg, approximately 122.9 mg, approximately 123.0 mg, approximately 123.1 mg, approximately 123.2 mg, approximately 123.3 mg, approximately 123.4 mg, approximately 123.5 mg, approximately 123.6 mg, approximately 123.7 mg, approximately 123.8 mg, approximately 123.9 mg, approximately 124.0 mg, approximately 124.1 mg, approximately 124.2 mg, approximately 124.3 mg, 124.4 mg, approximately 124.5 mg, approximately 124.6 mg, approximately 124.7 mg, approximately 124.8 mg, approximately 124.9 mg, and approximately 125.0 mg.

[0079] Embodiment 29. The effective doses for the above treatment are 40mg-200mg, 40mg-190mg, 40mg-180mg, 40mg-170mg, 40mg-160mg, and 40mg-1 50mg、40mg~140mg、40mg~120mg、40mg~110mg、40mg~100mg、40mg~80mg、40mg~70mg、40mg~60mg、40mg~50mg、50mg~200mg、50mg~190mg、50mg~180mg、50mg~170mg、50mg~160mg、50mg~150mg、50mg~140mg、50mg~120mg、50mg~110mg、50mg~100mg、50mg~80mg、50mg~70mg、50mg~60mg、60mg~200mg、60mg~190mg、60mg~180mg、60mg~170mg、60mg~160mg、60mg~150mg、60mg~140mg、60mg~120mg、60mg~110mg、60mg~100mg、60mg~80mg、60mg~70mg、70mg~200mg、70mg~190mg、70mg~180mg、70mg~170mg、70mg~160mg、70mg~150mg、70mg~140mg、70mg~120mg、70mg~110mg、70mg~100mg、70mg~80mg、80mg~200mg、80mg~190mg、80mg~180mg、80mg~170mg、80mg~160mg、80mg~150mg、80mg~140mg、80mg~120mg、80mg~110mg、80mg~100mg、80mg~90mg、90mg~200mg、90mg~190mg、90mg~180mg、90mg~170mg、90mg~160mg、90mg~150mg、90mg~140mg、90mg~120mg、90mg~110mg、90mg~100mg、100mg~200mg、100mg~190mg、100mg~180mg、100mg~170mg、100mg~160mg、100mg~150mg、100mg~140mg、100mg~120mg、100mg~110mg、110mg~200mg、110mg~190mg、110mg~180mg、110mg~170mg、110mg~160mg、110mg~150mg、110mg~140mg、110mg~130mg、110mg~120mg、120mg~200mg、120mg~190mg、120mg~180mg、120mg~170mg、120mg~160mg、120mg~150mg、120mg~140mg、120mg~130mg、130mg~200mg、130mg~190mg、130mg~180mg、130mg~170mg、130mg~160mg、130mg~150mg、130mg~140mg、140mg~200mg、140mg~190mg、140mg~180mg、140mg~170mg、140mg~160mg、140mg~150mg、150mg~200mg、150mg~190mg、150mg~180mg、150mg~170mg、150mg~160mg、160mg~200mg、160mg~190mg、160mg~180mg、160mg~170mg、180mg~200mg、180mg~190mg、190mg~200mg、105mg~135mg、105mg~130mg、105mg~125mg105mg~120mg、110mg~135mg、110mg~130mg、110mg~125mg、110mg~120mg、115mg~135mg、115mg~130mg、115mg~125mg、115mg~120mg、115mg~125mg、115mg~120mg、120mg~135mg、120mg~125mg、125mg~140mg、125mg~130mg、130mg~135mg、135mg~140mg、120mg~129mg、120mg~128mg、120mg~127mg、120mg~86mg、120mg~124mg、120mg~123mg、120mg~122mg、120mg~121mg、121mg~130mg、122mg~129mg、122mg~128mg、122mg~127mg、122mg~126mg、122mg~125mg、122mg~124mg、122mg~123mg、123mg~130mg、123mg~129mg、123mg~128mg、123mg~127mg、123mg~126mg、123mg~125mg、123mg~124mg、124mg~130mg、124mg~129mg、124mg~128mg、124mg~127mg、124mg~126mg、124mg~125mg、125mg~129mg、125mg~128mg、125mg~127mg、125mg~126mg、126mg~130mg、126mg~129mg、126mg~128mg、126mg~127mg The method according to any one of Embodiments 1 to 14, wherein the amount is within the range of mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.

[0080] Embodiment 30. The amount effective for the above treatment is less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg. The method according to any one of Embodiments 1 to 14, wherein the amount is full, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

[0081] Embodiment 31. The amount effective for the above treatment is less than approximately 300 mg, less than approximately 295 mg, less than approximately 290 mg, less than approximately 285 mg, less than approximately 280 mg, less than approximately 275 mg, less than approximately 270 mg, less than approximately 265 mg, less than approximately 260 mg, less than approximately 255 mg, less than approximately 250 mg, less than approximately 245 mg, less than approximately 240 mg, less than approximately 235 mg, less than approximately 230 mg, less than approximately 225 mg, less than approximately 220 mg, less than approximately 215 mg, less than approximately 210 mg, less than approximately 205 mg, less than approximately 200 mg, less than approximately 195 mg, less than approximately 190 mg, less than approximately 185 mg, less than approximately 180 mg, less than approximately 175 mg, less than approximately 170 mg, less than approximately 165 mg, less than approximately 160 mg, and less than approximately 150 mg. The method according to any one of Embodiments 1 to 14, wherein the amount is less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

[0082] Embodiment 32. The method according to any one of Embodiments 1 to 14, wherein the amount effective for the above treatment is at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185 mg, at least 190 mg, at least 195 mg, and at least 200 mg.

[0083] Embodiment 33. An effective dose for the above treatment is at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, and less The method according to any one of Embodiments 1 to 14, wherein the amount is any one of approximately 50 mg, at least approximately 55 mg, at least approximately 60 mg, at least approximately 65 mg, at least approximately 70 mg, at least approximately 75 mg, at least approximately 80 mg, at least approximately 85 mg, at least approximately 90 mg, at least approximately 95 mg, at least approximately 100 mg, at least approximately 105 mg, at least approximately 115 mg, at least approximately 120 mg, at least approximately 125 mg, at least approximately 130 mg, at least approximately 135 mg, at least approximately 140 mg, at least approximately 145 mg, at least approximately 150 mg, at least approximately 155 mg, at least approximately 160 mg, at least approximately 165 mg, at least approximately 170 mg, at least approximately 175 mg, at least approximately 180 mg, at least approximately 185 mg, at least approximately 190 mg, at least approximately 195 mg, and at least approximately 200 mg.

[0084] Embodiment 34. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every four weeks.

[0085] Embodiment 35. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 8 weeks.

[0086] Embodiment 36. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 12 weeks.

[0087] Embodiment 37. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 16 weeks.

[0088] Embodiment 38. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 20 weeks.

[0089] Embodiment 39. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every four weeks.

[0090] Embodiment 40. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every eight weeks.

[0091] Embodiment 41. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 12 weeks.

[0092] Embodiment 42. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 16 weeks.

[0093] Embodiment 43. The method according to any one of Embodiments 1 to 33, comprising administering the modified oligonucleotide once every 20 weeks.

[0094] Embodiment 44. A method according to any one of Embodiments 1 to 33, comprising administering the above-mentioned modified oligonucleotide once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, and once every 20 weeks.

[0095] Embodiment 45. The modified oligonucleotide is administered approximately once a week, approximately once every two weeks, approximately once every three weeks, approximately once every four weeks, approximately once every five weeks, approximately once every six weeks, approximately once every seven weeks, approximately The method according to any one of Embodiments 1 to 33, comprising administering the drug once every 8 weeks, approximately once every 9 weeks, approximately once every 10 weeks, approximately once every 11 weeks, approximately once every 12 weeks, approximately once every 13 weeks, approximately once every 14 weeks, approximately once every 15 weeks, approximately once every 16 weeks, approximately once every 17 weeks, approximately once every 18 weeks, approximately once every 19 weeks, and approximately once every 20 weeks.

[0096] Embodiment 46. The method according to any one of Embodiments 1 to 33, comprising administering the above-mentioned modified oligonucleotide to the above-mentioned human subject in an initial loading dose of 120 mg.

[0097] Embodiment 47. The method according to Embodiment 46, comprising administering the above-mentioned human subject a second loading dose of 120 mg of the modified oligonucleotide four weeks after the initial loading dose.

[0098] Embodiment 48. The method according to Embodiment 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject described above, four weeks after the second loading dose.

[0099] Embodiment 49. The method according to Embodiment 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject described above, 8 weeks after the second loading dose.

[0100] Embodiment 50. The method according to Embodiment 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject described above, 12 weeks after the second loading dose.

[0101] Embodiment 51. The method according to Embodiment 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject described above, 16 weeks after the second loading dose.

[0102] Embodiment 52. The method according to any one of Embodiments 7 to 10 and 15 to 51, wherein the HTT RNA is mHTT RNA.

[0103] Embodiment 53. The method according to any one of Embodiments 11 to 51, wherein the HTT protein is an mHTT protein.

[0104] Embodiment 54. A method for reducing HD, reducing HTT RNA, reducing HTT protein, reducing mHTT RNA, or reducing mHTT protein in a human subject requiring reduction of HD, wherein the method applies to the human subject the following chemical structure:

[0105] [ka]

[0106] The method described above, comprising intrathecal administration of 120 mg or approximately 120 mg of a modified oligonucleotide or a salt thereof in a therapeutically effective amount, according to (Sequence ID 4).

[0107] Embodiment 55. The method according to Embodiment 54, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

[0108] Embodiment 56. A method for reducing HD, reducing HTT RNA, reducing HTT protein, reducing mHTT RNA, or reducing mHTT protein in a human subject requiring reduction of HD, wherein the method applies to the human subject the following chemical structure:

[0109] [ka]

[0110] The method described above, comprising intrathecal administration of 120 mg or approximately 120 mg of a modified oligonucleotide in a therapeutically effective amount, according to (Sequence ID 4).

[0111] Embodiment 57. Reduction of HD, reduction of HTT RNA, reduction of HTT protein, HTT A method for reducing HD, reducing HTT RNA, reducing HTT protein, reducing HTT mRNA, or reducing mHTT protein in human subjects requiring a reduction in mRNA or mHTT protein, wherein the method comprises intrathecal administration of a therapeutically effective amount of 120 mg or approximately 120 mg of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide has the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (SEQ ID NO: 4), A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The above method, where o = phosphodiester nucleoside bond.

[0112] Embodiment 58. An embodiment comprising administering the above-mentioned modified oligonucleotide once every four weeks. The method described in any one of the application forms 54 to 57.

[0113] Embodiment 59. The method according to any one of Embodiments 54 to 57, comprising administering the modified oligonucleotide once every eight weeks.

[0114] Embodiment 60. The method according to any one of Embodiments 54 to 57, comprising administering the modified oligonucleotide once every 16 weeks.

