Novel micropeptide HMBJ and its use
The novel micropeptide HMBJ, encoded by lncRNA ENSG00000272654, addresses the lack of effective treatments for organ fibrosis by demonstrating inhibitory effects on fibrosis markers, offering therapeutic and diagnostic solutions for liver, kidney, and lung fibrosis.
Patent Information
- Application Number
- JP2025567371
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-15
- Filing Date
- 2024-05-15
- Publication Date
- 2026-05-20
AI Technical Summary
Current research lacks effective micropeptides for diagnosing and treating organ fibrosis, a condition characterized by excessive fibrous connective tissue in organs, which can lead to organ failure and malignant tumors.
Identification and utilization of a novel micropeptide HMBJ encoded by the lncRNA ENSG00000272654, which exhibits low expression in organ fibrotic cells, and its use in recombinant vectors and pharmaceutical compositions for therapeutic and diagnostic applications.
The novel micropeptide HMBJ demonstrates significant inhibitory effects on organ fibrosis markers, providing a new therapeutic approach for liver, kidney, and lung fibrosis, expanding the treatment spectrum for organ fibrosis drugs.
Smart Images

Figure 2026516285000001_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of biomedicine, specifically relating to a novel micropeptide HMBJ, a lncRNA and / or ORF encoding the novel micropeptide HMBJ, and its use in the diagnosis or auxiliary diagnosis, treatment or auxiliary treatment of multiple organ fibroses.
Background Art
[0002] Long non-coding RNA (lncRNA) refers to a functional RNA molecule composed of more than 200 nucleotides and considered untranslatable into protein. Existing related studies suggest that lncRNA plays an important role in epigenetic regulation, cell cycle regulation and differentiation regulation, and is involved in major human diseases that have an adverse impact on health, including cancer and neurodegenerative diseases. With the rapid development of molecular biology, computational biology and deep sequencing technologies, atypical short open reading frames (ORFs) hidden in long non-coding RNAs that have not been annotated so far actually play a role in encoding functional proteins. Micropeptide is a type of translation product encoded by short open reading frames (sORFs) and within the range of 2 to 100 codons in length.
[0003] Organ Fibrosis refers to fibrotic diseases occurring in multiple organs. The main pathological changes are the increase of fibrous connective tissue in organ tissues and the decrease of parenchymal cells. The persistence of fibrotic lesions in organs may further destroy the structure and function of organs and induce organ failure and malignant tumors. This is regarded as a tumor-like lesion with intermediate properties between benign and malignant, posing a serious threat to human health and life.
[0004] Knowledge and research on micropeptides related to organ fibrosis are of paramount importance in developing novel and effective disease diagnoses and treatments, and provide valuable reference and developmental insights for exploring new application fields. However, at present, there are no reports on micropeptides in the field of organ fibrosis research. [Overview of the project]
[0005] 1. Purpose of the Invention The first object of this application is to provide an lncRNA and its nucleotide sequence that exhibits low expression in organ fibrotic cells and / or tissues.
[0006] A second object of this application is to provide an ORF and its nucleotide sequence, which is located within the above-mentioned lncRNA and can be obtained by encoding a novel micropeptide HMBJ.
[0007] The third objective of this application is to provide a novel micropeptide HMBJ, which is a novel human endogenous polypeptide discovered for the first time, and its amino acid sequence.
[0008] A fourth object of this application is to provide the use of the above-mentioned lncRNA in the preparation of reagents for diagnosing or adjunctally diagnosing organ fibrosis, and / or in the preparation of drugs for treating or adjunctally treating organ fibrosis.
[0009] A fifth object of this application is to provide the use of the ORF sequence within the above-mentioned lncRNA in the preparation of reagents for diagnosing or adjunctally diagnosing organ fibrosis, and / or in the preparation of drugs for treating or adjunctally treating organ fibrosis.
[0010] A sixth object of this application is to provide the use of the above-mentioned novel micropeptide HMBJ or nucleotides encoding the novel micropeptide HMBJ in the preparation of drugs for the treatment or adjunct treatment of organ fibrosis.
