Kit for evaluating gene mutations related to myeloproliferative neoplasms

Abstract

This method accurately determines the presence or absence of multiple types of gene mutations present in CARL, which are associated with myeloproliferative neoplasms. [Solution] It corresponds to one of the type 1, type 3, type 4, and type 5 mutations associated with myeloproliferative neoplasms in CALR, and has a mismatch due to artificial deletion.

Description

Technical Field

[0001] The present invention relates to a probe set capable of evaluating gene mutations useful as diagnostic items for myeloproliferative neoplasms, and a microarray comprising the probe set.

Background Art

[0002] Myeloproliferative neoplasms (MPN) are diseases caused by the tumorigenesis of myeloid cells. MPN is characterized by the marked proliferation of myeloid cells (granulocytes, blast cells, bone marrow megakaryocytes, mast cells, etc.). MPN includes chronic myelogenous leukemia (CML), chronic neutrophilic leukemia (CNL), polycythemia vera (PV), primary myelofibrosis (PMF), essential thrombocythemia (ET), chronic eosinophilic leukemia (CEL), hypereosinophilic syndrome (HES), mastocytosis, and myeloproliferative neoplasms, unclassifiable (MPN, U).

[0003] As described in Non-Patent Literature 1, the diagnosis of MPN is based on clinical parameters, bone marrow morphology, and gene mutation data. In Philadelphia chromosome-negative patients, MPN excluding CML can be diagnosed by combining these indicators. Specifically, gene mutation data is used for mutations in three genes: JAK2, CALR, and MPL, and additionally, mutation data for ASXL1, EZH2, TET2, IDH1 / IDH2, SRSF2, and SF3B1. In particular, since JAK2, CALR, and MPL are considered to be the molecular basis for the development of MPN, the presence or absence of mutations in these gene groups is an important factor in the definitive diagnosis of MPN.

[0004] Furthermore, Non-Patent Document 2 discloses that the JAK2V617F mutation (a mutation in which valine at position 617 is replaced with phenylalanine) is frequently observed in PV, ET, and PMF, and that in a small number of PV cases, in addition to the above mutation, insertion / deletion type mutations in exon 12 are also observed. JAK2 (Janus activating kinase 2) is a gene that codes for a protein that controls erythropoietin receptor signaling. In addition, Non-Patent Document 3 discloses that mutations in exon 12 of JAK2 are associated with polycythemia vera (PV) and idiopathic erythrocytosis (IE). Furthermore, Patent Document 5 discloses the detection of the c2035t mutation (T514M mutation) among the mutations in exon 12 of the JAK2 gene as a mutation indicating myeloproliferative disorder.

[0005] Non-patent document 2 further discloses that the MPLW515L / K mutation in PMF was observed in PMF and ET. MPL is a gene that encodes the thrombopoietin receptor.

[0006] Non-patent document 2 further discloses that, regarding CALR, type 1 mutations (52-base deletion) and type 2 mutations (5-base insertion) are the most frequent, and that these mutations are found in ET and PMF. Type 1 mutations are more frequent in PMF and are disclosed to be associated with the conversion to myelofibrosis in ET. CALR is a gene that encodes calreticulin, one of the molecular chaperones of the endoplasmic reticulum.

[0007] Furthermore, Patent Document 1 discloses a JAK2V617F site-specific fluorescently labeled probe as a method for analyzing mutations in the JAK2 gene. Patent Document 2 discloses a technique for detecting mutations different from the JAK2V617F mutation found in patients who are negative for the JAK2V617F mutation but exhibit myeloproliferative neoplasms.

[0008] Furthermore, Patent Document 3 discloses a probe set for detecting W515K and W515L mutations in MPL, which are used as probes for detecting MPL gene polymorphisms.

[0009] Furthermore, Patent Document 4 discloses a technique for identifying mutations in CALR.

[0010] Furthermore, Patent Document 5 discloses the detection of mutations in JAK2 nucleic acid, and discloses gene mutations located in exon 12 of JAK2. Furthermore, in view of the above circumstances, Patent Document 6 discloses the design of primers and probes for each gene mutation as a means of simultaneously and easily detecting multiple gene mutations related to myeloproliferative neoplasms, and discloses the V617F mutation in JAK2, type 1 and type 2 mutations in CALR, and W515L and W515K mutations in MPL as gene mutations to be detected (five gene mutations in three genes).

[0011] Furthermore, the method for designing a probe to detect a target gene mutation involves designing the probe based on the nucleotide sequence of the surrounding region containing the gene mutation. In this case, the probe is designed as a sequence that perfectly matches the nucleotide sequence of the surrounding region containing the gene mutation, or as a nucleotide sequence containing one or more non-natural nucleotides, as disclosed in Patent Document 7. A probe containing one or more non-natural nucleotides does not form a hybridize (mismatch) with the surrounding region containing the gene mutation at the location of the non-natural nucleotide. According to Patent Document 7, this mismatch allows for highly accurate detection of whether the target nucleic acid in the sample has a gene mutation. [Prior art documents] [Patent Documents]

[0012] [Patent Document 1] Japanese Patent Publication No. 2012-034580 [Patent Document 2] WO2009 / 060804 [Patent Document 3] WO2011 / 052755 [Patent Document 4] Special Publication 2016-537012 [Patent Document 5] Patent No. 6017136 [Patent Document 6] WO2019 / 004334 [Patent Document 7] Special Publication No. 2000-511434 [Non-patent literature]

[0013] [Non-Patent Document 1] Francesco Passamonti and Margherita Maffioli, Hematology 2016, p. 534-542 [Non-Patent Document 2] NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines), Myeloproliferative Neoplasms, Version 2.2017, October 19, 2016 [Non-Patent Document 3] Linda M. Scott et al., N Engl J Med. 2007 Feb 1;356(5):459-68 [Overview of the project] [Problems that the invention aims to solve]

[0014] The present invention aims to provide a gene mutation evaluation kit that can accurately determine the presence or absence of multiple types of gene mutations present in CARL among the gene mutations associated with myeloproliferative neoplasms, and that can determine the presence or absence of myeloproliferative neoplasms with higher accuracy. [Means for solving the problem]

[0015] This invention encompasses the following: (1) A kit for evaluating gene mutations related to myeloproliferative neoplasms, comprising a CALR mutant probe corresponding to at least one gene mutation selected from the group consisting of a type 1 mutation with a 52-base deletion in which 52 bases from positions 506 to 557 of the wild-type CALR gene sequence shown in Sequence ID No. 10 are deleted, a type 3 mutation with a 46-base deletion in which 46 bases from positions 509 to 554 of the same sequence are deleted, a type 4 mutation with a 34-base deletion in which 34 bases from positions 516 to 549 of the same sequence are deleted, and a type 5 mutation with a 52-base deletion in which 52 bases from positions 505 to 556 of the same sequence, wherein the CALR mutant probe has a mismatch due to an artificial deletion. (2) The CALR mutant probe for the above type 1 mutation has a nucleotide sequence in which one or more nucleotides selected from the range of 558 to 564 in SEQ ID NO: 10 are deleted, or a complementary nucleotide sequence thereof. The CALR mutant probe for the above type 3 mutation has a nucleotide sequence in which one or more bases selected from the range of positions 555 to 559 in SEQ ID NO: 10 are deleted, or a complementary nucleotide sequence thereof. The CALR mutant probe for the above type 4 mutation has a nucleotide sequence in which one or more bases selected from the range of positions 550 to 558 in SEQ ID NO: 10 are deleted, or a complementary nucleotide sequence thereof. The CALR variant probe for the above-mentioned type 5 mutation has a base sequence in which one or more bases selected from the range of positions 558 to 564 in Sequence ID No. 10 are deleted, or a complementary base sequence thereof, as described in (1). (3) The gene mutation evaluation kit according to (1), characterized in that the CALR mutant probe for the type 1 mutation includes the nucleotide sequence shown in SEQ ID NO: 95 or its complementary nucleotide sequence, the CALR mutant probe for the type 3 mutation includes the nucleotide sequence shown in SEQ ID NO: 53 or its complementary nucleotide sequence, the CALR mutant probe for the type 4 mutation includes the nucleotide sequence shown in SEQ ID NO: 54 or its complementary nucleotide sequence, and the CALR mutant probe for the type 5 mutation includes the nucleotide sequence shown in SEQ ID NO: 55 or its complementary nucleotide sequence. (4) The gene mutation evaluation kit according to (1), further comprising a CALR mutant probe corresponding to a type 2 mutation in which TTGTC is inserted between positions 568 and 569 in the base sequence of the wild-type CARL gene shown in Sequence ID No. 10. (5) The gene mutation evaluation kit according to (1), further comprising a JAK2 mutant probe corresponding to gene mutations associated with myeloproliferative neoplasms in JAK2 and / or an MPL mutant probe corresponding to gene mutations associated with myeloproliferative neoplasms in MPL. (6) Using the gene mutation evaluation kit according to any one of (1) to (5) above, for a subject to be diagnosed, at least one gene mutation selected from the group consisting of type 3 mutation, type 4 mutation, and type 5 mutation related to myeloproliferative tumor in CARL is identified, and a data analysis method for diagnosing myeloproliferative tumor.

