Human EIF3L-binding molecule and cancer exosome diagnosis and antithrombotic treatment

By combining human EIF3L and CD63 with molecular detection of cancer-related exosomes, the challenges of early identification and treatment of cancer thrombosis in existing technologies have been solved. This approach provides early diagnosis and personalized treatment options, avoids the side effects of conventional anticoagulants, and improves treatment efficacy and patient quality of life.

JP2026518713APending Publication Date: 2026-06-09THE CLEVELAND CLINIC FOUND

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
THE CLEVELAND CLINIC FOUND
Filing Date
2024-05-20
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Current technologies are insufficient to effectively identify and treat cancer-related thrombosis. Conventional anticoagulant therapy may lead to bleeding complications and affect the effectiveness of chemotherapy. Furthermore, thrombosis is often only discovered after autopsy, and there is a lack of early diagnostic methods.

Method used

We provide human EIF3L-binding molecules and CD63-binding molecules, which can be used to identify and treat cancer-related thrombosis by detecting CD63-positive, PCA3-positive, and EIF3L-positive exosomes. Treatment is carried out using monoclonal antibodies or antigen-binding fragments of specific heavy and light chain variable regions or complementarity-determining regions, combined with expression vectors.

Benefits of technology

It enables early identification of high-risk cancer thrombosis patients, avoids bleeding complications associated with conventional anticoagulants, provides more targeted treatment options, reduces chemotherapy interference, and improves patients' quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026518713000003
    Figure 2026518713000003
  • Figure 2026518713000004
    Figure 2026518713000004
  • Figure 2026518713000005
    Figure 2026518713000005
Patent Text Reader

Abstract

This specification provides human EIF3L-binding molecules and nucleic acid sequences encoding such molecules. In certain embodiments, human EIF3L-binding molecules having specific light chain and / or heavy chain variable regions, or light chain and / or heavy chain CDRs (e.g., monoclonal antibodies or their antigen-binding fragments), and methods are provided herein for treating a pro-thrombus condition involving pathological exosome production in a subject (e.g., a human subject with tumor-mediated thrombosis) using such molecules, and / or other EIF3L-binding molecules, and / or CD63-binding molecules. In some embodiments, the presence or level of cancer is detected by detecting CD63-positive and / or PCA3-positive and / or EIF3L-positive exosomes in a sample.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application claims priority to U.S. Provisional Application No. 63 / 503,332, filed May 19, 2023, which is hereby incorporated by reference in its entirety.

[0002] This invention was made with government support under Grant No. HL142772 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0003] Field of the Invention Disclosed herein are human EIF3L binding molecules and nucleic acid sequences encoding such molecules. In certain embodiments, human EIF3L binding molecules (e.g., monoclonal antibodies or antigen-binding fragments thereof) having specific light and / or heavy chain variable regions, or light and / or heavy chain CDRs, and methods of using such molecules, and / or other EIF3L binding molecules, and / or CD63 binding molecules to treat thrombogenic states associated with pathologic exosome production in a subject (e.g., a human subject with tumor-mediated thrombosis) are provided herein. In some embodiments, the presence or level of cancer is detected by detecting CD63-positive, and / or PCA3-positive, and / or EIF3L-positive exosomes in a sample.

Background Art

[0004] Thrombosis is one of the major complications and a leading cause of death in cancer patients. 8~3 Approximately 30% of venous thromboembolism cases are estimated to be associated with cancer, and metastatic cancer poses an even higher risk. 4~7 The interaction between platelets and tumor progression has been established for over 170 years, but the underlying mechanism remains unclear. Since thrombosis affects a large number of patients every year and determines patient morbidity and disease-related mortality, elucidating all the mechanisms of cancer-related thrombosis is extremely important for the development of better targeted therapies.

[0005] Cancer promotes a pro-thrombotic state by producing procoagulant microparticles (MVs), adhesion molecules, and cytokines. 15 Tumor MVs are small heterogeneous membrane-bound vesicles with unique morphological features and functions. 16 One of the most well-characterized MVs is the exosome, a 30 - 150 nm vesicle generated in the multivesicular endosome (MVE). 9 High levels of circulating exosomes have been detected in the plasma of various cancer patients. 80~13 Tumor exosomes can carry cancer-specific lipids, proteins, and nucleic acids that aid metastasis. 84 In most methods of exosome purification, heterogeneous EV populations of diverse biological origins, including ectosomes that bud directly from the cell membrane, are co-isolated. 15

[0006] Current treatments for cancer thrombosis involve administration of anticoagulants, which can lead to hemorrhagic complications and potentially delay or halt chemotherapy and associated deterioration of the patient's quality of life. 16、17 Therefore, timely identification of cancer patients at high risk of thrombosis is essential for treatment success. Unfortunately, thrombosis is often not detected until autopsy. 2、18

Summary of the Invention

[0007] This specification provides human EIF3L-binding molecules and nucleic acid sequences encoding such molecules. In certain embodiments, human EIF3L-binding molecules having specific light chain and / or heavy chain variable regions, or light chain and / or heavy chain CDRs (e.g., monoclonal antibodies or their antigen-binding fragments), and methods for treating pro-thrombus conditions involving pathological exosome production in a subject (e.g., a human subject with tumor-mediated thrombosis) using such molecules, and / or other EIF3L-binding molecules, and / or CD63-binding molecules are provided herein. In some embodiments, the presence or level of cancer is detected by detecting CD63-positive and / or PCA3-positive and / or EIF3L-positive exosomes in a sample.

[0008] In some embodiments, compositions are provided herein that include a human EIF3L-binding molecule and / or one or more nucleic acid molecules encoding the human EIF3L-binding molecule, the human EIF3L-binding molecule comprising: a) a heavy chain variable region (the heavy chain variable region comprising: i) SEQ ID NO: 6, or a CDRH1 amino acid sequence comprising SEQ ID NO: 6 having one or two conservative amino acid changes; ii) SEQ ID NO: 7, or a CDRH2 amino acid sequence comprising SEQ ID NO: 7 having one or two conservative amino acid changes; and iii) SEQ ID NO: 8, or one or more (i) a CDRH3 amino acid sequence containing SEQ ID NO: 8 having two conservative amino acid changes; and / or (b) a light chain variable region (the light chain variable region includes: i) SEQ ID NO: 10, or a CDRL1 amino acid sequence containing SEQ ID NO: 10 having one or two conservative amino acid changes; ii) SEQ ID NO: 11, or a CDRL2 amino acid sequence containing SEQ ID NO: 11 having one or two conservative amino acid changes; and iii) SEQ ID NO: 12, or a CDRL3 amino acid sequence containing SEQ ID NO: 12 having one or two conservative amino acid changes).

[0009] In some embodiments, methods are provided herein for treating or preventing a prothrombotic condition in a subject that is accompanied by or caused by pathological exosome production, the method comprising: i) treating the subject with an expression vector comprising a human EIF3L-binding molecule, or one or more mRNAs encoding the EIF3L-binding molecule, or one or more nucleic acid molecules encoding the human EIF3L-binding molecule (optionally, the human EIF3L-binding molecule is as described herein); or ii) an expression vector comprising a human CD63-binding molecule, or one or more mRNAs encoding the human CD63-binding molecule, or one or more nucleic acid molecules encoding the CD63-binding molecule (the subject is suffering from or suspected of developing the prothrombotic condition).

[0010] In certain embodiments, methods are provided herein for treating or preventing a prothrombotic condition in a subject suffering from a prothrombotic condition, which is accompanied by or caused by pathological exosome production, the method comprising treating the subject with an expression vector comprising a human EIF3L-binding molecule or one or more nucleic acid molecules encoding the human EIF3L-binding molecule, as described above and herein (for example, using the commercially available antibody described in Example 1), the subject suffering from or suspected of developing the prothrombotic condition. In some embodiments, i) the subject has cancer and has or is suspected of having tumor-mediated thrombosis and / or tumor-mediated thrombotic disorder and / or thrombosis associated with antitumor therapy, and optionally, the tumor-mediated thrombotic disorder is selected from the group consisting of heart attack, acute ischemic stroke, transient ischemic attack, deep vein thrombosis, pulmonary embolism, and phlebitis, and / or, iii) the thrombus-promoting condition is selected from sepsis, septic shock, viral infection, SARS-CoV-2 infection, sickle cell disease, cardiovascular disease, acute coronary syndrome (ACS), stroke, acute inflammation, infection-sepsis, and acute coronary syndrome. In further embodiments, the human CD63-binding molecule binds to the glycosylated version of human CD63.

[0011] In some embodiments, i) the CDRH1 amino acid sequence includes SEQ ID NO: 6; ii) the CDRH2 amino acid sequence includes SEQ ID NO: 7; iii) the CDRH3 amino acid sequence includes SEQ ID NO: 9; iv) the CDRL1 amino acid sequence includes SEQ ID NO: 10; v) the CDRL2 amino acid sequence includes SEQ ID NO: 11; vi) the CDRL3 amino acid sequence includes SEQ ID NO: 12. In certain embodiments, the human EIF3L binding molecule is an antibody, minibody, diabody, scFv, or antibody fragment that can bind to human EIF3L. In additional embodiments, the antibody fragment is a Fab, F(ab')2, or Fv antibody fragment. In some embodiments, the antibody or antibody fragment includes at least the antigen-binding portion of the A1806-3A1-3 antibody.

[0012] In certain embodiments, the heavy chain and / or light chain variable regions include a human framework region. In additional embodiments, the human EIF3L-binding molecule further includes a light chain constant region and a CH1 heavy chain constant region. In certain embodiments, the EIF3L-binding molecule further includes a CH2 heavy chain constant region and / or a CH3 heavy chain constant region. In other embodiments, the light chain constant region is human or humanized mouse, and / or the CH1, CH2, and CH3 heavy chain constant regions are human or humanized mouse. In other embodiments, the human EIF3L-binding molecule includes an antibody, the light chain constant region of which is selected from IgG kappa and IgG lambda, and the heavy chain constant region of which is selected from IgG1, IgG2, IgG3, and IgG4. In certain embodiments, the human EIF3L-binding molecule includes an antibody or its antigen-binding moiety that is glycosylated or deglycosylated.

[0013] In certain embodiments, the compositions herein further include a physiologically acceptable buffer. In additional embodiments, the heavy chain variable region includes SEQ ID NO: 5, or SEQ ID NO: 5 having one or more conservative amino acid changes. In further embodiments, the light chain variable region includes SEQ ID NO: 9, or SEQ ID NO: 9 having one or more conservative amino acid changes. In additional embodiments, the composition includes one or more nucleic acid molecules. In other embodiments, the one or more nucleic acid molecules include i) a first nucleic acid sequence encoding the heavy chain variable region, and ii) a second nucleic acid sequence encoding the light chain variable region. In further embodiments, the composition further includes an expression vector, wherein the first and / or second nucleic acid sequences are present within the expression vector.

[0014] In some embodiments, this specification provides a method for detecting CD63-positive, PCA3-positive, or EIF3L-positive small extracellular vesicles (sEVs) in a sample, the method comprising: a) contacting the sample with i) an anti-CD63 antibody or its antigen-binding moiety, and / or ii) an anti-PCA3 antibody or its antigen-binding moiety, and / or an anti-EIF3L antibody or its antigen-binding moiety (the sample comprises purified sEVs derived from a blood, plasma, or serum sample of a cancer subject, and the sample is CD63-positive, PCA3-positive, or EIF3L-positive). a) a) a) a suspected presence of L-positive sEVs, wherein an anti-CD63 antibody or its antigen-binding moiety, if present in the sample, forms a first complex with the CD63-positive sEV; an anti-PCA antibody or its antigen-binding moiety, if present in the sample, forms a second complex with the PCA3-positive sEV; and an anti-EIF3L antibody or its antigen-binding moiety, if present in the sample, forms a third complex with the EIF3L-positive sEV; and a) a) a detection of the presence or absence of the first complex and / or the second complex and / or the third complex in the sample.

[0015] Anti-CD63 antibodies are described herein and are commercially available (see, for example: ab231975 and ab68418 from Abcam, EXOAB-CD63A-1 from System Biosciences; EWI018 from Kerfast; Clone H5C6 from BD Biosciences; and ExoBrite® CD63 Flow antibody from Biotium). Anti-PCA-3 antibodies are commercially available (see, for example: HUFI03418 from AssayGenie, DEIA-LL272 from Creative Diagnostics). Anti-EIF3L antibodies are described herein and are commercially available (e.g., from MyBioSource, Solarbio Life Sciences, Bethyl Laboratories, Aviva Systems Biology, GeneTex, and Biobyt).

[0016] In certain embodiments, the sample is derived from a subject suffering from or suspected of suffering from a prothrombus-forming condition accompanied by pathological exosome production as described above, and / or thrombosis and / or thrombotic disorder. In other embodiments, the human anti-CD63 antibody, anti-EIF3L antibody, or its antigen-binding moiety includes a detectable label, and / or the anti-CD63 antibody, anti-EIF3L antibody, or its antigen-binding moiety is as described above and herein. In some embodiments, the method further comprises contacting the sample with a conjugate molecule capable of binding to i) an anti-CD63 antibody, an anti-EIF3L antibody, or its antigen-binding moiety, or ii) an anti-PCA3 antibody or its antigen-binding moiety, wherein the conjugate molecule includes a detectable label. [Brief explanation of the drawing]