[0011] 2.Technical solution To achieve the objectives of the above invention, the technical solutions employed in this application are as follows:
[0012] This application provides the lncRNA molecule ENSG00000272654 having the nucleotide sequence shown in Sequence ID No. 1. The applicant has for the first time discovered, by analyzing high-throughput sequencing data from multiple organ fibrosis studies, that the lncRNA molecule ENSG00000272654 has a significant association with organ fibrosis, specifically exhibiting low expression in various organ fibrotic cells and / or tissues, although no related studies have been reported to date.
[0013] This application also provides the open reading frames (ORF) of the lncRNA molecule ENSG00000272654 having the nucleotide sequence shown in Sequence ID No. 2. By analyzing the translational features of the open reading frames of the lncRNA molecule ENSG00000272654, the applicant discovered that this molecule may encode a functional protein. Endogenous coding verification was performed using methods including gene editing, immunoprecipitation, and LC-MS / MS, and it was demonstrated that the lncRNA molecule ENSG00000272654 has a coding sequence (ORF), which has not been reported to date.
[0014] This application also provides a novel micropeptide HMBJ whose amino acid sequence includes the sequence shown in Sequence ID No. 3. This micropeptide is encoded by the human lncRNA ENSG00000272654 and is a novel human endogenous polypeptide that has been discovered for the first time.
[0015] This application also provides nucleotides encoding the novel micropeptide HMBJ described above. These nucleotide sequences are not limited to the lncRNA molecule ENSG00000272654 or the ORF contained therein. Those skilled in the art will understand that corresponding nucleotide sequences can be designed based on the amino acid sequence of the novel micropeptide HMBJ.
[0016] This application also provides a recombinant vector comprising the above nucleotide sequence encoding a novel micropeptide HMBJ. This recombinant vector may be other vectors known to those skilled in the art, such as plasmids or viral vectors.
[0017] This application also provides the use of the novel micropeptide HMBJ, the nucleotide encoding the novel micropeptide HMBJ, and the recombinant vector in the preparation of drugs for the therapeutic or adjunctive treatment of organ fibrosis. Through validation, the applicant found that the novel micropeptide HMBJ has a significant inhibitory effect on organ fibrotic cell models and can be used for the therapeutic or adjunctive treatment of organ fibrosis.
[0018] Furthermore, the above-mentioned organ fibrosis includes liver fibrosis, kidney fibrosis, and / or lung fibrosis.
[0019] This application also provides the use of the above-mentioned lncRNA molecule ENSG00000272654 and / or the ORF contained herein in the preparation of reagents for diagnosing or adjunctally diagnosing organ fibrosis.
[0020] Furthermore, the reagents for diagnosing or adjunctally diagnosing the above-mentioned organ fibrosis include primers that specifically amplify the lncRNA molecule ENSG00000272654 or the ORF contained therein.
[0021] Furthermore, the above specific primer pair is F:CAAGGGATGGAGGCGAAACT, R:Contains the nucleotide sequence CCACAGTGCTGGTCAAGTCA
[0022] Furthermore, the organ fibrosis includes liver fibrosis, kidney fibrosis, and / or lung fibrosis.
[0023] This application also provides a pharmaceutical composition for treating or adjuvantly treating organ fibrosis. This pharmaceutical composition includes at least the above-mentioned novel micropeptide HMBJ, the nucleotide encoding the above-mentioned novel micropeptide HMBJ, or the above-mentioned recombinant vector, and a pharmaceutically acceptable carrier.
[0024] This application also provides a kit for diagnosing or adjuvantly diagnosing organ fibrosis. This kit includes primers that specifically amplify the lncRNA molecule ENSG00000272654 or the ORF contained therein.
[0025] Furthermore, the above specific primer pair F: CAAGGGATGGAGGCGAAACT, R: CCACAGTGCTGGTCAAGTCA includes the nucleotide sequence.
[0026] 3. Beneficial effects Compared with the prior art, the beneficial effects of this application are as follows.
