Elimination of CD19-positive lymphomas by NK cells expressing CD19-CAR

Abstract

We provide genetically modified cells for cancer treatment. [Solution] In this invention, NK-92 cells expressing CD19 CAR, CD16, and IL2 were obtained by introducing a multi-cistronic construct encoding CD19 CAR, Fc receptor, IL-2, or a variant thereof into NK-92® cells. Compositions comprising these cells, and methods for treating cancer in patients using these cells are provided herein.

Description

[Technical Field]

[0001] This application claims priority to the inventors' concurrently pending U.S. Provisional Patent Application No. 62 / 753,719, filed on 31 October 2018.

[0002] Sequence List The contents of the 38kb sequence listing ASCII text file named 104077.0008PCT Seq_ST25 were created on July 15, 2019, and submitted electronically via EFS-Web with this application, and are incorporated as a whole by reference.

[0003] The field of this invention is genetically modified cells related to cancer treatment. [Background technology]

[0004] The background art description contains information that may be useful in understanding the present invention. Nothing provided herein constitutes prior art or relates to the currently claimed invention, nor is it permitted that any publication specifically or implicitly referenced constitutes prior art.

[0005] All publications and patent applications herein are incorporated by reference to the same extent as each individual publication or patent application is shown to be incorporated by reference specifically and individually. If a definition or use of a term in an incorporated reference conflicts with or contradicts a definition of that term provided herein, the definition provided herein shall apply, and the definition of that term in the reference shall not apply.

[0006] Natural killer (NK) cells are cytotoxic lymphocytes that constitute the main component of the innate immune system. NK cells generally make up about 10-15% of circulating lymphocytes and bind to and kill target cells, such as virus-infected cells and many malignant tumor cells, nonspecifically with respect to antigens and without prior immune sensitization. (Herberman et al., Science 214:24 (1981)). Killing of target cells occurs through the induction of cytolysis. NK cells used in autologous NK cell transplantation are isolated from the peripheral blood lymphocyte ("PBL") fraction of the blood of the subject, expanded in cell culture to obtain a sufficient number of cells, and then reinjected into the subject. Such autologous NK cells have shown some efficacy in in vivo therapy. However, such therapies are limited to autologous situations and are further complicated by the fact that not all NK cells are cytolytic.

[0007] NK-92® is a cytolytic cancer cell line discovered in the blood of subjects with non-Hodgkin lymphoma and subsequently immortalized in vitro. NK-92® cells are derived from NK cells but lack the major inhibitory receptor displayed by normal NK cells, while retaining the majority of activating receptors. However, NK-92® cells do not attack normal cells, nor do they induce unacceptable immune rejection responses in humans. Characterization of the NK-92® cell line is disclosed in International Publication No. 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK-92® cells are being evaluated as a therapeutic agent in the treatment of certain cancers. [Overview of the Initiative] [Means for solving the problem]

[0008] In some embodiments, this disclosure provides NK-92® cells expressing CD19 CAR and Fc receptor. In some embodiments, the NK-92® cells include a multicistronic construct encoding CD19 CAR and Fc receptor. In some embodiments, the Fc receptor is CD16. In some embodiments, the Fc receptor includes SEQ ID NO: 2. In some embodiments, the multicistronic transgene further includes a sequence encoding IL-2 or a variant thereof. In some embodiments, the IL-2 variant is erIL-2. In some embodiments, one or more coding sequences of CD19 CAR, Fc receptor, or erIL-2 are codon-optimized for expression in human systems.

[0009] In some embodiments, NK-92® cells can kill CD19-expressing cells, such as tumor cells. In some embodiments, the tumor cells are SUP-B15 cells. In some embodiments, the CD19 CAR contains an scFv antibody fragment. In some embodiments, the scFv antibody fragment has the amino acid sequence of SEQ ID NO: 10. In some embodiments, the multicistronic construct contains the sequence of SEQ ID NO: 9, which encodes the scFv antibody fragment. In some embodiments, NK-92® cells contain a sequence encoding a self-cleaving peptide, which is located between the CD19 CAR and CD16, and which enables equimolar expression of CD19 CAR and FcR. In some embodiments, NK-92® cells contain an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof.

[0010] In some embodiments, the direct cytotoxicity of NK-92® cells against CD19-expressing cells is 70-100% when the effector-to-target ratio is 10. In some embodiments, the ADCC activity of NK-92® cells is 30-90% when the effector-to-target ratio is 10. In some embodiments, the CD19 CAR contains a sequence that shares at least 90% identity with SEQ ID NO: 10.

[0011] In some embodiments, the Disclosure provides a kit comprising a pharmaceutical composition containing the NK-92® cells of the Disclosure.

[0012] In some embodiments, the disclosure provides a method for generating NK-92® cells, comprising providing a vector encoding CD19 CAR and CD16, and introducing the vector into NK-92® cells to generate NK-92® cells. In some embodiments, the vector further comprises a sequence encoding IL-2. In some embodiments, the vector comprises a sequence encoding a self-cleaving peptide, the sequence located between the CAR and CD16, and the sequence enabling equimolar expression of the CAR and CD16. In some embodiments, the vector comprises an internal ribosome entry sequence (IRES) between the CD16 encoding sequence and the IL-2 encoding sequence.

[0013] In some embodiments, the Disclosure provides a method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a composition, wherein the composition comprises any multiple NK-92® cells. In some embodiments, the subject has a body surface area of ​​1 m². 2 Approximately 1 x 10 8 ~Approx. 1×10 11 Individual modified cells are administered to the target.

[0014] In some embodiments, cancer is leukemia or lymphoma.

[0015] In some embodiments, cancer is one or more of the following: B-cell malignancies, B-cell malignancies after HSCT, CLL, B-ALL, acute lymphoblastic leukemia (ALL), B-cell lineage lymphoma after UCBT, chronic lymphocytic leukemia (CLL), B-non-Hodgkin lymphoma (B-NHL), ALL after HSCT; lymphoma, refractory follicular lymphoma, or lymphoblastic leukemia. In some embodiments, B-cell malignancies are mantle cell lymphomas. In some embodiments, multiple NK-92® cells are administered intravenously. In some embodiments, multiple NK-92® cells are administered intratumorally.

[0016] The above general description and the following detailed description are illustrative and explanatory and provide further information about this disclosure. Other purposes, advantages and novel features will be readily apparent to those skilled in the art.

[0017] The purpose, features, and advantages will be more readily apparent when considered in conjunction with the accompanying drawings and when referring to the following disclosure. [Brief explanation of the drawing]

[0018] [Figure 1] This is a schematic representation of the structural domains of the first, second, and third generation CARs. [Figure 2] The components of a tricistronic plasmid containing the CAR coding sequence, P2A sequence, CD16 coding sequence, and erIL-2 coding sequence are shown. [Figure 3A-B] The results of flow cytometry analysis showing the expression of CD16 and CD19-CAR on the surface of CD19 t-haNK™ cells are shown. The peaks on the right side of each plot represent populations of cells expressing CD16 or CD19. [Figure 4A-B]Figure 4A shows the cytotoxic effect of CD19 t-haNK® cells against K562 cells. 16B1 and 18B1 are two CD19 t-haNK® populations obtained from two electroporation events performed on two different days. Figure 4B shows the cytotoxic effect of selected CD19 t-haNK® clones against K562 in a cytotoxicity assay. [Figure 5A-B] Figure 5A shows the cytotoxic effect of CD19 t-haNK® cells against SUP-B15 cells. 16B1 and 18B1 are two CD19 t-haNK® populations obtained from two electroporation events performed on two different days. Figure 5B shows the cytotoxic effect of selected CD19 t-haNK® clones against SUP-B15 in a cytotoxicity assay. [Figure 6A-B] Figure 6A shows the ADCC activity of CD19 t-haNK® cells against SKBr3 cells when combined with Herceptin (anti-Her2 antibody). The anti-CD20 antibody Rituxan was used as a control. Figure 6B shows the ADCC activity of selected CD19 t-haNK® clones against CD19KO / CD20+ SUP-B15 cells when combined with the anti-CD20 antibody Rituximab. [Figure 7] This shows the doubling time of the selected CD19 t-haNK(trademark) clone. [Figure 8] This shows IL-2 release from selected CD19 t-haNK(trademark) clones under culture conditions. [Figure 9] The survival curves of animals carrying IV Raji tumors are shown. Statistical analysis was performed using the log-rank (Mantelcox) test, ****, P<0.0001. [Figure 10] This shows the changes in animal body weight in the IV Raji tumor model. Data are mean ± SEM. SEM was calculated by dividing the standard deviation by the square root of N. [Figure 11]The tumor growth curves for the SC Raji model are shown. Data are mean ± SEM. Statistical analysis was performed using two-way ANOVA followed by Tukey's test for multiple comparisons; ***, P<0.001; ****, P<0.0001. [Figure 12] This study demonstrates that CD19 t-haNK™ reduced the metastatic disease burden in the liver of SC Raji tumor-bearing mice. (a) Whole liver images of animals from the indicated treatment group at day 13. Yellow arrows indicate metastatic lesions. Livers were fixed in 10% formalin for at least 24 hours before photography. (b) Quantification of tumor cell progression in the liver at the indicated day (assessed by HE staining). Day 13: Unpaired two-sided t-test*, P=0.0257. Statistical analysis for days 11 and 15 could not be performed due to limited sample size. See Table 4 for raw data. [Figure 13] This shows changes in animal body weight in the SC Raji tumor model. Data are mean ± SEM. [Modes for carrying out the invention]

[0019] overview This disclosure provides NK-92® cells expressing CD19 CAR and Fc receptors. In some embodiments, the cells further express IL-2. In some embodiments, the NK-92® cells include a tricistronic construct comprising nucleic acid sequences encoding CD19 CAR and Fc, as well as IL-2.

[0020] term Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art.

[0021] In this specification and in the following claims, numerous terms are referenced and defined to have the following meanings.

[0022] The terms used herein are for the purpose of describing specific embodiments only and are not limiting. The singular forms “a,” “an,” and “the” used herein also include the plural form unless otherwise specified by the context. Therefore, for example, a reference to “natural killer cells” includes multiple natural killer cells.

[0023] All numerical specifications, such as pH, temperature, time, concentration, quantity, and molecular weight, including their ranges, are approximations that may vary by only 0.1 or 1.0 increments (+) or (-) as appropriate. While not always explicitly stated, it should be understood that the term "approximately" may precede all numerical specifications.

[0024] As used herein, when used to indicate the presence of a particular cell marker, the "+" sign means that the cell marker is detectably present against an isotype control in fluorescence-activated cell sorting; or detectable beyond the background in quantitative or semi-quantitative RT-PCR.

[0025] As used herein, when used to indicate the presence of a particular cell marker, the cell marker is not detectably present against an isotype control in fluorescence-activated cell sorting; or is not detectable beyond the background in quantitative or semi-quantitative RT-PCR.

[0026] As will be understood by those skilled in the art, for any and all purposes, and especially with regard to the provision of written explanations, all scopes disclosed herein also encompass any and all conceivable subscopes and combinations thereof. Any listed scope can be readily understood and made possible that the same scope may be divided into at least equal 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 10, etc. As a non-limiting example, each scope disclosed herein can be readily divided into a lower third, a middle third, an upper third, etc. Similarly, as will be understood by those skilled in the art, all terms, e.g., “maximum,” “at least,” “greater than,” “less than,” etc., include the number cited and then refer to the scope that can be divided into the above subscopes. Finally, as will be understood by those skilled in the art, a scope includes each individual member. Thus, for example, a group having 1 to 3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1 to 5 cells refers to a group having 1, 2, 3, 4, or 5 cells, and so on.