[0115] Embodiment 61. For the above-mentioned human subject, a) The above modified oligonucleotide in an initial loading dose of approximately 120 mg, b) Approximately 4 weeks after administering the initial loading dose, administer a second loading dose of approximately 120 mg of the modified oligonucleotide. c) Approximately 8 weeks after administering the second loading dose, administer the modified oligonucleotide in a first maintenance dose of approximately 120 mg. d) The method according to any one of Embodiments 54 to 57, comprising administering a second maintenance dose of approximately 120 mg of the modified oligonucleotide approximately 8 weeks after administering the first maintenance dose.

[0116] Embodiment 62. For the above human subject, a) The above modified oligonucleotide in an initial loading dose of approximately 120 mg, b) Approximately 4 weeks after administering the initial loading dose, administer a second loading dose of approximately 120 mg of the modified oligonucleotide. c) Approximately 16 weeks after administering the second loading dose, administer the modified oligonucleotide in a first maintenance dose of approximately 120 mg. d) The method according to any one of Embodiments 54 to 57, comprising administering a second maintenance dose of approximately 120 mg of the modified oligonucleotide approximately 16 weeks after administering the first maintenance dose.

[0117] Embodiment 63. The method according to any one of embodiments 54 to 62, wherein at least one symptom of HD is alleviated.

[0118] Embodiment 64. The method according to Embodiment 63, wherein at least one of the above symptoms includes brain atrophy, decreased brain activity, decreased brain connectivity, muscle atrophy, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning impairment, decreased attention, impaired visual processing, decreased working memory, decreased psychomotor speed, impaired verbal motor output, decreased independence, decreased emotional blunting, decreased learning ability, impaired mental connectivity, speech dysfunction, depression, irritability, anger, motor dysfunction, self-care impairment, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, or a combination thereof.

[0119] Embodiment 65. The method according to any one of Embodiments 1 to 64, wherein the human subject has a mutation in at least one IT15 gene.

[0120] Embodiment 66. The method according to any one of Embodiments 1 to 65, comprising identifying a mutation in at least one IT15 gene in the above-mentioned human subject.

[0121] Embodiment 67. The above at least one IT15 gene is at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least The method according to Embodiment 65 or Embodiment 66, having any of 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, or at least 60 consecutive CAG iterations.

[0122] Embodiment 68. The method according to Embodiment 65 or Embodiment 66, wherein at least one IT15 gene has 27 to 35 consecutive CAG repeats.

[0123] Embodiment 69. The method according to Embodiment 65 or Embodiment 66, wherein at least one IT15 gene has 35 to 60 consecutive CAG repeats.

[0124] Embodiment 70. The method according to Embodiment 65 or Embodiment 66, wherein at least one of the IT15 genes has more than 60 consecutive CAG repeats.

[0125] Embodiment 71. The method according to any one of Embodiments 1 to 70, wherein the modified oligonucleotide is administered to the CNS of the human subject.

[0126] Embodiment 72. The method according to any one of Embodiments 1 to 71, wherein the modified oligonucleotide is administered by intrathecal administration.

[0127] Embodiment 73. The method according to any one of Embodiments 1 to 72, wherein the modified oligonucleotide is administered by bolus intrathecal administration.

[0128] Embodiment 74. The method according to any one of Embodiments 1 to 73, wherein HTT RNA is reduced.

[0129] Embodiment 75. The method according to any one of Embodiments 1 to 74, wherein the HTT protein is reduced.

[0130] Embodiment 76. The method according to any one of Embodiments 1 to 75, wherein mHTT RNA is reduced.

[0131] Embodiment 77. The method according to any one of Embodiments 1 to 76, wherein the mHTT protein is reduced.

[0132] Embodiment 78. The method according to any one of Embodiments 1 to 77, comprising detecting a certain amount of mHTT RNA in a biological sample from the human subject described above.

[0133] Embodiment 79. The method according to any one of Embodiments 1 to 78, comprising detecting a certain amount of mHTT protein in a biological sample from the human subject described above.

[0134] Embodiment 80. The method according to any one of Embodiments 1 to 79, wherein the biological sample comprises cerebrospinal fluid.

[0135] Embodiment 81. The method according to any one of Embodiments 78 to 80, wherein the above detection occurs before the above administration.

[0136] Embodiment 82. The method according to any one of Embodiments 78 to 80, wherein the above detection occurs after the above administration.

[0137] Embodiment 83. The method according to any one of Embodiments 78 to 80, wherein the above detection occurs before and after the above administration.

[0138] Embodiment 84. The method according to any one of Embodiments 78 to 83, comprising detecting the amount of HTT RNA, HTT protein, mHTT RNA, mHTT protein, or a combination thereof, and then adjusting the administered initial loading dose, loading dose, maintenance dose, or therapeutically effective amount.

[0139] Embodiment 85. The method according to any one of Embodiments 1 to 84, comprising performing electroencephalography (EEG) or magnetic resonance imaging (MRI) on the subject to analyze brain activity, brain size, or a combination thereof.

[0140] Embodiment 86. The method according to Embodiment 85, wherein the EEG or MRI described above is performed before administration, after administration, or in combination thereof.

[0141] Embodiment 87. The method according to Embodiment 86, comprising determining or adjusting the amount effective for the above treatment after performing the above EEG or MRI.

[0142] Embodiment 88. The method according to Embodiment 87, further comprising performing the above-mentioned EEG or MRI after administration, and adjusting the administration frequency after performing the above-mentioned EEG or MRI.

[0143] Embodiment 89. The method according to any one of Embodiments 85 to 88, wherein the EEG or MRI is performed within 1, 2, 4, 6, 8, 12, or 24 hours of administration.

[0144] Embodiment 90. The method according to any one of Embodiments 85 to 89, comprising performing the above EEG before administration, performing analysis after administration, detecting an increase of less than 4 Hz in EEG signal power from a first EEG to a second EEG, and subsequently increasing the frequency of administration of the above modified oligonucleotide in a therapeutically effective amount.

[0145] Embodiment 91. The method according to Embodiment 90, comprising administering a loading dose once every four weeks, administering a maintenance dose once every eight or sixteen weeks before recording the first EEG, and administering the maintenance dose in less than eight weeks or less than sixteen weeks.

[0146] Embodiment 92. The method according to any one of Embodiments 85 to 91, comprising recording a first EEG before administration, recording a second EEG after administration, detecting an increase of less than 4 Hz in EEG signal power from the first EEG to the second EEG, and subsequently administering the modified oligonucleotide in a dose greater than the amount effective for the treatment.

[0147] Embodiment 93. The method according to Embodiment 92, wherein the dose is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 90%, or at least more than 100% of the amount effective for the treatment.

[0148] Embodiment 94. The method according to any one of Embodiments 85 to 93, wherein the amount effective for the above treatment is about 120 mg or 120 mg.

[0149] I.HTT In certain embodiments, methods for reducing HTT RNA and / or HTT protein in target cells or biological fluids are described herein. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein. HTT RNA is encoded by the human IT15 gene, located on the short (p) arm of human chromosome 4. HTT protein is the protein expression product of HTT RNA. HTT protein is highly expressed in neurons compared to other cell types. A representative nucleic acid sequence for the human IT15 gene is provided in GENBANK deposit number NC_000004.12, with nucleotides 3072001-3247000 cleaved, incorporated herein as Sequence ID No. 1. A representative nucleic acid sequence for human HTT RNA is provided in GENBANK deposit number NM_002111.6, incorporated herein as Sequence ID No. 2. A representative protein sequence for the human HTT protein is provided in GENBANK deposit number NP_002102.4, which is incorporated herein by reference as Sequence ID No. 3.

[0150] II.ISIS 443139 In certain embodiments, a method for administering the modified oligonucleotide ISIS 443139 to subjects requiring administration of the modified oligonucleotide ISIS 443139 is described herein. In certain embodiments, ISIS 443139 is characterized as a 5-10-5 MOE gapmer having CTCAGTAACATTGACACCAC (incorporated herein as SEQ ID NO: 4) (at 5'→3'), where each of nucleosides 1-5 and 16-20 (5'→3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D deoxyribonucleoside, and nucleosides 2-3, 3-4, 4 The nucleoside bonds in nucleosides ~5, 16~17, 17~18, and 18~19 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1~2, 5~6, 6~7, 7~8, 8~9, 9~10, 10~11, 11~12, 12~13, 13~14, 14~15, 15~16, and 19~20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0151] In certain embodiments, ISIS 443139 is represented by the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (SEQ ID NO: 4), where, A = adenine nucleic acid base, mC=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and o = phosphodiester nucleoside bond.

[0152] In certain embodiments, ISIS 443139 has the following chemical structure:

[0153] [ka]

[0154] This is represented by (Sequence ID 4). Structure 1.ISIS 443139

[0155] In certain embodiments, the sodium salt of ISIS 443139 has the following chemical structure:

[0156] [ka]

[0157] This is represented by (Sequence ID 4). Structure 2. Sodium salt of ISIS 443139

[0158] III. Specific pharmaceutical compositions In certain embodiments, a method for administering a pharmaceutical composition containing modified oligonucleotide ISIS 443139 to a subject is described herein. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or is essentially composed of sterile saline and modified oligonucleotide ISIS 443139. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises sterile water and modified oligonucleotide ISIS In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition contains or is essentially composed of artificial cerebrospinal fluid (aCSF) and modified oligonucleotide ISIS 443139. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0159] In certain embodiments, the pharmaceutical composition comprises one or more excipients and modified oligonucleotide ISIS 443139. In certain embodiments, the excipients are selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0160] In certain embodiments, a pharmaceutical composition containing the modified oligonucleotide ISIS 443139 The substances include any pharmaceutically acceptable salt of modified oligonucleotide ISIS 443139, esters of modified oligonucleotide ISIS 443139, or salts of such esters. In certain embodiments, a pharmaceutical composition comprising modified oligonucleotide ISIS 443139 may (directly or indirectly) provide a biologically active metabolite or residue when administered to a human subject. Therefore, for example, this disclosure also covers pharmaceutically acceptable salts of modified oligonucleotide ISIS 443139, prodrugs of modified oligonucleotide ISIS 443139, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Preferred pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0161] In certain embodiments, the pharmaceutical composition comprises one or more lipid moieties and a modified oligonucleotide ISIS 443139. In certain embodiments, the lipid moieties are used to increase the distribution of ISIS 443139 to specific cells or tissues. In certain such methods, the modified oligonucleotide ISIS 443139 is introduced into a pre-formed liposome or lipoplex made of a mixture of cationic and neutral lipids. In certain methods, a DNA complex with mono- or polycationic lipids is formed in the absence of neutral lipids.

[0162] In certain embodiments, the pharmaceutical compositions disclosed herein include a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0163] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the modified oligonucleotides described herein to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with a tissue-specific antibody.