[0017] [Figure 1]Platelets take up sEVs (small extracellular vesicles or exosomes) derived from cancer cells. A. FACS analysis (n=3) of isolated mouse platelets alone (control) or mouse platelets incubated for 60 minutes with Alexa Fluor 488-labeled synthetic, fibroblast-derived, or LNCaP-C4-2 / cancer-derived sEVs (10 μg / ml). B. Bar graph (n=3) showing the mean percentage of sEV-positive (Alexa Fluor 488-positive) platelets obtained from the FACS analysis of panel A. C. Representative confocal images (n=4) of isolated mouse platelets labeled with WGA-Alexa Fluor 594 (red) after incubation for 60 minutes with WGA-Alexa Fluor 488-labeled LNCaP-C4-2 / cancer sEVs (green). D. Bar graph showing the quantification of synthesis (control) and LNCaP-C4-2 / cancer-sEV (Alexa Fluor 488 mean fluorescence intensity (MFI)) levels detected in platelets by confocal microscopy of panel C (n=3). E. TEM of isolated mouse platelets incubated with LNCaP-C4-2-sEV. Red arrows indicate LNCaP-C4-2-sEV in platelets (n=4). F. Plot of representative time courses (of 3) of LNCaP-C4-2-sEV uptake by platelets at 0 minutes at a concentration of 10 μg / ml, as detected by FACS (n=3). G. PCR detection of hRPL28 RNA in platelets isolated from NSG mice carrying LNCaP-C4-2 tumor xenograft. The lanes show C57BL / 6J-WT (platelets), NSG mice treated with IgM isotype controls (control + IgM), and NSG mice (n=3) carrying tumor xenografts treated with IgM (tumor + IgM) or blocking antibodies (tumor + anti-sEV antibody). H. The left panel shows the detection of lncRNA PCA3 and EST00000501280 by nested PCR in LNCaP-sEV and cells, but not in mouse platelets. The right panel shows the detection of PCA3 RNA in mouse platelets pre-incubated with LNCaP-sEV or vehicle (control) and LNCaP cells. Mouse GAPDH was used as a loading control for equivalent platelets.I. PCR detection of PCA3 in platelets isolated from healthy donors and cancer patients before (Pre-Op) and after (Post-Op) prostatectomy. LNCaP cells and VCaP cells were used as positive controls. Human GAPDH served as a loading control. (n=11 healthy donors (control group) and 32 pre- and post-operative patients). J. Bar graphs showing the number of pre- and post-operative patient samples positive for PCA3 detection (n=30 pre- and post-operative patients). Graphs represent mean ± SEM (B, D), where n is a biological replicate or donor (I, J). P-values ​​were determined by Dunn's post-hoc multiple comparison test (B) and non-parametric Mann-Whitney U test (D), following the non-parametric Kruskal-Wallis test. [Figure 2]Platelet activation by cancer sEVs. A. Mean percentage of activated platelets measured by FACS. 2 × 10⁸ / ml gel-filtered mouse platelets were incubated for 60 minutes with vehicle alone (resting), thrombin (0.05 U / ml, 5 minutes), and LNCaP-C4-2 / cancer sEV at the indicated concentrations. After incubation, integrin αIIbβ3 activation was evaluated using JON / A(PE) antibody with FACS (n=3). B. FACS analysis showing the time course of platelet activation by 20 μg / ml LNCaP-C4-2 / cancer sEV and thrombin (0.05 U / ml, 5 minutes) (n=4). C. FACS analysis of platelet activation by JON / A(PE) antibody after treatment with synthetic sEV and LNCaP-C4-2 / cancer sEV for 60 minutes, followed by treatment with ADP (10 μM, 5 minutes). D. Bar graph showing the mean percentage of activated platelets in panel C (n=4). E. Vascular occlusion time in mice evaluated with 12% FeCl3-induced carotid artery injury 60 minutes after injection of 100 μl of PBS, synthetic, and LNCaP-C4-2 cancer sEV (10 μg / ml) (n=5, 8, and 12 mice in each group, respectively). F-G. WT mice and APOE- / - mice fed a Western diet for 15 weeks and carrying prostate cancer cells (RM1) xenograft or PBS (control) were subjected to 12% FeCl3-induced injury. Vascular occlusion time is shown for WT mice (n=6 and 4 in each group) (F) and APOE- / - mice (n=4) (G). A-G. Graphs represent mean ± SEM, and n is the biological repeat. P-values ​​were determined using the Kruskal-Wallis test followed by Dunn's post-hoc multiple comparison test (A, B, D, E) and the Mann-Whitney test (F, G). [Figure 3]Platelet uptake of cancer sEVs mediated by N-linked glycosylated CD63. A. Representative confocal images of platelets labeled with WGA-Alexa Fluor 594 (red) and sEVs labeled with BODIPY-488 (green). LNCaP-C4-2 / cancer-sEVs were treated overnight with PNGaseF or buffer alone, and then stained with BODIPY-488. SEVs were washed and incubated with gel-filtered mouse platelets for 60 minutes. Platelets were then washed and imaged with a confocal microscope (n=4). B. Bar graphs showing the MFI levels of BODIPY-488-labeled PNGaseF-treated sEVs taken up by platelets, compared relatively to untreated (control) sEVs, as observed by confocal microscopy (n=4 experiments; 3-4 fields of view of cells analyzed per experiment). C. Representative confocal images of platelets incubated with anti-CD63-treated sEVs. LNCaP-C4-2-sEVs were incubated overnight with anti-CD63 blocking antibody, isotype IgG control, or vehicle (control), washed with 100,000 g centrifugation, and then labeled with WGA-Alexa Fluor 488 for 4 hours. The treated sEVs were then incubated for 60 minutes with isolated mouse platelets pre-stained with WGA-Alexa Fluor 594 (red) (n=5). D. Bar graph representing the quantification of sEV levels (Alexa Fluor 488-MFI) in platelets (red) observed by confocal microscopy in panel C. sEVs treated with anti-CD9 or anti-TSP1 are an additional control group (control and anti-CD63 groups n=5, IgG n=3, CD9 / TSP1 n=4, cells from 3 fields of view analyzed per experiment). E. Quantification of MFI levels of sEVs treated with PNGaseF, anti-CD63, a combination of PNGaseF and anti-CD63, and O-glycosidase (O-glyco) compared relatively to untreated sEVs in platelets (control) as evaluated by confocal microscopy (n=7 for control and anti-CD63, n=3 for others). F. MFI levels of sEVs in platelets pretreated with the cytoskeletal inhibitors cytochalasin D (50 μM), ML141 (2 μM), and wiscostatin (10 μM), as quantified by confocal microscopy and compared to vehicle alone (control) (n=3). A-F. Graphs represent mean ± SEM, and n is the biological repeat.The p-values ​​were determined using the Kruskal-Wallis test, followed by Dunn's post-hoc multiple comparison tests (D, E, F) and the Mann-Whitney U test (B). [Figure 4] Inhibition of cancer sEV-induced platelet activation. A. Representative FACS histogram of platelet activation by LNCaP-C4-2-sEV treated with anti-CD63 fab fragment or vehicle alone. ADP (10 μM) was used as a platelet agonist (n=4). B. MFI of platelet activation by various treatments expressed in relation to sEV treatment as measured by FACS in Panel A (n=4). C. Percentage of activated platelets measured by FACS using JON / A(PE) antibody in Panel A for integrin αIIbβ3 activation (n=5 for all groups except ADP (n=4)). D. Representative bar graph showing platelet P-selectin expression in the basal (resting) state or in the presence of LNCaP-C4-2-sEV, sEV treated with IgG isotype control, and sEV treated with anti-CD63 antibody (n=3). E. FACS analysis of platelet activation by 20 μg / ml PC3 cell line-derived sEVs pretreated with anti-CD63 or IgG isotype control Fab fragments (n=4). F. Percentage of activated platelets measured by FACS using JON / A(PE) antibody from panel E for integrin αIIbβ3 activation (n=4). G. PCR analysis of hRPL28 in mouse platelets incubated with LNCaP-C4-2-sEVs treated with anti-CD63 or IgG control Fab fragments. mRNA from LNCaP-C4-2 cells serves as a positive control for hRPL28. Mouse GAPDH serves as a loading control for platelets. Graphs represent mean ± SEM, and n is the biological replicate. P-values ​​were determined by the Kruskal-Wallis test followed by Dunn's post-hoc test. [Figure 5]Platelet-RPTPα and sEV-CD63 mediated platelet activation signaling cascade. Isolated mouse platelets stained with A.WGA-594 (red) were incubated for 60 minutes with LNCaP-C4-2-sEV (10 μg / ml) labeled with WGA-Alexa fluor 488 (green) or sEVs pretreated with IgG isotype (control) and anti-CD63 antibody. In parallel, platelets were also pretreated with anti-RPTPα antibody for 30 minutes and subsequently incubated with labeled sEVs. Unbound sEVs were removed by centrifugation, platelets were fixed with 4% PFA, and visualized using a confocal microscope. Representative confocal images of platelets containing sEVs are shown (n=4). Bar graphs showing the mean levels of LNCaP-C4-2-sEV in platelets detected by BA confocal microscopy (MFI of Alexa fluor-488 per platelet compared relatively to the sEV+ group (black bars)) (columns 2 and 5: n=4, RPTP: n=5, others: n=6). C-H. Isolated mouse platelets (2 × 10⁸ / ml) were incubated with LNCaP-C4-2-sEV (20 μg / ml) or vehicle alone (control) for specified times. Subsequently, platelets were washed, lysed, and the specified proteins were analyzed by Western blotting. Representative immunoblots and their respective quantitative densitometry analyses are shown on the right (D. RP and 5 min: n=6, others: n=3, Fn=3; H. Group RP and 90 min in the left panel: n=4, others: n=3). Graphs represent mean ± SEM, and n is the biological repeat. The p-value was determined using the Kruskal-Wallis test followed by Dunn's post-hoc test. [Figure 6]RPTPα is required for sEV-induced signaling pathways in platelets. Isolated mouse platelets (2 × 10⁸ / ml) were pretreated with RPTPα antibody or IgG (0.01 μg / ml) for 30 minutes and washed to remove unbound antibody. These platelets were then incubated with LNCaP-C4-2-sEV (20 μg / ml) or vehicle alone (control) for 5 minutes (A, B) and 90 minutes (C~G), and incubated with thrombin (0.05 U / ml) for 15 minutes. The platelets were then washed and subjected to Western blotting analysis to detect the specified protein. Western blots (C, D, and F) were reprobed with PLCγ2, Akt, and P38 antibodies and showed the same GAPDH as indicated. The quantitative densitometry analyses for each group are shown in the panel below (A-B, D: control and negative control groups n=6, positive control group n=3; C, E: n=3; F: control and negative control groups n=4, positive control group n=3). The graphs represent the mean ± SEM, where n is the biological replicate. P-values ​​were determined by the Kruskal-Wallis test followed by Dunn's post-hoc multiple comparison test. [Figure 7] CD63 blocking antibodies inhibit cancer sEV-mediated platelet activation cascades and thrombus formation in vivo. A. Representative immunoblots of mouse platelets incubated with LNCaP-C4-2-sEV pretreated with CD63 or CD9 blocking antibody (0.01 μg / ml) or IgG Fab fragment. B. Quantitative densitometry analysis of immunoblots A (n=3) showing phosphoprotein levels (relative to IgG treatment) after normalization to total protein for each anti-CD63 and anti-CD9 treatment. C. Occlusion time (n=5, 7, and 4 for each group) of WT mice injected with LNCaP-C4-2-sEV pretreated with anti-CD63 Fab fragment (0.01 μg / ml) or IgG, followed by 10% FeCl3-induced carotid thrombosis (injury). D. Schematic diagram illustrating the mechanism of cancer sEV-mediated thrombus formation in the circulatory system. The graph shows the mean ± SEM, where n is the biological replicate. P-values ​​were determined by the Kruskal-Wallis test followed by Dunn's post-hoc multiple comparison test. [Figure 8] Characterization of sEVs. A. Representative Western blots of LNCaP-C4-2 cell lysates and LNCaP-C4-2-sEV lysates. sEV-specific markers CD63 and caveolin 1 were detected mainly in the sEV lysates, and only in very small amounts in the cell lysates. Annexin II, ezrin, α-actinin 4, and β-actin were undetectable in the sEV fraction. B. Transmission electron microscope (TEM) images of sEVs of various sizes, showing the purity and structural integrity of sEVs. N=3 biological replicates. C. Histogram showing the percentage frequency distribution of LNCaP-C4-2 sEV sizes analyzed from TEM images. N=3 biological replicates. D. Nano-FACS analysis of the LNCaP-C4-2 sEV fraction, showing the purity of isolated sEVs. Over 95% of the purified particles were less than 180 nm in size, which corresponds to the characteristic 30–150 nm size of sEVs (especially exosomes). Beads of different sizes and sEV-containing buffer (filtered PBS) were used as control groups. E. Representative NTA of LNCaP-C4-2 sEVs (UC-sEVs) purified by fractionation ultracentrifugation, and control is 0.1 μm filtered PBS used to resuspend sEVs. Biological replicates of n=6. Particle size (diameter, μM) is shown on the x-axis. [Figure 9]Uptake of LNCaP-C4-2 sEVs by human platelets. A. WGA-Alexa fluor-488-labeled LNCaP-C4-2 sEVs were treated with anti-CD63 antibody or IgG and incubated with purified human platelets (2 × 10⁸ / ml) for 60 minutes. Platelets were washed and analyzed by confocal microscopy. Representative 3D reconstructed images show sEVs in green and platelets in red. B. Representative TEM images of human platelets co-incubated with LNCaP-C4-2 sEVs or vehicle alone. The left panel shows the entire platelet. The area enclosed in yellow is magnified and shown in the right panel. Blue arrows indicate LNCaP-C4-2 sEVs within the platelet. C. Bar graphs (quantified from TEM images in B) represent the mean (±SEM) number of membrane-bound and internalized sEVs observed for each cross-section of mouse and human platelets. Experiments were conducted on mouse and human platelets, with n=4 each (analysis of a total of 20 sections in mice and 30 sections in humans). The p-value was determined by the non-parametric Mann-Whitney U test. Histograms show the FACS analysis of isolated mouse platelets incubated for 60 minutes with fibroblast-derived sEVs (10 μg / ml) labeled with D. Alexa Fluor 488, mouse prostate cancer cell line (RM1)-derived sEVs (10 μg / ml), and vehicle (control). [Figure 10] Mouse platelets interact with (bind to / take up) various cancer-derived sEVs. sEVs from A-C.LNCaP-C4-2, LNCaP, PC3, and SK-RC-26b were labeled with WGA-Alexa Fluor-488 and washed by ultracentrifugation. These labeled cancer sEVs (20 μg / ml) were then incubated with mouse platelets (2 × 10⁸ / ml) for 60 minutes. The platelets were washed, and sEV uptake was analyzed using FACS. Restless platelets were treated with the vehicle alone as a control. [Figure 11]Detection of sEV-specific markers. A. Reverse transcriptase PCR analysis of various mRNAs known to be enriched in cancer. Total RNA was isolated from breast cancer (MDA-MB-231), prostate cancer (LNCaP-C4-2), and kidney cancer (SK-RC-26b) cells and sEVs and analyzed by PCR. GAPDH was used as a loading control. B. PCR analysis of prostate-specific membrane antigen (PSMA) in sEV and LNCaP, PC3 (prostate cancer), MDA-MB-231 (breast cancer), SK-RC-26b (kidney cancer), and mouse platelet cells. C. Gel-filtered mouse platelets were incubated with LNCaP-C4-2 sEV or vehicle alone in Tyrode's buffer for 60 minutes. Platelets were washed, total RNA was separated, and the RPL28 transcript was analyzed by PCR. Total RNA from LNCaP-C4-2 cells was used as a positive control. D. Blood was collected from the inferior vena cava of mice, placed in an ACD anticoagulant containing PGE1, and 100 μl of blood was incubated with LNCaP-sEV (10 μg / ml) at 37°C for 60 minutes. Next, platelets were isolated by gel filtration and analyzed for the presence of RPL28 transcripts by PCR. E. LNCaP-C4-2-sEV (150 μl) in PBS (20 μg / ml) was injected into the tail vein of mice. Control mice were injected with 150 μl of PBS alone. The mice were allowed to rest for 60 minutes, and then blood was collected from the inferior vena cava. Leukocytes were separated, platelets were purified by gel filtration, and total RNA was isolated from these cells. RNA samples were analyzed by PCR for the presence of RPL28. GAPDH was used as a loading control. [Figure 12]Detection of PCA3 in platelets from prostate cancer patients. A. As described in the Materials and Methods section, platelets were isolated from the blood of healthy donors or prostate cancer patients. All platelet RNA was isolated and analyzed for the presence of the prostate cancer markers PCA3 and EST00000501280 by nested PCR. GAPDH served as a loading control. B. PCA3 was amplified by PCR from LNCaP cells and platelets of prostate cancer patients and subjected to restriction digestion with BsgI and ScaI. C. Purified platelets from healthy controls, as well as from cancer patients before (Pre-OP) and after (Post-Op) prostatectomy, were analyzed for the presence of PCA3 by nested PCR. (n=11 healthy donors (control group) and 32 pre- and post-operative patients). LNCaP and VCaP cDNA were used as positive controls for PCA3, and GAPDH served as a loading control. D-E. NTA analysis of sEVs isolated from the plasma of healthy volunteers and cancer patients. D. Representative histograms of sEV size distribution and concentration (sEV / plasma ml) in healthy patients and patients before and after prostatectomy. E. Bar graph showing the mean sEV concentration per 1 ml of plasma. There were 7 control donors and 10 patients each before and after surgery. The graphs represent mean ± SEM, where n is the biological replicate. P-values ​​were determined by one-way ANOVA followed by Tukey's post-hoc multiple comparison test. [Figure 13]Detection of additional cancer sEV markers in platelets of prostate cancer patients. A. PCR analysis of lncRNA pCAT1 in LNCaP sEV, platelets from patient samples, and platelets from healthy donors. B. PCR detection of pCAT1 in platelets of prostate cancer patients before and after prostatectomy. Human GAPDH (hGAPDH) served as a loading control. C. Bar graph showing the number of preoperative patient samples positive for PCAT1 detection by PCR (n=30 donors). D, E. PCR analysis and quantification of patient samples positive for lncRNA TMPRSS2-ERG (n=14 donors). F. Synergistic effect of sEVs on ADP-mediated platelet aggregation. Platelets in 1× Tyrode's buffer containing calcium and fibrinogen were incubated with LNCaP-C4-2 sEV at the indicated concentration for 45 minutes, and aggregation was then evaluated in the presence of 10 μM ADP. The graph shows the aggregation rate 10 minutes after ADP treatment. The graph shows the mean ± SEM and the biological replicates of n=3. P-values ​​were determined by the Kruskal-Wallis test with Dunn's post-hoc test. [Figure 14] Platelet activation by sEVs derived from PC3 and SK-RC-26b cancer cell lines. A-B. PC3, LNCaP-C4-2, and SK-RC-26b cell-derived sEVs (20 μg / ml) pretreated with or untreated fab anti-CD63 antibody or fab IgG were incubated with mouse platelets (2 × 10⁸ / ml) for 60 minutes. Platelets were washed and platelet integrin αIIbβ3 activation was analyzed using JON / A(PE) antibody with FACS. Restless platelets were controlled by vehicle alone. Biological repeats of n=3. C. Representative flow cytometry histograms showing platelet P-selectin expression under basal (restless) conditions or in the presence of LNCaP-C4-2 sEVs, sEVs treated with IgG isotype controls, and sEVs treated with anti-CD63 antibody. Biological repeats of n=3. D. Flow cytometry histogram showing platelet annexin V expression under basal (resting) conditions, or in the presence of LNCaP-C4-2 sEVs and sEVs treated with anti-CD63 antibody. [Figure 15]Platelet uptake of CD63-mediated cancer sEVs. A-D. Labeled LNCaP-C4-2 sEVs were incubated with platelets isolated from WT, kindlin 3-deficient (K3-reduced, n=3 mice), CD36 knockout (CD36- / -, n=4 mice), AKT3 knockout (AKT3- / -, n=5 mice), and TLR2 knockout (TLR2- / -, n=3 mice). The MFI level of LNCaP-C4-2 sEVs was quantified from confocal images, taken up by platelets, and expressed as a relative comparison with WT. Graphs represent mean ± SEM, and n is the biological repeat. P-values ​​were determined by two-sided independent t-tests. [Figure 16]Cancer sEV-induced platelet activation signaling mechanism. A.WT mouse platelets (2 × 10⁸ / ml) were incubated with LNCaP-C4-2 sEV (20 μg / ml), ADP (10 μM), KODA-PC (capable of activating PLCγ2 via TLR2, 20 μM), or vehicle alone (control) for specified times. The platelets were then washed, lysed, and analyzed by Western blot to detect the specified proteins. Three biological replicates were performed (n=3). B-D. Platelets (2 × 10⁸ / ml) were pretreated for 15 minutes with a PI3K inhibitor (LY294002, 20 μM), a Src inhibitor (dasatinib, 10 μM), an Akt inhibitor (MK2206, 10 μM), an ERK inhibitor (PD98059, 10 μM), and a phospholipase C inhibitor (U73122), and then incubated with LNCaP-C4-2 sEV (20 μg / ml) for 90 minutes. To detect the specified proteins, platelets were washed, lysed, and analyzed by Western blot analysis. Biological replicates of n=3. E. Quantitative densitometry analysis of immunoblots of panels B-D. This shows the phosphoprotein levels of platelets treated with a Src inhibitor (dasatinib, 10 μM), a PI3K inhibitor (LY294002, 20 μM), and an Akt inhibitor (MK2206, 10 μM), followed by incubation with 20 μg / ml LNCaP-C4-2 sEV for 90 minutes (relative to untreated platelets incubated with LNCaP-C4-2 sEV). The graph represents the mean ± SEM and n=3 biological replicates. P-values ​​were determined by the Kruskal-Wallis test with Dunn's post-hoc test. [Figure 17]A. In vitro inhibition of sEV-mediated platelet activation by pharmacological inhibitors. Purified mouse platelets (2 × 10⁸ / ml) were pretreated with the inhibitors LY294002, MK2206, PD98059, or U73122 for 15 minutes, then incubated with LNCaP-C4-2 sEV (20 μg / ml) for 90 minutes, washed, and analyzed for integrin αIIbβ3 activation using FACS analysis. Thrombin (0.05 U / ml) was used as a positive control for 15 minutes. Actual MFI levels for representative experiments are shown in the bar graph (representing two biological replicates using platelets isolated from two animals in each replicate). B. Isolated mouse platelets (2 × 10⁸ / ml) were incubated with PC3 sEV (20 μg / ml) or vehicle alone (control) for 90 minutes. Platelets were then washed, lysed, and analyzed by Western blot analysis (representing two biological replicates). C. Elimination of sEV-independent signaling pathways in platelet activation. Quantitative densitometry analysis of immunoblots. This shows the levels of phosphoproteins in sEV-treated platelets in the presence of a specified inhibitor (compared to sEV-treated platelets alone). Platelets were treated with LNCaP-C4-2 sEV (20 μg / ml) simultaneously with apirase (1 U / ml) and RGD cyclic peptide (RGD, 100 μM), followed by incubation for 90 minutes. Platelets were pretreated with daltroban (100 μM) for 15 minutes and then incubated with LNCaP-C4-2 sEV (20 μg / ml) for 90 minutes (n=3 biological replicates for sEV and sEV + apirase, n=2 biological replicates for sEV + RGD and + daltroban). Graphs represent mean ± SEM. [Figure 18] A schematic diagram of an exemplary IgG molecule with various regions and sections labeled is shown. The CDR and framework region (FR) of one of the two variable region light chains and one of the two variable region heavy chains are also labeled. [Figure 19]A shows the A1806-3A1-3 heavy chain amino acid sequence (SEQ ID NO: 1) including the leader sequence (italicized). B shows the A1806-3A1-3 heavy chain nucleic acid sequence (SEQ ID NO: 2). C shows the A1806-3A1-3 light chain amino acid sequence (SEQ ID NO: 3) including the leader sequence (italicized). D shows the A1806-3A1-3 light chain nucleic acid sequence (SEQ ID NO: 4). [Figure 20] A shows the A1806-3A1-3 variable heavy chain amino acid sequence (SEQ ID NO: 5), which includes CDRH1 (SEQ ID NO: 6), CDRH2 (SEQ ID NO: 7), and CDRH3 (SEQ ID NO: 8). B shows the A1806-3A1-3 variable light chain amino acid sequence (SEQ ID NO: 9), which includes CDRL1 (SEQ ID NO: 10), CDRL2 (SEQ ID NO: 11), and CDRL3 (SEQ ID NO: 12). [Figure 21] Occlusion time in mice (immunodeficient mice used to grow human LNCAP-C4-2 tumors) injected bilaterally with LNCaP-C4 tumors. Mice were intravenously treated with control IgM or 3A1-3 antibody. Occlusion time was then measured in a FeCl3-induced carotid thromboembolic model. A shows the time to occlusion graphed. B shows photographs of tumor-free skin, tumors in the next row (mice treated with control antibody), and the two tumors at the bottom (mice treated with 3A1-3 antibody). Note that intratumoral thrombosis / bleeding was reduced as a result of 3A1-3 treatment. [Figure 22] 3A13 immunoprecipitates EIF3L from both LNCAP-C4 exosomes and cells. Confirmation of binding of EIF3L (67kd) by mutual IP with 3A13 (A and C) and commercially available anti-EIF3L polyclonal antibodies (B and D). A shows the gel probed with the commercially available anti-EIF3L antibody, B shows the gel probed with the 3A13 antibody (showing binding to EIF3L), C shows the gel probed with the 3A13 antibody, and D shows the gel probed with the commercially available anti-EIF3L antibody. These are two independent validation methods demonstrating that 3A13 recognizes EIF3L (in addition to mass spectrometry). [Figure 23]Direct binding of 3A13 to fluorescently labeled exosomes using an MST assay. A shows a capillary scan of a microscale thermophoresis assay. B shows that mAb-3A13 binds to LNCaP-C42 exosomes (target complex, bottom green line), and that this complex can be reduced by interfering with the interaction using commercially available recombinant EIF3L (blue line), but the strength of the interaction does not change (indicated by vertical shift). [Figure 24] This shows that mAb3A13 is likely to block LNCaP-C42 exosome uptake in vivo and in vitro. A shows that short-term treatment with 3A13 does not reduce tumor size (at least when injected with a delay), but platelet-mediated exosome uptake is blocked. B shows that 3A13 blocks platelet-mediated exosome uptake, which is measured by the presence of the cancer-specific human marker hRPL28 in mouse platelets. Note that the band disappears after 3A13 treatment. C shows that a similar (but less efficient) inhibition can be achieved with an anti-EIF4L antibody (bottom left). D shows that both 3A13 and another antibody of ours, 3H9B, inhibit cancer exosome uptake. [Figure 25] mAb-3A13 prevents platelet activation induced by prostate cancer LNCaP-C4-2 exosomes (measured by FACS) (summary graphs A and C). Platelet activation was evaluated using JON / A(PE) antibody with FACS. B and D: Anti-EIF3L antibody can also inhibit platelet activation. This indicates the importance of EIF3L in this process. C and D are summaries of the FACs curves shown above. [Figure 26] This study demonstrates that EIF3L can be detected in exosomes of the kidney cancer cell line (SK-rc26b). [Figure 27]mAb-3A13 prevents platelet activation induced by renal cancer SK-Rc-26b exosomes (measured by FACS) (summary in A and C). Platelet activation was evaluated using JON / A(PE) antibody with FACS. B and D show that 3A13 inhibits platelet activation induced by prostate cancer LNCaP-C4-2 exosomes (measured by FACS). Platelet activation was evaluated using JON / A(PE) antibody with FACS. [Figure 28] This study demonstrates that EIF3L is detectable in exosomes derived from colorectal cancer, renal cancer, and prostate cancer cell lines. Both the anti-EIF3L antibody and the 3A13 antibody (excluding the 3H9B antibody) react with three distinct lines of colorectal cancer exosomes (CaCO2, HT29, and HCT) as demonstrated by dot blot analysis. [Figure 29] This shows the levels of cancer exosomes in the blood of a control group (non-cancer subjects) and prostate cancer patients before (pre-operative) and after (post-operative) radical prostatectomy. A shows the exosome profile in the control blood, and B and C show exosomes derived from the blood of prostate cancer patients before (pre-operative) and after (post-operative) radical prostatectomy. D is a bar graph summarizing the results shown in A-C. [Figure 30]The results of screening plasma from prostate cancer patients using mAb-3A13 and anti-EIF3L are shown. A. Purified platelets from a healthy control group, as well as from cancer patients before (Pre-OP) and after (Post-OP) prostatectomy, were analyzed for the presence of PCA3 by nested PCR. (n=11 healthy donors (control group) and 32 pre- and post-operative patients). LNCaP and VCaPcDNA were used as positive controls for PCA3, and GAPDH served as a loading control. B shows that the 3A13 antibody binds to exosomes in prostate cancer patients before prostatectomy but not after cancer removal. Therefore, 3A13 reacts to circulating exosomes in patients (and can be used for diagnosis). C and D show that the anti-EIF3L antibody also recognizes the same samples from prostate cancer patients that are recognized by 3A13(B). Dots of patient-derived plasma were placed on immunoblotting paper and colored using 3A13 antibody (B) or antibodies against EIF3L (C and D). This simple dot blot assay requires droplets of plasma or serum and can be used for cancer screening, detection, and staging. [Figure 31] This shows secondary screening of plasma from prostate cancer patients. The 3A13 antibody does not react with plasma from healthy donors (Figures 32A and B), but it binds to plasma from prostate cancer patients before prostatectomy, but not after cancer removal. A. Dots of patient plasma were placed on immunoblotting paper and colored using the 3A13 antibody. B. Dots of patient plasma were placed on immunoblotting paper and colored using the anti-EIF3L antibody. C and D show optimization and improvement of dot blotting sensitivity using different plasma sample preparation methods. [Figure 32] This shows that mAb-3A13 binds to EIF3L in LnCap-C4 cells. A shows that mAb-3A13 pulls down EIF3L in LnCap-C42 cell lysates (indicated by arrows). B shows the reverse experiment. An antibody against EIF3L immunoprecipitated the antigen recognized by the 3A13 antibody. These are two independent validation methods (in addition to mass spectrometry) that demonstrate 3A13 recognizes EIF3L. [Figure 33]This study demonstrates that 3A1-3 mAb reduces platelet activation induced by colorectal cancer exosomes. A shows the FACS analysis profile (gray: unstained control platelets; blue: resting, untreated platelets; red: platelets activated with CaCo-2 and treated with control mouse IgM kappa isotype antibody; green: platelets activated with exosomes pretreated with 3A1-3 mAb). B shows summary bar graphs of five independent experiments. Details: CaCo-2 cells (ATCC number HTB-37™) are epithelial cells isolated from colon tissue of a 72-year-old Caucasian male with colorectal adenocarcinoma. Exosome isolation was performed by fractional centrifugation of the cell supernatant. Exosomes were pretreated overnight with 3A1-3 mAb or mouse IgM kappa isotype control. Mouse platelets were purified by gel filtration (Sepharose CL-2B column) and incubated with pretreated exosomes for 45 minutes. Platelet integrin αIIbβ3 activation was evaluated using JON / A(PE) antibody and FACS analysis with a CytoFLEX flow cytometer, and analyzed with FlowJo10 software.