[0027] (1) This application provides an lncRNA and its nucleotide sequence. By analyzing the sequencing data of multiple organ fibroses, it was discovered that the lncRNA molecule ENSG00000272654 shows low expression in organ fibrosis. No relevant research reports have been found through literature search. These can be used for the diagnosis or auxiliary diagnosis of organ fibrosis, the treatment or auxiliary treatment, or the preparation of reagents for treating or adjuvantly diagnosing and treating organ fibrosis.
[0028] (2) This application provides a nucleotide sequence having an open reading frame of an lncRNA. The nucleotide sequence can be obtained by encoding a novel micropeptide HMBJ. Searches of databases (BLAST, UniProt) and literature have not found any protein or polypeptide fragments having a homologous sequence to the micropeptide HMBJ. This nucleotide sequence can be used to encode and generate a novel micropeptide HMBJ, to diagnose or adjunct to the diagnosis, treatment or adjunct therapy of organ fibrosis, or to prepare reagents for diagnosing or adjunctarially diagnosing, treating or adjunctarially treating organ fibrosis.
[0029] (3) This application provides a novel micropeptide HMBJ having a novel amino acid sequence. Searches of databases (BLAST, UniProt) and literature have not found any protein or polypeptide fragments having a homologous sequence to the micropeptide HMBJ. This novel micropeptide HMBJ consists of 71 amino acids. The synthetic peptide of the micropeptide HMBJ has shown significant in vitro inhibitory effects on key indicators of human liver fibrosis, renal fibrosis, and pulmonary fibrosis, including type I collagen α1 chain gene (Col1a1), transforming growth factor β1 (TGFβ1), and connective tissue growth factor (CTGF). Since the novel micropeptide HMBJ can also be used as a therapeutic agent for other organ fibrosis, it greatly expands the therapeutic spectrum of this micropeptide and provides new concepts for the development of organ fibrosis drugs.
[0030] (4) In this application, a novel synthetic peptide of the micropeptide HMBJ is obtained using a solid-phase synthesis method based on the amino acid sequence of the novel micropeptide HMBJ. The method mainly includes polypeptide synthesis, polypeptide purification, polypeptide purity detection, and identification by mass spectrometry. Three organ fibrosis cell models are constructed, for example, human hepatic astrocytocytes LX-2, human non-small cell lung cancer cell line A549, and human renal proximal tubular cells HK2, to which 10 nmol of recombinant human TGFβ1 (Peprotech) stimulating factor and synthetic peptides of the micropeptide HMBJ at different concentrations are added, and after incubation for 24 hours, the total RNA of the cell samples is extracted and recovered using TRIzol reagent. Next, the extracted total RNA is reverse transcribed using a reverse transcription reagent, and then mRNA expression of the genes Col1a1, TGFβ1, and CTGF in the three organ fibrosis cell models is detected using real-time fluorescence quantitative PCR. The results suggest that the synthetic peptide of the micropeptide HMBJ has a significant inhibitory effect on the three organ fibrosis cell models. [Brief explanation of the drawing]
[0031] [Figure 1] This is a volcano plot analyzing the low expression of ENSG00000272654 in organ fibrosis using differential analysis. [Figure 2] This figure shows Sanger sequencing performed on monoclonal cells into which a flag tag for the micropeptide HMBJ was inserted using gene editing technology. [Figure 3] This figure shows the expression status of the target band of the micropeptide HMBJ detected using immunoprecipitation. [Figure 4] This figure shows the protein mass spectrum of the micropeptide HMBJ detected using LC-MS / MS. [Figure 5] This figure shows the melting curves obtained by detecting the primer specificity of four organ fibrosis genes using the qPCR method. [Figure 6]This figure shows the detection of gene markers for constructing a human liver fibrosis cell model using the qPCR method. [Figure 7] This figure shows the detection of gene markers for constructing a human renal fibrosis cell model using the qPCR method. [Figure 8] This figure shows the detection of gene markers for constructing a human lung fibrosis cell model using the qPCR method. [Figure 9] This is a diagram showing the liquid phase results of the synthesis of the micropeptide HMBJ. [Figure 10] This is a graph showing the mass spectrum results of the synthesized peptide of the micropeptide HMBJ. [Figure 11] This figure shows the inhibitory effect of the micropeptide HMBJ in a human liver fibrosis cell model detected using the qPCR method. [Figure 12] This figure shows the inhibitory effect of the micropeptide HMBJ in a human renal fibrosis cell model, detected using the qPCR method. [Figure 13] This figure shows the inhibitory effect of the micropeptide HMBJ in a human lung fibrosis cell model detected using the qPCR method. [Modes for carrying out the invention]
[0032] The present application will be further described below, along with specific examples.