[0164] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used with hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3 w / v% benzyl alcohol, 8 w / v% the nonpolar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300. The proportions of such cosolvent systems can be varied considerably without significantly altering their solubility and toxic properties. Furthermore, the identity of the cosolvent components can be varied; for example, other surfactants may be used instead of Polysorbate 80™, the fraction size of polyethylene glycol may be varied, other biocompatible polymers may replace polyethylene glycol, such as polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0165] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV)). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, e.g., aCSF, water, or a physiologically compatible buffer, e.g., Hanks' solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components (e.g., components that aid solubility or serve as preservatives) are included. In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Certain pharmaceutical compositions for injection are provided in unit dosage forms, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are oily or The product is a suspension, solution, or emulsion in an aqueous vehicle and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants. Specific solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (e.g., sesame oil), synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.

[0166] Under certain conditions, the modified oligonucleotide ISIS 443139 acts as an acid. ISIS 443139 may be described or explained in protonated (free acid) form or in relation to its ionized (cationic) (salt) form, but aqueous solutions of ISIS 443139 are in equilibrium between these forms. For example, the phosphate bond of ISIS 443139 in aqueous solution is in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the term "ISIS 443139" is intended to include all such forms. Furthermore, ISIS 443139 has several such bonds, each of which is in equilibrium. Therefore, ISIS 443139 exists as a collection of multiple forms, all in equilibrium at multiple locations. The term "ISIS 443139" is intended to include all such forms. Illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are also intended to include the corresponding forms. Where the term "or its salt" follows a structure depicting the free acid of ISIS 443139, it explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with cations. In certain cases, one or more specific cations are identified.

[0167] In certain embodiments, ISIS 443139 is present in an aqueous solution with sodium. In certain embodiments, ISIS 443139 is present in an aqueous solution with potassium. In certain embodiments, ISIS 443139 is present in PBS. In certain embodiments, ISIS 443139 is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to a desired pH.

[0168] This specification describes certain specific dosages. For clarity, the dosage of ISIS 443139 in milligrams represents the mass of the free acid form of ISIS 443139. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dosage, it is assumed that ISIS 443139 exists as a solvent-free, sodium-acetic acid-free, anhydrous, free acid. For example, if ISIS 443139 is in a sodium-containing solution (e.g., saline solution), ISIS 443139 can be partially or completely deprotonated and associate with Na+ ions. However, although the mass of protons is counted in the weight of the dosage, the mass of Na+ ions is not. Therefore, for example, a dosage of 120 mg of ISIS 443139 is equal to the number of fully protonated molecules weighing 120 mg. This is equivalent to 127 mg of solvent-free, sodium-acetic acid-free, anhydrous sodium ISIS 443139.

[0169] IV. Specific Dosage In certain embodiments, a method for administering a therapeutically effective amount of modified oligonucleotide ISIS 443139 to a subject is described herein. In certain embodiments, the therapeutically effective amount is 10 mg. In certain embodiments, the therapeutically effective amount is 30 mg. In certain embodiments, the therapeutically effective amount is 60 mg. In certain embodiments, the therapeutically effective amount is 90 mg. In certain embodiments, the therapeutically effective amount is 120 mg.

[0170] In certain embodiments, the therapeutically effective doses are 5 mg, 10 mg, 15 mg, 20 mg, 2 5mg, 30mg, 35mg, 40mg, 45mg, 50mg, 55mg, 60mg, 65mg, 70mg, 75mg, 80mg, 85mg, 90mg, 95mg, 100mg, 105 mg, 110mg, 115mg, 120mg, 125mg, 130mg, 135mg, 140mg, 145mg, 150mg, 155mg, 160mg, 165mg, 170mg, 17 The dosage is one of the following: 5mg, 180mg, 185mg, 190mg, 195mg, 200mg, 205mg, 210mg, 215mg, 220mg, 225mg, 230mg, 235mg, 240mg, 245mg, 250mg, 255mg, 260mg, 265mg, 270mg, 275mg, 280mg, 285mg, 290mg, 295mg, and 300mg.

[0171] For specific uses, the effective therapeutic dose is approximately 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg. The dosage is one of the following: approximately 160 mg, approximately 165 mg, approximately 170 mg, approximately 175 mg, approximately 180 mg, approximately 185 mg, approximately 190 mg, approximately 195 mg, approximately 200 mg, approximately 205 mg, approximately 210 mg, approximately 215 mg, approximately 220 mg, approximately 225 mg, approximately 230 mg, approximately 235 mg, approximately 240 mg, approximately 245 mg, approximately 250 mg, approximately 255 mg, approximately 260 mg, approximately 265 mg, approximately 270 mg, approximately 275 mg, approximately 280 mg, approximately 285 mg, approximately 290 mg, approximately 295 mg, and approximately 300 mg.

[0172] In a specific embodiment, the therapeutically effective doses are 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117.0 mg, 117.1 mg, 117.2 mg, and 117.3 mg. , 117.4mg, 117.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118.0mg, 118.1mg, 118.2mg, 118.3mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8mg, 118.9mg, 119.0mg, 119.1mg, 119.2mg, 119.3mg, 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg, 119.9mg, 1 20.0mg, 120.1mg, 120.2mg, 120.3mg, 120.4mg, 120.5mg, 120.6mg, 120.7mg, 120.8mg, 120.9mg, 121.0mg, 121.1mg, 121.2mg, 12 1.3mg, 121.4mg, 121.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122.0mg, 122.1mg, 122.2mg, 122.3mg, 122.4mg, 122.5mg, 122 The dosage is one of the following: 0.6mg, 122.7mg, 122.8mg, 122.9mg, 123.0mg, 123.1mg, 123.2mg, 123.3mg, 123.4mg, 123.5mg, 123.6mg, 123.7mg, 123.8mg, 123.9mg, 124.0mg, 124.1mg, 124.2mg, 124.3mg, 124.4mg, 124.5mg, 124.6mg, 124.7mg, 124.8mg, 124.9mg, and 125.0mg.

[0173] In specific applications, the therapeutically effective doses are approximately 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, and 116.9 mg. Approximately 117.0 mg, 117.1 mg, 117.2 mg, 117.3 mg, 117.4 mg, 117.5 mg, 117.6 mg, 117.7 mg, 117.8 mg, 117.9 mg, 118.0 mg, 118.1 mg, 118.2 mg, 118.3 mg, 118.4 mg, 118.5 mg, 118.6 mg, 118.7 mg, 118.8 mg, 118.9 mg, 119 mg. 0mg, approximately 119.1mg, approximately 119.2mg, approximately 119.3mg, approximately 119.4mg, approximately 119.5mg, approximately 119.6mg, approximately 119.7mg, approximately 119.8mg, approximately 119.9mg, approximately 120.0mg, approximately 120.1mg, approximately 120.2mg, approximately 120.3mg, 120.4mg, approximately 120.5mg, approximately 120.6mg, approximately 120.7mg, approximately 120.8mg, approximately 120.9mg, approximately 121.0mg, approximately 1 21.1mg, approximately 121.2mg, approximately 121.3mg, approximately 121.4mg, approximately 121.5mg, approximately 121.6mg, approximately 121.7mg, approximately 121.8mg, approximately 121.9mg, approximately 122.0mg, approximately 122.1mg, approximately 122.2mg, approximately 122.3mg, 122.4mg, approximately 122.5mg, approximately 122.6mg, approximately 122.7mg, approximately 122.8mg, approximately 122.9mg, approximately 123.0mg, approximately 123.1mg g is one of the following: approximately 123.2 mg, approximately 123.3 mg, approximately 123.4 mg, approximately 123.5 mg, approximately 123.6 mg, approximately 123.7 mg, approximately 123.8 mg, approximately 123.9 mg, approximately 124.0 mg, approximately 124.1 mg, approximately 124.2 mg, approximately 124.3 mg, 124.4 mg, approximately 124.5 mg, approximately 124.6 mg, approximately 124.7 mg, approximately 124.8 mg, approximately 124.9 mg, and approximately 125.0 mg.

[0174] In certain embodiments, the effective therapeutic dose is 40mg-200mg, 40mg-190mg, 40mg-180mg, 40mg-170mg, 40mg-160mg, 40mg-150mg, 40mg-140mg, 40mg-120mg, 40mg-110mg, 40mg-100mg, 40mg-80mg, 40mg-70mg, 40mg-60mg, 40mg-50mg, 50mg-200mg, 50mg-190mg, 50mg-180mg, 50mg-170mg, 50mg-160mg, 50mg-150mg, 50mg-140mg, 50 mg~120mg, 50mg~110mg, 50mg~100mg, 50mg~80mg, 50mg~70mg, 50mg~60mg, 60mg~200mg, 60mg~190mg, 60mg~180mg, 60mg~170mg, 60mg~160mg, 60mg~150 mg, 60mg~140mg, 60mg~120mg, 60mg~110mg, 60mg~100mg, 60mg~80mg, 60mg~70mg, 70mg~200mg, 70mg~190mg, 70mg~180mg, 70mg~170mg, 70mg~160mg, 70 mg~150mg, 70mg~140mg, 70mg~120mg, 70mg~110mg, 70mg~100mg, 70mg~80mg, 80mg~200mg, 80mg~190mg, 80mg~180mg, 80mg~170mg, 80mg~160mg, 80mg~1 50mg, 80mg~140mg, 80mg~120mg, 80mg~110mg, 80mg~100mg, 80mg~90mg, 90mg~200mg, 90mg~190mg, 90mg~180mg, 90mg~170mg, 90mg~160mg, 90mg~150mg , 90mg~140mg, 90mg~120mg, 90mg~110mg, 90mg~100mg, 100mg~200mg, 100mg~190mg, 100mg~180mg, 100mg~170mg, 100mg~160mg, 100mg~150mg, 100mg~1 40mg, 100mg~120mg, 100mg~110mg, 110mg~200mg, 110mg~190mg, 110mg~180mg, 110mg~170mg, 110mg~160mg, 110mg~150mg, 110mg~140mg, 110mg~130mg,110mg~120mg、120mg~200mg、120mg~190mg、120mg~180mg、120mg~170mg、120mg~160mg、120mg~150mg、120mg~140mg、120mg~130mg、130mg~200mg、130mg~190mg、130mg~180mg、130mg~170mg、130mg~160mg、130mg~150mg、130mg~140mg、140mg~200mg、14、 0mg~190mg, 140mg~180mg, 140mg~170mg, 140mg~160mg, 140mg~150mg, 150mg~200mg, 150mg~190mg, 150mg~180mg, 150mg~170mg, 150mg~160mg, 160 mg~200mg, 160mg~190mg, 160mg~180mg, 160mg~170mg, 180mg~200mg, 180mg~190mg, 190mg~200mg, 105mg~135mg, 105mg~130mg, 105mg~125mg105mg ~120mg, 110mg~135mg, 110mg~130mg, 110mg~125mg, 110mg~120mg, 115mg~135mg, 115mg~130mg, 115mg~125mg, 115mg~120mg, 115mg~125mg, 115mg~ 120mg, 120mg~135mg, 120mg~125mg, 125mg~140mg, 125mg~130mg, 130mg~135mg, 135mg~140mg, 120mg~129mg, 120mg~128mg, 120mg~127mg, 120mg~8 6mg, 120mg~124mg, 120mg~123mg, 120mg~122mg, 120mg~121mg, 121mg~130mg, 122mg~129mg, 122mg~128mg, 122mg~127mg, 122mg~126mg, 122mg~125 mg, 122mg~124mg, 122mg~123mg, 123mg~130mg, 123mg~129mg, 123mg~128mg, 123mg~127mg, 123mg~126mg, 123mg~125mg, 123mg~124mg, 124mg~130m g, 124mg-129mg, 124mg-128mg, 124mg-127mg, 124mg-126mg, 124mg-125mg, 125mg-129mg, 125mg-128mg, 125mg-127mg, 125mg-126mg, 126mg-130mg, 126mg-129mg, 126mg-128mg, 126mg-127mg, 127mg-130mg, 127mg-129mg, 127mg-128mg, 128mg-130mg, 128mg-129mg, and 129mg-130mg.