[0018] definition To facilitate understanding of the present invention, numerous terms are defined below.

[0019] As used herein, the terms “exosome” and “small extracellular vesicle” (also known as “sEV”) refer to vesicles with a diameter of less than 200 nm, as published in the Journal of Extracellular Vesicles and described in the MISEV2018 guidelines.

[0020] As used herein, the term “antibody” is intended to refer to an immunoglobulin molecule consisting of four polypeptide chains: two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain consists of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region consists of three domains (CH1, CH2, and CH3). Each light chain consists of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region consists of one domain (CL). The VH and VL regions can be further subdivided into hypervariable regions (called complementarity-determining regions (CDRs)) sandwiched between more conserved regions (called framework regions (FRs)). Each variable region (VH or VL) contains three CDRs called CDR1, CDR2, and CDR3 (see Figure 18). Each variable region also contains four framework subregions designated as FR1, FR2, FR3, and FR4 (see Figure 18), which may be human framework subregions.

[0021] As used herein, the term “antibody fragment or portion” refers to a portion of an intact antibody. Examples of antibody fragments or portions include, but are not limited to, linear antibodies, single-chain antibody molecules, Fv, Fab, and F(ab')2 fragments, and multispecific antibodies formed from antibody fragments. Antibody fragments preferably retain at least a portion of the heavy chain and / or light chain variable region.

[0022] As used herein, the terms “complementarity-determining region” and “CDR” refer primarily to regions involved in antigen binding. The light chain variable region has three CDRs (CDRL1, CDRL2, and CDRL3), and the heavy chain variable region has three CDRs (CDRH1, CDRH2, and CDRH3).

[0023] As used herein, the term “framework” refers to residues in the variable region other than the CDR residue. There are four framework subregions (FR1, FR2, FR3, and FR4) that constitute the framework (see Figure 18). To indicate whether a framework subregion is in the light chain variable region or the heavy chain variable region, “L” or “H” may be added to the abbreviation of the subregion (for example, “FRL1” indicates framework subregion 1 in the light chain variable region). It has been noted that in certain embodiments, the human EIF3L-binding molecule of the present invention may have a framework smaller than the complete framework (for example, the human CD63-binding molecule may have a framework that contains only one or more of the four subregions).

[0024] As used herein, the term “complete human framework” means a framework having an amino acid sequence naturally found in humans. Examples of complete human frameworks include, but are not limited to, KOL, NEWM, REI, EU, TUR, TEI, LAY, and POM (see, for example, Kabat et al., (1991) Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA; and Wu et al., (1970) J. Exp. Med. 132, 211-250 (both incorporated herein by reference)). In certain embodiments, the human CD63-binding molecules herein have a complete human framework.

[0025] As used herein, the terms “subject” and “patient” refer to any animal (e.g., mammals, e.g., dogs, cats, birds, livestock, preferably humans).

[0026] As used herein, the terms “codon” or “triplet” refer to a group of three adjacent nucleotides that designate one of the naturally occurring amino acids found in a polypeptide. The terms also include codons that do not designate any amino acid. It should also be noted that, due to the degeneracy of the genetic code, there may be many codons that code for the same amino acid. Therefore, many of the bases in the nucleic acid sequences of the present invention can be modified without changing the actual amino acid sequence they encode. This disclosure is intended to encompass all such nucleic acid sequences.

[0027] As used herein, the terms “oligonucleotide having a polypeptide-coding nucleotide sequence,” “polynucleotide having a polypeptide-coding nucleotide sequence,” and “nucleic acid sequence having a peptide-coding nucleotide sequence” mean a nucleic acid sequence containing a coding region of a particular polypeptide. The coding region may exist in the form of, for example, cDNA, genomic DNA, or RNA. If present in the form of DNA, the oligonucleotide or polynucleotide may be single-stranded (i.e., sense strand) or double-stranded. Suitable regulatory elements (e.g., enhancer / promoter, splice junction, polyadenylation signal, etc.) may be located near the coding region of the gene if necessary to enable proper transcription initiation and / or correct processing of primary RNA transcription. Alternatively, the coding region utilized in the expression vector of the present invention may contain endogenous enhancer / promoter, splice junction, intervening sequence, polyadenylation signal, etc., or a combination of both endogenous and exogenous regulatory elements.

[0028] Furthermore, as used herein, there is no size limit or distinction between the terms “oligonucleotide” and “polynucleotide.” Both terms simply refer to molecules composed of nucleotides. Similarly, there is no size distinction between the terms “peptide” and “polypeptide.” Both terms simply refer to molecules composed of amino acid residues.

[0029] As used herein, the “complementary sequence of” a given sequence is used in relation to a sequence that is completely complementary to that sequence over its entire length. For example, sequence 5'-AGTA-3' is the “complementary strand” of sequence 3'-TCAT-5'.

[0030] When used in relation to nucleic acids, the term "isolated" typically refers to a nucleic acid sequence that has been identified and isolated from at least one related contaminating nucleic acid (e.g., a host cell protein), such as "isolated oligonucleotide," "isolated polynucleotide," or "isolated nucleic acid sequence encoding a CD63-binding molecule."

[0031] As used herein, the terms “purified” or “purify” refer to the removal of contaminants from a sample. For example, an EIF3L-binding molecule (e.g., an antibody or antibody fragment) can be purified by removing contaminating non-immunoglobulin proteins. It is also purified by removing immunoglobulins that do not bind to the same antigen. Removal of non-immunoglobulin proteins and / or immunoglobulins that do not bind to a particular antigen increases the proportion of antigen-specific immunoglobulins in the sample. In another example, recombinant antigen-specific polypeptides are expressed in bacterial host cells, and the polypeptides are purified by removing host cell proteins, thereby increasing the proportion of recombinant antigen-specific polypeptides in the sample.

[0032] As used herein, the term “Fc region” refers to the C-terminal region of an immunoglobulin heavy chain. The “Fc region” may be a native sequence Fc region or a variant Fc region (e.g., with increased or decreased effector function). [Modes for carrying out the invention]

[0033] This specification provides human EIF3L-binding molecules and nucleic acid sequences encoding such molecules. In certain embodiments, human EIF3L-binding molecules having specific light chain and / or heavy chain variable regions, or light chain and / or heavy chain CDRs (e.g., monoclonal antibodies or their antigen-binding fragments), and methods are provided herein for treating a pro-thrombus condition involving pathological exosome production in a subject (e.g., a human subject with tumor-mediated thrombosis) using such molecules, and / or other EIF3L-binding molecules, and / or CD63-binding molecules. In some embodiments, the presence or level of cancer is detected by detecting CD63-positive and / or PCA3-positive exosomes in a sample.

[0034] In studies conducted during the development of the embodiments described herein, the inventors demonstrated that platelet uptake of cancer cell-derived sEVs is mediated in vitro and in vivo via sEV-tetraspanin CD63 or EIF3L, and further accurately outlined the pathway leading to platelet activation. Platelets accumulate cancer cell-derived mRNA, which may function as a predictive marker for the thrombus-promoting state in cancer patients.

[0035] Platelet hyperreactivity and thrombosis are life-threatening complications in cancer patients. Tumor-induced platelet activation is a complex process involving direct interactions. Understanding the mechanisms of tumor-platelet communication and platelet activation can help in the development of targeted therapies to prevent thrombosis in cancer patients. In research conducted during the development of the embodiments herein, the inventors elucidated a novel mechanism of cancer-platelet communication mediated by sEVs. This involves CD63 and EIF3L on cancer sEVs and RPTPα on platelets, leading to the accumulation of cancer markers in platelets, platelet hyperreactivity, and thrombosis. Platelets selectively take up sEVs from malignant cells, thereby accumulating tumor markers. The prostate cancer marker PCA3 is present in platelets of prostate cancer patients before prostatectomy but absent after prostatectomy. This suggests the value of cancer sEV markers in platelets in both cancer detection and prediction of thrombotic events. Cancer sEV uptake occurs through a novel mechanism involving CD63 and EIF3L on sEVs and platelet RPTPα, leading to platelet activation and subsequent thrombosis. Interfering with this mechanism using anti-CD63 antibodies or fragments thereof, or anti-EIF3L antibodies or fragments thereof, prevents both sEV uptake and thrombosis in vivo. Therefore, sEV-CD63 and EIF3L are therapeutic targets for treating and preventing thrombosis in cancer patients (e.g., using anti-CD63 antibodies or anti-EIF3L antibodies).

[0036] In certain embodiments, the human EIF3L-binding molecule comprises one or more antibodies, variable regions, or CDRs shown in SEQ ID NOs: 1, 3, 5-12, and / or variable regions or CDRs having one or more conserved or non-conserved amino acid changes in these SEQ ID NOs: 1, 3, 5-12, and a nucleic acid sequence encoding SEQ ID NOs: 1, 3, 5-12 (e.g., using at least a portion of the nucleic acid sequence of SEQ ID NO: 2 or 4). Modifications to the amino acid sequence of the CDR or variable region (see Figures 19-20) can be generated by modifying the nucleic acid sequence encoding the amino acid sequence. Nucleic acid sequences encoding a given CDR or variable region variant can be prepared by methods known in the art using the guidelines herein for specific sequences. These methods include, but are not limited to, site-directed (or oligonucleotide-mediated) mutagenesis, PCR mutagenesis, and preparation by cassette mutagenesis of previously prepared nucleic acids encoding the CDR or variable region.