[0027] As used herein, the term “substantially identical” is used interchangeably with the terms “equivalent” or “substantially similar,” and refers to a quantifiable characteristic of NK-92® cells, such as cytotoxicity, viability, or cell doubling time, where two measurements of that characteristic differ from each other by 15% or less, 10% or less, 8% or less, or 5% or less.

[0028] It should be understood that, although not always explicitly stated, the reagents described herein are merely illustrative and that equivalents thereof are known in the art.

[0029] For the purposes of this invention, and unless otherwise indicated, the term "NK-92(registered trademark)" refers to the original NK-92(registered trademark) cell line, as well as clones of the NK-92(registered trademark) cell line, NK-92(registered trademark) cells, and modified NK-92(registered trademark) cells (e.g., by introduction of exogenous genes). NK-92® cells and exemplary and non-exclusive modifications thereof are described in U.S. Patent Nos. 7,618,817; 8,034,332; 8,313,943; 9,181,322; 9,150,636; and U.S. Patent Publication No. 10 / 008,955, all of which are incorporated herein by reference as a whole, including wild-type NK-92®, NK-92®-CD16, NK-92®-CD16-γ, NK-92®-CD16-ζ, NK-92®-CD16(F176V), NK-92®-MI, and NK-92®-CI. NK-92® cells are known to those skilled in the art, and such cells are readily available from NantKwest®, Inc.

[0030] As used herein, the term "NK-92(registered trademark) cells" refers to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights thereto of which are owned by NantKwest(registered trademark) (hereinafter, "NK-92(registered trademark) cells").

[0031] As used herein, the term "aNK cells" refers to unmodified natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights thereto of which are owned by NantKwest® (hereinafter, "aNK cells").

[0032] As used herein, the term "haNK cells" refers to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), whose rights are held by NantKwest®, and which have been modified to express CD16 on their cell surface (hereinafter referred to as "CD16+NK-92® cells" or "haNK cells").

[0033] As used herein, the term "taNK cells®" refers to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights thereto of which are owned by NantKwest®, and which have been modified to express a chimeric antigen receptor (hereinafter referred to as "CAR-modified NK-92® cells" or "taNK cells®").

[0034] As used herein, the term "t-haNK®" cells refer to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), which are vested by NantkWest®, express CD16 on their cell surface, and are modified to express a chimeric antigen receptor (hereinafter referred to as "CAR-modified CD16+NK-92® cells" or "t-haNK® cells"). In some embodiments, the tumor-specific antigen is CD19, and these NK-92® cells are referred to as CD-19 t-haNK® cells.

[0035] As used herein, the term "multicistronic construct" refers to a recombinant DNA construct that can be transcribed into a single mRNA molecule, which encodes two or more transgenes. A multicistronic construct is referred to as a bicistronic construct if it encodes two transgenes, a tricistronic construct if it encodes three genes, a quadrocistric construct if it encodes four genes, and so on.

[0036] As used herein, the term “chimeric antigen receptor” (CAR) refers to an extracellular antigen-binding domain fused to an intracellular signaling domain. CARs can be expressed in T cells or NK cells to increase cytotoxicity. Generally, the extracellular antigen-binding domain is an scFv specific to the antigen found on the target cell. CAR-expressing NK-92® cells are targeted to cells that express a particular antigen on their cell surface, based on the specificity of the scFv domain. The scFv domain can be genetically engineered to recognize any antigen, such as tumor-specific and virus-specific antigens. For example, the CD19 CAR recognizes CD19, a cell surface marker expressed by some cancers.

[0037] As used herein, the term "tumor-specific antigen" refers to an antigen present on cancer or neoplastic cells but undetectable on normal cells originating from the same tissue or lineage as the cancer cells. As used herein, tumor-specific antigen also refers to tumor-associated antigens, i.e., antigens expressed at higher levels on cancer cells compared to normal cells originating from the same tissue or lineage as the cancer cells.

[0038] As used herein, the term “target” refers to the ability of NK-92® cells to recognize and kill tumor cells (i.e., target cells) when referring to tumor targeting. In this context, the term “targeted” refers, for example, to the ability of CARs expressed by NK-92® cells to recognize and bind to cell surface antigens expressed by tumors.

[0039] The term “antibody” refers to any isotype of intact immunoglobulin, or a fragment thereof that can compete with an intact antibody for specific binding to a target antigen, such as chimeric, humanized, fully human, and bispecific antibodies. Intact antibodies generally contain at least two full-length heavy chains and two full-length light chains, but in some examples they may contain fewer chains; for example, antibodies naturally occurring in camels may contain only heavy chains. Antibodies may originate exclusively from a single source, or they may be “chimeric,” where different parts of the antibody originate from two different antibodies. Antigen-binding proteins, antibodies, or binding fragments can be produced in hybridomas by recombinant DNA technology or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise specified, the term “antibody” includes antibodies containing two full-length heavy chains and two full-length light chains, as well as their derivatives, variants, fragments, and mutaines. Furthermore, unless explicitly excluded, antibodies include monoclonal antibodies, bispecific antibodies, minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as “antibody mimes”), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as “antibody conjugates”), and fragments thereof. In some embodiments, this term also includes peptide bodies.

[0040] The term "subject" refers to non-human animals, such as mammals, e.g., cats, dogs, cattle, horses, pigs, sheep, and goats, as well as humans. The term "subject" also refers to patients who require treatment for the diseases described herein.

[0041] "Optional" or "depending on circumstances" means that the event or situation described thereafter may or may not occur, and that the description includes examples of when the event or situation occurs and when it does not.

[0042] The term “contains” means that the composition and method described includes the elements, but does not exclude other elements. “Essentially consisting of” means, when used to define a composition and method, to exclude any other elements that are essentially important to the combination. For example, a composition essentially consisting of the elements defined herein does not exclude other elements that do not substantially affect the basic and novel features of the claims. “Consists of” means to exclude other components and substantial method steps in amounts greater than trace amounts. Embodiments defined by each of these transitional terms are within the scope of this disclosure.

[0043] As used herein, the terms “cytotoxicity” and “cytolyticity” are synonymous when used to describe the activity of effector cells, such as NK cells. Generally, cytotoxic activity refers to the killing of target cells through various biological, biochemical, or biophysical mechanisms. More specifically, cell lysis refers to the activity of an effector that dissolves the plasma membrane of target cells, thereby destroying their physical integrity. This results in the killing of target cells. While we do not wish to be constrained by theory, the cytotoxic effect of NK cells is thought to be due to cell lysis.

[0044] The term "kill" in relation to cells / cell populations includes any type of operation that results in the death of those cells / cell populations.

[0045] The term "cytokine" refers to a general class of biomolecules that affect cells of the immune system. Examples of cytokines, though not limited to them, include FLT3 ligands, interferons, and interleukins (ILs), particularly IL-2, IL-12, IL-15, IL-18, and IL-21.

[0046] The terms “patient,” “subject,” and “individual” are used interchangeably herein and refer to any animal, or its cells, whether in vitro or in situ, that is suitable for the methods described herein. In some non-limiting embodiments, the patient, subject, or individual is a human.

[0047] The term “to treat” or “treatment” encompasses the treatment of a disease or disorder described herein in a subject, e.g., a human, and includes (i) inhibiting the disease or disorder, i.e., stopping its onset; (ii) alleviating the disease or disorder, i.e., causing regression of the disorder; (iii) slowing the progression of the disorder; and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. The term “administering” monoclonal antibodies or natural killer cells to a subject, or “administering” them to a subject, includes any route for introducing or delivering the antibodies or cells to perform the desired function. Administration may be carried out by any route suitable for the delivery of cells or monoclonal antibodies. Thus, possible routes of delivery include intravenous, intramuscular, intraperitoneal, or subcutaneous delivery. In some embodiments, modified NK-92® cells are administered directly to a tumor, for example, by injection into the tumor. In some embodiments, the modified NK-92® cells described herein are administered parenterally, for example, by injection, infusion, or transplantation (subcutaneous, intravenous, intramuscular, intravesicular, intratumoral, or intraperitoneal).

[0048] The term "expression" refers to the production of gene products.

[0049] As used herein, the term "cytotoxicity" refers to the killing of target cells by any of the following biological, biochemical, or biophysical mechanisms, when used to describe the activity of effector cells, such as NK cells.

[0050] The terms “reduce,” “reduced,” “reduction,” and “decrease” are all used herein to mean a reduction of at least 10% compared to a reference level, for example, a reduction of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or a reduction of up to 100% including 100% (i.e., a level of absence compared to a reference sample), or any reduction of 10 to 100% compared to a reference level.

[0051] The term "cancer" refers to all types of cancer, neoplasms, or malignant tumors found in mammals, such as leukemia, carcinomas, and sarcomas. Exemplary cancers include cancers of the brain, breast, cervix, colon, head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovarian, sarcoma, stomach, uterus, and medulloblastoma. Additional examples include Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, neoplasms of the pancreatic endocrine and exocrine parts, and prostate cancer.

[0052] The term “therapeutic effective dose” or “effective dose” refers to the amount required to improve the symptoms of a disease in an untreated patient. The effective dose of the active compound used to implement this disclosure for the therapeutic treatment of a disease will vary depending on the method of administration, the age, weight, and overall health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate dose and dosage regimen. Such a dose is referred to as the “effective” dose.

[0053] Titles or subtitles may be used herein for the convenience of the reader and do not affect the scope of this disclosure. Furthermore, some terms used herein are specifically defined below.

[0054] NK-92(registered trademark) cells NK-92® is a cytolytic cancer cell line discovered in the blood of subjects with non-Hodgkin lymphoma and subsequently immortalized in vitro. NK-92® cells are derived from NK cells but lack the major inhibitory receptors displayed by normal NK cells, while retaining the majority of activating receptors. However, NK-92® cells do not attack normal cells, nor do they induce unacceptable immune rejection responses in humans. Characterization of the NK-92® cell line is disclosed in International Publication No. 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK-92® cells are being evaluated as a therapeutic agent in the treatment of certain cancers.

[0055] vector A vector for transfecting cells to produce the modified cells described herein is described herein. In one embodiment, the vector described herein is a transient expression vector. Exogenous transgenes introduced using such a vector are not integrated into the nuclear genome of the cell; therefore, in the absence of vector replication, the exogenous transgenes are degraded or diluted over time.

[0056] In one embodiment, the vector described herein enables stable translocation of cells. In one embodiment, the vector enables the uptake of a transgene into the cell genome. In one embodiment, the vector has a positive selection marker. The positive selection marker is any gene that allows cells to grow under conditions that kill cells that do not express the gene. Non-limiting examples include antibiotic resistance, for example, Geneticin (the Neo gene from Tn5).

[0057] In one embodiment, the vector is a plasmid vector. In one embodiment, the vector is a viral vector. As will be understood by those skilled in the art, any suitable vector can be used. Suitable vectors are well known in the art.