[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of this application. The term "and / or" as used herein includes any one or more and all combinations of the relevant enumerated items.
[0034] Unless otherwise specified in the examples, the procedures are carried out under conventional conditions or conditions provided by the manufacturer. Unless otherwise specified, the reagents and equipment used are all standard products available commercially.
[0035] As used herein, the term “about” is used to give flexibility and impreciseness to a given term, measure, or value. Those skilled in the art can readily determine the degree of flexibility to a particular variable.
[0036] As used herein, the term "at least one of..." is synonymous with "one or more of...". For example, "at least one of A, B, and C" clearly includes A only, B only, C only, and any combination thereof.
[0037] In this specification, concentrations, quantities, and other numerical data may be presented in range format. Such range formatting is used solely for convenience and brevity, and should be interpreted flexibly to include not only the explicitly stated range limit but also all individual numbers or subranges (each number and subrange clearly described) within that range. For example, a numerical range from approximately 1 to approximately 4.5 should be interpreted to include not only the explicitly stated limit value from 1 to approximately 4.5 but also individual numbers (2, 3, 4, etc.) and subranges (1 to 3, 2 to 4, etc.). The same principle applies to describing only one numerical range, such as "less than approximately 4.5," which should be interpreted to include all the values and ranges described above. Furthermore, such interpretation should apply regardless of the breadth of the described range or feature.
[0038] In the examples, the methods for verifying the endogenous code of the micropeptide HMBJ include gene editing, immunoprecipitation, and LC-MS / MS, specifically, The steps involve precisely inserting a Flag tag into the genomic location of the micropeptide HMBJ using gene editing, The steps include observing the production of a target band using immunoprecipitation combined with chemiluminescence, The method includes the step of detecting the protein mass spectrum of the micropeptide HMBJ using LC-MS / MS.
[0039] In the examples, the step of detecting gene markers in an organ fibrosis cell model using real-time fluorescence quantitative PCR is specifically: Human hepatic stellate cells (LX-2), human non-small cell lung cancer cell line A549, and human renal proximal tubular cells HK2 were seeded on plates, and recombinant human TGFβ1 (Peprotech) stimulating factor was added at different concentrations. This includes detecting the mRNA expression status of Col1a1 and α-SMA genes using real-time fluorescence quantitative PCR after 24 hours and 48 hours of continuous stimulation, and determining whether the cell model was successfully constructed.
[0040] In the examples, the steps of obtaining a novel micropeptide HMBJ using solid-phase synthesis and verifying the quality of the synthesized peptide are specifically as follows: Peptide resin synthesis: Decapping is performed using hexahydropyridine / N,N-dimethylformamide (DMF) decapping solution, the resin is washed with DMF, a condensing agent is added and the reaction is carried out thoroughly in the reaction vessel, and finally the resin is thoroughly washed with DMF to remove by-products. The cell lysate is added to completely dissolve the polypeptide, and the resin and polypeptide are separated using a sand-filled funnel. The polypeptide is precipitated by adding anhydrous diethyl ether, the supernatant is removed by centrifugation, the polypeptide is washed again with anhydrous diethyl ether, and then extracted to obtain crude polypeptide. The crude polypeptide is dissolved in deionized water, filtered, and purified by semi-preparative high-performance liquid chromatography. This includes measuring the purity of polypeptides using analytical RP-HPLC.