[0037] Simply put, to perform site-directed mutagenesis of DNA, the start DNA is first modified by hybridizing an oligonucleotide encoding the desired mutation onto a single strand of such start DNA. After hybridization, DNA polymerase is used to synthesize the entire second strand, using the hybridized oligonucleotide as a primer and the single strand of start DNA as a template. Thus, the oligonucleotide encoding the desired mutation is incorporated into the resulting double-stranded DNA.

[0038] PCR mutagenesis is also suitable for creating amino acid sequence variants of initiation CDRs (see, for example, Vallette et.al., (1989) Nucleic Acids Res. 17:723-733 (incorporated herein by reference)). Briefly speaking, when a small amount of template DNA is used as the initiation material for PCR, primers that are slightly different in sequence from the corresponding region in the template DNA can be used to generate a relatively large amount of specific DNA fragments that differ from the template sequence only at positions where the primer differs from the template.

[0039] Another method for preparing variants, cassette mutagenesis, is based on the technique described below: Wells et al., (1985) Gene 34:315-323 (incorporated herein by reference). The starting material is a plasmid (or other vector) containing the start CDR or variant region DNA to be mutated. The codon(s) in the start DNA to be mutated are identified. There must be specific restriction enzyme sites on both sides of the identified mutation site(s). If such restriction sites are not present, they can be generated using the oligonucleotide-mediated mutagenesis method described above to introduce them into the appropriate positions in the start polypeptide DNA. The plasmid DNA is cleaved at these sites to linearize it. A double-stranded oligonucleotide encoding the DNA sequence between the restriction sites but containing the desired mutation(s) is synthesized using a standard procedure, and the two strands of the oligonucleotide are synthesized separately and then hybridized together using a standard method. This double-stranded oligonucleotide is called a cassette. This cassette is designed to have 5' and 3' ends compatible with the ends of a linearized plasmid, allowing for direct ligation of the plasmid. This plasmid currently contains a variant DNA sequence.

[0040] Alternatively or additionally, a desired amino acid sequence encoding a CDR variant or variable region variant can be determined, and nucleic acid sequences encoding such amino acid sequence variants can be synthetically generated. Conservative modifications can be made to the amino acid sequences of the CDR or variable region. Naturally occurring residues are classified into classes based on common side-chain properties.

[0041] (1) Hydrophobic: norleucine, met, ala, val, leu, ile, (2) Neutral hydrophilic: cysteine, serine, threonine, (3) Acidic: asp, glu, (4) Basicity: asn, gln, his, lys, arg, (5) Residues that affect chain orientation: glycine, proline, and (6) Aromatics: trp, tyr, phe.

[0042] Conservative substitution involves replacing one member of a particular class with another member of the same class within a specific antibody, variable region, or CDR, such as in SEQ ID NOs: 1, 3, 5-12.

[0043] The CDR of the present invention can be used with any type of suitable framework. In some embodiments, the CDR is used with a fully human framework or a sub-region of a framework. For example, the NCBI website contains sequences of known human framework regions. Examples of human VH sequences include, but are not limited to, VH1-18, VH1-2, VH1-24, VH1-3, VH1-45, VH1-46, VH1-58, VH1-69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33, and VH3-35. Examples include VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1, and VH7-81, which are described in Matsuda et al., (1998) J. Exp. Med. 188: 1973-1975 and contain the complete nucleotide sequences of the human immunoglobulin chain variable region loci, which are incorporated herein by reference. Examples of human VK sequences, though not limited to them, include A1, A10, A11, A14, A17, A18, A19, A2, A20, A23, A26, A27, A3, A30, A5, A7, B2, B3, L1, L10, L11, L12, L14, L15, L16, L18, L19, L2, L20, L22, L23, L24, L25, L4 / 18a, L5, L6, L8, L9, O1, O11, O12, O14, O18, O2, O4, and O8. These are cited in Kawasaki et al., (2001) Eur. J. Immunol. 31:1017-1028; Schable and Zachau, (1993) Biol. Chem. Hoppe. These are presented in Seyler 374:1001-1022 and Brensing-Kuppers et al., (1997) Gene 191:173-181, all of which are incorporated herein by reference.Examples of human VL sequences include, but are not limited to, V1-11, V1-13, V1-16, V1-17, V1-18, V1-19, V1-2, V1-20, V1-22, V1-3, V1-4, V1-5, V1-7, V1-9, V2-1, V2-11, V2-13, V2-14, V2-15, V2-17, V2-19, V2-6, V2-7, V2-8, V3-2, V3-3, V3-4, V4-1, V4-2, V4-3, V4-4, V4-6, V5-1, V5-2, V5-4, and V5-6, which are listed in Kawasaki et al., (1997) Genome This is presented in Res.7:250-261 (incorporated herein by reference). A complete human framework can be selected from any of these functional germ cell genes. Generally, these frameworks differ from one another by a limited number of amino acid changes. These frameworks can be used in conjunction with the CDRs described herein. Further examples of human frameworks that can be used with the CDRs of the present invention include, but are not limited to, KOL, NEWM, REI, EU, TUR, TEI, LAY, and POM (see, for example, Kabat et al., (1991) Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA; and Wu et al., (1970), J. Exp. Med. 132:211-250 (both incorporated herein by reference)).

[0044] In certain embodiments, the human EIF3L-binding molecule of the present invention comprises an antibody or antibody fragment (for example, including one or more of the CDRs described herein, as shown in Figure 20). The antibody or antibody fragment of the present invention can be prepared, for example, by recombinant expression of immunoglobulin light and heavy chain genes in a host cell. For example, to recombinantly express an antibody, a host cell can be transfected with one or more recombinant expression vectors containing DNA fragments encoding the immunoglobulin light and heavy chains of an antibody, so that the light and heavy chains are expressed within the host cell and, preferably, secreted into the culture medium in which the host cell is cultured, and the antibody can be recovered from this medium. Standard recombinant DNA methodologies can be used to obtain the heavy and light chain genes of an antibody, incorporate these genes into a recombinant expression vector, and introduce the vector into host cells, as described below: Sambrook, Fritsch and Maniatis (eds), Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989); Ausubel, FM et al. (eds.), Current Protocols in Molecular Biology, Greene Publishing Associates, (1989); and U.S. Patent No. 4,816,397 by Boss et al. (all of which are incorporated herein by reference).

[0045] For certain antibodies, the anti-EIF3L antibody or fragment thereof prepared herein has the IgG isotype constant region shown in Table 1 below. [Table 1]

[0046] To express an antibody having one or more of the CDRs of this specification, DNA fragments encoding the variable regions of the light and heavy chains are first obtained. These DNAs can be obtained by amplifying and modifying the variable sequences of the light and heavy chains of germline cells using polymerase chain reaction (PCR).

[0047] Once germline VH and VL fragments are obtained, these sequences can be mutated to encode one or more of the CDR amino acid sequences disclosed herein (see Figure 20). The amino acid sequences encoded in the germline VH and VL DNA sequences can be compared to the CDR sequence(s) necessary to distinguish them from the germline sequences. The appropriate nucleotides of the germline DNA sequence are then mutated using the genetic code to determine which nucleotide changes should be made, so that the mutant germline sequence encodes a selected CDR. Mutation of the germline sequence can be carried out by standard methods (e.g., PCR-mediated mutagenesis (the mutant creotide is incorporated into PCR primers so that the PCR product contains the mutation) or site-directed mutagenesis). In other embodiments, the variable region is newly synthesized (e.g., using a nucleic acid synthesizer).

[0048] Once DNA fragments encoding the desired VH and VL segments are obtained (for example, by amplification and mutagenesis of germline VH and VL genes, or by synthesis, as described above), these DNA fragments can be manipulated using standard recombinant DNA techniques to convert variable region genes into full-length antibody chain genes, Fab fragment genes, or scFv genes, for example. In these manipulations, the DNA fragment encoding VL or VH is operably ligated to another DNA fragment encoding another polypeptide, such as an antibody constant region or a flexible linker. Isolated DNA encoding the VH region can be converted into a full-length heavy chain gene by operably ligating the VH-encoding DNA to another DNA molecule encoding the heavy chain constant regions (CH1, CH2, and CH3). The sequences of mouse and human heavy chain constant region genes are known in the art, and DNA fragments containing these regions can be obtained by standard PCR amplification. The heavy chain constant regions may be, for example, IgG1, IgG2, IgG3, IgG4, IgA, IgE, IgM, or IgD constant regions. In the case of Fab fragment heavy chain genes, the DNA encoding VH can be operably ligated to another DNA molecule that encodes only the heavy chain CH1 constant region.

[0049] Isolated DNA encoding the VL region can be converted into full-length light chain genes (and Fab light chain genes) by operably ligating the VL-encoding DNA to another DNA molecule encoding the light chain constant region CL. The sequences of mouse and human light chain constant region genes are known in the art (see, for example, Kabat, EA, et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USD Department of Health and Human Services. NIH Publication No. 91-3242), and DNA fragments containing these regions can be obtained by standard PCR amplification. The light chain constant region may be a kappa or lambda constant region.

[0050] To construct the scFv gene, the DNA fragments encoding VH and VL can be operably linked to another fragment encoding a flexible linker (e.g., amino acid sequence (Gly4-Ser)3) so that the VH and VL sequences can be expressed as a continuous single-chain protein having VL and VH regions linked by a flexible linker (see, for example, Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; and McCafferty et al., (1990) Nature 348:552-554 (all incorporated herein by reference)).

[0051] To express the antibody or antibody fragment of the present invention, DNA encoding partial or full-length light and heavy chains (e.g., obtained as described above) can be inserted into an expression vector such that the gene is operably ligated to transcriptional and translational regulatory sequences. In this context, the term “operably ligated” means that the antibody gene is ligated into the vector such that the transcriptional and translational regulatory sequences in the vector perform the intended function of controlling the transcription and translation of the antibody gene. The expression vector and expression regulatory sequences are typically selected to be compatible with the expression host cell used. The antibody light chain gene and antibody heavy chain gene can be inserted into separate vectors, or, more generally, both genes are inserted into the same expression vector. The antibody gene can be inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and vector, or, if restriction sites are absent, blunt-end ligation). Prior to the insertion of the light or heavy chain sequence, the expression vector may already contain the antibody constant region sequence. For example, one approach to converting VH and VL sequences into a full-length antibody gene is to insert them into an expression vector that already encodes the heavy chain constant region and the light chain constant region, respectively, such that the VH segment is operably ligated to the CH segment(s) in the vector, and the VL segment is operably ligated to the CL segment(s) in the vector. Additionally or alternatively, the recombinant expression vector may encode a signal peptide that promotes the secretion of the antibody chain from host cells. The antibody chain gene can be cloned into the vector such that the signal peptide is in-frame ligated to the amino terminus of the antibody chain gene. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide derived from a non-immunoglobulin protein).

[0052] In addition to the antibody chain gene, the recombinant expression vector of the present invention may possess regulatory sequences that control the expression of the antibody chain gene in host cells. The term “regulatory sequence” is intended to include promoters, enhancers, and other expression regulatory elements (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain gene. Such regulatory sequences are described, for example, in: Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) (incorporated herein by reference). It will be understood by those skilled in the art that the design of the expression vector (e.g., selection of regulatory sequences) may depend on factors such as the selection of host cells to be transformed and the desired level of protein expression. In certain embodiments, the regulatory sequence for mammalian host cell expression includes viral elements that induce high levels of protein expression in mammalian cells (e.g., cytomegalovirus (CMV) (e.g., CMV promoter / enhancer), Simianvirus 40 (SV40) (e.g., SV40 promoter / enhancer), adenovirus (e.g., adenovirus major late promoter (AdMLP)), and promoters and / or enhancers derived from polyomaviruses). For further descriptions of viral regulatory elements and their sequences, see, for example, U.S. Patent No. 5,168,062 by Stinski, U.S. Patent No. 4,510,245 by Bell et al., and U.S. Patent No. 4,968,615 by Schaffner et al. (all incorporated herein by reference).

[0053] In addition to antibody chain genes and regulatory sequences, the recombinant expression vector of the present invention may contain additional sequences (e.g., sequences that regulate vector replication in host cells (e.g., origin of replication) and selection marker genes). Selection marker genes facilitate the selection of host cells into which the vector has been introduced (see, for example, U.S. Patents 4,399,216, 4,634,665 and 5,179,017 by Axel et al.). For example, selection marker genes typically confer resistance to a drug (e.g., G418, hygromycin, or methotrexate) to host cells into which the vector has been introduced. Selection marker genes include a dihydrofolate lectase (DHFR) gene (for use in dhfr-host cells with methotrexate selection / amplification) and a neomycin gene (for G418 selection).

[0054] For the expression of light and heavy chains, the expression vector(s) encoding the heavy and light chains can be introduced into host cells using standard methods. The various forms of the term “transfection” are intended to encompass the wide variety of methods commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells (e.g., electroporation, calcium phosphate precipitation, DEAE dextran transfection, etc.).

[0055] In certain embodiments, the expression vector used to express the human EIF3L-binding molecule of the present invention is a viral vector (e.g., a retroviral vector). Such viral vectors may be used to generate a stably transduced cell line (e.g., for a continuous source of the EIF3L-binding molecule). In some embodiments, GPEX gene product expression technology (Catalent, Somerset, New Jersey) is used to generate a CD63-binding molecule (and a stable cell line expressing the EIF3L-binding molecule). In certain embodiments, expression technologies described in Bleck et al. WO0202783 and WO0202738 (both incorporated herein by reference in their entirety) are used.

[0056] Mammalian host cells for expressing the recombinant antibodies of the present invention include, for example, Chinese hamster ovary (CHO cells) (e.g., dhfr-CHO cells, described in Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220, e.g., RJ Kaufman and PA Sharp (1982) Mol. Biol. 159:601-621), NSO myeloma cells, COS cells, and SP2 cells. In other embodiments, the host cells express GnTIII as described in WO9954342 and U.S. Patent Publication 20030003097 (both incorporated herein by reference), and as a result, the expressed EIF3L-binding molecule increases ADCC activity. When a recombinant expression vector encoding an antibody gene is introduced into mammalian host cells, the antibody is generally produced by culturing the host cells for a period sufficient to allow antibody expression within the host cells, or more preferably by secreting the antibody into the culture medium in which the host cells are growing. The antibody can be recovered from the culture medium using standard protein purification methods.

[0057] Host cells can also be used to generate portions of intact antibodies (e.g., Fab fragments or scFv molecules). Variations of the above procedure will be understood to be within the scope of this disclosure. For example, it may be desirable to transfect host cells with DNA encoding either the light or heavy chain of the antibody of this disclosure. Recombinant DNA techniques can also be used to remove some or all of the DNA encoding either or both of the light and heavy chains that are not necessary for binding to EIF3L. Molecules expressed from such cleaved DNA molecules are also included in the antibodies of the present invention. Furthermore, a bifunctional antibody can be generated in which one heavy chain and one light chain are the antibody of the present invention, and the other heavy and light chains are specific to antigens other than EIF3L (e.g., by crosslinking the antibody of the present invention to a second antibody using a standard chemical crosslinking method).

[0058] In certain embodiments, the antibodies and antibody fragments of the present invention are produced in transgenic animals. For example, transgenic sheep and cattle can be designed to produce antibodies or antibody fragments in their milk (see, for example, Pollock DP, et al., (1999) Transgenic milk as a method for the production of recombinant antibodies. J.Immunol.Methods 231:147-157, incorporated herein by reference). The antibodies and antibody fragments of the present invention can also be produced in plants (see, for example, Larrick et al., (2001) Production of secretory IgA antibodies in plants. Biomol.Eng. 18:87-94, incorporated herein by reference). Additional methodologies and purification protocols are presented below: Humphreys et al., (2001) Therapeutic antibody production technologies: molecular applications, expression and purification, Curr. Opin. Drug Discov. Devel. 4:172-185, incorporated herein by reference. In certain embodiments, the antibodies or antibody fragments of the present invention are produced by transgenic chickens (see, for example, U.S. Patent Publications 20020108132 and 20020028488, both incorporated herein by reference).

[0059] In certain embodiments, the human EIF3L-binding molecule of the present invention (e.g., as an antibody or antibody fragment), or other EIF3L-binding molecules and / or CD63-binding molecules, are useful in immunoassays for detecting or quantifying human EIF3L and / or CD63-containing exosomes in a sample (e.g., a purified blood sample from a subject). In some embodiments, an immunoassay for CD63 or EIF3L typically involves incubating a biological sample in the presence of a detectably labeled antibody or antibody fragment of the present invention that can selectively bind to CD63 and / or EIF3L present on exosomes (e.g., if CD63 can be methylated), and detecting the labeled peptide or antibody that binds in the sample. Various clinical assay procedures are well known in the art.

[0060] The present invention provides an immunoassay method for determining the presence, quantity, or concentration of human exosomes having CD63 and / or EIF3L on the surface of a test sample. Such a method can be used with any suitable assay known in the art. Examples of such assays include, but are not limited to, immunoassays (e.g., sandwich immunoassays (e.g., monoclonal-polyclonal sandwich immunoassays, e.g., radioisotope detection (radioimmunosystay (RIA)), and enzyme detection (enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA) (e.g., Quantikine ELISA assay, R&D Systems, Minneapolis, Minnesota)), competitive inhibition immunoassays (e.g., forward and reverse), fluorescence polarization immunoassay (FPIA), enzyme amplification immunoassay method (EMIT), ARCHITECT assay (ABBOTT), bioluminescence resonance energy transfer (BRET), and homogeneous chemiluminescence assays.

[0061] Human CD63 and / or EIF3L-binding molecules can be captured on beads, nitrocellulose, or other solid supports capable of immobilizing soluble proteins (e.g., magnetic beads). Next, a sample containing human CD63 and / or EIF3L (e.g., exosomes with CD63 and / or EIF3L on their surface) is attached to the support and then washed with a suitable buffer to remove unbound proteins. A second detectably labeled molecule (e.g., an antibody or peptide) capable of binding to the human CD63 and / or EIF3L-binding molecule can be added to the solid support and then washed a second time with the buffer to remove unbound molecules. The amount of unbound label on the solid support can then be detected by a known method.