[0058] In some embodiments, cells are translocated with mRNA encoding a target protein (e.g., CAR). mRNA translocation results in transient expression of the protein. In one embodiment, mRNA translocation into NK-92® cells is performed immediately before cell administration. In one embodiment, "immediately before" cell administration refers to approximately 15 minutes to approximately 48 hours before administration. Preferably, mRNA translocation is performed approximately 5 hours to approximately 24 hours before administration.

[0059] CD19 CD19 is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. It has a single transmembrane domain, a cytoplasmic C-terminus, and an extracellular N-terminus. CD19 is a biomarker for normal and neoplastic B cells, as well as follicular dendritic cells, and is critically involved in establishing the endogenous B cell signaling threshold via modulation of both B cell receptor-dependent and B cell-independent signaling.

[0060] CD19 is expressed in most acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), and B-cell lymphomas. The majority of B-cell malignancies express CD19 at normal to high levels (80% of ALL, 88% of B-cell lymphomas, and 100% of B-cell leukemias). CD19 is a hallmark of B cells, but it has also been observed in cases of myeloma, for example, in 2% of AML cases. (Wang et al., Exp. Hematol. Oncol. Nov. 29, 2012; 1:36). A non-limiting list of malignancies associated with CD19 is shown in Table 1.

[0061] [Table 1]

[0062] CAR Phenotypic changes that distinguish tumor cells from normal cells derived from the same tissue are often associated with changes in the expression of specific gene products, e.g., loss of normal cell surface components or acquisition of other cell surface components (i.e., antigens undetectable in corresponding normal, non-cancerous tissues). Antigens expressed in neoplasms or tumor cells but not in normal cells, or antigens expressed in neoplasmic cells at levels substantially higher than those found in normal cells, are referred to as “tumor-specific antigens” or “tumor-associated antigens.” Tumor-specific antigens are used as targets for cancer immunotherapy. One such therapy utilizes chimeric antigen receptors (CARs) expressed on the surface of immune cells, e.g., T cells and NK cells, to enhance cytotoxicity against cancer cells. A CAR comprises a single-chain variable fragment (scFv) bound to at least one intracellular signaling domain. The scFv recognizes and binds to an antigen on a target cell (e.g., a cancer cell), triggering effector cell activation. The signaling domain contains an immunoreceptor tyrosine-based activation domain (ITAM), which is important for intracellular signaling by the receptor.

[0063] This disclosure provides NK-92® cells that have been genetically engineered to express at least a chimeric antigen receptor (CAR) on their cell surface. A CAR combines an extracellular antigen-recognition domain (usually derived from the variable domain of a specific antibody) with an intracellular signaling domain (having one or additional co-stimulatory elements) that can trigger a cytolytic response when the specific antigen is recognized. Multiple types of CARs exist, and all of them can be used in this application. First-generation CARs contain one cytoplasmic signaling domain. The signaling domain may be derived, for example, from Fc-epsilon receptor gamma (FcεRIγ) containing one ITAM, or from CD3ζ containing three ITAMs. CD3ζ CARs are thought to be more efficient than FcεRIγ CARs in tumor eradication. See, for example, Haynes, et al. 2001, J. Immunology 166:182-187; Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID See 956304. Second and third-generation CARs combine multiple signaling domains, e.g., the cytoplasmic signaling domain and co-stimulatory signaling domain of CD3ζ, e.g., CD28 / CD134 / CD137 / ICOS and CD28 / CD134, with a single CAR to promote the activation and proliferation of NK-92® cells. Therefore, in some embodiments, the CD19 CAR expressed by CD19 t-haNK® cells includes a hinge region from CD8 and / or the transmembrane domain of CD28. In some embodiments, the CD19 CAR includes the cytoplasmic signaling domain of FcεRIγ. In some embodiments, the CD19 CAR includes the cytoplasmic signaling domain of CD3ζ. Examples of hinge regions, transmembrane domains of CD28 and cytoplasmic signaling domains of FcεRIγ or CD3ζ are disclosed in U.S. Provisional Patent Application No. 62 / 674,936, which is incorporated herein by reference in its entirety.

[0064] While previous publications, such as Haynes, et al. 2001, J. Immunology 166:182-187 and Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID 956304, have disclosed that CD3ζ CAR may be more effective than FcεRIγ CAR in tumor eradication, the present inventors have surprisingly and unexpectedly found that such a thing does not apply to the cells, compositions, and methods disclosed herein. In fact, the inventors have found that when the NK-92® cells disclosed herein have an FcεRIγ CAR domain, they are as effective as, or in some embodiments even more effective than, when they have a CD3ζ CAR.

[0065] In some cases, the CAR is specific to CD19. In some embodiments, CD19 is human CD19. In some embodiments, the CD19 CAR contains an scFv fragment containing the amino acid sequence of SEQ ID NO: 10. In some embodiments, the CD19 CAR contains the amino acid sequence of SEQ ID NO: 12. In some embodiments, the CD19 t-haNK® cells contain the nucleic acid sequence of SEQ ID NO: 9, which encodes SEQ ID NO: 10. In some embodiments, the CD19 t-haNK® cells contain the nucleic acid sequence of SEQ ID NO: 11, which encodes SEQ ID NO: 12. In some embodiments, the CD19 t-haNK® cells contain the tricistronic construct of SEQ ID NO: 13.

[0066] In some embodiments, the CD19 CAR polypeptide contains a sequence that shares at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity with SEQ ID NO: 10. In some embodiments, an epitope tag peptide, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of the polypeptide to support cell surface detection using anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0067] In the example, variant polypeptides are produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. CD16 variants are produced by performing site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985), or other known techniques on cloned DNA (Ausubel, 2002; Sambrook and Russell, 2001).

[0068] In some embodiments, the polynucleotide encoding the CD19 CAR is mutated to change the amino acid sequence encoding the CAR without altering the CAR's function. For example, polynucleotide substitutions resulting in amino acid substitutions at "non-essential" amino acid residues can be created in SEQ ID NO: 9 or SEQ ID NO: 11.

[0069] Conservative substitutions in SEQ ID NO: 10 or 12, in which an amino acid of one class is replaced by another amino acid of the same class, fall within the range of disclosed variants, provided that the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, e.g., β-sheet or α-helical structure, (2) charge, (3) hydrophobicity, or (4) the bulk of the side chain at the target site can alter the polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of one member of one class with another. Substitutions can be introduced at a conservative substitution site or, more preferably, at a non-conservative site.

[0070] In the example, variant polypeptides are produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Variants can be produced by performing site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985), or other known techniques on cloned DNA (Ausubel, 2002; Sambrook and Russell, 2001).

[0071] In some cases, CD19 t-haNK cells (trademark) can be used to treat cancer, particularly cancers that express CD19. In some cases, cancers include leukemia (e.g., acute leukemia (e.g., acute lymphoblastic leukemia, acute myeloid leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemia (e.g., chronic myeloid (granulocytic) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenström macroglobulinemia, heavy chain disease, solid tumors, sarcomas and carcinomas, including, but not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endosarcoma, lymphatic vessel The following are selected from the group consisting of sarcoma, intralymphatic sarcoma, synoviomas, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial cancer, renal cell carcinoma, liver cancer, bile duct cancer, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal glandoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0072] Fc receptor In some embodiments, NK-92® cells are modified to express at least one Fc receptor, and as a result, at least one Fc receptor is displayed on the cell surface of the NK-92® cells. The Fc receptor binds to the Fc portion of the antibody. Several Fc receptors are known and differ in their preferred ligand, affinity, expression, and post-binding effect to the antibody.

[0073] [Table 2]

[0074] [Table 3]

[0075] In some embodiments, NK-92® cells are modified to express the Fc receptor protein on their cell surface.

[0076] In some embodiments, the Fc receptor is CD16. For the purposes of this disclosure, specific amino acid residues of CD16 are specified by reference to SEQ ID NO: 2, or to SEQ ID NO: 1 by a different position. Thus, the amino acid residue "at position 158" of the CD16 polypeptide is the amino acid residue corresponding to position 158 of SEQ ID NO: 2 (or SEQ ID NO: 1) when the CD16 polypeptide and SEQ ID NO: 2 are at most aligned. In some embodiments, NK-92® cells are modified to express the mature form of the protein, e.g., human CD16 having phenylalanine at position 158 of SEQ ID NO: 1. In a typical embodiment, NK-92® cells are modified to express the mature form of the protein, e.g., the high-affinity form of human CD16 having valine at position 158 of SEQ ID NO: 2. Position 158 of the mature protein corresponds to position 176 of the CD16 sequence containing the native signal peptide. In some embodiments, the CD16 polypeptide is encoded by a polynucleotide encoding the precursor (i.e., having the native signal peptide) polypeptide sequence of SEQ ID NO: 3 or SEQ ID NO: 4. Therefore, in one embodiment, the Fc receptor comprises FcγRIII-A(CD16). In some embodiments, NK-92® cells are genetically modified to express an Fc receptor coding polypeptide having at least 90% sequence identity with SEQ ID NO: 1 (FcγRIII-A or CD16 having phenylalanine (F-158) at position 158; or at least 90% identity with SEQ ID NO: 2 (CD16 having valine (F158V) at position 158, a higher affinity form).

[0077] In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with the polynucleotide sequence encoding full-length spontaneously occurring CD16, which includes a signal peptide having phenylalanine at position 176 of full-length CD16 (corresponding to position 158 of the mature CD16 protein). In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with the polynucleotide sequence encoding full-length spontaneously occurring CD16, which includes a signal peptide having valine at position 176 (corresponding to position 158 of the mature protein). In some embodiments, the polynucleotide encoding CD16 has at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 13 and includes a codon encoding valine at the position of the polynucleotide encoding position 176 of the full-length CD16 polypeptide including the signal peptide. In some embodiments, the polynucleotide encoding CD16 includes SEQ ID NO: 13 but has a codon encoding valine at position 176 of full-length CD16.

[0078] In some embodiments, the CD16 polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 2 and includes valine at position 158 as determined by reference to SEQ ID NO: 2. In some embodiments, the polynucleotide encodes SEQ ID NO: 2. In some embodiments, the CD16 polynucleotide encodes a chimeric receptor comprising at least a partial sequence of CD16 fused to the extracellular domain of CD16 with or without a signal sequence, or any other fragment of full-length CD16, or the amino acid sequence of another protein. In other embodiments, epitope tag peptides, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of a mature polypeptide to support cell surface detection using anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0079] In some embodiments, homologous CD16 polynucleotides may have a polynucleotide length of about 150 to about 700, about 750, or about 800, but CD16 variants having more than 700 to 800 polynucleotides are within the scope of this disclosure.

[0080] Examples of homologous polynucleotide sequences include those encoding polypeptide sequences that encode variants of CD16. Examples of homologous polynucleotide sequences include naturally occurring allele variations relating to SEQ ID NO: 1. Transfusion of NK-92® cells with a polypeptide having the amino acid sequence shown in either SEQ ID NO: 1 or SEQ ID NO: 2, its naturally occurring variant, or any polynucleotide encoding a sequence that is at least 70% identical, or at least 80%, 90%, or 95% identical to SEQ ID NO: 1 or SEQ ID NO: 2, is within the scope of this disclosure. In some embodiments, the homologous polynucleotide sequence encodes a conserved amino acid substitution in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, NK-92® cells are transfused using a degenerate homologous CD16 polynucleotide sequence that encodes a polypeptide that is different from the natural polynucleotide sequence but is identical.