Advantages of the Invention

[0016] According to the present invention, among the gene mutations related to myeloproliferative tumor, a plurality of gene mutations (type 1 mutation, type 3 mutation to type 5 mutation) particularly present in CARL can be accurately determined. Therefore, according to the present invention, the diagnostic accuracy of myeloproliferative tumor using the information of the above gene mutations of the subject to be diagnosed can be improved.

Brief Description of the Drawings

[0017] [Figure 1] It is a configuration diagram for explaining the deletion regions in type 1 gene mutation, type 3 gene mutation, type 4 gene mutation, and type 5 gene mutation in CARL. [Figure 2] It is a characteristic diagram showing the results of measuring each mutant sample and wild-type sample using the type3 mutation probe 5, type4 mutation probe 5, and type5 mutation probe 4 designed in the examples. [Figure 3] It is a configuration diagram for explaining the primers designed to amplify the region containing a plurality of gene mutations included in exon 12 of JAK2. [Figure 4] It is a characteristic diagram showing the results of measuring the fluorescence intensities derived from four amplified fragments obtained using the primer set designed in Example 1. [Figure 5] It is a characteristic diagram with the concentration of the labeled primer (forward primer) of the primer set for amplifying the region containing the V617F mutation site on the horizontal axis and the fluorescence intensities derived from the four amplified regions on the vertical axis. [Figure 6]This characteristic diagram shows the concentration of the labeled primer (forward primer) in a primer set that amplifies the region containing the V617F mutation site on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis. [Figure 7] This characteristic graph shows the concentration of labeled primers (reverse primers) in a primer set that amplifies JAK2 exon 12 on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis. [Figure 8] This characteristic graph shows the concentration of labeled primers (reverse primers) in a primer set that amplifies JAK2 exon 12 on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis. [Figure 9] This characteristic graph shows the concentration ratio of labeled primers (reverse primers) from the primer set that amplifies exon 12 to labeled primers (forward primers) from the primer set that amplifies the region containing the V617F mutation site on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis. [Figure 10] This is a characteristic diagram showing the results of detecting the V617F mutation in JAK2 and gene mutations present in exon 12, etc., using a mutation model sample. [Modes for carrying out the invention]

[0018] The kit for evaluating gene mutations related to myeloproliferative neoplasms according to the present invention comprises a CALR mutation probe that identifies at least one gene mutation selected from the group consisting of so-called type 3 mutations, type 4 mutations, and type 5 mutations as a gene mutation related to myeloproliferative neoplasms in CARL.

[0019] The main known mutations in the CALR gene are type 1 mutations (52 base deletions), type 2 mutations (5 base insertions), type 3 mutations (46 base deletions), type 4 mutations (34 base deletions), and type 5 mutations (52 base deletions, different from type 1 mutations). These type 1 through type 5 mutations are located at the C-terminus of the CALR protein. One of these mutations is found in 20-25% of patients with primary myelofibrosis (PMF) or essential thrombocythemia (ET). Type 2 mutations are primarily associated with essential thrombocythemia (ET), while type 1 mutations are associated with primary myelofibrosis (PMF). Furthermore, CALR gene mutations are also found in myeloproliferative neoplasms that do not have JAK2 gene mutations, which will be discussed in detail later.

[0020] The nucleotide sequence encoding wild-type CALR is shown in SEQ ID NO: 10. If a type 1 mutation is present, 52 nucleotides from position 506 to 557 will be deleted in the nucleotide sequence shown in SEQ ID NO: 10. If a type 2 mutation is present, TTGTC will be inserted between positions 568 and 569 in the nucleotide sequence shown in SEQ ID NO: 10. If a type 3 mutation is present, 46 nucleotides from position 509 to 554 will be deleted in the nucleotide sequence shown in SEQ ID NO: 10. If a type 4 mutation is present, 34 nucleotides from position 516 to 549 will be deleted in the nucleotide sequence shown in SEQ ID NO: 10. If a type 5 mutation is present, 52 nucleotides from position 505 to 556 will be deleted in the nucleotide sequence shown in SEQ ID NO: 10.

[0021] Figure 1 schematically shows the deleted regions for type 1, type 3, type 4, and type 5 deletion mutations, using a portion of the nucleotide sequence encoding wild-type CALR (sequence number 56) as a reference. As shown in Figure 1, type 1 mutation (sequence number 57), which deletes 52 nucleotides of wild-type CALR; type 3 mutation (sequence number 58), which deletes 46 nucleotides of wild-type CALR; type 4 mutation (sequence number 59), which deletes 34 nucleotides of wild-type CALR; and type 5 mutation (sequence number 60), which deletes 52 nucleotides of wild-type CALR, each have very similar sequences before and after the deletion at the 3' end of the deletion site (arrow in the figure). In Figure 1, the sequences that match before and after the deletion are underlined for each of the nucleotide sequences of type 1, type 3, type 4, and type 5 mutations.

[0022] The gene mutation evaluation kit according to the present invention includes, as a CALR mutation probe, at least one probe selected from the group consisting of a type 1 mutation probe for detecting type 1 mutations, a type 3 mutation probe for detecting type 3 mutations, a type 4 mutation probe for detecting type 4 mutations, and a type 5 mutation probe for detecting type 5 mutations. That is, the gene mutation evaluation kit according to the present invention may include all of the type 3 mutation probe, type 4 mutation probe and type 5 mutation probe, or it may include one or any two of the type 3 mutation probe, type 4 mutation probe and type 5 mutation probe.

[0023] These CALR mutant probes have a mismatch due to an artificial deletion. Specifically, the CALR mutant probe is designed as a complementary strand with at least one base (1 to several bases, for example, 1 to 5 bases, preferably 1 to 3 bases, more preferably 1 base) deleted (i.e., artificially deleted) from the deleted sequences of type 1, type 3, type 4, and type 5 mutants shown in Figure 1. Here, the base to be artificially deleted is preferably selected from the region that matches the wild-type sequence (underlined in Figure 1) in the deleted sequences of type 1, type 3, type 4, and type 5 mutants, as shown in Figure 1. Note that the CALR mutant probe can be designed as a complementary strand to a predetermined base sequence, but it may also be designed as the same strand as that base sequence.

[0024] In other words, CALR mutant probes corresponding to these type 1, type 3, type 4, or type 5 mutations can be designed as complementary strands in which at least one base is deleted in a region within 10 bases, preferably within 8 bases, and more preferably within 5 bases, 3' end of the deletion site (arrow in Figure 1).

[0025] More specifically, a CALR mutant probe corresponding to a type 1 mutation can be designed as a complementary strand in which at least one base is deleted from the 7-base range (underlined area in Figure 1) 3' end, counting from the deletion site (arrow in Figure 1). Using the nucleotide sequence shown in SEQ ID NO: 10 as a reference, a CALR mutant probe corresponding to a type 1 mutation can be designed as a complementary strand in which at least one base is deleted from the 7-base range from position 558 to 564. In particular, it is preferable to design a CALR mutant probe corresponding to a type 1 mutation as a complementary strand of GACGAGGAGCGGACAAGGAG (SEQ ID NO: 95), which has AGA deleted from positions 560 to 562 in the nucleotide sequence shown in SEQ ID NO: 10 (the nucleotide sequence of SEQ ID NO: 95 may also be used).

[0026] A CALR mutant probe corresponding to a type 3 mutation can be designed as a complementary strand in which at least one base is deleted from the 5-base range 3' end (underlined area in Figure 1) above the deletion site (arrow in Figure 1). Using the nucleotide sequence shown in SEQ ID NO: 10 as a reference, a CALR mutant probe corresponding to a type 3 mutation can be designed as a complementary strand in which at least one base is deleted from the 5-base range from position 555 to position 559. In particular, it is preferable to design a CALR mutant probe corresponding to a type 3 mutation as a complementary strand of GAGGAGCAGAGCAGAGGACAA (SEQ ID NO: 53) in which the G at position 558 in the nucleotide sequence shown in SEQ ID NO: 10 is deleted (the nucleotide sequence of SEQ ID NO: 53 may also be used).

[0027] A CALR mutant probe corresponding to type 4 mutations can be designed as a complementary strand in which at least one base is deleted from the 9-base range (underlined area in Figure 1) 3' end, counting from the deletion site (arrow in Figure 1). Using the nucleotide sequence shown in SEQ ID NO: 10 as a reference, a CALR mutant probe corresponding to type 4 mutations can be designed as a complementary strand in which at least one base is deleted from the 9-base range from position 550 to 558. In particular, it is preferable to design a CALR mutant probe corresponding to type 4 mutations as a complementary strand of CAGAGGCTTAGAGGAGGCAGAG (SEQ ID NO: 54) in which the G at position 552 in the nucleotide sequence shown in SEQ ID NO: 10 is deleted (the nucleotide sequence of SEQ ID NO: 54 may also be used).