[0062] The detection of human CD63 and / or EIF3L-binding molecules can be carried out by binding to an enzyme used in enzyme-linked immunosorbent assay (EIA) or enzyme-linked immunosorbent assay (ELISA). The bound enzyme reacts with the exposed substrate to produce a chemical moiety that can be detected, for example, by spectrophotometer, fluorescence assay, or visual means. Enzymes that can be used to detectably label human CD63 and / or EIF3L-binding molecules according to the present invention include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase.

[0063] In some embodiments of the present invention, human CD63 and / or EIF3L detected in the above assay may be present in a biological sample (e.g., containing exosomes produced by cancer cells). Any sample containing human CD63 and / or EIF3L can be used. In certain embodiments, the sample is a biological fluid (e.g., blood, brain tissue, serum, lymph, urine, cerebrospinal fluid, amniotic fluid, synovial fluid, tissue extract, or homogenate). However, the present invention is not limited to assays using only these samples, and it is possible for those skilled in the art to determine preferred conditions that allow the use of other samples.

[0064] In certain embodiments, kits for detecting CD63 and / or EIF3L, comprising human CD63 and / or EIF3L detection molecules, are presented herein. Such kits may comprise any of the immunodiagnostic reagents described herein and may further comprise instructions for use of the immunodiagnostic reagents in an immunoassay to determine the presence of human CD63 and / or EIF3L in a test sample (e.g., a test sample containing CD63 and / or EIF3L expressing exosomes from cancer cells). The kit may also comprise other reagents (e.g., buffers, salts, enzymes, enzyme cofactors, substrates, detection reagents, etc.) necessary to perform the diagnostic assay or facilitate quality control evaluation. Other components (e.g., buffers and solutions for the separation and / or processing of the test sample, e.g., pretreatment reagents) may also be included in the kit. The kit may further comprise one or more other controls. One or more components of the kit may be lyophilized, in which case the kit may further comprise reagents suitable for reconstitution of the lyophilized components.

[0065] The various components of the kit may be supplied in suitable containers (e.g., microtiter plates) as needed. The kit may further include containers for holding or storing samples (e.g., sample containers or cartridges). Optionally, the kit may also include reaction vessels, mixing vessels, and other components to facilitate the preparation of reagents or test samples. The kit may also include one or more instruments (such as syringes, pipettes, forceps, measuring spoons, or similar) to assist in obtaining test samples. [Examples]

[0066] The following examples are provided to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and should not be construed as limiting its scope.

[0067] Example 1 Mechanisms of information exchange between tumors and platelets in cancer Thrombosis is one of the leading complications in cancer patients and often leads to death. However, the underlying mechanisms of platelet hyperactivation are not fully understood. We isolated mouse and human platelets and treated them with small extracellular vesicles (sEVs) from various cancer cell lines. We demonstrated that platelets very effectively take up sEVs from malignant prostate cancer cells. The uptake process is rapid, proceeds efficiently within the mouse circulation, and is mediated by the abundant sEV membrane protein CD63. Uptake of cancer cell-specific RNA leads to the accumulation of cancer cell-specific RNA in platelets both in vitro and in vivo. The human prostate cancer sEV-specific RNA marker PCA3 is detected in platelets of approximately 70% of prostate cancer patients. This was significantly reduced after prostatectomy. In vitro studies showed that platelet uptake of cancer sEVs induces potent platelet activation in a CD63-RPTPα-dependent manner. In contrast to physiological agonists (ADP) and thrombin, sEVs activate platelets via a non-standard mechanism dependent on active translation. In vivo studies demonstrated that thrombus formation was promoted in both a mouse tumor model and in mice injected intravenously with cancer sEVs. The pro-thrombus-forming effect of sEVs was normalized by blocking CD63.

[0068] Tumors communicate with platelets via sEVs, which deliver cancer markers and activate platelets in a CD63-dependent manner, leading to thrombosis. This highlights the diagnostic and prognostic value of platelet-related cancer markers and identifies novel pathways for intervention.

[0069] Materials and methods Patient sample Using a protocol approved by the Cleveland Clinic Foundation's Institutional Review Board, and with patient consent, blood samples (2–5 ml) were obtained from healthy volunteers and prostate cancer patients at the Cleveland Clinic Glickman Urology and Kidney Institute. Healthy volunteers were randomly selected and included 6 men and 5 women. Further details (e.g., PSA levels and tumor histology of patients undergoing prostatectomy) are shown in Table 2.

[0070] Table 2. Patient tumor metrics. Prostate-specific antigen (PSA), tumor size, Gleason grade, and androgen deprivation therapy (ADT) parameters for prostate cancer patients are shown in this example. [Table 2]

[0071] reagent Synthetic sEVs (plain liposomes) were purchased from Encapsula Nano Sciences (catalog number: CEP-500). CD63 blocking antibody (catalog number: H-193) was purchased from Santa Cruz Biotechnology (catalog number: sc-15363). The Fab fragment of CD63 was generated by papain digestion. PNGaseF (catalog number: P0704S) and O-glycosidase (catalog number: P0733S) were purchased from NewEnglandBioLabs. Cytochalasin D (catalog number: C8273), wiscosttine (catalog number: W2270), and ML141 (catalog number: SML0407) were purchased from Sigma-Aldrich. The inventors purchased dasatinib (catalog number: 11498) and RGD (catalog number: 14501) from Caymanchem; LY294002 (catalog number: S1105) from Selleckchem; and apirase (catalog number: A6410-200UN) and daltroban (catalog number: D7441) from Sigma Aldrich. Conjugated anti-mouse activated α IIb I purchased the β3 (clone JON / A) (catalog number: M023-2) monoclonal antibody from Emfret Analytics.

[0072] cell line The BJ normal human fibroblast cell line (catalog number CRL-2522), LNCaP-C4-2 human bone metastatic prostate cancer cell line (catalog number CRL-3314), LNCaP human prostate cancer cell line (catalog number CRL-1740), PC3 human prostate cancer cell line (catalog number CRL-1435), and MDA-MB-231 human breast cancer cell line (catalog number HTB-26) were all obtained from ATCC. The RM1 mouse prostate cancer cell line and the SK-RC-26b kidney cancer cell line were obtained from the labs of WDHeston and James Finke. LnCaP-C4-2 cell cultures of less than 15 passages and others of 4-12 passages were used. Cells were tested for the presence of mycoplasma using the MycoAlertT MPLUS assay.

[0073] animal Male mice aged 8-12 weeks with an average weight of 25-30g were used. C57BL / 6J mice and NSG (strain number: 005557) mice were obtained from JAX Labs. Kindrin 3-deficient mice (K3) expressing very low levels of mutant kindrin 3 protein were used. 機能低下型 ) was generated as described above. 43、62 CD63 KO mice were introduced to Roy L. Silverstein Labs. 42 From Hay Labs 63 Dr. S. Akira (Osaka University) 64The mice were obtained from [source]. APOE KO mice (strain number: 002052) and their control group, injected with RMI tumors, were 6 months old. The APOE KO mice were fed a high-cholesterol Western diet (Envigo Teklad, TD.96121) for 15 weeks. The mice were housed in micro-isolater cages with individual ventilation in a pathogen-free facility and subjected to a light-dark cycle consisting of 12 hours of light and 12 hours of dark. No disqualification or exclusion criteria were used in our study. Considering that the main in vivo experiments were conducted using prostate cancer cell lines—sEV—derived from male-specific prostate tissue and tumor xenografts, and considering that male sex has been reported to influence the growth and outcome of prostate tumors, we limited our study to male subjects. Randomization and blinding: Male littermates were assigned to different experimental groups of tumor xenograft model and sEV injection using a randomization process that alternately assigned animals to each group. The person responsible for conducting and evaluating the in vivo thrombosis study using a blinded method, and for performing the assay, was unaware of the animal group assignments.

[0074] Platelet separation Platelets were purified by gel filtration (Sepharose CL-2B column) as described above. 65 For functional studies, 2 × 10⁻⁶ units of HEPES buffered Tyrode's solution were used. 8 The solution was diluted to a platelet / ml concentration.

[0075] Isolation and characterization of small EVs LnCaP-C4-2 cell cultures of less than 15 passages and other cell cultures of 4–12 passages were used. Cells were cultured in RPMI (for LNCaP-C4-2) or DMEM / F12 medium supplemented with 15% FBS, 100 U / ml penicillin and streptomycin, 0.25 μg / ml amphotericin B, and further supplemented with non-essential amino acids (NEAAs). After the cells reached approximately 75% confluence, the culture flasks were washed five times with filtered PBS while gently shaking in a 45 RPM shaker. Cells were added to serum-free medium supplemented with 0.1% ultracentrifugation (110,000 g) sEV-free bovine serum albumin (BSA). After 24 hours, conditioning medium taken from four T175 flasks was pooled (approximately 120 ml, totaling approximately 5 × 10⁶). 7 Cells were conditioned and then subjected to fractional centrifugation at 4°C at 300g (10 minutes) followed by 2000g (10 minutes) to remove cell debris and apoptotic cell bodies. Next, the supernatant was centrifuged in a Sorvall-Bios16 centrifuge at 10,000g for 20 minutes at 4°C to remove large extracellular organisms (EVs). The supernatant was then filtered through a 0.22μm filter to remove EVs larger than 200nM (medium and large EVs), and then centrifuged at 110,000g at 4°C for 90 minutes using a Beckman 75Ti rotor to pelletize sEVs. The sEV pellet was resuspended and washed in ice-cold PBS filtered through a 0.1μm filter by ultracentrifugation at 110,000g, and the resulting sEV pellet was resuspended in PBS filtered through a 0.1μm filter.

[0076] Quantification of small EVs sEV was characterized by transmission electron microscopy (TEM), apogee FACS, nanoparticle tracking analysis (NTA), BCA protein assay (Thermo Fisher Scientific), and Western blotting. To confirm reproducibility, the inventors analyzed several batches of sEV by BCA protein assay and NTA. Based on BCA protein estimation and Nano-FACS or NTA analysis, an average sEV of 10 μg / ml corresponds to 1 × 10⁶. 11This corresponds to particles / ml. Serum-free medium supplemented with 0.1% ultracentrifugation (110,000g) bovine serum albumin (BSA), which is sEV-free, was subjected to an sEV separation protocol and analyzed by protein estimation and NTA to confirm EV depletion in the medium.

[0077] Isolation of small extracellular organisms (EVs) from blood cells Plasma was collected from blood samples and stored at -80°C until use. Briefly, 20 μl of plasma was diluted in PBS filtered through a 0.1 μm filter and centrifuged at 2000 g for 10 minutes to remove cell debris and apoptotic cell bodies. Next, the supernatant was centrifuged in a Sorvall-Bios16 centrifuge at 10,000 g for 20 minutes at 4°C to remove large extracellular molecules (EVs). The supernatant was then filtered through a 0.22 μm filter to remove EVs larger than 200 nM (medium and large EVs), and then centrifuged using a Beckman75Ti rotor at 110,000 g for 90 minutes at 4°C to pelletize sEVs. The sEV pellet was resuspended and washed in ice-cold PBS filtered through a 0.1 μm filter by ultracentrifugation at 110,000 g, and the resulting sEV pellet was resuspended in PBS filtered through a 0.1 μm filter.

[0078] Apogee FACS The Apogee A50 (Apogee Flow Systems) can identify extracellular vesicle (EV)-sized nanoparticles and is routinely used for EV characterization. Size-calibrated non-fluorescent silica beads (0.18, 0.24, 0.30, 0.59, 0.88, and 1.30 μm) were used for calibration and gating by small-angle light scattering (SALS) and large-angle light scattering (LALS). The system was washed with 10% bleach to remove adhering particles, and then washed with PBS filtered through a 0.22 μm filter. sEVs resuspended in PBS filtered through a 0.22 μm filter were analyzed at a flow rate of 1.5 μL / min and a retention time of 180 seconds.

[0079] Nanoparticle Tracking Analysis (NTA) A ZetaView (Particle Metrix, Germany) instrument was calibrated with 100 nm polystyrene nanoparticles and operated according to the manufacturer's instructions using the EV's default software settings. For each run, 1 ml of sample diluted in PBS filtered through a 0.1 μm filter was injected into the sample chamber at an ideal concentration of 50–200 particles / frame. Each measurement consisted of 3 cycles, scanning 11 cell locations and capturing 60 frames per location. The captured video was analyzed using the built-in ZetaView software 8.02.31. The following parameters were applied: maximum particle size 1000, minimum particle size 5, minimum particle brightness 20.

[0080] RNA extraction and PCR All sEV or platelet-derived RNAs were isolated using the miRCURY® RNA IsonKit (Exiqon) according to the manufacturer's protocol. All platelet and sEV-derived RNAs were reverse transcribed into cDNA containing random hexamers using the QuantiTect reverse transcription kit (Qiagen) as recommended by the manufacturer. The following primers were used: FTH1 134bp 5'AGGTGGCCGAATCTTCCT(Sequence ID 13) Reverse 5'CCAGTTTGTGCAGTTCCAGT (Sequence No. 14) Rab13 107bp Forward 5'CGGGACATCTTGCTCAAGT(Sequence ID 15) Reverse 5'AGGGAGCACTTGTTGGTGTT (Sequence No. 16) RPPH1 89bp Forward 5'CGGAGGGAAGCTCATCAGTG(Sequence ID 17) Reverse TGGCCCTAGTCTCAGACCTT (Sequence ID 18) RPL28 215bp Forward 5'CTTCCGCTACAACGGACTGA (Sequence ID 19) Reverse 5'CCATGCGCAGGTCGG (Sequence ID 20) PRC1 340bp Forward 5'CTATGATATTGACAGTCCTGCCAGTGGC (Sequence No. 21) Reverse 5'TATTTGCAACCTGTCCCAGAGCTCTCG (Sequence No. 22) hGA PDH229bp Forward 5'GAAGGTGAAGGTCCGGAGTC (Sequence No. 23) Reverse 3'TCAGAAGATGGTGATGGGATTTC (Sequence No. 24) mGAPDH 154bp Forward 5'ACTCCCACTCTTCCACCTTC (Sequence ID 25) Reverse 5'TCCAGGGTTTCTTACTCCTTG (Sequence No. 26) PSMA 177bp Forward 5'CATAGTGCTCCCTTTTGATTGTC (Sequence No. 27) Reverse 5'CTCTCACTGAACTTGGAAGCAAT (Sequence ID 28) PCAT1 322bp Step 1 Forward 5'GTGGAGAAGAGGCAGAAACA (Sequence No. 29) Step 1 Reverse 5'TGACTGCACTGTACCTTCATTAG (Sequence ID 30) Step 2 Forward 5'ATGACGCAAAGGAACCTAACT (Sequence ID 31) Step 2 Reverse 5'CTCCAAGGCTGGTCACTAT (Sequence No. 32) TMPRSS2ERG 600bp Step 1 Forward 5' CAGGAGGCGGAGGCGGA (Sequence No. 33) Step 1 Reverse 5'GGCGTTGTAGCTGGGGTGAG (Sequence No. 34) Step 2 Forward 5'GGAGCGCCGCCTGGAG (Sequence No. 35) Step 2 Reverse 5' CCATATTCTTTCACCGCCCACTCC (Sequence No. 36) LncRNA 273bp Forward 5'TGAGCACTTTCCCACCATAC (Sequence ID 37) Reverse 5'CCTCATTCACCCTCCAATCT (Sequence ID 38) FLT 130bp Forward 5'GCTACGAGCGTCTCCTGAAG (Sequence ID 39) Reverse 5'GGCCTGGTTCAGCTTTTTCT (Sequence No. 40) The above-mentioned PCA3 (120bp) primer nested PCR: Step 1: Forward 5'AGTCCGCTGTGAGTCT3' (SEQ ID NO: 41), reverse 5'CCATTTCAGCAGATGTGTGG3' (SEQ ID NO: 42). Step 2: Forward 5'ATCGACGCACTTTCTGAGT3' (SEQ ID NO: 43), reverse 5'TGGTTGGGCCTCAGATGGTAA3' (SEQ ID NO: 44). 59、66 The following PCR cycle conditions were typically used: 35 cycles of 3 minutes at 94°C, 30 seconds at 94°C, 45 seconds at 60°C, 1 minute at 72°C, and a final extension step of 10 minutes at 72°C. Primers were used at a concentration of 500 nM in Choice Taq Blue Master Mix (catalog no. CB4065-8, Denville). PCR products were subjected to electrophoresis in a 2% agarose gel at 110 V for 30-40 minutes and visualized under UV light using SYBR® Safe DNA Gel Stain (catalog no. S33102, Thermofisher).

[0081] Immunostaining and confocal microscopy The dyes WGA-Alexa Fluor-488 (catalog number W11261) and WGA-Alexa Fluor-594 (catalog number W11262) (both manufactured by ThermoFisher Scientific) were dissolved in filtered PBS according to the manufacturer's recommendations (without sodium azide), and centrifuged at 110,000 g at 4°C for 90 minutes using a Beckman 75Ti rotor. Any undissolved particles or aggregates formed in the solution were pelletized and removed. The supernatant of the dye was used to stain sEV and platelets at a final concentration of 5 μg / ml. WGA-Alexa Fluor-488 was added to sEV or PBS alone (negative control), placed on a rotating apparatus overnight at 4°C, and then washed with filtered ice-cold PBS at 110,000 g at 4°C for 90 minutes using a Beckman 75Ti rotor. The stained sEV and negative control pellets were then resuspended in filtered Tyrode's Buffer or PBS. Platelets were stained with WGA-Alexa Fluor-594 for 20 minutes, followed by washing with Tyrode buffer by centrifugation at 300 g at room temperature. Stained platelets were co-incubated with stained sEV or negative control. After co-incubation, platelets were washed, fixed with 4% PFA for 20 minutes, washed with PBS, and mounted on slides using ProLong® Diamond Antifade Mountant (catalog no. P36961; ThermoFisher Scientific).

[0082] Confocal images were acquired using a Leica SP5 confocal / multiphoton microscope and a Leica TCS SPE confocal microscope at the Lerner Institute's Imaging Core. Platelets were imaged using a 63× objective lens with a step size of 0.5 μm across the platelet height. Images were processed, and staining intensity was quantified using Volocity software and Image J. 3D images were prepared by merging confocal stacks using Volocity.