[0081] In other examples, NK-92® cells are modified using cDNA sequences with polymorphisms that alter the CD16 amino acid sequence, such as inter-individual allele variations exhibiting genetic polymorphisms in the CD16 gene. In other examples, NK-92® cells are modified using CD16 genes from other species that have polynucleotide sequences different from the sequence of Sequence ID No. 1.

[0082] Variant polypeptides can be produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. CD16 variants can be produced by performing site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985), or other known techniques on cloned DNA (Ausubel, 2002; Sambrook and Russell, 2001).

[0083] In some embodiments, the polynucleotide encoding CD16 is mutated to alter the amino acid sequence encoding CD16 without changing the function of CD16. For example, polynucleotide substitutions resulting in amino acid substitutions at "non-essential" amino acid residues can be created in SEQ ID NO: 1 or SEQ ID NO: 2.

[0084] Conservative substitutions in SEQ ID NO: 1 or SEQ ID NO: 2, which replace an amino acid of one class with another amino acid of the same class, fall within the range of disclosed CD16 variants, provided that the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, e.g., a β-sheet or α-helical stereostructure, (2) charge, (3) hydrophobicity, or (4) the bulkiness of the side chains of the target site may alter the CD16 polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of one member of one class with another. Substitutions can be introduced at a conservative substitution site or, more preferably, at a non-conservative site.

[0085] In some embodiments, the CD16 polypeptide variant has a length of at least 200 amino acids and has at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, or at least 90% identity. In some embodiments, the CD16 polypeptide variant has a length of at least 225 amino acids and has at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, or at least 90% identity. In some embodiments, the CD16 polypeptide variant has a valine at position 158, determined by reference to SEQ ID NO: 2.

[0086] In some embodiments, a nucleic acid encoding a CD16 polypeptide may encode a CD16 fusion protein. CD16 fusion polypeptides include any portion of CD16 or the entire CD16 fused with a non-CD16 polypeptide. Fusion polypeptides are readily produced using recombinant methods. For example, a CD16 polypeptide, e.g., a polynucleotide encoding SEQ ID NO: 1 or SEQ ID NO: 2, is fused in-frame with a non-CD16 encoding polynucleotide (e.g., a polynucleotide sequence encoding a signal peptide of a heterologous protein). In some embodiments, the heterologous polypeptide sequence is fused to the C-terminus of CD16, or the fusion polypeptide can be internally located within CD16. Typically, up to approximately 30% of the CD16 cytoplasmic domain can be replaced. Such modifications may improve expression or enhance cytotoxicity (e.g., ADCC responsiveness). In other cases, chimeric proteins, such as domains from other lymphocyte-activating receptors, including but not limited to Ig-α, Ig-B, CD3-e, CD3-d, DAP-12, and DAP-10, replace a portion of the CD16 cytoplasmic domain.

[0087] Fusion genes can be synthesized using conventional techniques, e.g., automated DNA synthesizers and PCR amplification using anchor primers that create a complementary overhang between two consecutive gene fragments (which can then be annealed and re-amplified to generate a chimeric gene sequence) (Ausubel, 2002). Many vectors are commercially available that facilitate in-frame subcloning of CD16 into the fusion region.

[0088] Cytokine The cytotoxicity of NK-92® cells is dependent on the presence of cytokines (e.g., interleukin-2 (IL-2)). The cost of using exogenously added IL-2 required to maintain and expand NK-92 cells in commercially available scale cultures is considerable. Administration of sufficient amounts of IL-2 to human subjects to maintain NK-92® cell activation causes adverse side effects.

[0089] In one embodiment, NK-92® cells are modified to express at least one cytokine. In particular, at least one cytokine is IL-2 (SEQ ID NO: 6), IL-12, IL-15, IL-18, IL-21, or a variant thereof. In some embodiments, the cytokine is IL-2, IL-15, or a variant thereof. In some embodiments, IL-2 is a variant targeted to the endoplasmic reticulum, and IL-15 is a variant targeted to the endoplasmic reticulum.

[0090] In one embodiment, IL-2 is cloned and expressed along with a signal sequence that directs IL-2 to the endoplasmic reticulum (erIL-2) (SEQ ID NO: 7). This allows for the expression of IL-2 at a level sufficient for autocrine activation without releasing IL-2 extracellularly. Konstantinidis et al. “Targeting IL-2 to the endoplasmic reticulum confines autocrine growth stimulation to NK-92” (R) See "cells" Exp Hematol. 2005 Feb;33(2):159-64. Continuous activation of FcR-expressing NK-92® cells can be prevented, for example, by the presence of suicide genes.

[0091] Suicide gene The term "suicide gene" refers to a transgene that enables negative selection of cells expressing a suicide gene. Suicide genes are used as a safety system that allows cells expressing that gene to be killed by the introduction of a selective agent. This is desirable when recombinant genes cause mutations that lead to uncontrolled cell growth, or when the cells themselves are capable of such growth. Numerous suicide gene systems have been identified, e.g., the herpes simplex virus thymidine kinase (TK) gene, the cytosine deaminase gene, the varicella-zoster virus thymidine kinase gene, the nitroreductase gene, the Escherichia coli (Escherichia coli) gpt gene, and the E. coli (E. coli) Deo gene. Typically, suicide genes encode proteins that do not have adverse effects on cells but kill them in the presence of a specific compound. Therefore, suicide genes are typically part of a system.

[0092] In one embodiment, the suicide gene is active in NK-92® cells. In one embodiment, the suicide gene is a thymidine kinase (TK) gene. The TK gene may be a wild-type or mutant TK gene (e.g., tk30, tk75, sr39tk). Cells expressing the TK protein can be killed using ganciclovir.

[0093] In another embodiment, the suicide gene is cytosine deaminase, which is toxic to cells in the presence of 5-fluorocytosine. Garcia-Sanchez et al. "Cytosine deaminase adenoviral vector and 5-fluorocytosine selectively reduce breast cancer cells 1 million-fold when they contaminate hematopoietic cells: a potential purging method for autologous transplantation." Blood. 1998 Jul 15;92(2):672-82.

[0094] In another embodiment, the suicide gene is a cytochrome P450 that is toxic in the presence of ifosfamide or cyclophosphamide. See, for example, Touati et al. “A suicide gene therapy combining the improvement of cyclophosphamide tumor cytotoxicity and the development of an anti-tumor immune response.” Curr Gene Ther. 2014;14(3):236-46.

[0095] In another embodiment, the suicide gene is iCasp9. See also Di Stasi, (2011) “Inducible apoptosis as a safety switch for adoptive cell therapy.” N Engl J Med 365:1673-1683. Morgan, “Live and Let Die: A New Suicide Gene Therapy Moves to the Clinic” Molecular Therapy (2012);20:11-13. iCasp9 induces apoptosis in the presence of the small molecule AP1903. AP1903 is a biologically inactive small molecule that has been shown to be well tolerable in clinical trials and is used in adoptive cell therapy.

[0096] Codon optimization In some embodiments, the construct sequences used to transform aNK cells are codon-optimized to maximize the expression efficiency of CD19 CAR, CD16, and / or erIL-2 in the human lineage. Codon optimization is typically carried out by modifying the nucleic acid sequence by replacing at least one, two or more, or a significant number of, codons in the native sequence with codons that are more frequently used or most frequently used in the genes of the expression lineage. Codon optimization can be used for translation rate, or to produce recombinant RNA transcripts with desired properties, such as a longer half-life compared to transcripts produced using non-optimized sequences. Methods for codon optimization are readily available, such as GeneArt™ from Thermo Fisher Scientific (Waltham, MA); Optimizer, which is freely accessible at http: / / genomes.urv.es / OPTIMIZER; and GeneGPS Expression Optimization Technology from DNA 2.0 (Newark, California). In certain embodiments, the coding sequence for CD19 CAR is codon-optimized and includes the sequence described in Sequence ID No. 9.

[0097] Transgene expression Transgenes can be genetically engineered into expression vectors by any mechanism known to those skilled in the art. When multiple transgenes are to be inserted into cells, they can be genetically engineered into the same expression vector or into different expression vectors.

[0098] In some embodiments, cells are transfected with mRNA encoding the transgenic protein to be expressed.

[0099] The transgene and mRNA can be introduced into NK-92® cells using any transtransfer method known in the art, for example, in non-limiting examples, infection, electroporation, lipofection, nucleofection, or a “gene gun.”

[0100] NK-92® cells expressing CD19 CAR This disclosure provides modified NK-92® cells expressing CD19 CAR and FcR. The modified NK-92® cells may also express IL-2.

[0101] In some embodiments, modified NK-92® cells include a multicistronic transgene, which encodes a chimeric antigen receptor and an Fc receptor, and optionally IL-2.

[0102] In some embodiments, FcR is CD16. In some embodiments, CD16 is a high-affinity CD16 comprising or consisting of SEQ ID NO: 2. In some embodiments, IL-2 is an erIL-2 comprising or consisting of SEQ ID NO: 7.

[0103] In some embodiments, the CD19 CAR coding sequence and the CD16 coding sequence are separated by a sequence encoding a self-cleaving peptide for producing equimolar expression of CD19 CAR and CD16 encoded from the same mRNA. Self-cleaving peptides and their coding sequences are well known, for example, disclosed in Wang et al., Scientific Reports 5, Article number 16273 (2015), relevant disclosures of which are incorporated herein by reference. Non-limiting examples of self-cleaving peptides include porcine rhinovirus-1 2A (P2A), thosea asigna virus 2A (T2A), equine rhinitis A virus 2A (E2A), silkworm (B. mori) cytoplasmic polyhedrosis virus (BmCPV 2A), and silkworm softening virus (BmIFV 2A). In some embodiments, the self-cleaving peptide is a P2A peptide encoded by SEQ ID NO: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct.

[0104] In some embodiments, the CD16 coding sequence and the erIL-2 coding sequence are separated by an internal ribosome entry sequence (IRES) that enables the initiation of translation from the internal region of mRNA transcribed from the nucleic acid sequence.

[0105] In some embodiments, modified NK-92® cells include a tricistronic construct expressing CAR, high-affinity CD16, and erIL-2 from a single mRNA. In some embodiments, the tricistronic construct includes the sequence described in SEQ ID NO: 11. CAR integration allows effector cells to specifically engage with and kill target cells expressing targets recognized by the CAR; CD16 integration enables ADCC when combined with therapeutic monoclonal antibodies; and erIL2 enables cell expansion in the absence of exogenous IL-2 while maintaining selective pressure on transgene expression. One exemplary tricistronic construct is shown in Figure 2.

[0106] To produce modified NK-92® cells expressing CAR and CD16 (e.g., high-affinity CD16), and erIL-2, a multicistronic plasmid is introduced into aNK cells, for example, by electroporation. Transformed NK-92® cells are grown in IL-2-free medium, and individual clones are selected from the transformed NK-92® cells by limited-dilution cloning and characterized based on criteria, e.g., high levels of CAR and CD16 expression, cytotoxicity, ADCC, growth rate, and / or IL-2 secretion. Suitable clones may also express surface markers, e.g., CD3, CD16, CD54, CD56, NKG2D, and / or NKp30, at levels substantially similar to those of aNK cells. If necessary, whole-genome sequencing (WGS) is performed to determine the transgene integration site. Clones meeting one or more of these criteria can be selected for further development and used to treat patients in a clinical setting.