[0041] In the example, a method for detecting the inhibitory effect of micropeptide HMBJ in a fibrotic cell model using real-time fluorescence quantitative PCR is described as follows: The steps include counting human hepatic stellate cells (LX-2), human non-small cell lung cancer cell line A549, or human renal proximal tubular cells HK2, and seeding them onto a plate. Excluding the blank group, the following steps were performed: 10 nmol of recombinant human TGFβ1 (Peprotech) stimulating factor was added, and the subjects were stimulated continuously for 24 hours. The process involves extracting total RNA from a cell sample recovered using TRIzol reagent, reverse transcribing the extracted total RNA using a reverse transcription reagent, and then performing a qPCR reaction using a qPCR premix. The procedure includes the step of detecting the mRNA expression status of the genes Col1a1, TGFβ1, and CTGF, respectively, using a real-time fluorescence quantitative PCR instrument.
[0042] Example 1 In this example, the expression level of the gene ENSG00000272654 was analyzed in various organ fibrosis conditions.
[0043] Using the Aspera command, high-throughput sequencing data related to various organ fibrosis were downloaded in bulk from the NCBI and ENA databases using "fibrosis" and "Homo sapiens" as keywords. This data included human liver fibrosis and normal cell data (accession number: PRJNA638727), human liver fibrosis patient and healthy tissue data (accession number: PRJEB27201), human renal fibrosis and normal cell data (accession number: GSE23338), and human lung fibrosis patient and healthy tissue data (accession number: PRJNA878759). The downloaded sequencing data was then processed and analyzed. First, the Fastp software package (v0.18.0) was used to filter and remove reads containing adapter sequences and low-quality bases from the raw data. Next, the Bowtie software package (v1.3.0) was used to align the data with human tRNA and rRNA sequences. Data that failed to align were aligned with the human reference genome (GRCh38.Ensembl98) using the HISAT2 software package (v2.2.1). Ultimately, reads with an alignment success rate exceeding 90% were selected for subsequent analysis. Next, genes and transcripts within the data were assembled and quantified using the StringTie software package (v1.2.2). Furthermore, differential gene expression analysis was performed using the DESeq2 software package (v1.38.3). The results showed that the significance padj for the gene ENSG00000272654 was less than 0.05, and the fold change (log2FoldChange) was less than -1, suggesting that this gene has low expression levels in multiple organ fibrosis. The differences in expression are shown in Figure 1.
[0044] Example 2 In this example, the coding ability of the micropeptide HMBJ was detected intrinsically using gene editing, immunoprecipitation, and LC-MS / MS.
[0045] The gene sequence ENSG00000272654 was downloaded from the Ensembl database, and a corresponding sgRNA plasmid and donor fragment containing a Flag tag were designed. The sgRNA plasmid and donor fragment were introduced into 293T cells using Lipo3000 liposome transfection reagent. Fluorescence was observed 48 hours after transfection. Cells were harvested by trypsin digestion, centrifuged, and the supernatant was removed. The cells were then resuspended in basal medium for fluorescently labeled cell sorting. After counting the sorted cells, monoclonal plate seeding and Sanger sequencing were performed to select monoclonal cells with accurately inserted Flag tags (see Figure 2).
[0046] Cells were immersed in PBS and washed twice, then recovered by trypsin digestion. After centrifugation and removal of the supernatant, the cell pellet was resuspended in RIPA cell lysate. After lysis on ice for 30 minutes, the cells were centrifuged at 12000 g for 15 minutes, and the supernatant was collected. Flag antibody and agarose gel were added to form a protein-antibody-gel complex. After centrifugation at 6000 g for 1 minute and removal of the gel, 1× SDS loading buffer was added, mixed uniformly, and then boiled for 10 minutes to denature. Total protein was separated by 12% SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. Then, 5% skim milk powder was added and sealed at room temperature for 3 hours, followed by five washes with TBST for 10 minutes each. Flag primary antibody was added and incubated overnight at 4°C, followed by five washes with TBST for 10 minutes each. Secondary antibody was added and incubated at room temperature for 1 hour, followed by five washes with TBST for 10 minutes each. The samples were developed using an ECL ultra-high sensitivity chemiluminescent solution, and the presence or absence of the target band was detected using a Tannon imaging system. The results are shown in Figure 3.
[0047] To further demonstrate the coding ability of the micropeptide HMBJ, the SDS-PAGE gel containing the target protein in the above steps was stained with Coomassie brilliant blue. Bands visible to the naked eye were excised from the gel and detected by LC-MS / MS (liquid chromatography-tandem quadrupole mass spectrometry) to obtain the mass spectrum results of the target micropeptide shown in Figure 4.