[0083] Transmission electron microscope Negative staining of sEV: TEM: sEVs were isolated, then suspended in 2.5% glutaraldehyde-0.1M phosphate buffer and fixed overnight at 4°C. The samples were then placed on a Formvarcarbon-coated grid and air-dried for 1 hour. The grid was rinsed five times with 0.1M phosphate buffer and distilled water, then treated with contrast agent and embedded in a mixture of 4% uranyl acetate and 2% methylcellulose (1:9). The grid was air-dried and observed on an FEI Tecnai G2 Spirit BioTWIN (transmission electron microscope, FEI, Hills Boroboro, Oregon) equipped with an Orius 832 CCD camera (11 megapixels, Gatan, Inc., Pleasanton, California) and DigitalMicrograph software (Gatan, Pleasanton, California).

[0084] Platelets were fixed in 2.5% glutaraldehyde-0.1M phosphate buffer for 90 minutes. The fixed cells were centrifuged at 4°C, and the platelet pellet was washed three times with 0.1M phosphate buffer and fixed with 1% osmium tetroxide at 4°C for 1 hour. Next, the plates were dehydrated stepwise with ethanol (50%, 70%, 90%, 96%, 100%) and embedded in epone. Thin sections were excised using an EM UC7 ultramicrotome (Leica Microsystems GmbH, Vienna, Austria), stained with uranyl acetate and lead citrate, and then examined using an FEI Tecnai G2 Spirit BioTWIN transmission electron microscope (FEI, Hills Boroboro, Oregon) equipped with an Orius 832 CCD camera (11 megapixels, Gatan, Inc., Pleasanton, California) and DigitalMicrograph software (Gatan, Pleasanton, California).

[0085] Western blot analysis After processing, platelets were pelletized and lysed in RIPA buffer on ice. Platelet lysates or cell lysates or sEV extracts were separated on a 12% polyacrylamide slab gel using the Mini-Protean II system (catalog no. 4561044 Bio-Rad Laboratories). Next, proteins were transferred to Immobilon-P, PVDF membrane (catalog no.: IPVH00010 Millipore) by electrophoresis, and the membrane was blocked with 5% skim milk powder or 5% BSA in TTBS (TTBS: 0.2M Tris [pH 7.4], 1.5M NaCl, 0.1% thimerosal, and 0.5% Tween 20). The membrane was washed with TTBS and incubated overnight at 4°C with the primary antibody. The following commercially available primary antibodies were used: anti-CD63 (E-12) (catalog number sc-365604), CD9 (ALB6) (catalog number sc-59140), caveolin 1 (7C8) (catalog number sc-53564), and annexin 2 / ANXA2 antibody (H-5) (catalog number sc-48397) (all manufactured by Santa Cruz Biotechnology). Phosphorylated SAPK / JNK (Thr183 / Tyr185) (81E11) (Catalog No. 4668S), Phosphorylated p38MAPK (Thr180 / Tyr182) (D3F9) (Catalog No. 4511T), p44 / 42MAPK (Erk1 / 2) (L34F12) (Catalog No. 4696), Phosphorylated p44 / 42MAPK (Erk1 / 2) (Thr202 / Tyr204) (Catalog No. 9101S), Akt (pan) (11E7) (Catalog No. 4685), Phosphorylated Akt (Ser473) (193H12) (Catalog No. 4058), PLCγ2 (Catalog No. 3872S), phosphorylated PLCγ2 (Tyr1217) (Catalog No. 3871S), Src (36D10) (Catalog No. 2109S), phosphorylated Src family (Tyr416) ​​(Catalog No. 2101S), Ezrin (Catalog No. 3145), GAPDH (14C10) (Catalog No. 2118S), α-actinin (D7U5A) (Catalog No. 15145S), and β-actin (Catalog No. 4967S) (all manufactured by Cellsignaling).Phosphorylated RPTPα (Ser180) from Biossusa (catalog number BS-5175R) and RPTPα from Novus Biologicals (catalog number NBP2-57255) were used. Next, the membranes were washed with TTBS and incubated at room temperature for 1 hour with appropriate secondary antibodies (catalog number A0545 Amersham) (catalog number A3682 Amersham) conjugated to horseradish peroxidase at a 1:5,000 dilution. Then, they were washed twice with TTBS for 15 minutes each, followed by four washes for 5 minutes each, and colored with an enhanced chemiluminescence (ECL) kit (catalog number 32132 Amersham).

[0086] Tail vein injection sEV was isolated from cultured cancer cells by fractionation centrifugation as described above, and 100 μl of sEV in PBS filtered through a 0.22 μm filter at a final concentration of 20 mg / ml was injected into the tail vein of mice. The mice were anesthetized, and blood samples were collected from the inferior vena cava 60 minutes later.

[0087] In vivo thrombosis assay As described above, we conducted in vivo thrombosis research using FeCl3-induced carotid thrombosis in C57BL / 6J male mice. 32 Mice were injected via tail vein with either 100 μl of cancer cell-derived sEV in PBS filtered through a 0.22 μm filter or PBS filtered through a 0.22 μm filter (control). Sixty minutes after injection, the mice were anesthetized by intraperitoneal injection with a ketamine / xylazine mixture (ketamine 100 mg / kg body weight, xylazine 10 mg / kg body weight). The carotid artery was exposed and injury was induced with 12% FeCl3 (10% FeCl3 for anti-CD63 experiments). The injured area of ​​the artery was observed using a Leica DM LFS microscope (Leica, Germany) with a ×10 / 0.30 objective lens. Images were acquired using a cooled high-speed digital camera (QImaging Retiga EXi Fast 1394) and Streampix acquisition software. 32 All mice were included in the study, and no exclusions were performed.

[0088] Xenotransplant model NSGs at 4-6 weeks of age. Cg-Prkdc is used as the xenotransplant model. scid Il2rg tm1Wjl We used SzJ male mice (purchased from Jackson Laboratory). The mice were anesthetized with a ketamine / xylazine mixture (ketamine 100 mg / kg body weight, xylazine 10 mg / kg body weight). LNCaP-C4-2 cells (4 × 10⁶ cells resuspended in 50% Matrigel (100 μl) diluted in PBS) were used. 5 The cells are injected subcutaneously into either side of the abdomen, and the tumor is reduced to approximately 1 cm. 3 After growing them, platelets were isolated. 19 During this period, mice carrying human tumor xenografts were injected with five doses of sEV blocking antibody (anti-sEV ab) or IgM as a control. All mice were included in the study, and no exclusion was performed.

[0089] FACS analysis As described above, platelets isolated by gel filtration were incubated with sEV isolated from cancer cells or control cells for 1 hour, and platelet integrin αII was analyzed using JON / A(PE) antibody (Emfret, catalog number M023-2) and FACS analysis. b β3 activation was evaluated. 67 Platelet annexin V and P-selectin expression was evaluated using annexin V FITC conjugate antibody (BD Pharmingen, catalog number 51-6587) and CD62P / P-selectin antibody (Psel.KO2.3), PE conjugate (ThermoFisher Scientific, catalog number A16339). Data were acquired using a FACS Calibur II instrument (Becton Dickinson, San Jose, California) and analyzed using FlowJo 10 software (TreeStar, Ashland, Oregon). A weak physiological agonist (ADP, 10 μM) and a strong physiological agonist (thrombin, 0.05 U / ml) were used as positive controls.

[0090] statistics All data are expressed as mean ± standard error of the mean (SEM). Prism9 software (GraphPad) was used for statistical testing and graphing. The Shapiro-Wilk normality test and the long normality test were used to determine the data distribution for n≧6. For small sample sizes N<6 and for non-normally distributed data even when n≧6, the inventors used the nonparametric Mann-Whitney U test to compare two groups, and the Kruskal-Wallis test with Dunn's post-hoc test for three or more groups. A p-value less than 0.05 was considered significant. In experiments with n=3, the minimum p-value achievable with nonparametric tests is 0.1000.

[0091] result Isolated mouse platelets incorporate sEVs. SEVs generated by a highly metastatic human prostate cancer cell line (LNCaP-C4-2) and other cancer cell lines were isolated and characterized according to MISEV 2018 (details in Supplementary Methods). Western blotting analysis demonstrated the presence of CD63 (sEV membrane marker) and caveolin 1 (sEV cytoplasmic marker) and the absence of α-actinin 4 (sEV negative marker) compared to LNCaP-C4-2 cell lysates (Figure 8A). Simultaneously, annexin II and β-actin (markers of prostasome and cytoplasmic contaminants, respectively) were identified. 20、21 ) was not present in the sEV lysate (Figure 8A). Ectosome marker (ezrin) 15 The absence of [unspecified element] indicates a dominance of the exosome population (Figure 8A). The size and structural integrity of purified sEVs were evaluated by transmission electron microscopy (TEM; Figures 8B, C). Negatively stained sEVs were observed as cup-shaped bimembrane vesicles, 98% of which were in the range of 30–150 nm, with an average diameter of 83.5 nm (Figures 8B, C). Apogee FACS analysis confirmed that 95% of the sEV fraction were in the range of 30–150 nm (Figure 8D). Furthermore, NTA analysis was used to show the number, concentration, and size of the particles (Figure 8E).

[0092] Next, using FACS, we demonstrated that platelets readily incorporated LNCaP-C4-2 / cancer sEVs, while the interaction of synthetic sEVs with platelets was minimal and not significantly different from that of fibroblast-derived sEVs (Figure 1A, B). This indicates process selectivity and cancer specificity. Confocal microscopy (Figure 1C, D, and Figure 9A) and TEM analysis confirmed the uptake of cancer sEVs by mouse and human platelets, indicating the presence of LNCaP-C4-2-derived cancer sEVs within platelets, although only a small fraction of the sEVs were associated with the platelet surface (Figure 1E and Figure 9B, C). Mouse platelets also preferentially incorporated mouse prostate cancer cell line (RM1)-derived sEVs compared to human fibroblast-derived sEVs (Figure 9D), confirming that the uptake of human cancer sEVs is cancer-specific rather than species-specific. Platelet uptake of cancer sEVs was rapid, with a significant amount of sEVs detected within 15-20 minutes after incubation, reaching a plateau after 45-60 minutes (Figure 1F).

[0093] Similar results were observed using surrogate prostate cancer cell lines PC3 and LNCaP, as well as other cancer cells (i.e., metastatic renal cell carcinoma cell line (SK-RC-26b)) (Figures 17A-C). Therefore, this appears to be a phenomenon specific to cancer in general.

[0094] Cancer sEVs transfer mRNA from cancer cells to platelets. To find cancer markers that are transferred to platelets by sEVs, the inventors analyzed several previously reported candidates: GTPase RAB13, ferritin heavy chain 1 (FTH1), ferritin light chain (FTL), and lncRNA RPPH1. 22~25 It was detected in both mouse and human platelets that lacked sEV (Figure 11A). Other markers, Polycomb inhibitory complex 1 (PRC1) and the prostate cancer marker PSMA were also detected. 26 It was not detected in cancer sEVs (Figure 11A, B). Ribosomal protein L28 (RPL28) 27Only LNCaP-C4-2 was highly enriched with cancer sEVs, but was not present in either mouse or human platelets (Figure 11A). It would be the most appropriate cancer sEV marker in platelets.

[0095] Isolated mouse platelets were incubated with LNCaP-C4-2-derived cancer sEVs in Tyrode's buffer, washed to remove unbound sEVs, and then analyzed by PCR. RPL28 mRNA was readily detected in platelets (Figure 11C). Experiments performed on whole mouse blood also revealed that RPL28 mRNA migrates to platelets (Figure 11D). Next, the inventors intravenously injected LNCaP-C4-2-derived cancer sEVs or vehicles and collected blood 60 minutes later. RPL28 was detected in platelets of mice injected with sEVs but not in the control group (Figure 11E). In contrast to platelets, the level of RPL28 in leukocytes did not change significantly after sEV injection. To demonstrate the importance of this mechanism in vivo, the inventors transplanted LNCaP-C4-2 tumors into immunodeficient NSG mice and subsequently treated them with sEV-blocking antibodies or IgM isotype controls. Only platelets isolated from mice carrying xenografts were RPL28-positive, while platelets from the control group and tumor-bearing mice treated with sEV blocking antibodies were RPL28-negative (Figure 1G). Therefore, direct transfer of cancer markers to platelets occurs in vivo and can be prevented using antibodies against sEV.

[0096] Detection of cancer sEVs and the human prostate cancer marker PCA3 in patient platelets. Since RPL28 was detected at low levels in leukocytes (Figure 11E), the inventors continued their search for more specific markers for human studies. LncRNA PCA3 and ENST00000501280 are enriched in sEVs of prostate cancer cell lines. 8、29Using nested PCR, the inventors demonstrate that PCA3 is highly enriched in sEVs, ENST00000501280 is detected in both cells and sEVs, and neither marker is present in platelets (Figure 1H, left panel), thus making PCA3 a more preferred marker. Similar to RPL28, PCA3 and ENST00000501280 were detected in vitro by nested PCR in mouse platelets treated with LNCaP-sEV (Figure 1H, right panel). Next, the inventors examined blood samples from prostate cancer patients and healthy volunteers for the presence of PCA3 and ENST00000501280. Both markers were detected in patient platelets but not in control (healthy volunteer) platelets (Figure 12A). PCR amplification of sEVs and PCA3 in patient samples was confirmed by restriction digestion mapping of the amplification products (Figure 12B).

[0097] A large-scale analysis of PCA3 in platelets from 32 prostate cancer patients revealed that this marker was present in 69% of patient samples, while all control samples were negative (Figure 1I, J, and Figure 12C). Importantly, PCA3 was almost undetectable in the same patients two months after prostatectomy (postoperatively) (Figure 1I, J, and Figure 12C). NTA of sEVs purified from plasma revealed that sEV levels tended to be elevated in cancer patients and decreased after prostatectomy (Figure 12D-E). However, no correlation was found between sEV levels and the presence of PCA3. In contrast to PCA3, the lncRNAs PCAT1 and TMPR16-ERG were associated with prostate tumor-sEV17 0、31 Although PCA3 is known to be enriched in prostate cancer, it was only detected in about 25% of platelet samples from prostate cancer patients, making it less suitable as a platelet biomarker (Figure 13A-E). These results indicate that PCA3 in platelets originates from prostate cancer sEVs. Therefore, measuring PCA3 in platelets from prostate cancer patients could be a promising approach for cancer detection and staging.

[0098] Cancer sEVs induce platelet activation and promote thrombosis. When mouse platelets are incubated with LNCaP-C4-2 / cancer sEVs, platelet integrin α is activated in a concentration and time-dependent manner. IIb β 3, Activation was induced (Figure 2A, B). Platelet activation by cancer sEVs was comparable to activation induced by the physiological agonist (ADP) and thrombin (Figure 2A-D). Platelet activation was specific to cancer sEVs, while synthetic sEVs and fibroblast sEVs were ineffective (Figure 2C, D). Interestingly, platelet activation by ADP and thrombin occurred within seconds, while activation by sEVs was significantly slower, reaching a maximum at 60 minutes (Figure 2B). A platelet aggregation assay with ADP in the presence of gradually increasing concentrations of cancer sEVs showed a synergistic effect of cancer sEVs on ADP-induced platelet aggregation (Figure 13F). This suggests that cancer sEVs can prime platelets for subsequent activation by conventional agonists. Similar platelet activation profiles were observed using other metastatic cancer lines, prostate cancer PC3 and renal cancer SK-RC-26b (Figure 14A, B).

[0099] In an in vivo arterial thrombosis model, LNCaP-C4-2 cancer sEVs significantly shortened occlusion time in WT mice, while synthetic sEVs showed no effect (Figure 2E). Arterial occlusion was also promoted in mice carrying mouse prostate cancer tumors (RM1 tumor cells) (Figure 2F). This is consistent with results observed using cancer sEV injection. A significant number of prostate cancer patients have cardiovascular disease, and the combination of these conditions may exacerbate thrombosis. To demonstrate this in mice, we have introduced a model in which RM1 tumors are associated with hyperlipidemia and APOE deficiency (APOE - / - The tumor was transplanted into mice (fed a Western-style diet). If a tumor is present, it is associated with a tendency towards atherosclerosis (APOE). - / - Thrombosis was significantly promoted in mice. However, the effect was smaller than in wild-type mice (Figure 2G), which is because platelet reactivity was already elevated in these mice. 32In summary, these results strongly suggest that platelet uptake of cancer cell-derived sEVs and subsequent platelet activation promote thrombosis.

[0100] Tetraspanin CD63 and N-linked glycans on cancer sEVs mediate platelet uptake. SEV membrane proteins are highly N-linked glycosylated. 33 Changes in glycosylation affect receptor 17 4 The interaction with this molecule can be defined and thereby influence platelet uptake. Accordingly, the inventors removed N-linked glycans from sEV glycoproteins using PNGase-F, which significantly reduced platelet uptake of EVs (Figure 3A, B). One of the markers for cancer sEVs is tetraspanin CD63, which is extremely important for sEV secretion and protein packaging. 35、36 CD63 is highly expressed in sEVs across several cancers, both in vitro and in vivo. 37 A well-characterized blocking antibody against CD63 (anti-CD63). 38、39 Compared to sEV alone, IgG isotype-matched antibodies significantly reduced platelet uptake of sEV, but these were not effective (Figure 3C, D). Simultaneously, blocking tetraspanin-CD9 of another sEV with an anti-CD9 antibody did not affect sEV uptake (Figure 3D).

[0101] The combination of N-deglycosylation and an anti-CD63 blocking antibody did not show any additional effect on platelet uptake of sEVs (Figure 3E). This suggests a possible role of N-glycosylated CD63 in the interaction between cancer sEVs and platelets. Treatment with O-glycosidase did not significantly affect platelet uptake of sEVs (Figure 3E). Platelet uptake of CD63-mediated sEVs appears to be an active process. This is because inhibitors of cytoskeletal rearrangement (i.e., wiscostatin) significantly suppressed platelet uptake of cancer sEVs (Figure 3F).