[0175] In certain embodiments, the therapeutically effective dose is less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg The amount is one of the following: less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

[0176] In certain embodiments, the therapeutically effective dose is less than approximately 300 mg, less than approximately 295 mg, less than approximately 290 mg, less than approximately 285 mg, less than approximately 280 mg, less than approximately 275 mg, less than approximately 270 mg, less than approximately 265 mg, less than approximately 260 mg, less than approximately 255 mg, less than approximately 250 mg, less than approximately 245 mg, less than approximately 240 mg, less than approximately 235 mg, less than approximately 230 mg, less than approximately 225 mg, less than approximately 220 mg, less than approximately 215 mg, less than approximately 210 mg, less than approximately 205 mg, Approximately less than 200mg, approximately less than 195mg, approximately less than 190mg, approximately less than 185mg, approximately less than 180mg, approximately less than 175mg, approximately less than 170mg, approximately less than 165mg, approximately less than 160mg, approximately less than 150mg, approximately less than 145mg, approximately less than 140mg, approximately less than 135mg, approximately less than 130mg, approximately less than 125mg, approximately less than 120mg, approximately less than 115mg, approximately less than 110mg, approximately less than 105mg, approximately less than 100mg, approximately less than 95mg, approximately less than 90mg, approximately 85mg It is one of the following: less than g, less than approximately 80 mg, less than approximately 75 mg, less than approximately 70 mg, less than approximately 65 mg, less than approximately 60 mg, less than approximately 55 mg, less than approximately 50 mg, less than approximately 45 mg, less than approximately 40 mg, less than approximately 35 mg, less than approximately 30 mg, less than approximately 25 mg, less than approximately 20 mg, less than approximately 15 mg, less than approximately 10 mg, and less than approximately 5 mg.

[0177] To be specifically necessary, the therapeutically effective dose is one of the following: at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185 mg, at least 190 mg, at least 195 mg, and at least 200 mg.

[0178] For specific purposes, the therapeutically effective dose is at least approximately 5 mg, at least approximately 10 mg, at least approximately 15 mg, at least approximately 20 mg, at least approximately 25 mg, at least approximately 30 mg, at least approximately 35 mg, at least approximately 40 mg, at least approximately 45 mg, at least approximately 50 mg, at least approximately 55 mg, at least approximately 60 mg, at least approximately 65 mg, at least approximately 70 mg, at least approximately 75 mg, at least approximately 80 mg, at least approximately 85 mg, at least approximately 90 mg, at least approximately 95 mg, at least approximately 100 mg. It is at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185 mg, at least about 190 mg, at least about 195 mg, and at least about 200 mg.

[0179] VI. Specific Dosage Regimen In certain embodiments, this specification describes a method for administering a therapeutically effective amount of modified oligonucleotide ISIS 443139 to a subject one or more times. In certain embodiments, the method includes administering a therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In certain embodiments, the method includes administering a therapeutically effective amount once every 4 weeks. In certain embodiments, the method includes administering a therapeutically effective amount once every 8 weeks. In certain embodiments, the method includes administering a therapeutically effective amount once every 16 weeks.

[0180] In certain embodiments, the method includes administering a therapeutically effective amount approximately every 1 week, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks, every 12 weeks, every 13 weeks, every 14 weeks, every 15 weeks, every 16 weeks, every 17 weeks, every 18 weeks, every 19 weeks, or every 20 weeks.

[0181] In certain embodiments, the method includes administering a therapeutically effective amount for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.

[0182] Loading and maintenance doses In certain embodiments, a therapeutically effective dose is administered as a loading dose and / or maintenance dose. In certain embodiments, the method includes administering a loading dose(s), followed by a maintenance dose(s). In certain embodiments, the method includes administering a loading dose approximately every four weeks, followed by a maintenance dose approximately every eight weeks. In certain embodiments, the method includes administering a loading dose approximately every four weeks, followed by a maintenance dose approximately every sixteen weeks.

[0183] In certain embodiments, the method includes administering at least two loading doses, at least three loading doses, at least four loading doses, at least five loading doses, or at least six loading doses. In certain embodiments, the method includes administering two, three, four, five, sixteen loading doses. In certain embodiments, the method includes administering loading doses(s) approximately every one week, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every ten weeks, every eleven weeks, or every twelve weeks. In certain embodiments, the method includes administering an initial loading dose and administering a second loading dose approximately one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, ten weeks, eleven weeks, or twelve weeks after the initial loading dose.

[0184] In certain embodiments, the method includes administering at least two maintenance doses, at least three maintenance doses, at least four maintenance doses, at least five maintenance doses, or at least six maintenance doses. In certain embodiments, the method includes administering two, three, four, five, sixteen maintenance doses. In some cases, the method includes administering maintenance doses(s) approximately every four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, ten weeks, eleven weeks, twelve weeks, thirteen weeks, fourteen weeks, fifteen weeks, sixteen weeks, seventeen weeks, eighteen weeks, eighteen weeks, nineteen weeks, or twenty weeks. In certain embodiments, the method includes administering a first maintenance dose and administering a second maintenance dose approximately 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, or 20 weeks after the administration of the first maintenance dose.

[0185] In certain embodiments, the method includes administering a first maintenance dose(s) approximately one, two, three, four, five, six, seven, eight, nine, ten, eleven, thirteen, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty weeks after the last loading dose.

[0186] VI. Efficacy and Effectiveness In certain embodiments, a method for reducing HTT RNA and / or HTT protein in the cells or biological fluid of a human subject is described herein, wherein the method comprises administering a therapeutically effective amount of ISIS 443139 to the subject. In certain embodiments, the method reduces HTT RNA and / or HTT protein in the cerebrospinal fluid of a human subject. For example, by detecting / quantifying a first amount of HTT RNA or HTT protein in a first biological sample obtained before administration, detecting / quantifying a second amount of HTT RNA or HTT protein in a second biological sample obtained after administration, and comparing the first amount with the second amount, the HTT RNA or HTT protein is reduced. By detecting or quantifying the decrease within the substance, it is possible to determine whether the method reduces HTT RNA and / or HTT protein. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein.

[0187] In certain embodiments, the method includes reducing HTT RNA and / or HTT protein by 1 to 100%, or within a range defined by any two of these values. In certain embodiments, the method includes reducing HTT RNA and / or HTT protein in 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51% This includes reducing by %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein.

[0188] In certain embodiments, the method includes reducing HTT RNA or HTT protein by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein.

[0189] In certain embodiments, the method involves reducing HTT RNA or HTT protein by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100%. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein.

[0190] In certain embodiments, the method includes administering ISIS 443139 to a subject and detecting or quantifying the amount of HTT RNA or HTT protein in the subject's cells or biological fluid. In certain embodiments, the method includes detecting / quantifying a first amount of HTT RNA or HTT protein in a first biological sample obtained before administration, detecting / quantifying a second amount of HTT RNA or HTT protein in a second biological sample obtained after administration, and detecting or quantifying a decrease in HTT RNA or HTT protein by comparing the first amount with the second amount. In certain embodiments, the second biological sample is obtained less than approximately 24 hours after administration. In certain embodiments, the second biological sample is obtained less than approximately 1 week after administration. In certain embodiments, the second biological sample is obtained approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 1 It is available in 3 weeks, approximately 14 weeks, approximately 15 weeks, approximately 16 weeks, approximately 17 weeks, or approximately 18 weeks. In certain embodiments, the method includes increasing or decreasing the dose after comparing a first dose to a second dose. In certain embodiments, the method includes increasing or decreasing the frequency of administration after comparing a first dose to a second dose. In certain embodiments, HTT RNA is mHTT RNA. In certain embodiments, HTT protein is mHTT protein.

[0191] Evaluation of the effectiveness of ISIS 443139 In certain embodiments, the methods described herein are sufficiently effective to alleviate at least one symptom of HD in human subjects. In certain embodiments, at least one symptom is motor dysfunction. In certain embodiments, motor dysfunction includes restlessness, lack of coordination, involuntary initiation of movement, involuntary incontinence of movement, unsteady gait, chorea, rigidity, struggling, abnormal posture, instability, abnormal facial expression, difficulty chewing, difficulty swallowing, difficulty speaking, seizures, sleep disturbances, or a combination thereof. In certain embodiments, at least one symptom is cognitive dysfunction. In certain embodiments, cognitive dysfunction includes difficulty planning, difficulty with flexibility, difficulty with abstract thinking, difficulty with rule acquisition, difficulty initiating appropriate actions, difficulty with inappropriate actions, short-term memory impairment, long-term memory impairment, or a combination thereof. In certain embodiments, at least one symptom is psychiatric. In certain embodiments, the psychiatric symptoms are selected from paranoia, disorientation, stupor, hallucinations, dementia, anxiety, depression, emotional blunting, egocentrism, aggression, obsessive-compulsive behavior, irritability, and suicidal ideation. In certain embodiments, at least one symptom is a decrease in brain mass (cerebral atrophy), muscle atrophy, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, or a combination thereof.

[0192] In certain embodiments, the method described herein is sufficiently effective in reducing brain atrophy, decreased brain activity, or reduced brain activity in human subjects with HD compared to healthy control subjects. In certain embodiments, healthy control subjects are subjects without HD. In certain embodiments, the method is sufficiently effective in reducing brain atrophy, decreased brain activity, or reduced brain activity as measured by electroencephalography (EEG) or magnetic resonance imaging (MRI) in human subjects.