[0028] A CALR mutant probe corresponding to type 5 mutations can be designed as a complementary strand in which at least one base is deleted from the 7-base range from the 2nd to the 8th base from the 3' end (underlined area in Figure 1), counting from the deletion site (arrow in Figure 1). Using the nucleotide sequence shown in SEQ ID NO: 10 as a reference, a CALR mutant probe corresponding to type 5 mutations can be designed as a complementary strand in which at least one base is deleted from the 7-base range from position 558 to 564. In particular, it is preferable to design a CALR mutant probe corresponding to type 5 mutations as a complementary strand of GACGAGGGGCGGACAAGGAG (SEQ ID NO: 55), which has AGA positions 560 to 562 deleted in the nucleotide sequence shown in SEQ ID NO: 10 (the nucleotide sequence of SEQ ID NO: 55 may also be used).

[0029] Incidentally, the gene mutation evaluation kit according to the present invention may simultaneously identify gene mutations present in JAK2 and MPL in addition to the gene mutations in the CARL gene described above. These gene mutations in JAK2 and MPL, like the gene mutations in CARL, are gene mutations used in the diagnosis of myeloproliferative neoplasms in the classification by the World Health Organization (WHO) (for example, the 2016 version).

[0030] Genetic mutations associated with myeloproliferative neoplasms in JAK2 include the V617F mutation and gene mutations located in exon 12. That is, the gene mutation evaluation kit may include a V617F mutation probe corresponding to the V617F mutation, which is a gene mutation associated with myeloproliferative neoplasms in JAK2, and an exon 12 mutation probe corresponding to a gene mutation located in exon 12, which is a gene mutation associated with myeloproliferative neoplasms in JAK2, as JAK2 mutation probes. The gene mutation evaluation kit may also include a V617F mutation primer set that amplifies the region containing the V617F mutation in JAK2, and an exon 12 primer set that amplifies the region containing the gene mutation located in exon 12 of the JAK2 gene.

[0031] Specifically, the V617F mutation in the JAK2 gene means that the 617th valine molecule is substituted for phenylalanine. This mutation contributes to the activation of the JAK-STAT pathway and is a prominent feature of polycythemia vera (PV). Furthermore, the V617F mutation is found in 50-60% of patients with primary myelofibrosis (PMF) or essential thrombocythemia (ET). The sequence of exon 14, which includes the 617th valine molecule in the wild-type JAK2 gene, is shown in Sequence ID No. 11. In individuals with the V617F mutation, the 351st G molecule in the sequence shown in Sequence ID No. 11 is substituted for T.

[0032] Furthermore, gene mutations located in exon 12 are known as diagnostic criteria for MPN as defined by the World Health Organization (WHO), and are particularly detected in polycythemia vera (PV). Genetic mutations in exon 12 of the JAK2 gene are not limited to these, but include, for example, mutations in which asparagine at position 542 and glutamic acid at position 543 are deleted (referred to as the N542_E543del mutation), mutations in which glutamic acid at position 543 and aspartic acid at position 544 are deleted (referred to as the E543_D544del mutation), mutations in which arginine at position 541 to glutamic acid at position 543 are replaced with lysine (referred to as the R541_E543>K mutation), mutations in which phenylalanine at position 537 to lysine at position 539 are replaced with leucine (referred to as the F537_K539>L mutation), and mutations in which lysine at position 539 is replaced with leucine (referred to as the K539L(TT) mutation or K539L(CT) mutation). The K539L(TT) mutation is a mutation in which the 539th codon encoding lysine (AAA) becomes a codon encoding leucine (TTA). The K539L(CT) mutation is a mutation in which the 539th codon encoding lysine (AAA) becomes a codon encoding leucine (CTA).

[0033] Here, the sequence encoding exon 12 of the wild-type JAK2 gene is shown in Sequence ID No. 12. If the N542_E543del mutation is present, six bases from position 250 to 255 will be deleted in the sequence shown in Sequence ID No. 12. If the E543_D544del mutation is present, six bases from position 253 to 258 will be deleted in the sequence shown in Sequence ID No. 12. If the R541_E543>K mutation is present, six bases from position 248 to 253 will be deleted in the sequence shown in Sequence ID No. 12. If the F537_K539>L mutation is present, six bases from position 237 to 242 will be deleted in the sequence shown in Sequence ID No. 12. If the K539L(TT) mutation is present, AA at positions 241 and 242 will be replaced with TT in the sequence shown in Sequence ID No. 12. In the case of the K539L(CT) mutation, the 241st and 242nd AA positions in the sequence shown in Sequence ID No. 12 are substituted with CT.

[0034] Furthermore, gene mutations associated with myeloproliferative neoplasms in MPL include the W515K mutation (where tryptophan at position 515 is replaced by lysine) and the W515L mutation (where tryptophan at position 515 is replaced by leucine). These MPL gene mutations are found in 3-5% of patients with essential thrombocythemia (ET) and in 6-10% of patients with primary myelofibrosis (PMF). The nucleotide sequence encoding wild-type MPL is shown in SEQ ID NO: 13. In the case of the W515K mutation, the TG at positions 305 and 306 in the nucleotide sequence shown in SEQ ID NO: 13 are replaced by AA. In the case of the W515L mutation, the G at position 306 in the nucleotide sequence shown in SEQ ID NO: 13 is replaced by T.

[0035] The gene mutation evaluation kit according to the present invention includes a probe set for identifying gene mutations present in each of these genes: JAK2, CALR, and MPL.

[0036] More specifically, for the V617F mutation in JAK2, an oligonucleotide containing, for example, CTCCACAGAaACATACTCC (SEQ ID NO: 14), which corresponds to the substitution mutation in SEQ ID NO: 11, can be used as a mutant probe. In the above sequence, the lowercase 'a' corresponds to the substitution mutation from G to T at position 351 in the nucleotide sequence shown in SEQ ID NO: 11. Alternatively, when identifying the V617F mutation in JAK2, a wild-type probe corresponding to wild-type JAK2 (a sequence in which the lowercase 'a' in the above sequence is replaced with 'c') can also be used. In other words, to identify the V617F mutation in JAK2, it is sufficient to use a mutant probe containing the nucleotide sequence of SEQ ID NO: 14, or a probe set consisting of the mutant probe and the wild-type probe may be used.

[0037] Furthermore, for the JAK2 N542_E543del mutation, an oligonucleotide containing CACAAAATCAGA-GATTTGATATTTG (SEQ ID NO: 15) can be used as a mutant probe. Note that the position of the hyphen in the above sequence corresponds to the six base deletions from position 250 to 255 in the nucleotide sequence shown in SEQ ID NO: 12. For the JAK2 E543_D544del mutation, an oligonucleotide containing CACAAAATCAGAAAT-TTGATATTTGT (SEQ ID NO: 16) can be used as a mutant probe. Note that the position of the hyphen in the above sequence corresponds to the six base deletions from position 253 to 258 in the nucleotide sequence shown in SEQ ID NO: 12. For the JAK2 R541_E543>K mutation, an oligonucleotide containing CACAAAATCA-AAGATTTGATATTTGT (SEQ ID NO: 17) can be used as a mutant probe. Note that the position of the hyphen in the above sequence corresponds to the six base deletions from position 248 to 253 in the nucleotide sequence shown in SEQ ID NO: 12. For the JAK2 F537_K539>L mutation, an oligonucleotide containing CCAAATGGTG-TTAATCAGAAATGAA (SEQ ID NO: 18) can be used as a mutant probe. The position of the hyphen in the above sequence corresponds to the six base deletions from position 237 to 242 in the base sequence shown in SEQ ID NO: 12. For the JAK2 K539L(TT) mutation, an oligonucleotide containing GGTGTTTCACttAATCAGAAATGA (SEQ ID NO: 19) can be used as a mutant probe. The lowercase tt in the above sequence corresponds to the AA at positions 241 and 242 in the base sequence shown in SEQ ID NO: 12. For the JAK2 K539L(CT) mutation, an oligonucleotide containing GTGTTTCACctAATCAGAAATGA (SEQ ID NO: 20) can be used as a mutant probe. The lowercase ct in the above sequence corresponds to the AA at positions 241 and 242 in the base sequence shown in SEQ ID NO: 12.

[0038] Furthermore, when identifying each mutation in exon 12 of JAK2 as described above, wild-type probes corresponding to the wild-type of each mutation can also be used. Here, since each of the above mutations is very close to or partially overlaps with one another, one wild-type probe can be used to represent them, or several wild-type probes can be used in combination. In the example described later, two wild-type probes were used: one centered on the N542_E543del mutation, the E543_D544del mutation, and the R541_E543>K mutation, and another centered on the F537_K539>L mutation.