[0107] Expression IL-2 expression can be confirmed by the ability of modified NK-92® cells to grow under IL-2-free conditions. CAR and CD16 expression can be measured by flow cytometry. In NK-92® cells transformed with a tricistronic construct containing the coding sequences of CD19 CAR, CD16, and IL-2 (e.g., erIL-2), typically at least 70%, 80%, and 85% of transformed cells that can grow under IL-2-free conditions also exhibit high expression levels of both CAR and CD16.

[0108] In some cases, the IL-2 secretion level of transformed NK-92® cells can be measured at various time points using methods well known in the art, for example, by ELISA.

[0109] In some embodiments, the level of IL-2 released into the cell culture medium is determined by measuring the IL-2 level in the culture supernatant. In some embodiments, the total intracellular level of IL-2 is evaluated by measuring the IL-2 level in the cell pellet. In some embodiments, the total amount of IL-2 produced by transformed NK-92® cells is determined by measuring both the amount of IL-2 in the supernatant and the amount of IL-2 in the cell pellet.

[0110] In some cases, other surface markers of transformed NK-92® cells can be measured by flow cytometry. These markers include, but are not limited to, CD54, CD56, NKG2D, NKp30, and CD3. Preferred clones are those that demonstrate substantially similar expression levels of these markers to aNK cells under identical growth conditions.

[0111] cytotoxicity In some cases, the cytotoxicity of NK-92® cells transformed with tricistronic plasmids can be evaluated using flow-based cytotoxicity assays. Effector cells (NK-92® cells) and fluorophore-labeled target cells, such as tumor cells, are mixed in different effector-to-target ratios. Propidium iodide (PI) can be added to the cells, and the samples are analyzed by flow cytometry. Preferably, the fluorophore used to label the target cells can be distinguished from the PI by flow cytometry. In some embodiments, the fluorophore is CFSE. In some embodiments, the fluorophore is PKHGL67. Cytotoxicity can be determined by the percentage of PI-positive cells in the fluorophore-positive target population.

[0112] In some cases, the cytotoxicity of NK-92® cells transformed with tricistronic plasmids can also be tested using methods well known in the art. The cytotoxicity of NK-92® cells can be reflected by their direct cytotoxicity or ADCC activity. The direct cytotoxicity of the produced NK-92® cells, their ability to target and kill abnormal cells, such as tumor cells, can be tested using methods well known in the art, for example, the procedure described by Klingemann et al. (Cancer Immunol. Immunother. 33:395-397 (1991)). 51 This can be evaluated by a Cr release assay (Gong et al. (Leukemia, Apr;8(4):652-8(1994))). In some embodiments, target cells express antigens that can be recognized by CARs expressed on the surface of t-haNK® cells. Briefly, 51 Cr-labeled target cells are mixed with NK-92(registered trademark) cells and lysed. The percentage of specific cytotoxicity released is... 51 This can be calculated based on the amount of Cr. See U.S. Patent Application Publication No. 20020068044.

[0113] Alternatively, the direct cytotoxicity of the produced NK-92® cells can be evaluated using a calcein release assay. For example, NK-92® cells (referred to as effectors in the assay) can be mixed with calcein-loaded target cells (referred to as targets in the assay) in a certain ratio. After incubation for a certain period, the calcein released from the target cells can be evaluated, for example, using a fluorescence plate reader.

[0114] The effector-to-target ratio used in each assay may vary, and the effector:target ratio may be 20:1, 15:1, 10:1, 8:1, or 5:1; preferably, the effector:target ratio is 10:1. The target cells may be any cells expressing an antigen molecule that can be recognized by the CAR on NK-92® cells (t-haNK® cells). For example, SUP-B15 cells can be recognized by the CD19 CAR and are target cells for CD19 t-haNK® cells. The cytotoxicity of NK-92® cells may vary depending on the type of target cell used and the effector:target ratio. Generally, NK-92® cells produced using the methods described herein may have cytotoxicity of 60-100%, for example, 70-100% or 80-100%. In some cases, NK-92® cells may exhibit cytotoxicity of 80–100%, e.g., 82–100%, 85–100%, 87–100%, 88–100%, or 89–100%, when using a 1:10 effector:target ratio in a calcein release assay.

[0115] In some cases, the cytotoxicity of NK-92® cells being evaluated, such as t-haNK® cells, is antibody-dependent cytotoxicity (ADCC). The method for measuring the ADCC activity of NK-92® cells is similar to the method for measuring direct cytotoxicity described above, except that an antibody capable of recognizing target cells is also added. The Fc receptor on NK cells recognizes cell-binding antibodies, triggering a cell-lysis reaction and killing target cells. In one exemplary example, t-haNK® cells can be incubated with Herceptin (an anti-Her2 antibody) and SKBr3 (target cells), and the killing of SKBr3 cells is due to the internal components of the target cells, for example, 51 It can be measured by the release of Cr or calcein, or by PI staining of target cells.

[0116] Doubling time The growth rate of NK-92® cells, such as t-haNK® cells, can be evaluated using the cell doubling time, i.e., the time it takes for cells to proliferate until they reach twice their initial number. The doubling time is inversely proportional to the growth rate of NK-92® cells; the longer the doubling time, the slower the growth rate.

[0117] WGS Depending on the case, whole-genome sequencing (WGS) of transformed NK-92® cells is performed to identify the insertion sites of multicistronic constructs.

[0118] therapeutic use This disclosure also provides a method for treating any type of cancer in a subject at any stage of the disease. Non-limiting examples of suitable cancers include carcinoma, melanoma, or sarcoma. In some embodiments, the present invention is used to treat cancers of hematopoietic origin, such as leukemia or lymphoma. In some embodiments, the cancer is a solid tumor.

[0119] In some embodiments, a method of treating any type of cancer in a subject comprises administering to a patient a therapeutically effective amount of the above-described NK-92® cells, thereby treating the cancer. In some embodiments, the NK-92® cells express an Fc receptor, such as a high-affinity Fc receptor having the sequence set forth in SEQ ID NO: 2. In some embodiments, the NK-92® cells express a CD19 CAR, an Fc receptor, and IL-2. In some embodiments, the modified NK-92® cells comprise a multicistronic construct that encodes a chimeric antigen receptor and an Fc receptor.

[0120] Also provided is a method of treating a subject in need of treatment with the modified NK-92® cells described herein. In some embodiments, the subject or patient has cancer or an infectious disease, such as a viral infection.

[0121] The modified NK-92® cells can be administered to an individual in an absolute number of cells, e.g., to the individual, from about 1000 cells / injection to a maximum of about 10 billion cells / injection, e.g., about, at least about, or at most about 1×10 8 、1×10 7 、5×10 7 、1×10 6 、5×10 6 、1×10 5 、5×10 5 、1×10 4 、5×10 4 、1×10 3 、5×10 3 NK-92® cells (etc.), or any range (including endpoints) between any two numbers can be administered. Thus, the disclosure also provides a composition comprising a plurality of NK-92® cells, wherein the number of cells is 1×10 8 、1×10 7 、5×10 7 、1×10 6 、5×10 6 、1×10 5 、5×10 5 、1×10 4, 5×10 4 , 1 x 10 3 , or 5×10 3 The present invention provides a composition consisting of individual (or similar) elements.

[0122] In another embodiment, approximately 1000 cells / m³ are injected into the individual. 2 ~Up to approximately 10 billion cells / injection / m 2 For example, per injection, approximately, at least approximately, or at most approximately 1 × 10 8 pieces / m 2 , 1 x 10 7 pieces / m 2 , 5×10 7 pieces / m 2 , 1 x 10 6 pieces / m 2 , 5×10 6 pieces / m 2 , 1 x 10 5 pieces / m 2 , 5×10 5 pieces / m 2 , 1 x 10 4 pieces / m 2 , 5×10 4 pieces / m 2 , 1 x 10 3 pieces / m 2 , 5×10 3 pieces / m 2 NK-92® cells (such as) or any range (including endpoints) between any two numbers may be administered.

[0123] In other embodiments, NK-92® cells can be administered to such an individual in only a relative number of cells, for example, about 1,000 cells to a maximum of about 10 billion cells per kilogram of the individual, for example, about, at least about, or at most about 1 × 10¹⁶ cells per kilogram of the individual. 8 , 1 x 10 7 , 5×10 7 , 1 x 10 6 , 5×10 6 , 1 x 10 5 , 5×10 5 , 1 x 10 4 , 5×10 4 , 1 x 10 3 , or 5×103 NK-92® cells, etc., or any range (including endpoints) between any two numbers can be administered.

[0124] In other embodiments, the total dose can be calculated by m of body surface area, and it can be, for example, about 1×10 2 per 1 m 2 about 1×10 11 about 1×10 10 about 1×10 9 about 1×10 8 about 1×10 7 cells, etc., or any range (including endpoints) between any two numbers. The average human is about 1.6 m 2 to about 1.8 m 2 . In a preferred embodiment, about 1 billion to about 3 billion NK-92® cells are administered to the patient. In other embodiments, the amount of NK-92® cells injected per dose can be calculated by m of body surface area, and it can be, for example, 1×10 2 per 1 m 2 1×10 11 1×10 10 1×10 9 1×10 8 1×10 7 cells, etc. The average body surface area of a human is 1.6 - 1.8 m 2 .

[0125] In other embodiments, NK-92® cells can be administered only a relative number of cells to such an individual, for example, to the individual, about 1000 cells to a maximum of about 10 billion cells per 1 kilogram of the individual, for example, about, at least about, or at most about 1×10 8 1×10 7 5×10 7 1×10 6 5×10 6 1×10 5 5×10 5 1×10 4 5×10 4 1×10 3 or 5×10 3Individual (or similar) NK-92® cells, or any range (including endpoints) between any two numbers, may be administered.

[0126] NK-92® cells may be administered once to a patient with cancer, or they may be administered multiple times, for example, once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours during treatment, or once every 1, 2, 3, 4, 5, 6, or 7 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks or more, or once at any range (including endpoints) between any two numbers.

[0127] In some embodiments, NK-92® cells are administered in a composition containing NK-92® cells and a medium, such as human serum or its equivalent. In some embodiments, the medium contains human serum albumin. In some embodiments, the medium contains human plasma. In some embodiments, the medium contains about 1% to about 15% human serum or its equivalent. In some embodiments, the medium contains about 1% to about 10% human serum or its equivalent. In some embodiments, the medium contains about 1% to about 5% human serum or its equivalent. In preferred embodiments, the medium contains about 2.5% human serum or its equivalent. In some embodiments, the serum is human AB serum. In some embodiments, a serum substitute acceptable for use in human therapy is used instead of human serum. Such serum substitutes are known in the art or may be developed in the future. Human serum at concentrations greater than 15% can be used, but concentrations greater than about 5% are intended to be too expensive. In some embodiments, NK-92® cells are administered in a composition containing NK-92® cells and an isotonic solution that supports cell survival. In some embodiments, NK-92® cells are administered in a composition reconstituted from cryopreserved samples.