[0193] In certain embodiments, the methods described herein are sufficiently effective to alleviate at least one symptom of HD in a human subject, assessed by a clinically relevant test, score, or scale. In certain embodiments, the at least one symptom is general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning dysfunction, decreased attention, visual-perceptual processing dysfunction, decreased working memory, decreased psychomotor velocity, verbal-motor output dysfunction, decreased independence, decreased emotional blunting, decreased learning ability, mental connectivity dysfunction, speech dysfunction, depression, irritability, anger, motor dysfunction, self-care dysfunction, pain, discomfort, anxiety, suicidal ideation, and suicidal behavior, or a combination thereof. Non-limiting examples of such clinically relevant tests, scores, and scales include:

[0194] Total Functional Capacity Scale In certain embodiments, the methods described herein are sufficiently effective in reducing general functional impairment in subjects with HD, as assessed by the Total Functional Capacity Scale (TFC). The TFC is a certified measure of general functional ability in HD, as further described in Huntington Study Group, Mov. Disord. 1996;11:136-42. The TFC represents the investigator's assessment of a subject's ability to perform a range of basic daily living activities, including work, chores, financial management, eating, dressing, and bathing. TFC scores range from 0 to 13, with higher scores indicating better function. A one-point change in the TFC score represents a clinically significant change in the subject's function (for example, a one-point decrease may indicate a loss of work capacity at normal ability). In certain embodiments, the method improves the TFC score by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0195] Total athletic score In certain embodiments, the methods described herein are sufficiently effective in reducing motor impairment in subjects with HD, as assessed by the Total Motor Score (TMS). The TMS is a holistic index of motor function in HD, relating to both functional capacity, independence, and driving status based on the TFC score (Beglinger et al., Mov. Disord. 2012; 27: 1146-52; Schobel et al., Neurology 2017; 89: 2495-2502). The TMS score is the sum of individual monitor scores obtained by an investigator through administration of the 31-item monitor assessment portion of the UHDRS. The score ranges from 0 to 124, with higher scores indicating more severe impairment. In certain embodiments, the methods reduce the TMS score by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0196] Symbol Digit Modalities Examination In certain embodiments, the methods described herein are sufficiently effective in mitigating decreased attention, visual processing impairment, impaired working memory, decreased psychomotor speed, or a combination thereof in subjects with HD, as represented by the Symbol Digit Modality Test (SDMT). In the SMDT, subjects pair abstract symbols with concrete numbers according to a conversion key. The test measures the number of items correctly paired (up to 110 correct pairs) in 90 seconds. The SDMT has been shown to have strong reliability and validity. The SDMT is based on Smith, A., Symbol Digit Modalities. Test(SDMT). Manual(rev.)Los Angeles:Wes This is described in more detail in Tern Psychological Services, 1982. In certain embodiments, the method improves the number of correctly paired items by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 items.

[0197] Stroop Vocabulary Reading Test In certain embodiments, the methods described herein are sufficiently effective in mitigating attention deficits, processing deficits, psychomotor speed deficits, verbal motor output deficits, or combinations thereof in subjects with HD, as assessed by the Stroop Word Reading Test (SWR). During the SWR test, subjects are presented with pages printed in black ink containing the names of colors (i.e., "blue," "red," or "green") and instructed to read aloud as many words as possible within a predetermined time (45 seconds). The number of words read correctly is counted, with higher scores indicating better cognitive ability. For a further description of the SWR test, see Stroop, JR, J. Exp. Psychol. 1935, 18, 643-662. In certain embodiments, the methods improve the number of words a subject can read aloud within a given time by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 words.

[0198] Combined Unified Huntington's Disease Rating Scale (cUHDRS) In certain embodiments, the methods described herein are sufficiently effective in improving the assessment of subjects using the Combined Unified Huntington's Disease Rating Scale (cUHDRS). The cUHDRS assesses motor function, cognitive function, and overall function. The outcome measure consists of an equally weighted sum of the Z-scores of TFC, TMS, SDMT, and the SWR score of the UHDRS. It is a multi-domain index of clinical decline that tracks underlying cognitive brain changes and relates to daily changes in functional capacity. The cUHDRS is described in further detail by Schobel et al., Neurology 2017;89:2495-2502. It is disclosed that, in certain embodiments, the method improves the cUHDRS rating of the subject by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0199] Functional assessment of the Unified Huntington's Disease Rating Scale (cUHDRS) In certain embodiments, the method described herein is sufficiently effective to mitigate generalized dysfunction in subjects with HD, as assessed by the UHDRS functional assessment. The UHDRS functional assessment is a checklist of 25 common daily tasks. This checklist is described by the Huntington Study Group, Mov. Disord. 1996;11:136-42. The investigator indicates whether the subject can perform the tasks by assigning a score of 1 for all "yes" answers. The checklist is then totaled. The score can range from 0 (unable to perform any tasks) to 25 (able to perform all tasks on the checklist). In certain embodiments, the method improves the subject's UHDRS functional assessment by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0200] independence measure In certain embodiments, the method described herein is sufficiently effective to mitigate generalized dysfunction in subjects with hemodialysis (HD) as assessed by the Independence Scale (IS). The IS is an indicator of disease progression in terms of dysfunction and degree of independence. It is a subscale of the UHDRS. The scale consists of 19 individual levels (5 each) ranging from 10 to 100, where a score of 100 indicates no special care is needed, and a score of 10 indicates that the subject is tube-fed and requires comprehensive bed care. The IS is described in further detail by the Huntington Study Group, Mov. Disord. 1996;11:136-42. In certain embodiments, the method improves the subject's IS score by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 points.

[0201] Huntington's Disease Daily Activity Scale In certain embodiments, the method described herein is sufficiently effective to improve a subject's score on the Huntington's Disease Daily Activity Scale (HD-DAS). The HD-DAS assesses a subject's daily functioning. Following a semi-structured interview with the subject and / or comparison, the subject's ability to perform daily tasks, such as eating or using a telephone, is recorded. Each item is scored on a 4-point Likert scale, where 0 indicates no effect and 3 indicates a significant effect. The HD-DAS is described in further detail by Bylsma et al., Mov. Disord. 1993;8:183-90. In certain embodiments, the method improves the subject's HD-DAS score by 1, 2, or 3 points.

[0202] Overall impression, severity, and change scale In certain embodiments, the methods described herein are sufficiently effective to improve the overall impression, severity, and subject scores on change scales. This assessment can be performed by a clinician (CGI-S), a peer (CrGI-S), or a subject (PGI-S). Subjects are assessed using an 11-point numerical rating scale (NRS), with higher scores indicating greater severity. The CGI-S is described in further detail by Guy W: ECDEU Assessment Manual for Psychopharmacology Rockville, MD: USD Department of Health, Education, and Welfare; 1976. In certain embodiments, the methods reduce the subject's NRS score by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0203] Montreal Cognitive Assessment In certain embodiments, the method described herein is sufficiently effective to mitigate cognitive impairment in subjects with HD, as assessed by the Montreal Cognitive Assessment (MoCA). The MoCA is an assessment completed in a subject used to detect cognitive impairment. It includes a set of basic assessments, including attention and visuospatial tasks. The total score ranges from 0 to 30, with lower scores indicating greater impairment. The MoCA is described in further detail by Nasreddine et al., J.Am.Geriatr.Soc.2005 53:695-9. In certain embodiments, the method increases the subject's MoCA score by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0204] Work productivity and activity impairment testing In certain embodiments, the method described herein is sufficiently effective to mitigate general functional impairment in subjects with HD, as assessed by the Work Productivity and Activity Impairment Test (WPAI). The WPAI includes six items (all using an 11-point NRS, with higher scores indicating a greater impact) that assess employment status (yes / no), time lost due to the disease, time lost for other reasons, the impact of the disease on time worked, and the impact on productivity and daily activities. The WPAI is described in more detail by Reilly et al., Pharmacoeconomics 1993 4:353-65. In certain embodiments, the method reduces the subject's WPAI score by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0205] Emotional blunting assessment scale In certain embodiments, the method described herein is sufficiently effective in reducing emotional blunting disorder in subjects with HD, as assessed by the Affective Blunting Rating Scale (AES). The AES is an 18-item assessment of emotional blunting, including overt behavior, cognitive aspects of motivation, and emotional responsiveness. Each item is scored on a 4-point Likert scale from 1 ("not at all") to 4 ("a lot"). The total score is calculated by summing the 18 items (scores range from 18 to 72, with 3 items scored inversely), with higher scores indicating greater emotional blunting. The AES is described in further detail by Marin et al., Psychiatry Res. 1991 38:143-62. In certain embodiments, the method increases the subject's AES score by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0206] Neuro-Qol Cognitive Function Short Form Version 2 In certain embodiments, the methods described herein are sufficiently effective in mitigating concentration and / or learning impairments in subjects with HD, as assessed by the Neuro-Qol Cognitive Function Short Form. The Neuro-Qol Cognitive Function Short Form consists of eight items (including "Difficulty concentrating" and "Learning a new task or instruction"), each assessed using a 5-point Likert scale, with lower scores indicating greater difficulty (4 items) or higher frequency (4 items). The raw total score is converted to a T-score distribution (mean 50, standard deviation 10). See the User Manual for Quality of Life in the National Institute of Neurological Disorders and Stroke (NINDS) Neuro-QoL Index (version 2.0, March 2015).

[0207] Speech difficulties associated with Huntington's disease In certain embodiments, the methods described herein are sufficiently effective in mitigating speech impairment in subjects with Huntington's disease (HD), as assessed by the HD-SDI assessment. The HD-SDI is a single assessment of speech impairment over a 7-day period. The question is included. The HD-SDI is assessed using a 5-point Likert scale, with higher scores indicating a greater frequency of difficulty. In certain embodiments, the method reduces the score in question by at least 1, 2, 3, 4, or 5 points.

[0208] Symptoms of major depression scales In certain embodiments, the methods described herein are sufficiently effective in reducing depression in subjects with HD, as assessed by the Major Depression Scale Symptoms (SMDDS). The SMDDS is a self-report assessment of depression (McCarrier et al., Patient 2016, 9:117-134). The SMDDS consists of 16 items that assess concepts such as sadness, irritability, anxiety, and sleep disturbances. Each item is rated on a 5-point Likert scale, ranging from "never" to "extreme" (9 items) and from "never" to "always" (7 items). The item scores of 15 of the items (excluding the two least severe diet items) are summed to create a score from 0 to 60. Higher scores indicate more severe overall symptoms of depression. The SMDDS is described in more detail by Bushnell et al., Value in Health 2019 22:906-915. In certain embodiments, the method reduces the score in question by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 points.

[0209] Irritability and anger outburst scale reported by a group of Huntington's disease patients In certain embodiments, the method is sufficiently effective in reducing irritability and anger in subjects with Huntington's disease (HD) as assessed by the HD-CIAOS, a peer-reported scale for irritability and anger outbursts. The HD-CIAOS is a peer-reported assessment of a subject's irritability and anger outbursts over a 7-day period. It consists of three items: frequency of irritability behaviors (6-point Likert scale: "never" to "always"), frequency of anger outbursts (number of occurrences), and severity of the worst outburst (4-point Likert scale: "mild" to "very severe"). In certain embodiments, the method reduces the subject's score by 1, 2, 3, or 4 points.