[0039] Furthermore, for type 1 mutations in CALR, oligonucleotides containing, for example, CTCCTTGT-CCGCTCCTCGTC (sequence number 21), which corresponds to the 52-base deletion in sequence number 10, can be used as probes. In the above sequence, the position of the hyphen corresponds to the 52-base deletion from position 506 to 557 in the sequence shown in sequence number 10. In addition, when identifying type 1 mutations in CALR, a wild-type probe corresponding to wild-type CALR can also be used. That is, to identify type 1 mutations in CALR, a mutant probe containing the sequence of sequence number 21 can be used, or a probe set consisting of the mutant probe and the wild-type probe may be used.

[0040] Furthermore, for type 2 mutations in CALR, oligonucleotides containing, for example, ATCCTCCgacaaTTGTCCT (sequence number 22), which corresponds to the 5-base insertion in sequence number 10, can be used as probes. Note that in the above sequence, the lowercase letters gacaa represent the 5-base insertion. Alternatively, when identifying type 2 mutations in CALR, a wild-type probe corresponding to wild-type CALR can also be used. That is, to identify type 2 mutations in CALR, a mutant probe containing the base sequence of sequence number 22 can be used, or a probe set consisting of the mutant probe and the wild-type probe may be used.

[0041] Furthermore, for the W515K mutation in MPL, an oligonucleotide containing, for example, GAAACTGCttCCTCAGCA (SEQ ID NO: 23), which corresponds to the substitution mutation in SEQ ID NO: 13, can be used as a mutant probe. In the above sequence, the lowercase tt corresponds to the substitution mutation of TG at positions 305 and 306 to AA in the nucleotide sequence shown in SEQ ID NO: 13. Also, when identifying the W515K mutation in MPL, a wild-type probe corresponding to wild-type MPL (a sequence in which the lowercase tt in the above sequence is replaced with ca) can be used. In other words, to identify the W515K mutation in MPL, it is sufficient to use a mutant probe containing the nucleotide sequence of SEQ ID NO: 23, or a probe set consisting of the mutant probe and the wild-type probe may be used.

[0042] Furthermore, for the W515L mutation in MPL, an oligonucleotide containing, for example, GGAAACTGCAaCCTCAG (SEQ ID NO: 24), which corresponds to the substitution mutation in SEQ ID NO: 13, can be used as a mutant probe. In the above sequence, the lowercase 'a' corresponds to the substitution mutation of the 306th G to a T in the nucleotide sequence shown in SEQ ID NO: 13. Also, when identifying the W515L mutation in MPL, a wild-type probe corresponding to wild-type MPL (a sequence in which the lowercase 'a' in the above sequence is replaced with a 'c') can be used. In other words, to identify the W515L mutation in MPL, it is sufficient to use a mutant probe containing the nucleotide sequence of SEQ ID NO: 24, or a probe set consisting of the mutant probe and the wild-type probe may be used.

[0043] As described above, Sequence IDs 95, 53, 54, and 55 were exemplified as mismatched CARL mutant probes for identifying type 1, type 3, type 4, and / or type 5 mutations present in CARL. However, the nucleotide sequences of CARL mutant probes are not limited to Sequence IDs 95, 53, 54, and 55, and can be appropriately designed based on the nucleotide sequences of type 1 mutations shown in Sequence ID 57, type 3 mutations shown in Sequence ID 58, type 4 mutations shown in Sequence ID 59, and type 5 mutations shown in Sequence ID 60.

[0044] Furthermore, while examples of mutant probes for identifying gene mutations present in JAK2 were provided, the nucleotide sequences of the mutant probes are not limited to SEQ ID NOs. 14-20, but can be appropriately designed based on the JAK2 nucleotide sequences shown in SEQ ID NOs. 11 and 12. SEQ ID NOs. 21 and 22 were provided as examples of mutant probes for identifying type 1 and type 2 mutations present in CALR, respectively, but the nucleotide sequences of the mutant probes are not limited to SEQ ID NOs. 21 and 22, but can be appropriately designed based on the CALR nucleotide sequence shown in SEQ ID NO. 10. SEQ ID NOs. 23 and 24 were provided as examples of mutant probes for identifying gene mutations present in MPL, but the nucleotide sequences of the mutant probes are not limited to SEQ ID NOs. 13, but can be appropriately designed based on the MPL nucleotide sequence shown in SEQ ID NO. 13.

[0045] The base length of these probes is not particularly limited, but can be, for example, 10 to 30 bases, and preferably 15 to 25 bases. The probe can be, for example, 10 to 30 bases, and preferably 15 to 25 bases, by summing the base sequence designed based on the region containing the gene mutation in the base sequences of sequence numbers 10 to 13 and the base sequence added to one or both ends of said base sequence.

[0046] Furthermore, the probe designed as described above is preferably a nucleic acid, and more preferably DNA. DNA can be both double-stranded and single-stranded, but single-stranded DNA is preferred. The probe can be obtained, for example, by chemical synthesis using a nucleic acid synthesis apparatus. As the nucleic acid synthesis apparatus, devices such as DNA synthesizers, fully automated nucleic acid synthesizers, and automated nucleic acid synthesizers can be used.

[0047] The probes designed as described above are preferably used in the form of a microarray (for example, a DNA chip) by immobilizing their 5' ends on a carrier. In this case, it is preferable that the microarray has a mutant probe and a wild-type probe for each of the gene mutations described above. By using a mutant probe and a wild-type probe for each gene mutation, it is possible to accurately determine not only the presence or absence of a mutation but also the proportion of the mutation. Here, it is preferable that the mutant probe and the wild-type probe have a difference in length of 2 bases or less, and it is more preferable that they have the same length.

[0048] The microarray according to the present invention can be fabricated by fixing the above-described probes onto a carrier.

[0049] The material used for the support can be anything known in the art and is not particularly limited. For example, noble metals such as platinum, platinum black, gold, palladium, rhodium, silver, mercury, tungsten and their compounds, and conductive materials such as graphite and carbon fibers; silicon materials such as single-crystal silicon, amorphous silicon, silicon carbide, silicon oxide, and silicon nitride, and composite materials of these silicon materials such as SOI (silicon-on-insulator); inorganic materials such as glass, quartz glass, alumina, sapphire, ceramics, forsterite, and photosensitive glass; polyethylene, ethylene, and polypropylene. Examples of organic materials include cyclic polyolefins, polyisobutylene, polyethylene terephthalate, unsaturated polyesters, fluororesins, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resins, polyacrylonitrile, polystyrene, acetal resins, polycarbonate, polyamide, phenolic resins, urea resins, epoxy resins, melamine resins, styrene-acrylonitrile copolymers, acrylonitrile-butadiene styrene copolymers, polyphenylene oxide, and polysulfone. The shape of the carrier is not particularly limited, but it is preferably flat.

[0050] In the present invention, a support having a carbon layer and chemical modification groups on its surface is preferably used as the support. Supports having a carbon layer and chemical modification groups on their surface include those having a carbon layer and chemical modification groups on the surface of a substrate, and those having chemical modification groups on the surface of a substrate made of a carbon layer. The substrate material can be any material known in the art and is not particularly limited; the same materials as those listed above as support materials can be used.

[0051] In the microarray according to the present invention, a support having a fine, flat plate-like structure is preferably used. The shape is not limited to rectangular, square, or round, but typically a size of 1 to 75 mm square, preferably 1 to 10 mm square, and more preferably 3 to 5 mm square is used. Since it is easy to manufacture a support with a fine, flat plate-like structure, it is preferable to use a substrate made of silicon material or resin material, and in particular, a support having a carbon layer and chemical modification groups on the surface of a substrate made of single-crystal silicon is more preferable. Single-crystal silicon includes those in which the orientation of the crystal axis is slightly changed in parts (sometimes called mosaic crystals) and those containing disorder on an atomic scale (lattice defects).

[0052] In the present invention, the carbon layer formed on the substrate is not particularly limited, but it is preferable to use any of the following: synthetic diamond, high-pressure synthetic diamond, natural diamond, soft diamond (e.g., diamond-like carbon), amorphous carbon, carbon-based material (e.g., graphite, fullerene, carbon nanotube), a mixture thereof, or a laminate thereof. Carbides such as hafnium carbide, niobium carbide, silicon carbide, tantalum carbide, thorium carbide, titanium carbide, uranium carbide, tungsten carbide, zirconium carbide, molybdenum carbide, chromium carbide, vanadium carbide, etc. Here, soft diamond refers collectively to imperfect diamond structures that are mixtures of diamond and carbon, such as so-called diamond-like carbon (DLC), and the mixing ratio is not particularly limited. The carbon layer is advantageous in that it has excellent chemical stability and can withstand subsequent chemical modification group introduction and reactions during bonding with the analyte, the bonding with the analyte is flexible because it is done by electrostatic bonding, it is transparent to UV detection systems because it does not absorb UV, and it can conduct electricity during electroblotting. It is also advantageous in that it exhibits little nonspecific adsorption during bonding reactions with the analyte. As mentioned above, a support made of a carbon layer itself may also be used.