[0128] A pharmaceutically acceptable composition containing NK-92® cells may include various carriers and excipients. Various aqueous carriers, such as buffered saline, can be used. These solutions are sterile and generally free of undesirable substances. Suitable carriers and excipients, and their formulations, are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). A pharmaceutically acceptable carrier means a material that is not biologically or otherwise undesirable, i.e., it is administered to a subject without causing undesirable biological effects or interacting in a harmful manner with other components of the pharmaceutical composition in which it is contained. When administered to a subject, the carrier is sometimes selected to minimize the degradation of the active ingredient and to minimize adverse side effects in the subject. As used herein, the term pharmaceutically acceptable is used synonymously with physiologically acceptable and pharmacologically acceptable. Pharmaceutical compositions generally contain agents for buffering and preservation during storage, and may contain buffers and carriers for appropriate delivery depending on the route of administration.

[0129] These compositions for in vivo or in vitro use can be sterilized by sterilization techniques used for cells. The compositions may contain acceptable auxiliary substances required for the appropriate physiological state, such as pH adjusters and buffers, as well as toxicity modifiers, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate. The concentrations of cells and / or other agents in these formulations may vary and are primarily selected based on liquid volume, viscosity, and body weight, according to the requirements of the specific administration method and target.

[0130] In one embodiment, NK-92® cells are administered to a patient in combination with one or more other treatments or agents for the cancer being treated. In some embodiments, one or more other treatments for the cancer being treated may include, for example, antibodies, radiation, chemotherapy, stem cell transplantation, or hormone therapy.

[0131] In some embodiments, NK-92® cells and other cancer drugs / therapies are administered simultaneously or nearly simultaneously (e.g., within approximately 1, 5, 10, 15, 20, or 30 minutes of each other). In some embodiments, NK-92® cells and other cancer drugs / therapies are administered sequentially. In some embodiments, other cancer treatments / drugs are administered 1, 2, or 3 days after the administration of NK-92® cells.

[0132] In one embodiment, the other cancer agent is an antibody. In one embodiment, NK-92® cells are administered in combination with an antibody that targets diseased cells. In one embodiment, NK-92® cells and the antibody may be administered together to the patient, for example, in the same formulation; separately, for example, in separate formulations, in combination; or separately, for example, on different administration schedules or at different times on the same day. When administered separately, the antibody may be administered via any preferred route, for example, intravenous or intratumoral injection.

[0133] In some embodiments, the NK-92® cells of this disclosure are used in combination with therapeutic antibodies and / or other anticancer agents. Therapeutic antibodies can be used to target cells expressing cancer-related or tumor-related markers. Examples of cancer therapeutic monoclonal antibodies are shown in Table 4. In some embodiments, NK-92® cells express Fc receptors, for example, high-affinity Fc receptors having the sequence described in SEQ ID NO: 2. In some embodiments, NK-92® cells are haNK® cells. In one embodiment, the therapeutic antibody is avelumab.

[0134] [Table 4]

[0135] [Table 5]

[0136] Such administration of NK-92® cells can be carried out simultaneously with or in a sequential manner with the administration of monoclonal antibodies. In some embodiments, NK-92® cells are administered to the subject after treatment with the monoclonal antibody. Alternatively, NK-92® cells can be administered simultaneously, for example, within 24 hours of the monoclonal antibody.

[0137] In some embodiments, NK-92® cells are administered intravenously. In some embodiments, NK-92® cells are injected directly into the bone marrow.

[0138] Accordingly, the present disclosure provides a method for treating cancer or a viral infection in a patient requiring treatment for cancer or a viral infection, comprising administering to the patient a therapeutically effective amount of the NK-92® cells disclosed herein, thereby treating the cancer.

[0139] kit Kits for the treatment of cancer or infectious diseases using compositions comprising a plurality of NK-92® cells as described herein are also disclosed. In some embodiments, the kits of this disclosure may also include at least one monoclonal antibody. The NK-92® cells contained in the kit express CAR and Fc receptors. In some embodiments, the NK-92® cells further express IL-2, e.g., erIL-2, or IL-15, e.g., erIL-15. In some embodiments, the NK-92® cells include a multicistronic construct, the multicistronic construct encoding a chimeric antigen receptor, an Fc receptor, and optionally IL-2 or IL-15.

[0140] In one embodiment, the kit may contain additional compounds, such as therapeutic compounds or drugs, to be administered before, concurrently with, or after the administration of NK-92® cells. Examples of such compounds include antibodies, vitamins, minerals, fludrocortisone, ibuprofen, lidocaine, quinidine, and chemotherapeutic agents.

[0141] In various embodiments, the kit instructions include instructions for using the kit components in the treatment of cancer or infectious diseases. The instructions may further include information on how to handle NK-92® cells (e.g., thawing and / or culturing). The instructions may further include guidelines on dosage and frequency of administration.

[0142] In one embodiment, the kit further comprises one or more containers filled with one or more compositions described herein, for example, a composition comprising NK-92® cells as described herein. Optionally, such containers may be accompanied by a label indicating that the kit is for the treatment of cancer, for example, those described herein. Optionally, the label may also include a notice in the form prescribed by an authority that regulates the manufacture, use, or sale of a pharmaceutical or biological product, the notice reflecting the authority's approval for manufacture, use, or sale for human administration.

[0143] Materials, compositions, and components that can be used in, used in combination with, used in the preparation thereof, or are products thereof are disclosed herein. These and other materials are disclosed herein, and where combinations, subsets, interactions, groups, etc., of these materials are described, specific references to various individual and collective combinations and permutations of these compounds may not be explicitly made, but it is understood that each is specifically intended and described herein. For example, where a method is disclosed and discussed, and numerous modifications that can be made to numerous molecules including that method are discussed, each and every combination and permutation of the method, as well as possible modifications, are specifically intended unless it is specifically indicated otherwise. Similarly, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure, including, but not limited to, steps in methods of using the compositions of the disclosure. So, where various additional steps can be performed, it should be understood that each of those additional steps can be performed by any prescribed method step or combination of method steps of the methods of the disclosure, and that each such combination or subset of combinations should be considered specifically contemplated and disclosed. [Examples]

[0144] The following embodiments are for illustrative purposes only and should not be construed as limiting. There are various alternative techniques and procedures available to those skilled in the art that would similarly enable the following embodiments to be carried out successfully.

[0145] Example 1: Production of PD-1 CAR-modified NK-92(registered trademark) cells The CD19 CAR was cloned into the tricistronic plasmid pNEUKv1 FcR_IL-2 vector, which also contains the CD16 and erIL-2 transgenes. The tricistronic plasmid was electroporated into aNK cells. Since untransformed aNK cells, which are IL-2 dependent, could not survive in IL-2 depleted medium, CD19 CAR-expressing NK-92® cells were selected using IL-2 depleted medium.

[0146] Limited dilution cloning Aliquots of polyclonal CD19 t-haNK™ pooled cultures were diluted to a density of 3 cells / ml in growth medium without IL-2 supplementation. This cell suspension was aliquoted in 96-well plates at a volume of 200 μl per well, corresponding to an average of 0.6 cells per well. The plates were incubated at 37°C for 10 days, and then cell growth was visually confirmed. Currently, a total of 20 cultures, which will be named clones, were picked, transferred to large containers, and numbered according to their initial growth rate, and clones #1-10 were able to be first passaged.

[0147] Example 2: Biological Analysis Method Cell culture: Polyclonal and clonal CD19 t-haNK™ cells were supplemented with 5% thermoactivated human AB serum (derived from CMV-negative test donors) and cultured in IL-2-free growth medium.

[0148] aNK cells were cultured in growth medium supplemented with 5% thermoactivated human AB serum (derived from a CMV-negative donor) and 500 IU / ml recombinant human IL-2.

[0149] haNK cells were supplemented with 5% thermoactivated human AB serum (derived from CMV-negative test donors) and cultured in IL-2-free growth medium.

[0150] K562 cells were cultured in RPMI-1640 supplemented with 10% thermoinactivated fetal bovine serum and an antibiotic / antifungal cocktail. K562 cells were subculturised every 2–5 days, or whenever the culture medium turned yellow.

[0151] SUP-B15 and SUP-B15 CD19KO / CD20+ The cells were cultured in RPMI-1640 supplemented with 20% thermoinactivated fetal bovine serum, 55 μM beta-mercaptoethanol, and an antibiotic / antifungal cocktail. Otherwise, the cells were passaged in the same manner as the K562 cells described above.

[0152] Antibody staining for flow cytometry analysis: Cells were collected by centrifugation, washed twice in FACS buffer (5% FBS in 1× D-PBS), and resuspended in 1 ml of FACS buffer. For direct fluorophore conjugate antibody staining of surface proteins, cells were incubated with appropriate conjugate antibodies (or isotype controls) at 4°C in the dark for 20 minutes, and then washed twice in FACS buffer. For detection of CAR proteins, cells were incubated with biotinylated anti-F(ab')2 fragment antibody, and then incubated with streptavidin-APC antibody. Samples were analyzed on a MACSQuant flow cytometer.

[0153] Growth assay: 1 × 10⁶ samples were resuspended in growth medium supplemented with 5% heat-inactivated human AB serum. 5 The initial cell count was calculated at a concentration of 1 cell / mL (day 1), and the cells were counted on days 3, 5, and 7 using an automated cell counter. The growth rate was calculated using the following formula: Doubling time (hours) = [Duration (hours) × log(2)] / [log(final cell density) - log(initial cell density)] It was calculated using the method described above.

[0154] Cytotoxicity: The suspension-growth cell system was resuspended by pipetting the cell culture from top to bottom. Cell viability was determined by automated counting (trypan blue exclusion method). Target cells were labeled with CFSE dye, and target and effector cells were diluted to the required cell concentration in RPMI-1640 supplemented with 10% thermoinactivated FBS and antibiotics / antifungal agents. Effector and target cells were mixed in 96-well plates at different effector-to-target ratios (E:T of 20:1, 10:1, 5:1, 2.5:1, 1.25:1, 0.62:1, 0.31:1, and 0.15:1) and co-cultured for 4 hours in a 37°C incubator under a 5% CO2 atmosphere. PI was then added for fluorescent labeling of dead cells, and the assay was analyzed on a MACSquant flow cytometry instrument.

[0155] ADCC: The suspension-growth cell system was resuspended by pipetting the cell culture from top to bottom. Cell viability was determined by automated counting (trypan blue exclusion method). Target cells were labeled with PKH67-GL dye, and target and effector cells were diluted to the required cell concentration in RPMI-1640 supplemented with 10% heat-inactivated FBS and antibiotics / antifungal agents. Target cells were pre-incubated at room temperature for 30 minutes with monoclonal antibodies trastuzumab, rituximab, or without antibody. Antibody-labeled target cells (and unantibody-controlled cells) were then mixed in 96-well plates with effector cells at different effector-to-target ratios (E:T of 20:1, 10:1, 5:1, 2.5:1, 1.25:1, 0.62:1, 0.31:1, and 0.15:1) and co-cultured for 4 hours in a 37°C incubator under a 5% CO2 atmosphere. Next, PI was added for fluorescent labeling of dead cells, and the assay was analyzed on a MACSquant flow cytometry instrument.