[0210] EuroQol's 5-Dimensional, 5-Level Questionnaire In certain embodiments, the methods described herein are sufficiently effective in reducing motor impairment, self-care impairment, general functional impairment, pain / discomfort, anxiety, depression, or a combination thereof in subjects with HD, as assessed by the EuroQol 5-D 5-Level Questionnaire (EQ-5D-5L). The EQ-5D-5L is a certified self-report altered state questionnaire used to calculate a health status utility score for use in health economic analysis (see Brooks Health Policy 1996 37:53-72 and Herdman et al. Qual Life Res. 2011, 20:1727-36). The EQ-5D-5L has two components: a five-item healthy state profile that assesses motor, self-care, usual activity, pain / discomfort, and anxiety / depression, plus a visual analog scale (VAS) to measure health status. A publicly available weight measurement system allows for the creation of a single-component score of the subject's health status (index score) from the five-item score (i.e., without the VAS). In certain embodiments, the method improves the target EQ-5D-5L score.

[0211] Health Utility Index In certain embodiments, the methods described herein are sufficiently effective in improving the health status of subjects with HD, as assessed by the Health Utility Index (HUI). HUI is a multi-attribute system of health status (see Feeny et al., Pharmacoeconomics 1995, 7:490-502). The HUI2 and HUI3 questionnaires (commonly referred to as HUI2 / 3) contain 15 items with Likert-type response options. From these items, two scores are obtained: HU I2 (7 items) and HUI3 (8 items) can be produced. Both scores are health utility indices, where 0 = dead and 1 = perfectly healthy. In certain embodiments, the method improves the HUI score of the subject.

[0212] Columbia Suicide Severity Rating Scale In certain embodiments, the methods described herein are sufficiently effective in mitigating suicidal ideation or suicidal behavior in subjects with HD, as assessed by the Columbia Suicide Severity Rating Scale (C-SSRS). The C-SSRS is a tool constructed to assess suicidal ideation and behavior. It measures four components: severity of ideation, intensity of ideation, behavior, and lethality of actual suicide attempts. Binary (yes / no) data are collected for 10 categories, and a composite endpoint based on the category is used to monitor the subject's safety over time (Posner et al. Am.J. Psychiatry 2011). (168:1266-77). The C-SSRS maps to the Columbia-Classification Algorithm for Suicide Assessment and meets the criteria enumerated in the USFDA Draft Guidance (FDA 2012) for the assessment of suicidal tendencies in clinical trials. In certain embodiments, the method improves the subject's C-SSRS score.

[0213] VII. Specific Combination Therapies In certain embodiments, the method includes co-administration of ISIS 443139 together with at least one other pharmaceutical agent. In certain embodiments, at least one other pharmaceutical agent alleviates HD or its symptoms. In certain embodiments, ISIS 443139 is co-administered with at least one other pharmaceutical agent to produce a combination effect. In certain embodiments, ISIS 443139 is co-administered with at least one other pharmaceutical agent to produce a synergistic effect.

[0214] In certain embodiments, ISIS 443139 and at least one other pharmaceutical agent are administered simultaneously. In certain embodiments, ISIS 443139 and at least one other pharmaceutical agent are administered at different times. In certain embodiments, ISIS 443139 and at least one other pharmaceutical agent are prepared together in a single formulation. In certain embodiments, ISIS 443139 and at least one other pharmaceutical agent are administered and prepared separately.

[0215] In certain embodiments, pharmaceutical agents that may be administered concurrently with ISIS 443139 include: antipsychotics, e.g., haloperidol, chlorpromazine, clozapine, quetiapine, and olanzapine; antidepressants, e.g., fluoxetine, sertraline hydrochloride, venlafaxine, and nortriptyline; sedatives, e.g., benzodiazepines, clonazepam, paroxetine, venlafaxine, and beta-blockers; mood stabilizers, e.g., lithium, valproic acid, lamotrigine, and carbamazepine; paralytics, e.g., botulinum toxin; and / or tetrabenazine (Xenaz). Other experimental agents include, but are not limited to, ine, creatine, coenzyme Q10, trehalose, docosahexanoic acid, ACR16, ethyl-EPA, atomoxetine, citalopram, dimebon, memantine, sodium phenylbutyrate, ramelteon, ursodiol, zyprexa, xenacin, tiapride, riluzole, amantadine, [123I]MNI-420, atomoxetine, tetrabenazine, digoxin, detromethorphan, warfarin, alprozam, ketoconazole, omeprazole, and minocycline. [Examples]

[0216] The following embodiments illustrate, and are not limited to, specific embodiments of the present disclosure. There is no such thing. Furthermore, where specific embodiments are provided, the inventors intend for those specific embodiments to be generally applicable. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for further oligonucleotides having that motif or a similar motif. Similarly, for example, if a particular high-affinity modification is found at a particular position, other high-affinity modifications at the same position are also considered appropriate unless otherwise indicated.

[0217] Example 1: Phase 1-2a human clinical trial using ISIS 443139 A randomized, double-blind, multi-stage dose-escalating phase 1–2a trial was conducted involving adult human subjects with hemoglobin (HD). Table 1 shows the baseline characteristics of the human subjects. The subjects had a total functional capacity score of 11–13 on the Unified Huntington's Disease Rating Scale, indicating little to no functional impairment.

[0218] [Table 1-1]

[0219] [Table 1-2]

[0220] Human subjects were randomly assigned in a 3:1 ratio to receive either ISIS 443139 or placebo as a bolus intrathecal administration every four weeks for four doses (days 1, 29, 57, and 85). The primary endpoint was safety. Secondary endpoints included the pharmacokinetics of ISIS 443139 in CSF. Prescribed evaluation items included the concentration of mHTT protein in CSF.

[0221] Human subjects received either placebo or ISIS 443139 at escalating dose levels of 10 mg, 30 mg, 60 mg, 90 mg, or 120 mg. Each human subject received all four doses and completed the study. All adverse events in human subjects receiving ISIS 443139 were mild (83%) or moderate (17%) in severity (e.g., procedural pain and post-dural puncture headache). No serious adverse events were observed in human subjects receiving ISIS 443139. No clinically relevant adverse changes in laboratory variables were observed.

[0222] Immediately before administration on days 1, 29, 57, and 85, CSF (20 mL) was obtained from patients using a standard lumbar puncture collection kit to obtain trough concentrations of CSF mHTT protein. CSF was similarly collected during the post-treatment period, either day 113 or day 141 of the study. Human CSF mHTT protein was measured in three ways using a human mHTT single-molecule detection assay described by Wild et al., J. Clin. Invest. 2015, 125: 1979-1986, with the MW1 anti-HTT polyQ antibody (catalog 03-0076-02; Singulex) as described by Weiss et al., Anal Biochem. 2009, 395: 8-15. In patients treated with ISIS 443139, CSF trough concentrations of mHTT protein decreased in a dose-dependent manner at the last available sampling point 28 days after administration (see Table 2; up to a 63% decrease in individual patients (in the 120 mg cohort)). The 90 mg and 120 mg doses achieved an average decrease of approximately 40% in CSF mHTT protein. The percentage change was calculated from 1 day before administration to the last available point 28 days after administration (the latter being day 85 and day 113).

[0223] [Table 2]

[0224] In parallel with this clinical trial, we developed the Combined Unified Huntington's Disease Rating Scale (cUHDRS) to serve as an indicator of the clinical progression of early-stage hemoglobin (HD). We investigated the relationship between the degree of decrease in mHTT protein CSF concentration, the cUHDRS score, and changes in its four components. A correlation was observed between the decrease in mHTT protein CSF concentration and improvements in the cUHDRS score and two of its components.

[0225] Example 2: Phase 2 human clinical trial of ISIS 443139 for HD (results at 4 and 8 weeks) In the open-label extension study following the Phase 1-2a clinical trials described in Example 1, adult human subjects with HD received an initial loading dose of 120 mg on day 1, followed by a second loading dose of 120 mg on day 28. Subsequently, human subjects received a maintenance dose of 120 mg of ISIS 443139 every 4 weeks (Cohort Q4W) or every 8 weeks (Cohort Q8W). All doses of ISIS 443139 were delivered intrathecally. CSF samples were obtained, and the trough concentration of CSF mHTT protein was analyzed as described in Example 1. Using the trough concentration of mHTT protein, the mean decrease in CSF mHTT protein was calculated as a baseline percentage, as shown in Figure 1A for cohort Q4W and Figure 1B for cohort Q8W. As shown in Figures 1A and 1B, a decrease of approximately 30–50% in CSF mHTT protein was achieved by both regimens by day 85. In addition, CSF mHTT protein continued to decrease after day 85 in cohort Q4W. ISIS 443139 achieved a 66% decrease in the central trough concentration of CSF mHTT protein in cohort Q4W and a 47% decrease in the central trough concentration of CSF mHTT protein in cohort Q8W. Overall, ISIS 443139 was well tolerated in both cohorts.

[0226] Example 3. EEG activity as a biomarker for ISIS 443139 efficacy. The resting EEG of human subjects who participated in the Phase 1-2a clinical trial described in Example 1 was obtained from the following sources: Data were obtained at screening, baseline, and at 113, 141, and 197 days post-treatment after intrathecal administration of ISIS 443139 four times a month. A 20-electrode B-Alert®X24 wireless EEG system by Advanced Brain Monitoring (Carlsbad, CA), configured according to 10–20 systems, was used for EEG data acquisition. Resting EEG data was obtained during the study screening period for patients with HD, in four blocks per session (total recording time = 20 minutes), with alternative blocks of open or closed eyes. For healthy controls (HC), two blocks were recorded (total recording time = 10 minutes). Only closed-eye data were reported. Signals were digitized at 256 Hz using a 0.1–100 Hz bandpass filter, relative to the mastoid process. Offline, the signal was filtered to 1–30 Hz, cleaned using visual inspection, and noise signals were decomposed from the recording using independent component analysis (FastICA). Morlet wavelets (0.33 octaves) were used for frequency transformation of time-resolved EEG signals. For between-group statistics, rank-sum tests and cluster-based permutation tests (electrode × frequency space) based on rank-sum tests as first-level statistics were used. All error bars represent bootstrap estimates with 95% confidence intervals.

[0227] The results showed that HD reduced EEG brain activity compared to matched healthy controls. The results also showed a significant increase in EEG signal power in patients treated with ISIS 443139 compared to patients treated with placebo. Compared to baseline, ISIS 443139 treatment resulted in an increase in EEG signal power within the frequency range of 4–8 Hz. The increase in brain activity due to ISIS 443139 treatment was detectable at all dose levels and was present throughout the post-treatment EEG monitoring period. A positive correlation was also observed between the change from baseline in EEG activity and the change in CSF mHTT concentration.