[0053] In the present invention, the carbon layer can be formed by known methods. Examples include microwave plasma CVD (Chemical vapor deposit), ECRCVD (Electric cyclotron resonance chemical vapor deposit), ICP (Inductive coupled plasma), DC sputtering, ECR (Electric cyclotron resonance) sputtering, ionization evaporation, arc evaporation, laser evaporation, EB (Electron beam) evaporation, and resistance heating evaporation.

[0054] In high-frequency plasma CVD, a glow discharge generated between electrodes by high frequency decomposes the raw material gas (methane) and synthesizes a carbon layer on the substrate. In ionization evaporation, thermionic electrons generated by a tungsten filament are used to decompose and ionize the raw material gas (benzene), and a carbon layer is formed on the substrate by a bias voltage. The carbon layer may also be formed by ionization evaporation in a mixed gas consisting of 1-99 volume% hydrogen gas and the remaining 99-1 volume% methane gas.

[0055] In arc evaporation, a DC voltage is applied between a solid graphite material (cathode evaporation source) and a vacuum vessel (anode) to induce an arc discharge in a vacuum, generating a plasma of carbon atoms from the cathode. By applying an even more negative bias voltage to the substrate than that applied to the evaporation source, carbon ions in the plasma are accelerated toward the substrate, forming a carbon layer.

[0056] In laser deposition, for example, a carbon layer can be formed by irradiating a graphite target plate with pulsed Nd:YAG laser light to melt it and deposit carbon atoms onto a glass substrate.

[0057] When forming a carbon layer on the surface of a substrate, the thickness of the carbon layer is usually about 100 μm for a single molecular layer. If it is too thin, the surface of the underlying substrate may be locally exposed, and if it is too thick, productivity will be poor. Therefore, it is preferably 2 nm to 1 μm, and more preferably 5 nm to 500 nm.

[0058] By introducing chemically modifying groups onto the surface of a substrate on which a carbon layer is formed, oligonucleotide probes can be firmly immobilized on a support. The chemically modifying groups to be introduced can be appropriately selected by those skilled in the art and are not particularly limited, but examples include amino groups, carboxyl groups, epoxy groups, formyl groups, hydroxyl groups, and active ester groups.

[0059] The introduction of amino groups can be carried out, for example, by irradiating the carbon layer with ultraviolet light in ammonia gas or by plasma treatment. Alternatively, it can be carried out by chlorinating the carbon layer with ultraviolet light in chlorine gas, and then irradiating it with ultraviolet light again in ammonia gas. Alternatively, it can be carried out by reacting the chlorinated carbon layer with polyhydric amine gases such as methylenediamine and ethylenediamine.

[0060] The introduction of carboxyl groups can be carried out, for example, by reacting a suitable compound with the aminated carbon layer as described above. Compounds used to introduce carboxyl groups include, for example, halocarboxylic acids represented by the formula: X-R1-COOH (wherein X is a halogen atom and R1 is a divalent hydrocarbon group having 10 to 12 carbon atoms), such as chloroacetic acid, fluoroacetic acid, bromoacetic acid, iodoacetic acid, 2-chloropropionic acid, 3-chloropropionic acid, 3-chloroacrylic acid, and 4-chlorobenzoic acid; dicarboxylic acids represented by the formula: HOOC-R2-COOH (wherein R2 is a single bond or a divalent hydrocarbon group having 1 to 12 carbon atoms), such as oxalic acid, malonic acid, succinic acid, maleic acid, fumaric acid, and phthalic acid; and polyacrylic acid and polymethacrylate. Examples include acids, polycarboxylic acids such as trimellitic acid and butanetetracarboxylic acid; keto acids or aldehyde acids represented by the formula: R3-CO-R4-COOH (wherein R3 represents a hydrogen atom or a divalent hydrocarbon group having 1 to 12 carbon atoms, and R4 represents a divalent hydrocarbon group having 1 to 12 carbon atoms); monohalides of dicarboxylic acids represented by the formula: X-OC-R5-COOH (wherein X represents a halogen atom and R5 represents a single bond or a divalent hydrocarbon group having 1 to 12 carbon atoms), such as succinic acid monolide and malonic acid monolide; and acid anhydrides such as phthalic anhydride, succinic anhydride, oxalic anhydride, maleic anhydride, and butanetetracarboxylic anhydride.

[0061] The introduction of epoxy groups can be carried out, for example, by reacting a suitable polyvalent epoxy compound with the aminated carbon layer as described above. Alternatively, it can be obtained by reacting an organic peracid with the carbon-carbon double bonds contained in the carbon layer. Examples of organic peracids include peracetic acid, perbenzoic acid, diperoxyphthalic acid, performic acid, and trifluoroperacetic acid.

[0062] The introduction of the formyl group can be carried out, for example, by reacting glutaraldehyde with the aminated carbon layer as described above.

[0063] The introduction of hydroxyl groups can be carried out, for example, by reacting water with the chlorinated carbon layer as described above.

[0064] Active ester groups refer to esters that have a highly acidic electron-withdrawing group on the alcohol side of the ester group, thereby activating nucleophilic reactions; in other words, ester groups with high reactive activity. These are ester groups that have an electron-withdrawing group on the alcohol side of the ester group and are more active than alkyl esters. Active ester groups are reactive with groups such as amino groups, thiol groups, and hydroxyl groups. More specifically, phenol esters, thiophenol esters, N-hydroxyamine esters, cyanomethyl esters, and esters of heterocyclic hydroxy compounds are known to be active ester groups that have much higher activity than alkyl esters, etc. More specifically, examples of active ester groups include p-nitrophenyl group, N-hydroxysuccinimide group, succinimide group, phthalimide group, and 5-norbornene-2,3-dicarboximide group, with N-hydroxysuccinimide group being particularly preferred.

[0065] The introduction of an active ester group can be carried out, for example, by activating the carboxyl group introduced as described above with a dehydration condensation agent such as cyanamide or carbodiimide (e.g., 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide) and a compound such as N-hydroxysuccinimide. This process makes it possible to form a group in which an active ester group such as an N-hydroxysuccinimide group is bonded to the terminal of the hydrocarbon group via an amide bond (Japanese Patent Application Publication No. 2001-139532).

[0066] A microarray with probes immobilized on a carrier can be manufactured by dissolving the probes in a spotting buffer to prepare a spotting solution, dispensing this solution into a 96-well or 384-well plastic plate, and then spotting the dispensed solution onto the carrier using a spotting device or the like. Alternatively, the spotting solution may be manually spotted using a micropipette.

[0067] After spotting, incubation is preferable to allow the reaction in which the probe binds to the support to proceed. Incubation is usually carried out at a temperature of -20 to 100°C, preferably 0 to 90°C, for 0.5 to 16 hours, preferably 1 to 2 hours. Incubation is preferably carried out in a high-humidity atmosphere, for example, under conditions of 50 to 90% humidity. Following incubation, it is preferable to wash with a washing solution (e.g., 50 mM TBS / 0.05% Tween20, 2×SSC / 0.2% SDS solution, ultrapure water, etc.) to remove DNA that has not bound to the support.

[0068] By using a microarray configured as described above, it is possible to simultaneously determine the presence or absence of the above-mentioned gene mutations in JAK2, CALR, and MPL in the person being diagnosed.

[0069] Specifically, when determining the presence or absence of the above-mentioned gene mutations in JAK2, CALR, and MPL, the procedure includes the steps of: extracting DNA from a sample derived from the person to be diagnosed; using the extracted DNA as a template, amplifying the region containing the above-mentioned gene mutation in JAK2 (the region containing the V617F mutation site in JAK2, the region containing the gene mutation in exon 12), the region containing the above-mentioned gene mutation in CALR, and the region containing the above-mentioned gene mutation in MPL; and using the above-mentioned microarray, detecting the presence or absence of the above-mentioned gene mutations in JAK2, CALR, and MPL contained in the amplified nucleic acid.

[0070] The subjects of this diagnosis are typically human, and are not particularly limited by race, but are especially preferred to be of East Asian descent, and particularly preferred to be Japanese. In addition, patients suspected of having myeloproliferative neoplasms may also be included as subjects of this diagnosis.

[0071] There are no particular restrictions on the type of sample derived from the person being diagnosed. Examples include blood-related samples (blood, serum, plasma, etc.), lymph fluid, feces, cancer cells, tissue or organ fragments and extracts.

[0072] First, DNA is extracted from the sample taken from the person to be diagnosed. The extraction method is not particularly limited. For example, DNA extraction methods using phenol / chloroform, ethanol, sodium hydroxide, CTAB, etc., can be used.