[0048] After inserting a Flag tag into the genomic sequence of the target peptide, gene editing, immunoprecipitation, and mass spectral detection revealed the target band and mass spectral peptide fragment of the micropeptide HMBJ, fully demonstrating that the novel HMBJ peptide possesses endogenous coding ability.
[0049] Example 3 In this example, gene markers were detected in three organ fibrosis cell models using real-time fluorescence quantitative PCR.
[0050] (1) Primer design The primary indicators in the organ fibrosis cell model included type I collagen α1 chain gene (Col1a1), transforming growth factor β1 (TGFβ1), and connective tissue growth factor (CTGF). Corresponding primers, namely upstream and downstream primers for Col1a1, TGFβ1, CTGF, and α-SMA, were designed using Primer Premier 5.0. Total RNA was extracted from the recovered cell samples according to the instructions for the TRIzol reagent from Life Invitrogen. The purity and concentration of the extracted RNA were quantified using a NanoDrop 2000 ultra-micro spectrophotometer. Agarose gel quality control was performed to ensure the integrity of the extracted RNA. The extracted total RNA was reverse transcribed using the reverse transcription reagent HiScript® III RT SuperMix for qPCR (+gDNA wiper), and the qPCR reaction was performed using the qPCR premix ChamQ SYBR qPCR Master Mix. The reaction system is shown in the table below.
[0051] [Table 1]
[0052] After uniformly mixing the above components, the following procedure was performed: pre-denaturation at 95°C for 30s, followed by 95°C for 10s and 60°C for 30s, for 50 cycles. After the qPCR reaction was complete, the Cq values were collected from each sample well. To ensure data accuracy, the specificity of the reaction was determined by observing whether the maximum error of the Cq values of the three sample wells was 0.5 or less and whether the melting curve of the designed primer showed a single peak (see Figure 5).
[0053] (2) Model construction Human hepatic stellate cells LX-2, human non-small cell lung cancer cell line A549, and human renal proximal tubular cells HK2 were cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density reached over 80%. The cells were harvested by trypsin digestion, centrifuged, and the supernatant was removed. The cells were then resuspended in complete medium and counted using a cell counter. The cell concentration was measured at 1.5 × 10⁻⁶. 5 After adjusting the concentration to cells / mL, the cells were seeded into 6-well cell culture plates and cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours of cell culture, the culture medium was aspirated and recombinant human TGFβ1 (Peprotech) stimulant at different concentrations was added to each. After 24 and 48 hours of sequential stimulation, the mRNA expression status of the Col1a1 and α-SMA genes was detected using qPCR (see Figures 6, 7, and 8).
[0054] Example 4 In this example, micropeptides HMBJ were obtained using a solid-phase synthesis method, and the quality of the synthesized micropeptides was verified.
[0055] In this example, micropeptide HMBJ was synthesized using a polypeptide solid-phase synthesis method. The synthesized micropeptide HMBJ was separated and purified using preparative HPLC, and its purity was measured using analytical RP-HPLC. In the polypeptide solid-phase synthesis method, Fmoc-Thr-wang-resin was used as the starting material, and then protective amino acids were sequentially attached to the last amino acid of the target sequence. After attachment, the crude polypeptide was obtained by thorough washing, dissolution, and work-up. After dissolution of the crude polypeptide, it was purified, concentrated, and freeze-dried using preparative high-performance liquid chromatography to obtain the pure polypeptide. The specific reaction steps are as follows.
[0056] (1) Synthesis of peptide resins 1 mmol of Fmoc-Thr-wang-resin was weighed and injected into a glass sand-filled reaction column. 20 ml of CH2Cl2 was added to fully swell the resin.
[0057] a. Decapping: 20 ml of decapping solution containing 20% hexahydropyridine / N,N-dimethylformamide (DMF) was added. After reacting for the specified time, the decapping solution was removed, washed once with DMF, and then another 20 ml of decapping solution was added and the reaction was continued to remove the Fmoc protecting group.
[0058] b. Washing: The decapping solution was removed, and the resin was washed with DMF to completely remove by-products.