[0228] Example 4: Phase 3 human clinical trial of ISIS 443139 for HD A randomized, double-blind, placebo-controlled Phase 3 clinical trial will be conducted to evaluate the efficacy and safety of intrathecal ISIS 443139 in adult human subjects (25-65 years old) with overt hemodialysis (HD). Human subjects have a CAG-Age Production Score (CAP score) >400. The CAP score is calculated by multiplying the age of the human subject by (CAG repeat length - 33.66). This study has two groups: the first cohort (Q8W) receives a loading dose of 120 mg of ISIS 443139 on days 1 and 28, followed by a maintenance dose of 120 mg of ISIS 443139 every 8 weeks; and the second cohort (Q16W) receives a loading dose of 120 mg of ISIS 443139 on days 1 and 28, followed by a maintenance dose of 120 mg of ISIS 443139 every 16 weeks. The primary efficacy measure will be the change from baseline in Total Functional Capacity (TFC) at week 101. The secondary efficacy measure will be the change from baseline in the cUHDRS score at week 101. Changes from baseline in Total Functional Capacity (TFC) score, Total Motor Score (TMS), Symbol-Digit Modality Test (SDMT) score, and Stroop Word Reading Comprehension (SWR) score will also be measured.

Claims

1. A method for alleviating Huntington's disease (HD) in a human subject requiring alleviation of HD, wherein the method involves applying the following chemical structure to the human subject: 【Chemistry 1】 The method comprising administering a therapeutically effective amount of a modified oligonucleotide or a salt thereof, in accordance with (Sequence ID 4).

2. The method according to claim 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

3. A method for reducing HD in a human subject requiring HD reduction, wherein the method involves applying the following chemical structure to the human subject: 【Chemistry 2】 The method comprising administering a therapeutically effective amount of a modified oligonucleotide in accordance with (Sequence ID 4).

4. A method for reducing HD in a human subject requiring reduction of HD, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide, wherein the modified oligonucleotide has the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (Sequence ID 4), A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The method wherein o = phosphodiester nucleoside bond.

5. The method according to any one of claims 1 to 4, wherein at least one symptom of HD is alleviated.

6. At least one of the aforementioned symptoms is associated with: brain atrophy, decreased brain activity, decreased brain connectivity, muscle atrophy, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, and motor dysfunction. The method according to claim 5, comprising harm, cognitive impairment, daily functioning impairment, decreased attention, impaired visual processing, decreased working memory, decreased psychomotor speed, impaired verbal motor output, decreased independence, decreased emotional blunting, decreased learning ability, impaired mental connection, speech impairment, depression, irritability, anger, motor impairment, impaired self-care, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, or a combination thereof.

7. A method for reducing HTT RNA in a human subject requiring a reduction in HTT RNA, wherein the method involves applying the following chemical structure to the human subject: 【Transformation 3】 The method comprising administering a therapeutically effective amount of a modified oligonucleotide or a salt thereof, in accordance with (Sequence ID 4).

8. The method according to claim 7, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

9. A method for reducing HTT RNA in a human subject requiring a reduction in HTT RNA, wherein the method involves applying the following chemical structure to the human subject: 【Chemistry 4】 The method comprising administering a therapeutically effective amount of a modified oligonucleotide in accordance with (Sequence ID 4).

10. A method for reducing HTT RNA in a human subject requiring a reduction in HTT RNA, the method comprising administering a therapeutically effective amount of modified oligonucleotides to the human subject, wherein the modified oligonucleotides are chemically represented as follows (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes It has mCe (SEQ ID NO: 4), A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The method wherein o = phosphodiester nucleoside bond.

11. A method for reducing HTT protein in a human subject requiring a reduction in HTT protein, wherein the method involves applying the following chemical structure to the human subject: 【Transformation 5】 The method comprising administering a therapeutically effective amount of a modified oligonucleotide or a salt thereof, in accordance with (Sequence ID 4).

12. The method according to claim 11, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

13. A method for reducing HTT protein in a human subject requiring a reduction in HTT protein, wherein the method involves applying the following chemical structure to the human subject: 【Transformation 6】 The method comprising administering a therapeutically effective amount of a modified oligonucleotide in accordance with (Sequence ID 4).

14. A method for reducing HTT protein in a human subject requiring a reduction in HTT protein, the method comprising administering a therapeutically effective amount of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide has the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (Sequence ID 4), A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The method wherein o = phosphodiester nucleoside bond.

15. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is 10 mg.

16. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is 30 mg.

17. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is 60 mg.

18. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is 90 mg.

19. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is 120 mg.

20. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is about 10 mg.

21. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is approximately 30 mg.

22. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is approximately 60 mg.

23. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is approximately 90 mg.

24. The method according to any one of claims 1 to 14, wherein the amount effective for the aforementioned treatment is approximately 120 mg.

25. The effective doses for the aforementioned treatment are 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg The method according to any one of claims 1 to 14, wherein the amount is any one of mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg.

26. The effective doses for the aforementioned treatment are approximately 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, and 165 mg. The method according to any one of claims 1 to 14, wherein the amount is approximately 170 mg, approximately 175 mg, approximately 180 mg, approximately 185 mg, approximately 190 mg, approximately 195 mg, approximately 200 mg, approximately 205 mg, approximately 210 mg, approximately 215 mg, approximately 220 mg, approximately 225 mg, approximately 230 mg, approximately 235 mg, approximately 240 mg, approximately 245 mg, approximately 250 mg, approximately 255 mg, approximately 260 mg, approximately 265 mg, approximately 270 mg, approximately 275 mg, approximately 280 mg, approximately 285 mg, approximately 290 mg, approximately 295 mg, and approximately 300 mg.

27. The effective doses for the aforementioned treatment are 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117.0 mg, 117.1 mg, 117.2 mg, and 117. 3mg, 117.4mg, 117.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118.0mg, 118.1mg, 118.2mg, 118.3 mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8mg, 118.9mg, 119.0mg, 119.1mg, 119.2mg, 119.3mg , 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg, 119.9mg, 120.0mg, 120.1mg, 120.2mg, 120.3mg, 1 20.4mg, 120.5mg, 120.6mg, 120.7mg, 120.8mg, 120.9mg, 121.0mg, 121.1mg, 121.2mg, 121.3mg, 121 .. 4mg, 121.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122.0mg, 122.1mg, 122.2mg, 122.3mg, 122.4 mg, 122.5mg, 122.6mg, 122.7mg, 122.8mg, 122.9mg, 123.0mg, 123.1mg, 123.2mg, 123.3mg, 123.4m The method according to any one of claims 1 to 14, wherein the amount is any one of g, 123.5 mg, 123.6 mg, 123.7 mg, 123.8 mg, 123.9 mg, 124.0 mg, 124.1 mg, 124.2 mg, 124.3 mg, 124.4 mg, 124.5 mg, 124.6 mg, 124.7 mg, 124.8 mg, 124.9 mg, and 125.0 mg.

28. The effective doses for the aforementioned treatment are approximately 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117.0 mg, 117.1 mg, 117.2 mg, 117.3 mg, 117.4 mg, and approximately 117.5 mg, approximately 117.6 mg, approximately 117.7 mg, approximately 117.8 mg, approximately 117.9 mg, approximately 118.0 mg, approximately 118.1 mg, approximately 118.2 mg, approximately 118.3 mg, 118.4 mg, approximately 118.5 mg, approximately 118.6 mg, approximately 118.7 mg, approximately 118.8 mg, approximately 118.9 mg, approximately 119.0 mg, approximately 119.1 mg, approximately 119.2 mg, approximately 119.3 mg, approximately 119.4 mg, approximately 119.5 mg, approximately 119.6 mg, approximately 119.7 mg, approximately 119.8 mg, approximately 119.9 mg, approximately 120.0 mg, approximately 120.1 mg, about 120.2 mg, about 120.3 mg, 120.4 mg, about 120.5 mg, about 120.6 mg, about 120.7 mg, about 12 0.8mg, about 120.9mg, about 121.0mg, about 121.1mg, about 121.2mg, about 121.3mg, about 121.4mg , about 121.5mg, about 121.6mg, about 121.7mg, about 121.8mg, about 121.9mg, about 122.0mg, about 122 .1 mg, about 122.2 mg, about 122.3 mg, about 122.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 1 The method according to any one of claims 1 to 14, wherein the amount is any one of 22.8 mg, about 122.9 mg, about 123.0 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124.0 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg, and about 125.0 mg.

29. The effective doses for the aforementioned treatment are 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, and 50 mg to 80 mg. g、50mg~70mg、50mg~60mg、60mg~200mg、60mg~190mg、60mg~180mg、60mg~170mg、60mg~160mg、60mg~150mg、60mg~140mg、60mg~120mg、60mg~110mg、60mg~100mg、60mg~80mg、60mg~70mg、70mg~200mg、70mg~190mg、70mg~180mg、70mg~170mg、70mg~160mg、70mg~150mg、70mg~140mg、70mg~120mg、70mg~110mg、70mg~100mg、70mg~80mg、80mg~200mg、80mg~190mg、80mg~180mg、80mg~170mg、80mg~160mg、80mg~150mg、80mg~140mg、80mg~120mg、80mg~110mg、80mg~100mg、80mg~90mg、90mg~200mg、90mg~190mg、90mg~180mg、90mg~170mg、90mg~160mg、90mg~150mg、90mg~140mg、90mg~120mg、90mg~110mg、90mg~100mg、100mg~200mg、100mg~190mg、100mg~180mg、100mg~170mg、100mg~160mg、100mg~150mg、100mg~140mg、100mg~120mg、100mg~110mg、110mg~200mg、110mg~190mg、110mg~180mg、110mg~170mg、110mg~160mg、110mg~150mg、110mg~140mg、110mg~130mg、110mg~120mg、120mg~200mg、120mg~190mg、120mg~180mg、120mg~170mg、120mg~160mg、120mg~150mg、120mg~140mg、120mg~130mg、130mg~200mg、130mg~190mg、130mg~180mg、130mg~170mg、130mg~160mg、130mg~150mg、130mg~140mg、140mg~200mg、140mg~190mg、140mg~180mg、140mg~170mg、140mg~160mg、140mg~150mg、150mg~200mg、150mg~190mg、150mg to 180mg, 150mg to 170mg, 150mg to 160mg, 160mg to 200mg, 160mg to 190mg, 160mg to 180mg, 160mg to 170mg, 180mg to 200mg, 180mg to 190mg, 190mg ~200mg, 105mg~135mg, 105mg~130mg, 105mg~125mg105mg~120mg, 110mg~135mg, 110mg~130mg, 110mg~125mg, 110mg~120mg, 115mg~135mg, 115mg to 130mg, 115mg to 125mg, 115mg to 120mg, 115mg to 125mg, 115mg to 120mg, 120mg to 135mg, 120mg to 125mg, 125mg to 140mg, 125mg to 130mg, 130mg ~135mg, 135mg~140mg, 120mg~129mg, 120mg~128mg, 120mg~127mg, 120mg~86mg, 120mg~124mg, 120mg~123mg, 120mg~122mg, 120mg~121mg, 121mg to 130mg, 122mg to 129mg, 122mg to 128mg, 122mg to 127mg, 122mg to 126mg, 122mg to 125mg, 122mg to 124mg, 122mg to 123mg, 123mg to 130mg, 123mg ~129mg, 123mg~128mg, 123mg~127mg, 123mg~126mg, 123mg~125mg, 123mg~124mg, 124mg~130mg, 124mg~129mg, 124mg~128mg, 124mg~127mg The method according to any one of claims 1 to 14, wherein the amount is within the range of 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.