[0073] Next, the obtained DNA is used as a template to perform an amplification reaction, amplifying the region containing JAK2 (the region containing the V617F mutation site of JAK2, the region containing the gene mutation in exon 12), the region containing CALR, and the region containing MPL. For the amplification reaction, polymerase chain reaction (PCR), LAMP (Loop-Mediated Isothermal Amplification), ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids), etc., can be applied. In the amplification reaction, it is desirable to add a label so that the amplified region can be identified. At this time, there are no particular limitations on the method of labeling the amplified nucleic acid, but for example, a method of pre-labeling the primers used in the amplification reaction may be used, or a method of using labeled nucleotides as substrates in the amplification reaction may be used. There are no particular limitations on the labeling substance, but radioisotopes, fluorescent dyes, or organic compounds such as digoxigenin (DIG) or biotin can be used.

[0074] Furthermore, this reaction system includes buffers necessary for nucleic acid amplification and labeling, heat-resistant DNA polymerase, primers specific to the amplification region, labeled nucleotide triphosphates (specifically, nucleotide triphosphates to which fluorescent labeling has been added, etc.), nucleotide triphosphates, and magnesium chloride.

[0075] The gene mutation evaluation kit according to the present invention may include a primer set for amplifying regions containing type 1, type 3, type 4, and type 5 mutations present in CALR, i.e., regions containing deletion sites (arrows in Figure 1). Here, a primer set means a pair of primers consisting of a forward primer and a reverse primer.

[0076] The region containing the deletion site, amplified using the primer set, is detected by the CARL mutant probes with the aforementioned mismatch (e.g., SEQ ID NOs. 95, 53, 54, and 55). As shown in Figure 1, type 1, type 3, type 4, and type 5 mutants have the same sequence as the wild type (underlined in the middle of Figure 1) on the 3' side of the deletion site. Therefore, if probes designed to perfectly match type 1, type 3, type 4, and type 5 mutants, including the deletion site, were used, there is a possibility of non-specific hybridization even with wild-type samples.

[0077] In contrast, when CARL variant probes (e.g., SEQ ID NOs. 95, 53, 54, and 55) are used as described above, the possibility of nonspecific hybridization with the wild type can be reduced due to the presence of this mismatch. Therefore, by using the gene mutation evaluation kit according to the present invention, wild-type samples and samples with type 1 mutations can be reliably distinguished and detected. Furthermore, by using the gene mutation evaluation kit according to the present invention, wild-type samples and samples with type 3 mutations can be reliably distinguished and detected. Furthermore, by using the gene mutation evaluation kit according to the present invention, wild-type samples and samples with type 4 mutations can be reliably distinguished and detected.

[0078] The above description explains the design of CARL mutant probes with mismatches for detecting type 1, type 3, type 4, and type 5 mutations present in CARL. However, mutant probes can be designed similarly for mutations other than those in the CARL gene. For example, mutant probes can be designed similarly for deletion mutations exceeding a predetermined length where the sequence after the deletion is similar to the wild-type sequence. More specifically, for deletion mutations of 5 nucleotides or longer, preferably 10 nucleotides or longer, or deletion mutations longer than the suitable nucleotide length for a probe, where there is a sequence within 10 nucleotides containing the deletion site in the wild-type nucleotide sequence that matches the sequence after the deletion by 2 nucleotides or more, a mutant probe can be designed so that a portion of the matching sequence is a mismatch.

[0079] Furthermore, in the CARL mutant probes with mismatches for detecting type 1, type 3, type 4, and type 5 mutations present in CARL, a sequence matching the post-deletion sequence was found 5' from the deletion site in the wild-type nucleotide sequence. Therefore, a mutant probe with a mismatch 3' from the deletion site was designed. Conversely, in the case of a mutant where a sequence matching the post-deletion sequence is 3' from the deletion site in the wild-type nucleotide sequence, the mutant probe can be designed by setting the mismatch 5' from the deletion site.

[0080] Incidentally, the gene mutation evaluation kit according to the present invention may include, as a primer set for amplifying the region containing the gene mutation in JAK2, a V617F mutation primer set for amplifying the region containing the V617F mutation, and an exon 12 primer set for amplifying the region containing the gene mutation located in exon 12 of the JAK2 gene.

[0081] The primer set for the V617F mutation is not particularly limited as long as it can specifically amplify the region encoding the amino acid corresponding to valine at position 617 in the wild type, and can be appropriately designed by those skilled in the art. For example, An example is a set consisting of a forward primer JAK2-F:5'-GAGCAAGCTTTCTCACAAGCATTTGG-3' (SEQ ID NO: 25) and a reverse primer JAK2-R:5'-CTGACACCTAGCTGTGATCCTGAAACTG-3' (SEQ ID NO: 26).

[0082] Here, when amplifying the region containing the V617F mutation using the V617F mutation primer set, it is preferable to set the concentration of one of the V617F mutation primers, for example, the fluorescently labeled primer (e.g., the forward primer), to 1.0 μM or higher. By setting the primer concentration within this range, the region containing the V617F mutation and the region containing the gene mutation located in exon 12 can be amplified well. The upper limit of the primer concentration is not particularly limited and can be the upper limit of the primer concentration in a normal nucleic acid amplification reaction (e.g., 10 μM).

[0083] On the other hand, the primer set for exon 12 is preferably designed to amplify at least two, preferably three, more preferably four, even more preferably five, and most preferably six of the multiple gene mutations contained in exon 12 as described above. More specifically, as shown in Figure 3, the primer set for exon 12 can consist of a forward primer for exon 12 having a length of 10 or more consecutive bases selected from the base sequence shown in Sequence ID No. 1, and a reverse primer for exon 12 having a length of 10 or more consecutive bases selected from the base sequence shown in Sequence ID No. 2. Here, Sequence ID No. 1 is from position 178 to 228 of the base sequence encoding exon 12, and Sequence ID No. 2 is from position 399 to 435. Both are partial sequences within Sequence ID No. 12, and all six of the gene mutations described above are contained between them.

[0084] More specifically, the exon 12 forward primer can be one primer selected from the group consisting of exon 12 forward primer F1 having the nucleotide sequence shown in SEQ ID NO: 3, exon 12 forward primer F3 having the nucleotide sequence shown in SEQ ID NO: 4, exon 12 forward primer F4 having the nucleotide sequence shown in SEQ ID NO: 5, and exon 12 forward primer F5 having the nucleotide sequence shown in SEQ ID NO: 6.

[0085] Specifically, the reverse primer for exon 12 can be one primer selected from the group consisting of exon 12 reverse primer R1 having the nucleotide sequence shown in SEQ ID NO: 7, exon 12 reverse primer R2 having the nucleotide sequence shown in SEQ ID NO: 8, and exon 12 reverse primer R3 having the nucleotide sequence shown in SEQ ID NO: 9.

[0086] In particular, the primer set for exon 12 is more preferably a combination of exon 12 forward primer F5, which consists of the nucleotide sequence shown in SEQ ID NO: 6, and exon 12 reverse primer R2, which consists of the nucleotide sequence shown in SEQ ID NO: 8.

[0087] The nucleotide sequences of the forward primers F1, F3-F5, and reverse primers R1-R3 described above are represented by their corresponding positions on the nucleotide sequence encoding exon 12. Therefore, either the forward or reverse primer constituting the primer set will be the complementary strand of the nucleotide sequence indicated by the sequence number. In all the examples described later, the reverse side is prepared using the complementary strand.

[0088] Here, when amplifying the region containing the gene mutation in exon 12 using the exon 12 primer set, it is preferable to set the concentration of one of the exon 12 primers, for example, the fluorescently labeled primer (e.g., the reverse primer), to 2.5 μM or higher. By setting the primer concentration within this range, the region containing the V617F mutation and the region containing the gene mutation present in exon 12 can be amplified effectively. The upper limit of the primer concentration is not particularly limited and can be the upper limit of the primer concentration in a normal nucleic acid amplification reaction (e.g., 10 μM).

[0089] While not limited to Exon 12, the forward and reverse concentrations in a primer set may be the same or different. If they are different, it is sufficient that at least one of them satisfies the above concentration conditions. In the examples described later, the concentration of the fluorescently labeled primer is set higher in all primer sets for JAK2 V617F, Exon 12, CALR, and MPL.

[0090] Furthermore, it is preferable that the concentration ratio of the labeled primer in the V617F mutation primer set to the labeled primer in the exon 12 primer set [exon 12 primer concentration] / [V617F mutation primer concentration] be 1.0 to 5.5. By setting the concentration ratio within this range, the region containing the V617F mutation and the region containing the gene mutation located in exon 12 can be amplified effectively.