[0102] CD63 blocking antibodies inhibit platelet activation mediated by cancer sEVs. Integrin α induced by sEVs derived from LNCaP-C4-2. IIb β3 activation was comparable to that of ADP treatment, but in the presence of anti-CD63 (rather than isotype-matched antibodies), sEV-induced activation was not significantly different from that of resting platelets (Figures 4A-C), indicating that CD63-mediated sEV uptake is directly related to platelet activation. Similarly, cancer sEVs induce other platelet responses (e.g., granule secretion and P-selectin surface exposure), but activation in the presence of anti-CD63 antibodies (rather than isotype-matched antibodies) did not show statistically significant differences from that of unstimulated platelets (Figures 14C and 4D). A similar effect was observed with PS exposure measured by annexin V binding (Figure 14D). Similarly, PC3-derived sEVs induced platelet α IIb Although β3 activation was induced, the anti-CD63 antibody reduced the activation to the level of resting platelets (Figure 4E, F). Pre-incubation of cancer sEVs with anti-CD63 also reduced platelet hRPL28 mRNA levels compared to vehicle or isotype IgG controls (Figure 4G). Therefore, the anti-CD63 antibody inhibits platelet uptake of cancer cells (sEVs) and reduces subsequent platelet activation.

[0103] Platelet activation by cancer sEVs is mediated by RPTPα, Akt, and MAPK. Next, we evaluated the contribution of platelet surface receptors (e.g., integrins and scavenger receptors) as usable regulators of sEV uptake. 40 However, integrin-deficient mice (kindlin 3-deficient), scavenger receptor (CD36)-deficient mice, micropinocytosis regulator (AKT3)-deficient mice, and innate immune receptor (TLR2)-deficient mice 32、41~43 Platelets obtained from this method did not affect sEV uptake (Figures 15A-D).

[0104] CD63 interacts with tyrosine phosphatase α (RPTPα), a transmembrane receptor-like protein expressed on platelets.4 This leads to the activation of Src in kidney cells.11 5 This was reported. Accordingly, the inventors tested the effects of RPTPα inhibition alone or in combination with anti-CD63 on platelet uptake of cancer sEVs. LNCaP-C4-2 cancer-sEVs treated with anti-CD63 antibody showed a 75% reduction in sEV uptake by platelets, but this was not observed with IgG isotype control (Figure 5A, B). Platelets treated with anti-RPTPα antibody also showed a significant reduction in sEV uptake, but the combination of anti-CD63 treated sEVs and anti-RPTPα treated platelets did not show any synergistic effect (Figure 5A, B). This indicates that CD63 on sEVs and RPTPα on platelets play similar roles in platelet uptake of cancer sEVs.

[0105] At the molecular level, a significant increase in phosphorylation of RPTPα and its downstream target Src in platelets was observed within 5 minutes of incubation with LNCaP-C4-2 cancer sEVs, and then gradually decreased over 90 minutes (Figure 5C, D). Following these initial events, significant phosphorylation of Akt and PLCγ2 was detected 90 minutes after sEV addition compared to resting platelets at the same time point (Figure 5E, F). In comparison, ADP induced Akt phosphorylation within 15 minutes, but did not induce PLCγ2 phosphorylation (Figure 16A). Akt and PLCγ2 are known to regulate MAPK, and therefore, this suggests that α IIb Contributes to the activation of β3 integrin 46 The inventors observed that sEV induced phosphorylation of ERK, p38, and JNK in platelets, reaching a peak in 90 minutes (Figure 5G, H). In contrast, ADP-induced platelet activation caused phosphorylation of Erk alone in a very short time of 15 minutes (Figure 16A).

[0106] Next, the inventors investigated this signaling pathway (Figures 16B-E) leading to αIIbβ3 activation (Figure 80A) using various pharmacological inhibitors. Mouse platelets were incubated with the inhibitors for 15 minutes before treatment with LNCaP-C4-2-derived cancer sEVs. The Src inhibitor (dasatinib) and the PI3K inhibitor (LY294002) reduced the phosphorylation of Akt, Erk, and PLCγ2 (Figures 16B-E). This suggests the upstream nature of Src and PI3K. The Akt inhibitor (MK2206) inhibited the phosphorylation of Erk and Akt, but not PLCγ2 (Figures 16B-D). This suggests that Erk may be downstream of Akt, while PLCγ2 may be independent. This was confirmed by observations that the Erk inhibitor (PD98059) did not affect either Akt or PLCγ2, while the PLCγ2 inhibitor (U73122) inhibited only PLCγ2 and did not inhibit other molecules in the pathway (Figures 16B-D). Most of these inhibitors are known to affect the activation of integrin αIIbβ3 in platelets (e.g., activation by sEVs) (Figure 80A). A similar series of signaling events was observed even when using PC3 cancer sEVs (Figure 80B). This suggests that these pathways are common to cancer-derived sEVs during platelet activation.

[0107] The present inventors have identified an integrin antagonist (silentide, cyclic RGD pentapeptide) that is known to inhibit αIIbβ3 at high concentrations of 17-170 μM. 47 However, we observed that it did not affect the phosphorylation event mediated by sEVs (Figure 80C). This, along with results using Kindlin3-deficient mouse platelets, indicates that this process is independent of integrin function. Similarly, apirase (which hydrolyzes ADP released from platelets) and the TXA receptor antagonist (Daltroban) had no effect (Figure 80C). Therefore, cancer sEV-mediated platelet activation is not secondary to integrin signaling and the release of ADP or TXA2 from platelets.

[0108] Blocking the CD63-RPTPα interaction inhibits cancer sEV-induced platelet activation and thrombus formation. Treatment of platelets with an RPTPα-blocking antibody for 30 minutes, followed by incubation with LNCaP-C4-2-derived cancer sEVs for 5 minutes, resulted in reduced phosphorylation of Src, PLCγ2, Akt, Erk, and downstream targets. This highlights the crucial role of RPTPα in initiating this signaling cascade (Figure 6A-G). KODA-PC, known to induce platelet activation via a different TLR2-dependent mechanism, was used as a negative control for the anti-RPTPα antibody (Figure 16A). Similar to RPTPα, the blocking CD63 antibody inhibited components of the signaling cascade (Akt, PLCγ2, Erk, JNK, and p38) induced by cancer sEVs and leading to αIIbβ3 activation (Figure 7A, B). Finally, in an assay for FeCl3-induced carotid thrombosis, sEVs shortened occlusion time, while anti-CD63 blocking antibodies showed inhibitory antithrombotic effects, whereas control IgG did not (Figure 7C). These observations reaffirm the important role of CD63 in cancer sEV uptake, platelet activation, and promotion of thrombus formation.

[0109] Tumors can induce platelet activation through direct interaction with platelets or through the release of procoagulant factors (e.g., tissue factor (TF), podoplanin, ADP, and tumor EV).11 8~50 TF on the surface of tumor extravasation cells (EVs) is involved in platelet aggregation and thrombus formation.11 9、51 However, recent studies suggest that platelet aggregation is also driven by TF-independent pathways. 51 Or, more importantly, through still unknown mechanisms, such as those seen in breast cancer. 52 This indicates that it can be promoted. This suggests that the mechanism of platelet activation induced by tumor EVs is complex and that several alternative mechanisms may exist. Tumor cells (especially malignant metastatic tumors) produce and excrete high levels of sEVs (35–117 μg sEV / ml) ​​detected in the plasma of patients with prostate cancer, breast cancer, colorectal cancer, and other cancers. 80、12、13、53Therefore, in this example, we focused on cancer cell-derived sEVs containing tumor-specific markers as a potential mechanism of tumor-platelet information exchange. To overcome limitations regarding sEV yield, purity, and large variability in sEV concentration and composition among cancer patients, we used cancer cell line-derived sEVs rather than patient-derived sEVs. Our findings indicate that platelet activation is a direct result of sEV uptake via CD63.

[0110] Based on their characteristic size (less than 200 nm), shape, and expression of sEV markers, the EVs used in this study were classified and named sEV according to MISEV2018. Our findings demonstrate that platelets specifically take up cancer sEVs at a higher rate than other circulating sEVs, both in vitro and in vivo. These findings suggest that the mechanism of "information" transmission from tumors to platelets, and its impact on platelet biology and reactivity, is likely dependent on sEVs. Injection of cancer cell-derived sEVs into the circulatory system, or in vivo experiments using a mouse tumor xenograft model, demonstrated enhanced thrombosis. This suggests that this process may contribute to thrombosis in cancer patients. A significant number of prostate cancer patients have cardiovascular diseases that exacerbate thrombosis.12 4 Interestingly, the presence of a tumor indicates a tendency towards atherosclerosis (APOE). - / - Thrombosis was significantly promoted in mice. This indicates that, even in a state of extreme hyperlipidemia, cancer sEVs further enhance platelet reactivity and promote thrombosis.

[0111] High levels of CD63-positive sEVs are associated with cancer progression and are particularly a predictive biomarker for malignant cancer. 12、5、56Our research has revealed that CD63 (presumably in a glycosylated form) on the surface of tumor sEVs is crucial for platelet recognition and uptake. We further demonstrated that sEV uptake is an active process, involving platelet cytoskeletal rearrangement (i.e., CD63-dependent endocytosis leading to platelet activation). This role is specific, and blocking CD63 does not affect platelet activation by physiological agonists (e.g., ADP). This is because CD63 deficiency does not reduce platelet aggregation. 57 The mouse does not bleed. 55、57 This is consistent with previous reports. Importantly, the CD63 blocking antibody was able to reduce thrombosis in mice carrying tumor sEVs.

[0112] Recent studies have demonstrated that so-called "tumor-educating platelets" are characterized by altered RNA profiles. 58 This was suggested to be mediated by the translocation of tumor extracellular matrix (EVs) carrying the tumor marker (lncRNA PCA3) to platelets. 12、9 Here, we provide evidence that this process depends on the uptake of cancer cells sEVs. Recently, a prostate cancer-specific biomarker (PCA3) was detected in sEVs in the urine of prostate cancer patients. 9 Consistent with these studies, the inventors detected LNCaP-sEV and PCA3 in platelets in 69% of prostate cancer patients, but not in healthy donors. Supporting the tumor origin of this marker in platelets, the inventors found that almost all patients in the same cohort became PCA3-negative two months after radical prostatectomy. These findings open up further opportunities for early cancer detection and a new approach to assessing the risk of platelet hypersensitivity and thrombosis in cancer patients.

[0113] Platelet activation by sEV differed from that by physiological platelet agonists (ADP or thrombin). While potent, it required longer incubation with platelets and did not involve platelet receptors with similar ligands (CD36, TLR2, and integrins). This suggests the involvement of a non-standard pathway. In kidney cells, CD63 is involved in RPTPα 45 (Platelet 11) 4 It interacts with receptors (which are also expressed on sEVs). Blocking of sEV-CD63 or platelet-RPTPα inhibited cancer sEV-induced platelet activation, but not ADP or thrombin. This suggests a novel pathway. Interestingly, RPTPα-mediated Src activation is followed by a delay in the activation of PI3K, PLCγ2, Akt, and MAPK in platelet activation (Figure 7D). The involvement of platelet activation and surface receptors may initiate the translation of multiple proteins (e.g., Bcl-3, IL-1β, etc.)13 0、61 The involvement of such translation mechanisms may explain the long-term signaling cascade specific to cancer sEVs. PLCγ2 activation is independent of PI3K, Akt, or MAPK, but dependent on Src. This indicates that there are two parallel pathways for sEV-induced platelet activation (Figure 7D). Platelet MAPKs may trigger granule secretion and release of ADP or thromboxane (TXA2), which can also activate platelets. 11、6 Our observations on sEV-induced platelet activation using sEVs derived from various cancer cell lines (e.g., kidney cancer) indicate that this is a common cancer-related phenomenon.

[0114] In summary, our data reveals a novel mechanism of information exchange between cancer cells and platelets related to atypical platelet activation and the promotion of thrombus formation. Understanding this process opens up new opportunities for cancer detection and the prevention and treatment of thrombosis (a leading cause of death in patients with metastatic cancer).