[0156] Quantitative determination of IL-2 Wash the cells for analysis in D-PBS 1× to remove any remaining medium, resuspend them in fresh growth medium, and then transfer them to two 96-well plates, each containing 10 cells. 5Aliquots were made in triplicate at a density of 5 cells / well (= 200 μl / well), and the plates were incubated in a 5% CO2 humidified incubator at 37 °C. One set of plates was removed for analysis after 24 h of incubation and the other after 48 h. Analytical sample supernatants were prepared by a first centrifugation step at 500 × g for 5 min to remove cells, followed by a second centrifugation at 2000 × g for 5 min to remove cell debris. Sample supernatants were frozen at -80 °C until analysis. Cell pellets from the 500 × g centrifugation step were resuspended, triplicates were pooled, and cell density was recorded. The concentration of IL-2 in the sample supernatants was measured using a human IL-2 ELISA detection kit available from ThermoFisher Scientific (Waltham, MA) according to the manufacturer's instructions and compared to the provided standard. IL-2 concentrations were normalized to the cell number at 24 and 48 h and expressed as pg / ml / 10

[0157] Example 3: Phenotype of modified NK-92® cells Expression of CD19 CAR in CD19 t-haNK™ cells was measured by flow cytometry, and the results showed that CD19 t-haNK™ cells could grow in the absence of IL-2 and that more than 80% of the cells expressed both high levels of CD16 (Figure 3A) and CAR (Figure 3B).

[0158] In a separate experiment, 20 selected clones were screened by flow cytometry for surface expression of CD19 CAR (detected by biotinylated F(ab’)2 fragment specific primary antibody and streptavidin-APC secondary antibody) and CD16 (detected by 3G8 monoclonal antibody). Clones showing multiple positive populations, low staining intensity for CD16, or high background were discarded.

[0159] [Table 6]

[0160] The expression profiles of six NK cell markers in selected CD19 t-haNK(trademark) clones were determined by antibody staining and flow cytometry and compared with aNK. All clones and aNK were negative for CD3 expression, while aNK was the only one that was negative for CD16 expression. All clones were positive for CD54, CD56, NKp30, and NKG2D expression, and their expression levels were similar to those of the aNK control.

[0161] [Table 7]

[0162] Example 4: Cytotoxicity of CD19 t-haNK™ cells against target cell lines The cytotoxicity of CD19 t-haNK® cells was analyzed by incubation with target cells K562, SUP-B15, and SKBr. Figure 4A shows that CD19 t-haNK® cells maintained cytotoxicity comparable to that of parental aNK cells in killing K562 cells (target cells). 16B1 and 18B1 are two CD19 t-haNK® populations obtained from two electroporation events performed on different days.

[0163] In a separate experiment, selected CD19 t-haNK® clones were used as effectors in a flow cytometry-based in vitro cytotoxicity assay against a K562-target cell line (CD19-, NK-sensitive). All clones demonstrated efficient cytolytic activity against K562 in a 4-hour cytotoxicity assay. The mean maximum killing efficiencies for CD19 t-haNK® clones were 70.9±10.1% to 84.4±0.6% (n=2-5) compared to 84.1±2.4% for aNK controls at a 10:1 ratio. See Figure 4B.

[0164] Figure 5A demonstrates that CD19 t-haNK® cells exhibit improved specific killing of aNK®-resistant, CD19-positive SUP-B15 cell lines, showing that approximately 80–90% of cells were killed by CD19 t-haNK® cells compared to only about 10–20% of cells killed by aNK® cells in a ratio of 10 effectors to targets.

[0165] In separate experiments, selected CD19 t-haNK® clones were used as effectors in a flow cytometry-based in vitro cytotoxicity assay against a SUP-B15 target cell line (CD19+, NK resistant). All clones were able to efficiently target and kill resistant SUP-B15 in a 4-hour cytotoxicity assay. The mean maximum killing efficiencies for CD19 t-haNK® clones were 85.7±0.1% to 92.2±1.2% (n=2-5) compared to 10.8±7.4% for aNK controls at a 10:1 ratio. See Figure 5B.

[0166] Figure 6A shows that the ADCC activity of CD19 t-haNK® cells against SKBr3 cells (CD19-, Her2 / neu+) was equivalent to that of haNK® cells expressing only the CD16(158V) receptor when combined with the anti-Her2 / neu antibody Herceptin.

[0167] In a separate experiment, selected CD19 t-haNK® clones were used as effectors in a flow cytometry-based in vitro ADCC assay against a modified SUP-B15 target cell line (CD19-, CD20+, Her2-neu-, NK resistant) in combination with either an anti-CD20 rituximab monoclonal antibody or an anti-Her2-neu trastuzumab monoclonal antibody. In a 4-hour cytotoxicity assay, all clones, when combined with the anti-CD20 antibody rituximab, were able to efficiently target and kill resistant SUP-B15 CD19KO / CD20+ cells. The maximum killing efficiency for CD19 t-haNK® clones was 63.7%–77.8% at a 10:1 ratio compared to 67.1% for the haNK® control (n=1–2). Neither haNK® nor CD19 t-haNK® clones, when combined with the anti-Her2 / neu control antibody trastuzumab, were able to kill target SUP-B15CD19KO / CD20+ cells (maximum killing efficiency for CD19 t-haNK® clones was 7.7%–21.9% at a 10:1 ratio, compared to 4.1% for haNK®). ADCC-mediated killing for CD19 t-haNK® clones was 46.4%–65.2% at a 10:1 ratio, compared to 62.7% for the haNK® control. See Figure 6B.

[0168] Example 5: Other characteristics of CD19 t-haNK(trademark) cells The population doubling time of selected CD19 t-haNK(trademark) clones was determined by a 7-day cell growth assay without medium changes, and the average doubling time was calculated. All clones had population doubling times ranging from 33.1 to 54.5 hours, compared to 34.5 hours for the aNK control. See Figure 7.

[0169] CD19 t-haNK(trademark) clones were placed in a 6-well plate culture at a density of 10 e5 cells / ml without IL-2, and the culture supernatant was collected after 24 and 48 hours. The supernatant was analyzed by ELISA to detect and measure the potential release of ERIL-2 by CD19 t-haNK(trademark) cells. After 24 hours in the culture, CD19 t-haNK(trademark) clones released 16.1 to 1278.5 pg / ml / 10⁵ cells. See Figure 8.

[0170] Example 6: CD19 t-haNK™: Evaluation of the antitumor activity of CD19-targeted t-haNK™ cells in intravenous and subcutaneous models of Raji human Burkitt lymphoma in NSG mice. CD19 t-haNK™ is a natural killer cell that expresses a chimeric antigen receptor (CAR) for CD19 and treats B-cell lineage hematological malignancies. In this study, the antitumor effect of repeated intravenous (IV) administration of CD19 t-haNK™ was evaluated in both IV and subcutaneous (SC) Raji xenograft models in NSG mice. In both models, CD19 t-haNK® cells demonstrated significant therapeutic efficacy. Specifically, in the IV tumor model, CD19 t-haNK® cells significantly improved animal survival compared to vehicle controls. In the SC tumor model, CD19 t-haNK® cells significantly suppressed tumor growth, reduced the number of animal morbidity / death events, and significantly reduced the metastatic disease burden in the liver.

[0171] Targeted aNK cells expressing a chimeric antigen receptor (CAR) for CD19 have shown efficacy in Raji tumor-bearing NSG mice, which has already been shown to be most likely due to target-specific cytotoxicity in CAR-expressing cells (see, e.g., Oelsner et al, Cytotherapy, 2017). In this study, the efficacy of CD19 t-haNK® cells was evaluated in two different variations of the Raji xenograft model: 1) intravenously (IV) inoculated Raji cells; and 2) subcutaneously (SC) inoculated Raji tumors. Both models accepted repeated IV administration of CD19 t-haNK® cells. Additional animal groups (groups B and E) were also evaluated in this model using the original study protocol, but they were irrelevant to the determination of CD19 t-haNK® efficacy and are therefore not included in this report (see Table 6 for a simplified experimental design).

[0172] Example 7: Materials for CD19 t-haNK (trademark) testing CD19 t-haNK® cells (clone 19.6): CD19 t-haNK® cells were cultured in growth medium supplemented with 5% thermoinactivated human AB serum, and then followed the protocol provided by Process Development, NantKwest®, Inc., Torrey Pines.

[0173] Test animals: The test animals used were female NOD.Cg-Prkdc, 9-10 weeks old and weighing 20-27 grams at the start of the study (after isolation rearing). scid Il2rg tm1Wjl The mice used were / SzJ(NSG) mice. Twenty animals were used for the IV tumor model, while twelve were used for the SC tumor model. The animals were supplied by The Jackson Laboratory (610 Main Street Bar Harbor, ME 04609 US). Sterile stainless steel ear tags were applied to each mouse using a portable applicator for identification. In addition, each cage had a cage card containing the test number and animal number information.

[0174] Raji cancer cell lineage: Raji cells were initially purchased from ATCC (catalog #CCL-86(trademark); lot #61723871), then expanded and prepared by Preclinical Development, NantKwest(registered trademark), Inc. The cells were certified by IDEXX on March 18, 2018 (see Appendix 2 for certification report). The cell culture medium was ATCC-composed RPMI-1640 medium supplemented with 10% fetal bovine serum, penicillin (100 U / mL), and streptomycin (100 μg / mL). Exponentially growing Raji cells (passage 12) were collected by centrifugation. The cells were washed and 5 × 10⁶ cells were prepared for IV inoculation. 5 In serum-free medium at a concentration of 10 cells / mL, and for SC transplantation, 2.5 × 10 6 The cells were resuspended in medium / Matrigel (1:1 v / v) at a concentration of 100 viable cells / mL. The cells were stored on ice before injection into animals. 96% of the cells used in the in vivo study had a viability rate.

[0175] Raji IV model: 20 animals were intravenously injected with 0.2 mL of Raji cell suspension via the lateral tail vein using a 27 gauge needle (1 × 10⁻¹⁰ 5 (Inoculation material for individual cells).

[0176] Raji SC model: 0.1 mL of Raji cell suspension was transplanted into the bilateral flanks of 12 animals using a 25-gauge needle (2.5 × 10⁻⁶). 5 (Inoculation material for individual cells).

[0177] Example 8: Experimental procedure for the CD19 t-haNK (trademark) test IV. Raji Model: Within 24 hours after inoculation with cancer cells, defined as day 1, 20 animals were sham-randomized into two groups of 10 according to their body weight to achieve similar mean body weights between the groups. On days 2, 5, 8, 10, 12, and 17, CD19 t-haNK™ cells grown in the exponential growth phase were harvested by centrifugation and injected at a volume of 200 μL per mouse, resulting in 1 × 10⁶ cells per mouse. 7 5 × 10 for IV administration at individual cell doses 7 The cells were mixed in growth medium at a concentration of cells / mL. As shown in Table 6, animals in group A received the vehicle control, while animals in group C received CD19 t-haNK® cells.

[0178] Animals were weighed before tumor cell injection and twice weekly. Animals were observed daily for death / morbidity (G0-G4) and clinical signs of toxicity (T1-T12; see Table 6). Paralyzed or dying animals were euthanized. Animals were euthanized by CO2 inhalation followed by cervical dislocation. Death events (euthanasia or natural death) were recorded in the Death Log, and survival curves were calculated by aggregating the data.