[0091] The primers used in the amplification reaction of the region containing the above-mentioned gene mutation in CALR are not particularly limited as long as they can specifically amplify the region containing the above-mentioned gene mutation, and can be appropriately designed by those skilled in the art. For example, A set of primers consisting of primer CALR-F:5'-CGTAACAAAGGTGAGGCCTGGT-3' (SEQ ID NO: 27) and primer CALR-R:5'-GGCCTCTCTACAGCTCGTCCTTG-3' (SEQ ID NO: 28) is an example.

[0092] The primers used in the amplification reaction of the region containing the above-mentioned gene mutation in MPL are not particularly limited as long as they can specifically amplify the region containing the above-mentioned gene mutation, and can be appropriately designed by those skilled in the art. For example, A set of primers consisting of primer MPL-F:5'-CTCCTAGCCTGGATCTCCTTGG-3' (SEQ ID NO: 29) and primer MPL-R:5'-ACAGAGCGAACCAAGAATGCCTGTTTAC-3' (SEQ ID NO: 30) is an example.

[0093] Furthermore, the nucleic acid fragment amplified by the primer is not particularly limited as long as it contains the region corresponding to the designed probe, for example, preferably 1 kbp or less, more preferably 800 bp or less, even more preferably 500 bp or less, and particularly preferably 350 bp or less.

[0094] By performing a hybridization reaction between the amplified nucleic acid obtained as described above and a probe immobilized on a carrier, and detecting the hybridization of the amplified nucleic acid to the mutant probe, the presence or absence of the above gene mutation in the subject can be evaluated. In other words, the hybridization of the amplified nucleic acid to the mutant probe can be measured, for example, by detecting a label.

[0095] The signal from the label can be quantified by detecting the fluorescent signal using a fluorescence scanner (for example, when a fluorescent label is used) and analyzing it with image analysis software. The hybridization reaction is preferably carried out under stringent conditions. Stringent conditions refer to conditions in which a specific hybrid is formed and a nonspecific hybrid is not formed. For example, this refers to conditions in which the hybridization reaction is carried out at 50°C for 16 hours, followed by washing with 2×SSC / 0.2% SDS at 25°C for 10 minutes and 2×SSC at 25°C for 5 minutes. Alternatively, the hybridization temperature can be 45-60°C when the salt concentration is 0.5×SSC. It is more preferable to set the hybridization temperature lower than this when the probe chain length is short, and higher when the chain length is long. It goes without saying that the specific hybridization temperature increases as the salt concentration increases, and conversely, the specific hybridization temperature decreases as the salt concentration decreases.

[0096] Furthermore, when using a microarray equipped with both a mutant probe and a wild-type probe for each of the aforementioned gene mutations, the presence or absence of the gene mutation can be evaluated using the signal intensities from these mutant and wild-type probes. Specifically, the signal intensities from the wild-type probe and the mutant probe are measured, and a judgment value is calculated to evaluate the signal intensity derived from the mutant probe. An example of calculating the judgment value is to use the formula: [Signal intensity from mutant probe] / ([Signal intensity from wild-type probe]+[Signal intensity from mutant probe]).

[0097] Then, the judgment value calculated using the above formula is compared with a predetermined threshold (cutoff value). If the judgment value exceeds the threshold, it is determined that the amplified nucleic acid contains the above gene mutation; if the judgment value falls below the threshold, it is determined that the amplified nucleic acid does not contain the above gene mutation. By using this judgment value, it is possible to determine the presence or absence of each gene mutation in JAK2, CALR, and MPL as described above.

[0098] Here, the threshold is not particularly limited, but for example, it can be defined based on the judgment value calculated by the above formula using a sample in which the aforementioned gene mutations present in JAK2, CALR, and MPL have been confirmed to be wild-type. More specifically, multiple judgment values ​​can be calculated using multiple samples in which the aforementioned gene mutations present in JAK2, CALR, and MPL have been confirmed to be wild-type, and the value of the mean + 3σ (σ: standard deviation) can be used as the threshold. Note that the value of mean + 2σ or mean + σ can also be used as the threshold.

[0099] As described above, by using a microarray equipped with mutant probes to identify each gene mutation present in JAK2, CALR, and MPL, it is possible to simultaneously identify each gene mutation present in JAK2, CALR, and MPL. Information on each gene mutation present in JAK2, CALR, and MPL can be used, for example, in the diagnosis of myeloproliferative neoplasms according to the WHO classification (2016 version). In detail, according to the WHO classification, the presence of the above gene mutation in JAK2 is one of the requirements for the diagnosis of polycythemia vera (PV). Also, according to the WHO classification, the presence of any of the gene mutations present in JAK2, CALR, and MPL is one of the requirements for the diagnosis of essential thrombocythemia (ET). Furthermore, according to the WHO classification, one of the requirements for diagnosing prefibrotic / early primary myelofibrosis (prefibrotic / early PMF) or primary myelofibrosis (PMF) is the presence of a gene mutation in JAK2, CALR, or MPL.

[0100] Thus, for example, microarrays equipped with mutant probes to identify mutations in the JAK2, CALR, and MPL genes can be used to diagnose myeloproliferative neoplasms using the WHO classification (2016 version). [Examples]

[0101] The present invention will be described in more detail below with reference to examples, but the technical scope of the present invention is not limited thereto.

[0102] [Example 1] 1. Sample preparation In this example, genomic DNA derived from the peripheral blood of a healthy individual (manufactured by Biochain) was used as the wild-type sample. In this example, in order to detect the gene mutations shown in Table 1, the target regions (4 locations) containing the gene mutations were each amplified.

[0103] [Table 1]

[0104] In this example, the primers shown in Table 2 were designed to amplify the four target regions shown in Table 1. Note that exon12-F is F5, and exon12-R is the complementary strand of R2.

[0105] [Table 2]

[0106] Using the DNA samples prepared as described above, four target regions of the JAK2, CALR, and MPL genes were amplified by PCR. For PCR, the template genomic DNA was either 8 or 16 ng / μL. The reaction mixture composition is shown in Table 3.

[0107] [Table 3]

[0108] Then, the PCR thermal cycling was performed at 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 59°C for 30 seconds, and 72°C for 45 seconds, after which it was maintained at 72°C for 10 minutes, and finally at 4°C.

[0109] 2. Microarrays In this example, mutant probes corresponding to the V617F mutation in the JAK2 gene, six gene mutations in exon 12, type 1 to type 5 mutations in the CALR gene, and the W515L / K mutation in the MPL gene, as well as their corresponding wild-type probes, were designed. The nucleotide sequences of each probe are summarized in Table 4.

[0110] [Table 4]

[0111] 3. Identification of gene mutations Hybridization was performed using the chip equipped with the above probe as follows. First, a humidification chamber was placed in a chamber set to a specified temperature (52°C), and both the chamber and the humidification chamber were thoroughly preheated. 4 μL of PCR reaction solution and 2 μL of hybridization buffer (2.25 × SSC / 0.23% SDS / 0.2 nM IC5 labeled oligoDNA (manufactured by Life Technologies Japan)) were mixed. 3 μL of this solution was taken and dropped onto the central protrusion of the hybridization cover, which was then placed over the chip, and the reaction was carried out for 1 hour in a hybridization chamber apparatus (manufactured by Toyo Kohan Co., Ltd.) set to 52°C. After the hybridization reaction was complete, the chip with the hybridization cover removed was set in the holder, and the stainless steel holder for washing was immersed in a 0.1 × SSC / 0.1% SDS solution. After vibrating it up and down several times, the holder was immersed in a 1 × SSC solution (room temperature) until the fluorescence intensity of the chip was detected.

[0112] Immediately before detection, a cover film was placed over the chip, and the fluorescence intensity of the chip was detected using BIOSHOT (manufactured by Toyo Kohan). Using the fluorescence intensities of the wild-type and mutant probes measured as described above, the determination values ​​for the JAK2 gene mutations (V617F mutation and six gene mutations contained in exon 12), the CALR gene mutations, and the MPL gene mutations were calculated using the following formulas. Judgment value = [Fluorescence intensity of mutant probe] / ([Fluorescence intensity of wild-type probe] + [Fluorescence intensity of mutant probe])

[0113] [Experimental Example 1-1] In this experiment, we designed and evaluated multiple CARL mutant probes to detect type 3, type 4, or type 5 deletion mutations present in CARL. Specifically, for each type 3, type 4, or type 5 mutation, we designed multiple CARL mutant probes that perfectly matched the region containing the deletion site (arrow in Figure 1), as well as multiple CARL mutant probes that had a mismatch in that region (Table 5). The probes that were actually constructed had a linker (a continuous T segment) attached to the 5'-side of the complementary strand of the designed sequence.

[0114] [Table 5]

[0115] In this experiment, the fluorescence intensity for the mutant model sample (100% mutant plasmid) and the wild-type model sample (plasmid) was measured using each probe shown in Table 5. The results are shown in Table 6. In Table 6, "Specific fluorescence intensity*1" is the fluorescence intensity for the mutant model sample, and "Non-specific fluorescence intensity*2" is the fluorescence intensity for the wild-type model sample.