[0059] c. Condensation: The protective amino acids and activators for bonding were dissolved in DMF and the condensing agent, and the mixture was allowed to react thoroughly in the reaction vessel.
[0060] d. Washing: The reaction solution was withdrawn, and the resin was thoroughly washed with DMF to completely remove by-products.
[0061] (2)Dissolution The extracted resin was placed in an Erlenmeyer flask, and the dissolved solution was added to completely dissolve the synthesized polypeptide. The resin and polypeptide were then separated using a sand-filled funnel. The components of the dissolved solution and the volume ratio of each component were trifluoroacetic acid:phenol:water:anisole:EDT = 90:3:3:2:2.
[0062] (3) Post-processing The dissolution was added to anhydrous diethyl ether after an ice bath, and the polypeptide was slowly stirred to precipitate. After centrifugation and removal of the supernatant, the polypeptide was washed with anhydrous diethyl ether and separated to obtain crude polypeptide.
[0063] (4) Purification a. Dissolution: The crude polypeptide was dissolved in deionized water and filtered using a filtration membrane with a pore size of 0.45 μm.
[0064] b. Preparation: Purified by semi-preparative high-performance liquid chromatography (HPLC). Mobile phase: A was 0.1% TFA (acetonitrile), and B was 0.1% TFA (water). The purification system is shown in the table below.
[0065] [Table 2]
[0066] The solution was collected at an ultraviolet wavelength of 220 nm. MS confirmed that the molecular weight matched the theoretical value. HPLC analysis revealed the purity of the solution to be over 95%. This qualified solution was concentrated under reduced pressure at 37°C using a rotary evaporator to remove the organic solvent. It was transferred to a lyophilization tray, frozen at -80°C, and then lyophilized using a freeze-dryer to obtain a pure polypeptide.
[0067] (5) Purity detection The purified product after freeze-drying was recovered, and the purity of the polypeptide was detected by analytical RP-HPLC. The analytical conditions were: mobile phase: 0.1% TFA (acetonitrile), 0.1% TFA (water), loading volume: 10 μL. The specific reaction system is shown in the table below.
[0068] [Table 3]
[0069] The purity of the synthesized polypeptide was detected by reverse-phase liquid chromatography. As shown in Figures 9 and 10, the purity of the prepared micropeptide HMBJ was 95.86%, exceeding 95%, which met the requirements for subsequent experiments. Specific information is shown in the table below.
[0070] [Table 4]
[0071] Example 5 In this example, the inhibitory effect of the micropeptide HMBJ on a human liver fibrosis cell model was detected. Human liver stellate cells LX-2 were cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density reached over 80%. The cells were harvested by trypsin digestion, centrifuged, and the supernatant was removed. The cells were then resuspended in complete medium and counted using a cell counter. The cell concentration was set to 1.5 × 10⁻⁶. 5 After adjusting the concentration to cells / mL, the cells were seeded into 6-well cell culture plates and cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours of cell culture, the culture medium was aspirated, and 2‰ DMSO was added as a negative control, while 20 μmol of hydroxynidone was added as a positive control. The remaining groups were proportionally administered synthetic peptide HMBJ in doses of 40 μmol, 10 μmol, 2.5 μmol, 625 nmol, and 156 nmol, respectively. After 30 minutes, 10 nmol of recombinant human TGFβ1 (Peprotech) stimulant was added to each of the remaining groups, excluding the blank control. After 24 hours of continuous stimulation, the mRNA expression status of the genes Col1a1, TGFβ1, and CTGF was detected (see Figure 11).
[0072] Example 6 In this example, the inhibitory effect of the micropeptide HMBJ on a human renal fibrosis cell model was detected.