[0179] SC Raji Model: After SC tumor transplantation, animals were tested for tumor establishment at least twice a week. When the tumor became palpable, tumor volume (TV) was measured once or twice a week using a digital portable measuring device. The formula is: TV = length × width 2 Calculated using / 2 [length is the maximum diameter of the tumor, width is the minimum diameter]. When the average tumor volume reached an injectable size (195 mm in this case). 3 (24 days after transplantation), 12 tumor-bearing animals were sham-randomized into two groups of 6 to achieve similar tumor volume between the groups. This was defined as day 0. On days 1, 4, 7, 9, 11, and 13, exponentially growing CD19 t-haNK™ cells were harvested by centrifugation, irradiated with 1000 cGy gamma rays, and injected at a rate of 200 μL per mouse, resulting in 1 × 10⁶ cells per mouse. 7 5 × 10 for IV administration at individual cell doses 7 The cells were formulated in growth medium at a concentration of cells / mL. As shown in Table 6, animals in group D received the vehicle solution, while animals in group F received CD19 t-haNK® cells. The animals were weighed before tumor cell injection and then twice weekly.

[0180] Animals were observed daily for death / morbidity (G0-G4) and clinical signs of toxicity (T1-T12). Paralyzed or mortally injured animals were euthanized. Mortally injured animals were euthanized as soon as they showed signs of illness, while surviving animals were subjected to planned euthanasia for tissue recovery. Specifically, half of the surviving animals (maximum 3 mice / group) were euthanized on day 13, 6 hours after the last dose of the test substance. The remaining animals were euthanized on day 15, 48 hours after the last dose. Euthanasia was performed by cervical dislocation under deep anesthesia after the final intracardiac hemorrhage. Blood / serum samples were not analyzed in this part of the study and are therefore not included in this report.

[0181] At the end of the study, an autopsy was performed, and organs with visible macroscopic lesions were excised, fixed in 10% formalin, and submitted to the affiliated pathology laboratory (Seventh Wave Laboratories) for histological evaluation of tumor / metastatic disease burden.

[0182] [Table 8]

[0183] Example 9: Data analysis of the CD19 t-haNK (trademark) test The following formula: Tumor volume = length × width 2 The tumor volume was calculated using / 2 (where length and width are the longest and shortest diameters of the tumor, respectively).

[0184] Tumor growth inhibition (TGI) was calculated as follows: TGI = (T C -T t ) / ΔT C ×100% (wherein Tc and Tt are the mean tumor volumes for the control and treatment groups at the end of the study, respectively, and ΔTc is the change in mean tumor volume in the control group).

[0185] Tumor growth curves were analyzed using two-way ANOVA followed by Tukey's test for multiple comparisons. Survival curves were analyzed using the log-rank (Mantelcox) test. Differences in liver metastatic disease burden on individual days were analyzed using unpaired two-sided t-tests. P<0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism version 7.

[0186] Example 10: Results of the IV Raji Model for the CD19 t-haNK™ Test The primary readout in the IV tumor model was animal survival time. Death events were counted when an animal was found to have died or when an animal was euthanized due to disease-related morbidity and / or paralysis. As shown in Figure 9, compared to the vehicle control, CD19 t-haNK™ cell treatment significantly improved animal survival, resulting in a median survival time of 27 days compared to 21.5 days in the vehicle control group (P<0.0001). Animal body weight changes were also monitored throughout the study. As shown in Figure 10, CD19 t-haNK®-treated animals exhibited moderate (less than 10%) and short-term body weight loss when treatment was first initiated, which is not a rare phenomenon in animals receiving IV NK infusion and is not specific to CD19 t-haNK® cells. These weights were recoverable after the first week of treatment before decreasing again due to disease progression.

[0187] Example 11: Results of the SC Raji model for the CD19 t-haNK™ test. The main readout in the SC tumor model was tumor growth. As shown in Figure 11, CD19 t-haNK™ cells demonstrated clear and statistically significant inhibition of tumor growth from day 7 onward compared to the vehicle control group, with a TGI of 49% at the end of the test (day 13).

[0188] Furthermore, because Raji is an invasive lymphoma model, even with SC inoculation, cancer cells could disseminate and develop multiple metastatic sites, ultimately leading to animal morbidity and / or death. In the vehicle group, a total of three animals (50%) were mortal and therefore euthanized between days 11 and 13. In contrast, no unplanned death events occurred in the CD19 t-haNK™ cell group (Table 7).

[0189] Furthermore, a qualitative reduction in liver metastases was observed in CD19 t-haNK™-treated animals during autopsy (Figure 12a). Semi-quantitative estimation of disease burden was performed by the collaborating pathology laboratory (Seventh Wave Laboratories) on representative HE-stained liver sections. As summarized in Figure 12b and Table 8, a clear trend of increasing disease burden was observed as the experiment progressed. The livers of CD19 t-haNK™-treated animals showed a significantly lower percentage of cancerous invasive area compared to the vehicle control. Due to the small sample size and unplanned early deaths in the control group, statistical analysis could only be performed on data from day 13. This analysis showed a significant difference in disease burden, with an average invasion rate of 10% in CD19 t-haNK™-treated animals compared to 30% in the control group. Body weight changes were monitored throughout the study, and similar to the IV Raji model, CD19 t-haNK™ treated animals demonstrated moderate (less than 10%) and transient body weight loss at the beginning of the treatment regimen (Figure 13).

[0190] [Table 9]

[0191] [Table 10]

[0192] Example 12: Conclusion of the CD19 t-haNK (trademark) test To evaluate the antitumor efficacy of CD19 t-haNK® cells in repeated IV-dose regimens, two variations of the Raji xenograft model, using IV and SC tumor inoculation, were utilized in this study. In the IV tumor model, CD19 t-haNK® cells significantly improved animal survival, extending median survival by 5.5 days (a 26% increase) compared to the vehicle control group. In the SC tumor model, CD19 t-haNK® cells significantly inhibited tumor growth, resulting in a 49% TGI at the end of the study. Furthermore, CD19 t-haNK® treatment reduced the number of morbidity / death events in animals (0 out of 6 in CD19 t-haNK®-treated animals compared to 3 out of 6 in the control group) and significantly reduced the metastatic disease burden in the liver of SC Raji tumor-bearing animals. In summary, CD19 t-haNK(trademark) cells demonstrated significant therapeutic efficacy compared to vehicle controls in both variations of the Raji xenograft model.

[0193] It will be apparent to those skilled in the art that many further modifications are possible without departing from the concept of the invention as described herein, in addition to those already described. Therefore, the subject matter of the invention should not be limited beyond the appended claims. Furthermore, in interpreting both this specification and the claims, all terms should be interpreted in the broadest possible form consistent with the context. In particular, the terms “comprise” and “comprising” should be interpreted as non-exclusively referring to elements, components, or steps, indicating that the referenced elements, components, or steps may exist, or can be utilized, or can be combined with other elements, components, or steps not explicitly referenced. Where this specification or the claims refer to at least one selected from the group consisting of A, B, C..., and N, the sentence should be interpreted as requiring only one element from that group, and not A and N, or B and N, etc.

Claims

1. NK-92 cells expressing CD19 CAR and Fc receptor, comprising a multicistronic DNA construct, wherein the multicistronic construct encodes the CD19 CAR and the Fc receptor, and further comprises a sequence encoding IL-2 or a variant thereof, or IL-15 or a variant thereof.

2. The NK-92 cell according to claim 1, wherein the Fc receptor is CD16.

3. The NK-92 cell according to claim 1, wherein the Fc receptor includes SEQ ID NO:

2.

4. The NK-92 cell according to claim 1, wherein the IL-2 variant is erIL-2, or the IL-15 variant is erIL-15.

5. The NK-92 cell according to claim 4, wherein one or more of the coding sequences of the CD19 CAR, the Fc receptor, erIL-15, or erIL-2 are codon-optimized for expression in a human system.

6. NK-92 cells according to any one of claims 1 to 5, which can kill CD19-expressing cells.

7. The NK-92 cells according to claim 6, wherein the CD19-expressing cells are tumor cells.

8. The NK-92 cells according to claim 7, wherein the tumor cells are SUP-B15 cells.

9. The NK-92 cell according to claim 1, wherein the CD19 CAR comprises an scFv antibody fragment.

10. The NK-92 cell according to claim 9, wherein the scFv antibody fragment has the amino acid sequence of SEQ ID NO:

10.

11. The NK-92 cell according to claim 1, wherein the multi-cistronic construct comprises the sequence of Sequence ID No. 9, the sequence encoding the scFv antibody fragment.

12. The NK-92 cell according to claim 1, comprising a sequence encoding a self-cleaving peptide, wherein the sequence is located between the CD19 CAR and CD16, and the sequence enables equimolar expression of the CD19 CAR and the FcR.

13. NK-92 cells according to claim 1, comprising an internal ribosome entry sequence (IRES) between a sequence encoding CD16 and a sequence encoding IL-2 or a variant thereof, or a sequence encoding IL-15 or a variant thereof.

14. The NK-92 cells according to claim 1, wherein the direct cytotoxicity of the NK-92 cells against CD19-expressing cells is 70-100% when the effector-to-target ratio is 10.

15. The NK-92 cells according to claim 1, wherein the ADCC activity of the NK-92 cells is 30-90% when the ratio of effectors to targets is 10.

16. The NK-92 cell according to claim 1, wherein the CD19 CAR includes a sequence that shares at least 90% identity with sequence number 10.

17. The NK-92 cell according to claim 1, wherein the CD19 CAR comprises a cytoplasmic signaling domain.

18. The NK-92 cell according to claim 17, wherein the cytoplasmic signaling domain is Fc epsilon receptor gamma (FcεRIγ).

19. A kit comprising a pharmaceutical composition containing NK-92 cells as described in claim 1.

20. A method for generating NK-92 cells, To provide multicistronic vectors encoding CD19 CAR, CD16, and IL-2 or IL-15, and The vector is introduced into the NK-92 cells to generate the NK-92 cells. A method that includes this.

21. The method according to claim 20, wherein the vector comprises a sequence encoding a self-cleaving peptide, the sequence is located between CAR and CD16, and the sequence enables equimolar expression of CAR and CD16.

22. The method according to claim 20, wherein the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 or IL-15 coding sequence.

23. A method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a composition, wherein the composition comprises a plurality of NK-92 cells as described in claim 1.

24. The body surface area of ​​the aforementioned target is 1 m² ２ Approximately 1 x 10 ８ ~Approx. 1×10 １１ The method according to claim 23, wherein a modified cell is administered to the subject.

25. The method according to claim 23, wherein the cancer is leukemia or lymphoma.

26. The method according to claim 23, wherein the cancer is one or more of the following: B-cell malignancy, B-cell malignancy after HSCT, CLL, B-ALL, acute lymphoblastic leukemia (ALL), B-cell lineage lymphoma after UCBT, chronic lymphocytic leukemia (CLL), B-non-Hodgkin lymphoma (B-NHL), ALL after HSCT; lymphoma, refractory follicular lymphoma, or lymphoblastic leukemia.

27. The method according to claim 26, wherein the B-cell malignant tumor is mantle cell lymphoma.

28. The method according to claim 23, wherein the plurality of NK-92 cells are administered intravenously.

29. The method according to claim 23, wherein the plurality of NK-92 cells are administered intratumorally.

30. A method for administering NK cells to an individual, comprising administering a first composition containing NK cells expressing CD19 CAR and a second composition containing primary NK cells.

Images