[0116] [Table 6]

[0117] As shown in Table 6, probes with a deletion mismatch at a predetermined position were found to have high specific fluorescence intensity*1 and low nonspecific fluorescence intensity*2, and were found to be able to specifically hybridize to mutant samples. As shown in Table 6, we were able to design probes that can hybridize very specifically to mutant samples with a specific fluorescence intensity*1 of 10,000 or more and a nonspecific fluorescence intensity*2 of 1,000 or less. Furthermore, among the designed mutant probes, we were able to design probes that can hybridize very specifically to mutant samples with a specific fluorescence intensity*1 of 15,000 or more and a nonspecific fluorescence intensity*2 of 500 or less (e.g., type 3 mutant probe 5, type 4 mutant probe 5, type 4 mutant probe 7, type 5 mutant probe 4, and type 5 mutant probe 5). Of the type 4 mutant probes 5 and 7, which are probes for identifying type 4 mutations, type 4 mutant probe 5 is preferable due to its high specific fluorescence intensity*1. Furthermore, of the two probes for identifying type 5 mutations, type 5 mutation probe 4 is preferred due to its higher specific fluorescence intensity*1.

[0118] Furthermore, the fluorescence intensity for each mutant model sample (Type 1 mutant model plasmid, Type 2 mutant model plasmid, Type 3 mutant model plasmid, Type 4 mutant model plasmid, and Type 5 mutant model plasmid) and the fluorescence intensity for the wild-type model sample (plasmid) were measured using the probes shown in Table 5. The results are shown in Table 7.

[0119] [Table 7]

[0120] As shown in Table 7, it was revealed that probes with deletion-type mismatches at predetermined positions can specifically detect each mutation type. Figure 2 summarizes the results obtained using type 3 mutation probe 5, type 4 mutation probe 5, and type 5 mutation probe 4 from the results shown in Table 7. The actual probe sequences produced for type 3 mutation probe 5, type 4 mutation probe 5, and type 5 mutation probe 4 are shown in Table 4. Figure 2 also includes the results obtained using type 1 mutation probe 7 (the actual probe sequence is shown in Table 4) from Experimental Example 1-2, which will be described later.

[0121] [Experimental Example 1-2] In this experiment, we designed and evaluated multiple CARL mutant probes to detect type 1 mutations, which are deletion-type gene mutations present in CARL. Specifically, for type 1 mutations, we designed multiple CARL mutant probes that perfectly matched the region containing the deletion site (arrow in Figure 1), and multiple CARL mutant probes that had a mismatch in that region (Table 8). The probes that were actually constructed had a linker (a continuous T segment) attached to the 5'-side of the complementary strand of the designed sequence.

[0122] [Table 8]

[0123] In this experiment, the fluorescence intensity for the mutant model sample (5% mutant plasmid) and the wild-type model sample (plasmid) was measured using each probe shown in Table 8. The results are shown in Table 9. In Table 9, "Specific fluorescence intensity*1" is the fluorescence intensity for the mutant model sample, and "Non-specific fluorescence intensity*2" is the fluorescence intensity for the wild-type model sample.

[0124] [Table 9]

[0125] As shown in Table 9, it was revealed that probes with a deletion-type mismatch at a predetermined position can specifically hybridize to mutant samples with high specific fluorescence intensity*1 and low nonspecific fluorescence intensity*2. As shown in Table 9, we were able to design a probe that can hybridize very specifically to mutant samples with a specific fluorescence intensity*1 of 15000 or more and a nonspecific fluorescence intensity*2 of 3000 or less (type 1 mutant probe 7).

[0126] [Experimental Example 2] In this experiment, multiple primer sets were designed and evaluated to amplify the region containing six gene mutations in exon 12 of JAK2. The designed primer sets are shown in Figure 3. In this example, the primer sets shown in Table 10 below were evaluated. F1-F5 and R1-R3 in Table 10 correspond to Figure 1. As shown in Figure 3, forward primers F1, F3-F5 are within the range of the nucleotide sequence shown in SEQ ID NO: 1, while forward primer F2 was designed to be outside that range (SEQ ID NO: 52). In Experiment Example 1 and Experiment Example 2 described later, wild-type peripheral blood genomic DNA from healthy individuals was used as the sample, and evaluation was performed using the fluorescence intensity of the wild-type probe.

[0127] [Table 10]

[0128] The results are shown in Figure 4. As can be seen from Figure 4, it was found that when using any of the primer sets designed in this example, except for primer set 2 which uses F2, excellent fluorescence intensity could be achieved for all amplified fragments. Of these sets, primer sets 1, 4, and 5, which have high fluorescence intensity overall, are preferred, and primer sets 1 and 5, which have relatively small intensity differences between each analysis target region, are even more preferred. In the following evaluation, primer set 5 (combination of F5 and R2) was adopted as shown in Table 2.

[0129] [Experimental Example 3] Figures 5 and 6 show characteristic plots with the primer concentration in the primer mix mixed with the PCR reaction solution and the concentration of the labeled primer (forward primer) from the primer set that amplifies the region containing the V617F mutation site on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis. Figures 7 and 8 also show characteristic plots with the primer concentration in the primer mix mixed with the PCR reaction solution and the concentration of the labeled primer (reverse primer) from the primer set that amplifies JAK2 exon 12 on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis.

[0130] As can be seen in Figure 5, when the concentration of one labeled primer in the primer set that amplifies the region containing the V617F mutation site was 0.5 μM, a fluorescence intensity of 12000 or higher could not be achieved. Furthermore, as can be seen in Figure 6, even when the concentration of one labeled primer in the primer set that amplifies the region containing the V617F mutation site was 2.5 μM, a fluorescence intensity of 12000 or higher could not be achieved when the concentration of one labeled primer in the primer set that amplifies exon 12 was 2.0 μM.

[0131] On the other hand, as can be seen from Figure 7, even when the concentration of one labeled primer in the primer set that amplifies exon 12 was 3.0-4.0 μM, a fluorescence intensity of 12000 or higher could not be achieved when the concentration of one labeled primer in the primer set that amplifies the region containing the V617F mutation was 0.5 μM. Furthermore, as can be seen from Figure 8, a fluorescence intensity of 12000 or higher could be achieved when the concentration of one labeled primer in the primer set that amplifies the region containing the V617F mutation was 1.0 μM or higher, and the concentration of one labeled primer in the primer set that amplifies exon 12 was 2.5 μM or higher.

[0132] Figure 9 shows a characteristic plot in the primer mix mixed with the PCR reaction solution, with the concentration of the primers, the concentration ratio of the labeled primer (reverse primer) in the primer set that amplifies exon 12 to the labeled primer (forward primer) in the primer set that amplifies the region containing the V617F mutation site on the x-axis, and the fluorescence intensity derived from the four amplified regions on the y-axis. As can be seen from Figure 9, when the above concentration ratio was in the range of 1.0 to 5.5, a fluorescence intensity of 12000 or more was achieved for all amplified fragments.

[0133] [Example 2] In this example, for the mutation model sample, an artificial gene (plasmid) containing either the wild-type or mutant sequence of the gene region to be analyzed was constructed, and a mixture of the wild-type and mutant artificial genes was used. PCR for mutation detection was performed using the reaction mixture composition shown in Table 11.

[0134] [Table 11]

[0135] In this example, blocker oligo DNA shown in Table 12 was added to the PCR reaction solution. The blocker is added to suppress nonspecific hybridization of the mutation detection probe, so that sufficient detection sensitivity can be obtained even when the mutation rate of the target gene is small. It is designed to specifically hybridize with amplification products derived from the wild type.

[0136] [Table 12]

[0137] In this example, wild-type samples (n=9) in which all target gene regions were wild-type, and mutant model samples (n=3) in which some of the target regions were mutant, were used, with the proportion of mutant model samples set to 1% or 5%. The results are shown in Figure 10. The error bars in Figure 10 represent 5σ.

[0138] As shown in Figure 10, it became clear that all 1% or 5% of gene mutations could be identified.

Claims

[Claim 1] A CALR mutation-type probe is provided for evaluating gene mutations associated with myeloproliferative neoplasms, comprising a CALR mutation-type probe that corresponds to at least one gene mutation selected from the group consisting of a 52-base deletion type 1 mutation in which 52 bases from positions 506 to 557 are deleted in the wild-type CALR gene sequence shown in Sequence ID No. 10, a 46-base deletion type 3 mutation in which 46 bases from positions 509 to 554 are deleted in the same sequence, a 34-base deletion type 4 mutation in which 34 bases from positions 516 to 549 are deleted in the same sequence, and a 52-base deletion type 5 mutation in which 52 bases from positions 505 to 556 are deleted in the same sequence. The CALR variant probe described above is a gene mutation evaluation kit characterized by having a mismatch due to an artificial deletion.

Images