[0073] Human renal proximal tubular cells (HK2) were cultured at 37°C in a 5% CO2 cell culture incubator until the cell density reached over 80%. The cells were harvested by trypsin digestion, centrifuged, and the supernatant was removed. The cells were then resuspended in complete culture medium and counted using a cell counter. The cell concentration was measured at 1.5 × 10⁻⁶. 5 After adjusting the concentration to cells / mL, the cells were seeded into 6-well cell culture plates and cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours of cell culture, the culture medium was aspirated, and 2‰ DMSO was added as a negative control, while 20 μmol of hydroxynidone was added as a positive control. The remaining groups were proportionally administered synthetic peptide HMBJ in doses of 40 μmol, 10 μmol, 2.5 μmol, 625 nmol, and 156 nmol, respectively. After 30 minutes, 10 nmol of recombinant human TGFβ1 (Peprotech) stimulant was added to each of the remaining groups, excluding the blank control. After 24 hours of continuous stimulation, the mRNA expression status of the genes Col1a1, TGFβ1, and CTGF was detected (see Figure 12).
[0074] Example 7 In this example, the inhibitory effect of the micropeptide HMBJ on a human lung fibrosis cell model was detected.
[0075] Human non-small cell lung cancer cell line A549 was cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density reached over 80%. The cells were harvested by trypsin digestion, centrifuged, and the supernatant was removed. The cells were then resuspended in complete culture medium and counted using a cell counter. The cell concentration was measured at 1.5 × 10⁻⁶. 5After adjusting the concentration to cells / mL, the cells were seeded into 6-well cell culture plates and cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours of cell culture, the culture medium was aspirated, 2‰ DMSO was added as a negative control, and 2 μmol of nintedanib was added as a positive control. The remaining groups were proportionally supplemented with synthetic peptide HMBJ (40 μmol, 10 μmol, 2.5 μmol, 625 nmol, and 156 nmol) as treatment groups. After 30 minutes, 10 nmol of recombinant human TGFβ1 (Peprotech) stimulant was added to each of the remaining groups, excluding the blank control. After 24 hours of continuous stimulation, the mRNA expression status of the genes Col1a1, TGFβ1, and CTGF was detected (see Figure 13).
Claims
1. A novel micropeptide HMBJ characterized by containing the amino acid sequence shown in Sequence ID No.
3.
2. A nucleotide characterized by encoding a novel micropeptide HMBJ as described in claim 1.
3. The nucleotide according to claim 2, characterized in that the nucleotide sequence comprises an lncRNA molecule ENSG00000272654 and / or an ORF contained therein, the nucleotide sequence of the lncRNA molecule ENSG00000272654 is shown by SEQ ID NO: 1, and the nucleotide sequence of the ORF contained in the lncRNA molecule ENSG00000272654 is shown by SEQ ID NO:
2.
4. Use of the nucleotide according to claim 3 in the preparation of a reagent for diagnosing or adjunctally diagnosing organ fibrosis, wherein the organ fibrosis includes hepatic fibrosis, renal fibrosis and / or pulmonary fibrosis.
5. The use of the nucleotide described in claim 4 in the preparation of a reagent for diagnosing or adjunctally diagnosing organ fibrosis, wherein the reagent for diagnosing or adjunctally diagnosing organ fibrosis comprises a primer that specifically amplifies the lncRNA molecule ENSG00000272654 or ORF contained therein.
6. A recombinant vector characterized by comprising the nucleotide described in claim 2 or 3.
7. Use of the novel micropeptide HMBJ according to claim 1, the nucleotide according to claim 2 or 3, or the recombinant vector according to claim 6 in the preparation of a drug for treating or adjunctively treating organ fibrosis, wherein the organ fibrosis includes hepatic fibrosis, renal fibrosis, and / or pulmonary fibrosis.
8. A pharmaceutical composition for treating or adjunctally treating organ fibrosis, wherein the pharmaceutical composition comprises at least a novel micropeptide HMBJ according to claim 1, a nucleotide according to claim 2 or 3, or a recombinant vector according to claim 6, and a pharmaceutically acceptable carrier.
9. A kit for diagnosing or adjunctally diagnosing organ fibrosis, wherein the kit comprises a specific primer pair for the nucleotide sequence described in claim 3.
10. A kit for diagnosing or adjunctally diagnosing organ fibrosis according to claim 9, wherein the specific primer pair is F: CAAGGGATGGAGGCGAAAACT, R: CCACAGTGCTGGTCAAGTCA A kit characterized by containing the nucleotide sequence.