30. The effective dose for the aforementioned treatment is less than 300 mg, less than 295 mg, less than 290 mg, and 285 mg. Less than g, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, 1 The method according to any one of claims 1 to 14, wherein the amount is any one of the following: less than 35 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

31. The effective dose for the aforementioned treatment is approximately less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, and less than 150 mg. The method according to any one of claims 1 to 14, wherein the amount is less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

32. The method according to any one of claims 1 to 14, wherein the amount effective for the treatment is at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185 mg, at least 190 mg, at least 195 mg, and at least 200 mg.

33. The effective dose for the aforementioned treatment is at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, at least about 150 mg, at least about 155 mg, at least about 16 The method according to any one of claims 1 to 14, wherein the amount is any one of 0 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185 mg, at least about 190 mg, at least about 195 mg, and at least about 200 mg.

34. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every four weeks.

35. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every eight weeks.

36. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every 12 weeks.

37. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every 16 weeks.

38. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every 20 weeks.

39. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every four weeks.

40. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every eight weeks.

41. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every 12 weeks.

42. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every 16 weeks.

43. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once every 20 weeks.

44. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, and once every twenty weeks.

45. The method according to any one of claims 1 to 33, comprising administering the modified oligonucleotide at any of the following intervals: approximately once a week, approximately once every two weeks, approximately once every three weeks, approximately once every four weeks, approximately once every five weeks, approximately once every six weeks, approximately once every seven weeks, approximately once every eight weeks, approximately once every nine weeks, approximately once every ten weeks, approximately once every eleven weeks, approximately once every twelve weeks, approximately once every thirteen weeks, approximately once every fourteen weeks, approximately once every fifteen weeks, approximately once every sixteen weeks, approximately once every seventeen weeks, approximately once every eighteen weeks, approximately once every nineteen weeks, and approximately once every twenty weeks.

46. The modified oligonucleotide is administered to the aforementioned human subjects in an initial loading dose of 120 mg. The method according to any one of claims 1 to 33, which includes doing the following.

47. The method according to claim 46, comprising administering a second loading dose of 120 mg of the modified oligonucleotide to the human subject four weeks after the initial loading dose.

48. The method according to claim 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject four weeks after the second loading dose.

49. The method according to claim 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject eight weeks after the second loading dose.

50. The method according to claim 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject 12 weeks after the second loading dose.

51. The method according to claim 47, comprising administering a maintenance dose of 120 mg of the modified oligonucleotide to the human subject 16 weeks after the second loading dose.

52. The method according to any one of claims 7 to 10 and 15 to 51, wherein the HTT RNA is mHTT RNA.

53. The method according to any one of claims 11 to 51, wherein the HTT protein is an mHTT protein.

54. A method for reducing HD, reducing HTT RNA, reducing HTT protein, reducing mHTT RNA, or reducing mHTT protein in a human subject requiring reduction of HD, wherein the method involves the following chemical structure in the human subject: 【Transformation 7】 The method comprising intrathecal administration of 120 mg or about 120 mg of a modified oligonucleotide or a salt thereof in a therapeutically effective amount, according to (Sequence ID 4).

55. The method according to claim 54, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

56. A method for reducing HD, reducing HTT RNA, reducing HTT protein, reducing mHTT RNA, or reducing mHTT protein in a human subject requiring reduction of HD, wherein the method involves the following chemical structure in the human subject: 【Transformation 8】 The method comprising intrathecal administration of 120 mg or approximately 120 mg of a modified oligonucleotide in a therapeutically effective amount, in accordance with (Sequence ID 4).

57. A method for reducing HD, reducing HTT RNA, reducing HTT protein, reducing HTT mRNA, or reducing mHTT protein in a human subject requiring reduction of HD, the method comprising intrathecal administration of a therapeutically effective amount of 120 mg or about 120 mg of a modified oligonucleotide to the human subject, wherein the modified oligonucleotide has the following chemical notation (5'→3'): mCes Teo mCeo Aeo Ges Tds Ads Ads mCds Ads Tds Tds Gds Ads mCds Aeo mCeo mCeo Aes mCe (Sequence ID 4), A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The method wherein o = phosphodiester nucleoside bond.

58. The method according to any one of claims 54 to 57, comprising administering the modified oligonucleotide once every four weeks.

59. The method according to any one of claims 54 to 57, comprising administering the modified oligonucleotide once every eight weeks.

60. The method according to any one of claims 54 to 57, comprising administering the modified oligonucleotide once every 16 weeks.

61. The aforementioned human subjects, a) The modified oligonucleotide in an initial loading dose of approximately 120 mg, b) Approximately four weeks after administering the initial loading dose, administer a second loading dose of approximately 120 mg of the modified oligonucleotide. c) Approximately eight weeks after administering the second loading dose, administer the modified oligonucleotide in a first maintenance dose of approximately 120 mg. d) The method according to any one of claims 54 to 57, comprising administering a second maintenance dose of the modified oligonucleotide, approximately 120 mg, about eight weeks after administering the first maintenance dose.

62. The aforementioned human subjects, a) The modified oligonucleotide in an initial loading dose of approximately 120 mg, b) Approximately four weeks after administering the initial loading dose, administer a second loading dose of approximately 120 mg of the modified oligonucleotide. c) Approximately 16 weeks after administering the second loading dose, administer the modified oligonucleotide in a first maintenance dose of approximately 120 mg. d) The method according to any one of claims 54 to 57, comprising administering a second maintenance dose of the modified oligonucleotide, approximately 120 mg, about 16 weeks after administering the first maintenance dose.

63. The method according to any one of claims 54 to 62, wherein at least one symptom of HD is alleviated.

64. The method according to claim 63, wherein the at least one symptom includes brain atrophy, decreased brain activity, decreased brain connectivity, muscle atrophy, neurodegeneration, heart failure, impaired glucose tolerance, weight loss, osteoporosis, testicular atrophy, general dysfunction, motor dysfunction, cognitive dysfunction, daily functioning impairment, decreased attention, impaired visual processing, decreased working memory, decreased psychomotor speed, impaired verbal motor output, decreased independence, decreased emotional blunting, decreased learning ability, impaired mental connectivity, speech impairment, depression, irritability, anger, motor dysfunction, self-care impairment, pain, discomfort, anxiety, suicidal ideation, suicidal behavior, or a combination thereof.

65. The method according to any one of claims 1 to 64, wherein the human subject has a mutation in at least one IT15 gene.

66. The method according to any one of claims 1 to 65, comprising identifying a mutation in at least one IT15 gene in the human subject.

67. The at least one IT15 gene is at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, and at least The method according to claim 65 or claim 66, further comprising any of 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, or at least 60 consecutive CAG iterations.

68. The method according to claim 65 or claim 66, wherein the at least one IT15 gene has 27 to 35 consecutive CAG repeats.

69. The method according to claim 65 or claim 66, wherein the at least one IT15 gene has 35 to 60 consecutive CAG repeats.

70. The method according to claim 65 or claim 66, wherein the at least one IT15 gene has more than 60 consecutive CAG repeats.

71. The method according to any one of claims 1 to 70, wherein the modified oligonucleotide is administered to the CNS of a human subject.

72. The method according to any one of claims 1 to 71, wherein the modified oligonucleotide is administered by intrathecal administration.

73. The method according to any one of claims 1 to 72, wherein the modified oligonucleotide is administered by bolus intrathecal administration.

74. The method according to any one of claims 1 to 73, wherein HTT RNA is reduced.

75. The method according to any one of claims 1 to 74, wherein the HTT protein is reduced.

76. The method according to any one of claims 1 to 75, wherein mHTT RNA is reduced.

77. The method according to any one of claims 1 to 76, wherein the mHTT protein is reduced.

78. The method according to any one of claims 1 to 77, comprising detecting a certain amount of mHTT RNA in a biological sample from the aforementioned human subject.

79. The method according to any one of claims 1 to 78, comprising detecting a certain amount of mHTT protein in a biological sample from the aforementioned human subject.

80. The method according to any one of claims 1 to 79, wherein the biological sample includes cerebrospinal fluid.

81. The method according to any one of claims 78 to 80, wherein the detection occurs before the administration.

82. The method according to any one of claims 78 to 80, wherein the detection occurs after the administration.

83. The method according to any one of claims 78 to 80, wherein the detection occurs before and after the administration.

84. Any one of claims 78 to 83, comprising detecting the amount of HTT RNA, HTT protein, mHTT RNA, mHTT protein, or a combination thereof, and then adjusting the administered initial loading dose, loading dose, maintenance dose, or therapeutically effective dose. Methods used.

85. The method according to any one of claims 1 to 84, comprising performing an electroencephalogram (EEG) or magnetic resonance imaging (MRI) on the subject to analyze the brain activity, brain size, or a combination thereof of the subject.

86. The method according to claim 85, wherein the EEG or MRI is performed before administration, after administration, or in combination thereof.

87. The method according to claim 86, comprising determining or adjusting the amount effective for the treatment after performing the EEG or MRI.

88. The method according to claim 87, comprising performing EEG or MRI after administration, and adjusting the frequency of administration after performing EEG or MRI.

89. The method according to any one of claims 85 to 88, wherein the EEG or MRI is performed within 1, 2, 4, 6, 8, 12, or 24 hours of administration.

90. The method according to any one of claims 85 to 89, comprising: performing the EEG before administration; performing the analysis after administration; detecting an increase of less than 4 Hz in EEG signal power from a first EEG to a second EEG; and subsequently increasing the frequency of administration of a therapeutically effective amount of the modified oligonucleotide.

91. The method according to claim 90, comprising administering a loading dose approximately once every four weeks, administering a maintenance dose approximately once every eight or sixteen weeks before recording the first EEG, and administering the maintenance dose in less than eight weeks or less than sixteen weeks.

92. The method according to any one of claims 85 to 91, comprising recording a first EEG before administration, recording a second EEG after administration, detecting an increase of less than 4 Hz in EEG signal power from the first EEG to the second EEG, and subsequently administering the modified oligonucleotide in a dose greater than the amount effective for the treatment.

93. The method according to claim 92, wherein the dose is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 90%, or at least more than 100% of the amount effective for the treatment.

94. The method according to any one of claims 85 to 93, wherein the amount effective for the aforementioned treatment is about 120 mg or 120 mg.

Images