[0115] References 1.Brose KM and Lee AY.Cancer-associated thrombosis:prevention and treatment.Curr Oncol.2008;15:S58-67. 2.Donnellan E,Kevane B,Bird BR and Ainle FN.Cancer and venous thromboembolic disease:from molecular mechanisms to clinical management.Curr Oncol.2014;21:134-43. 3.Donati MB.Cancer and thrombosis.Haemostasis.1994;24:128-31. 4.Honn KV,Tang DG and Crissman JD.Platelets and cancer metastasis:a causal relationship?Cancer metastasis reviews.1992;11:325-51. 5.Blom JW,Vanderschoot JP,Oostindier MJ,Osanto S,van der Meer FJ and Rosendaal FR.Incidence of venous thrombosis in a large cohort of 66,329 cancer patients:results of a record linkage study.J Thromb Haemost.2006;4:529-35. 6.Mehta P.Potential role of platelets in the pathogenesis of tumor metastasis.Blood.1984;63:55-63. 7.Bastida E and Ordinas A.Platelet contribution to the formation of metastatic foci:the role of cancer cell-induced platelet activation.Haemostasis.1988;18:29-36. 8.Caine GJ,Stonelake PS,Lip GY and Kehoe ST.The hypercoagulable state of malignancy:pathogenesis and current debate.Neoplasia.2002;4:465-73. 9.Willms E,Cabanas C,Mager I,Wood MJA and Vader P.Extracellular Vesicle Heterogeneity:Subpopulations,Isolation Techniques,and Diverse Functions in Cancer Progression.Front Immunol.2018;9:738. 10.Zhang X,Yuan X,Shi H,Wu L,Qian H and Xu W.Exosomes in cancer:small particle,big player.Journal of hematology & oncology.2015;8:83. 11.Ghosh AK,Secreto CR,Knox TR,Ding W,Mukhopadhyay D and Kay NE.Circulating microvesicles in B-cell chronic lymphocytic leukemia can stimulate marrow stromal cells:implications for disease progression.Blood.2010;115:1755-64. 12.Hong CS,Funk S,Muller L,Boyiadzis M and Whiteside TL.Isolation of biologically active and morphologically intact exosomes from plasma of patients with cancer.J Extracell Vesicles.2016;5:29289. 13.Ludwig S,Floros T,Theodoraki MN,Hong CS,Jackson EK,Lang S and Whiteside TL.Suppression of Lymphocyte Functions by Plasma Exosomes Correlates with Disease Activity in Patients with Head and Neck Cancer.Clin Cancer Res.2017;23:4843-4854. 14.Zhang Y and Wang XF.A niche role for cancer exosomes in metastasis.Nature cell biology.2015;17:709-11. 15.Surman M,Stepien E,Hoja-Lukowicz D and Przybylo M.Deciphering the role of ectosomes in cancer development and progression:focus on the proteome.Clin Exp Metastasis.2017;34:273-289. 16.Dewilde S,Lloyd AJ,Holm MV and Lee AY.Quality Of Life Of Patients Experiencing Cancer-Associated Thrombosis.Value Health.2015;18:A397-8. 17.Lee AY and Peterson EA.Treatment of cancer-associated thrombosis.Blood.2013;122:2310-7. 18.Thompson CM and Rodgers LR.Analysis of the autopsy records of 157 cases of carcinoma of the pancreas with particular reference to the incidence of thromboembolism.Am J Med Sci.1952;223:469-78. 19.Kerr BA,McCabe NP,Feng W and Byzova TV.Platelets govern pre-metastatic tumor communication to bone.Oncogene.2013;32:4319-24. 20.Llorente A,van Deurs B and Sandvig K.Cholesterol regulates prostasome release from secretory lysosomes in PC-3 human prostate cancer cells.Eur J Cell Biol.2007;86:405-15. 21.Kowal J,Arras G,Colombo M,Jouve M,Morath JP,Primdal-Bengtson B,Dingli F,Loew D,Tkach M and Thery C.Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes.Proc Natl Acad Sci U S A.2016;113:E968-77. 22.Chen P,Chen G,Wang C and Mao C.RAB13 as a novel prognosis marker promotes proliferation and chemotherapeutic resistance in gastric cancer.Biochem Biophys Res Commun.2019;519:113-120. 23.Chan JJ,Kwok ZH,Chew XH,Zhang B,Liu C,Soong TW,Yang H and Tay Y.A FTH1 gene:pseudogene:microRNA network regulates tumorigenesis in prostate cancer.Nucleic Acids Res.2018;46:1998-2011. 24.Jezequel P,Campion L,Spyratos F,Loussouarn D,Campone M,Guerin-Charbonnel C,Joalland MP,Andre J,Descotes F,Grenot C,Roy P,Carlioz A,Martin PM,Chassevent A,Jourdan ML and Ricolleau G.Validation of tumor-associated macrophage ferritin light chain as a prognostic biomarker in node-negative breast cancer tumors:A multicentric 2004 national PHRC study.Int J Cancer.2012;131:426-37. 25.Liang ZX,Liu HS,Wang FW,Xiong L,Zhou C,Hu T,He XW,Wu XJ,Xie D,Wu XR and Lan P.LncRNA RPPH1 promotes colorectal cancer metastasis by interacting with TUBB3 and by promoting exosomes-mediated macrophage M2 polarization.Cell Death Dis.2019;10:829. 26.Chang SS.Overview of prostate-specific membrane antigen.Rev Urol.2004;6 Suppl 10:S13-8. 27.Labriet A,Levesque E,Cecchin E,De Mattia E,Villeneuve L,Rouleau M,Jonker D,Couture F,Simonyan D,Allain EP,Buonadonna A,D’Andrea M,Toffoli G and Guillemette C.Germline variability and tumor expression level of ribosomal protein gene RPL28 are associated with survival of metastatic colorectal cancer patients.Sci Rep.2019;9:13008. 28.Ahadi A,Brennan S,Kennedy PJ,Hutvagner G and Tran N.Long non-coding RNAs harboring miRNA seed regions are enriched in prostate cancer exosomes.Sci Rep.2016;6:24922. 29.Donovan MJ,Noerholm M,Bentink S,Belzer S,Skog J,O’Neill V,Cochran JS and Brown GA.A molecular signature of PCA3 and ERG exosomal RNA from non-DRE urine is predictive of initial prostate biopsy result.Prostate Cancer Prostatic Dis.2015;18:370-5. 30.Zhan Y,Du L,Wang L,Jiang X,Zhang S,Li J,Yan K,Duan W,Zhao Y,Wang L,Wang Y and Wang C.Expression signatures of exosomal long non-coding RNAs in urine serve as novel non-invasive biomarkers for diagnosis and recurrence prediction of bladder cancer.Mol Cancer.2018;17:142. 31.Motamedinia P,Scott AN,Bate KL,Sadeghi N,Salazar G,Shapiro E,Ahn J,Lipsky M,Lin J,Hruby GW,Badani KK,Petrylak DP,Benson MC,Donovan MJ,Comper WD,McKiernan JM and Russo LM.Urine Exosomes for Non-Invasive Assessment of Gene Expression and Mutations of Prostate Cancer.PLoS One.2016;11:e0154507. 32.Biswas S,Xin L,Panigrahi S,Zimman A,Wang H,Yakubenko VP,Byzova TV,Salomon RG and Podrez EA.Novel phosphatidylethanolamine derivatives accumulate in circulation in hyperlipidemic ApoE- / - mice and activate platelets via TLR2.Blood.2016;127:2618-29. 33.Escrevente C,Grammel N,Kandzia S,Zeiser J,Tranfield EM,Conradt HS and Costa J.Sialoglycoproteins and N-glycans from secreted exosomes of ovarian carcinoma cells.PLoS One.2013;8:e78631. 34.Margraf-Schonfeld S,Bohm C and Watzl C.Glycosylation affects ligand binding and function of the activating natural killer cell receptor 2B4 (CD244) protein.J Biol Chem.2011;286:24142-9. 35.Hurwitz SN,Cheerathodi MR,Nkosi D,York SB and Meckes DG,Jr.Tetraspanin CD63 Bridges Autophagic and Endosomal Processes To Regulate Exosomal Secretion and Intracellular Signaling of Epstein-Barr Virus LMP1.J Virol.2018;92. 36.Hurwitz SN,Nkosi D,Conlon MM,York SB,Liu X,Tremblay DC and Meckes DG,Jr.CD63 Regulates Epstein-Barr Virus LMP1 Exosomal Packaging,Enhancement of Vesicle Production,and Noncanonical NF-kappaB Signaling.J Virol.2017;91. 37.Garcia-Silva et al.,Melanoma-derived small extracellular vesicles induce lymphangiogenesis and metastasis through an NGFR-dependent mechanism.Nat Cancer.2021;2:1387-1405. 38.Xu L,Harada H and Taniguchi A.The effects of LAMP1 and LAMP3 on M180 amelogenin uptake,localization and amelogenin mRNA induction by amelogenin protein.J Biochem.2008;144:531-7. 39.Fabbri M,Paone A,Calore F,Galli R,Gaudio E,Santhanam R,Lovat F,Fadda P,Mao C,Nuovo GJ,Zanesi N,Crawford M,Ozer GH,Wernicke D,Alder H,Caligiuri MA,Nana-Sinkam P,Perrotti D and Croce CM.MicroRNAs bind to Toll-like receptors to induce prometastatic inflammatory response.Proc Natl Acad Sci U S A.2012;109:E2110-6. 40.Israels SJ,McMillan-Ward EM,Easton J,Robertson C and McNicol A.CD63 associates with the alphaIIb beta3 integrin-CD9 complex on the surface of activated platelets.Thromb Haemost.2001;85:134-41. 41.Ding L,Zhang L,Kim M,Byzova T and Podrez E.Akt3 kinase suppresses pinocytosis of low-density lipoprotein by macrophages via a novel WNK / SGK1 / Cdc42 protein pathway.J Biol Chem.2017;292:9283-9293. 42.Febbraio M,Abumrad NA,Hajjar DP,Sharma K,Cheng W,Pearce SF and Silverstein RL.A null mutation in murine CD36 reveals an important role in fatty acid and lipoprotein metabolism.J Biol Chem.1999;274:19055-62. 43.Meller J,Chen Z,Dudiki T,Cull RM,Murtazina R,Bal SK,Pluskota E,Stefl S,Plow EF,Trapp BD and Byzova TV.Integrin-Kindlin3 requirements for microglial motility in vivo are distinct from those for macrophages.JCI Insight.2017;2. 44.Karisch R,Fernandez M,Taylor P,Virtanen C,St-Germain JR,Jin LL,Harris IS,Mori J,Mak TW,Senis YA,Ostman A,Moran MF and Neel BG.Global proteomic assessment of the classical protein-tyrosine phosphatome and “Redoxome”.Cell.2011;146:826-40. 45.Lin D,Kamsteeg EJ,Zhang Y,Jin Y,Sterling H,Yue P,Roos M,Duffield A,Spencer J,Caplan M and Wang WH.Expression of tetraspan protein CD63 activates protein-tyrosine kinase (PTK) and enhances the PTK-induced inhibition of ROMK channels.J Biol Chem.2008;283:7674-81. 46.Li Z,Delaney MK,O’Brien KA and Du X.Signaling during platelet adhesion and activation.Arterioscler Thromb Vasc Biol.2010;30:2341-9. 47.Meyer dos Santos S,Kuczka K,Picard-Willems B,Nelson K,Klinkhardt U and Harder S.The integrin antagonist,cilengitide,is a weak inhibitor of alphaIIbbeta3 mediated platelet activation and inhibits platelet adhesion under flow.Platelets.2015;26:59-66. 48.Abdol Razak NB,Jones G,Bhandari M,Berndt MC and Metharom P.Cancer-Associated Thrombosis:An Overview of Mechanisms,Risk Factors,and Treatment.Cancers (Basel).2018;10. 49.Geddings JE and Mackman N.Tumor-derived tissue factor-positive microparticles and venous thrombosis in cancer patients.Blood.2013;122:1873-80. 50.Chen N,Ren M,Li R,Deng X,Li Y,Yan K,Xiao L,Yang Y,Wang L,Luo M,Fay WP and Wu J.Bevacizumab promotes venous thromboembolism through the induction of PAI-1 in a mouse xenograft model of human lung carcinoma.Mol Cancer.2015;14:140. 51.Almeida VH,Rondon AMR,Gomes T and Monteiro RQ.Novel Aspects of Extracellular Vesicles as Mediators of Cancer-Associated Thrombosis.Cells.2019;8. 52.Gomes FG,Sandim V,Almeida VH,Rondon AMR,Succar BB,Hottz ED,Leal AC,Vercoza BRF,Rodrigues JCF,Bozza PT,Zingali RB and Monteiro RQ.Breast-cancer extracellular vesicles induce platelet activation and aggregation by tissue factor-independent and -dependent mechanisms.Thromb Res.2017;159:24-32. 53.Hong CS,Muller L,Whiteside TL and Boyiadzis M.Plasma exosomes as markers of therapeutic response in patients with acute myeloid leukemia.Front Immunol.2014;5:160. 54.Van Hemelrijck M,Adolfsson J,Garmo H,Bill-Axelson A,Bratt O,Ingelsson E,Lambe M,Stattin P and Holmberg L.Risk of thromboembolic diseases in men with prostate cancer:results from the population-based PCBaSe Sweden.Lancet Oncol.2010;11:450-8. 55.Pols MS and Klumperman J.Trafficking and function of the tetraspanin CD63.Exp Cell Res.2009;315:1584-1592. 56.Pols MS,van ME,Oorschot V,ten BC,Fukuda M,Swetha MG,Mayor S and Klumperman J.Function of hVps41 and VAMP7 in direct TGN to late endosome transport of lysosomal membrane proteins.Nat Commun.2013;4:1361. 57.Schroder J,Lullmann-Rauch R,Himmerkus N,Pleines I,Nieswandt B,Orinska Z,Koch-Nolte F,Schroder B,Bleich M and Saftig P.Deficiency of the tetraspanin CD63 associated with kidney pathology but normal lysosomal function.Mol Cell Biol.2009;29:1083–1094. 58.Best MG,Sol N,Kooi I,Tannous J,Westerman BA,Rustenburg F,Schellen P,Verschueren H,Post E,Koster J,Ylstra B,Ameziane N,Dorsman J,Smit EF,Verheul HM,Noske DP,Reijneveld JC,Nilsson RJ,Tannous BA,Wesseling P and Wurdinger T.RNA-Seq of Tumor-Educated Platelets Enables Blood-Based Pan-Cancer,Multiclass,and Molecular Pathway Cancer Diagnostics.Cancer Cell.2015;28:666-676. 59.Nilsson RJ,Balaj L,Hulleman E,van Rijn S,Pegtel DM,Walraven M,Widmark A,Gerritsen WR,Verheul HM,Vandertop WP,Noske DP,Skog J and Wurdinger T.Blood platelets contain tumor-derived RNA biomarkers.Blood.2011;118:3680-3. 60.Lindemann S,Tolley ND,Dixon DA,McIntyre TM,Prescott SM,Zimmerman GA and Weyrich AS.Activated platelets mediate inflammatory signaling by regulated interleukin 1beta synthesis.J Cell Biol.2001;154:485-90. 61.Weyrich AS,Dixon DA,Pabla R,Elstad MR,McIntyre TM,Prescott SM and Zimmerman GA.Signal-dependent translation of a regulatory protein,Bcl-3,in activated human platelets.Proc Natl Acad Sci U S A.1998;95:5556-61. 62.Dudiki T,Meller J,Mahajan G,Liu H,Zhevlakova I,Stefl S,Witherow C,Podrez E,Kothapalli CR and Byzova TV.Microglia control vascular architecture via a TGFbeta1 dependent paracrine mechanism linked to tissue mechanics.Nat Commun.2020;11:986. 63.Ding L,Zhang L,Biswas S,Schugar RC,Brown JM,Byzova T and Podrez E.Akt3 inhibits adipogenesis and protects from diet-induced obesity via WNK1 / SGK1 signaling.JCI Insight.2017;2. 64.Takeuchi O,Hoshino K and Akira S.Cutting edge:TLR2-deficient and MyD88-deficient mice are highly susceptible to Staphylococcus aureus infection.J Immunol.2000;165:5392-6. 65.Kerr BA,Miocinovic R,Smith AK,Klein EA and Byzova TV.Comparison of tumor and microenvironment secretomes in plasma and in platelets during prostate cancer growth in a xenograft model.Neoplasia.2010;12:388-96. 66.Nilsson J, Skog J,Nordstrand A,Baranov V,Mincheva-Nilsson L,Breakefield XO and Widmark A.Prostate cancer-derived urine exosomes:a novel approach to biomarkers for prostate cancer.Br J Cancer.2009;100:1603-7. 67. Podrez EA, Byzova TV, Febbraio M, Salomon RG, Ma Y, Valiyaveettil M, Poliakov E, Sun M, Finton PJ, Curtis BR, Chen J, Zhang R, Silverstein RL and Hazen SL. Platelet CD36 links hyperlipidemia, oxidant stress and a prothrombotic phenotype.Nature medicine.2007;13:1086-95.

[0116] All publications and patents referenced herein are incorporated herein by reference. Various modifications and variations of the methods and systems of the present invention described herein will be obvious to those skilled in the art without departing from the scope and spirit of the invention. Although the invention is described in relation to certain preferred embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. In fact, various modifications of the described form for carrying out the invention which will be obvious to those skilled in the art in chemistry, medicine, molecular biology or related fields are intended to fall within the scope of the following claims.

Claims

1. A composition comprising a human EIF3L-binding molecule and / or one or more nucleic acid molecules encoding the human EIF3L-binding molecule, The aforementioned human EIF3L-binding molecule a) A heavy chain variable region, wherein the heavy chain variable region is i) Sequence ID 6, or a CDRH1 amino acid sequence containing Sequence ID 6 having one or two conservative amino acid changes, ii) Sequence ID 7, or a CDRH2 amino acid sequence containing Sequence ID 7 having one or two conservative amino acid changes, iii) The heavy chain variable region comprising SEQ ID NO: 8, or a CDRH3 amino acid sequence containing SEQ ID NO: 8 having one or two conservative amino acid changes, and / or b) A light chain variable region, wherein the light chain variable region is i) Sequence ID 10, or a CDRL1 amino acid sequence containing Sequence ID 10 having one or two conservative amino acid changes, ii) Sequence ID 11, or a CDRL2 amino acid sequence containing Sequence ID 11 having one or two conservative amino acid changes, and iii) The composition comprising the light chain variable region comprising SEQ ID NO: 12, or a CDRL3 amino acid sequence having one or two conservative amino acid changes.

2. i) The CDRH1 amino acid sequence includes SEQ ID NO: 6, ii) The CDRH2 amino acid sequence includes SEQ ID NO: 7, iii) The CDRH3 amino acid sequence includes SEQ ID NO: 9, iv) The CDRL1 amino acid sequence includes SEQ ID NO: 10, v) The CDRL2 amino acid sequence includes SEQ ID NO: 11, vi) The composition according to claim 1, wherein the CDRL3 amino acid sequence comprises SEQ ID NO:

12.

3. The composition according to claim 1, wherein the human EIF3L-binding molecule is an antibody, minibody, diabody, scFv, or antibody fragment capable of binding to human EIF3L.

4. The composition according to claim 3, wherein the antibody fragment is a Fab, F(ab')2, or Fv antibody fragment.

5. The composition according to claim 2, wherein the antibody or antibody fragment comprises at least the antigen-binding portion of the A1806-3A1-3 antibody.

6. The composition according to claim 1, wherein the heavy chain and / or light chain variable region includes a human framework region.

7. The composition according to claim 1, wherein the human EIF3L-binding molecule further comprises a light chain constant region and a CH1 heavy chain constant region.

8. The composition according to claim 7, wherein the EIF3L binding molecule further comprises a CH2 double chain constant region and / or a CH3 double chain constant region.

9. The composition according to claim 8, wherein the light chain constant region is from a human or humanized mouse, and / or the CH1, CH2, and CH3 heavy chain constant regions are from a human or humanized mouse.

10. The composition according to claim 1, wherein the human EIF3L-binding molecule comprises an antibody, the light chain constant region of the antibody is selected from IgG kappa and IgG lambda, and the heavy chain constant region of the antibody is selected from IgG1, IgG2, IgG3, and IgG4.

11. The composition according to claim 1, wherein the human EIF3L binding molecule comprises an antibody or its antigen-binding portion that is glycosylated or deglycosylated.

12. Furthermore, the composition according to claim 1, comprising a physiologically acceptable buffer.

13. The composition according to claim 1, wherein the heavy chain variable region comprises SEQ ID NO: 5, or SEQ ID NO: 5 having one or more conservative amino acid changes.

14. The composition according to claim 1, wherein the light chain variable region comprises SEQ ID NO: 9, or SEQ ID NO: 9 having one or more conservative amino acid changes.

15. The composition according to claim 1, wherein the composition comprises one or more nucleic acid molecules.

16. The composition according to claim 1, wherein one or more nucleic acid molecules include i) a first nucleic acid sequence encoding the heavy chain variable region, and ii) a second nucleic acid sequence encoding the light chain variable region.

17. Furthermore, the composition according to claim 16, comprising an expression vector, wherein the first and / or second nucleic acid sequences are present within the expression vector.

18. A method for treating or preventing a thrombus-promoting condition in a subject having pathological exosome production or a condition caused thereby, The target is i) Optionally, an expression vector comprising the human EIF3L-binding molecule as described in any of claims 1 to 17, or one or more mRNAs encoding the EIF3L-binding molecule, or one or more nucleic acid molecules encoding the human EIF3L-binding molecule. ii) Treatment with a human CD63-binding molecule, or one or more mRNAs encoding the human CD63-binding molecule, or an expression vector containing one or more nucleic acid molecules encoding the CD63-binding molecule, The method wherein the subject is suffering from or suspected of developing the thrombus-promoting condition.

19. i) The subject has cancer and has or is suspected of having tumor-mediated thrombosis and / or tumor-mediated thrombotic disorder and / or thrombosis related to antitumor therapy, and optionally, the tumor-mediated thrombotic disorder is selected from the group consisting of heart attack, acute ischemic stroke, transient ischemic attack, deep vein thrombosis, pulmonary embolism, and phlebitis, and / or iii) The method according to claim 18, wherein the thrombus formation-promoting state is selected from sepsis, septic shock, viral infection, SARS-CoV-2 infection, sickle cell disease, cardiovascular disease, acute coronary syndrome (ACS), stroke, acute inflammation, infection-sepsis, and acute coronary syndrome.

20. The method according to claim 18, wherein the human CD63-binding molecule and / or the human EIF3L-binding molecule is an antibody or its antigen-binding portion.

21. The method according to claim 18, wherein the antibody or its antigen-binding portion is a human antibody or its antigen-binding portion.

22. The method according to claim 18, wherein the antibody or its antigen-binding portion is a humanized antibody or its antigen-binding portion.

23. The method according to claim 18, wherein the heavy chain variable region of the human EIF3L binding molecule contains SEQ ID NO: 5, or SEQ ID NO: 5 having one or more conservative amino acid changes.

24. The composition according to claim 18, wherein the light chain variable region of the human EIF3L binding molecule contains SEQ ID NO: 9, or SEQ ID NO: 9 having one or more conservative amino acid changes.

25. The composition according to claim 18, wherein the human CD63-binding molecule is bound to a glycosylated version of human CD63.

26. A method for detecting CD63-positive, PCA3-positive, and / or EIF3L-positive small extracellular vesicles (sEVs) in a sample, a) The method includes contacting the sample with i) an anti-CD63 antibody or its antigen-binding portion, and / or ii) an anti-PCA3 antibody or its antigen-binding portion, and / or iii) an anti-EIF3L antibody or its antigen-binding portion, The aforementioned sample contains purified sEV derived from a blood, plasma, or serum sample of a cancer patient, and the aforementioned sample is suspected to contain CD63-positive, PCA3-positive, or EIF3L-positive sEV. If the anti-CD63 antibody or its antigen-binding portion is present in the sample, it forms a first complex with the CD63-positive sEV; if the anti-PCA antibody or its antigen-binding portion is present in the sample, it forms a second complex with the PCA3-positive sEV; if the anti-EIF3L antibody or its antigen-binding portion is present in the sample, it forms a third complex with the EIF3L-positive sEV; and further, the method is b) The method comprising detecting the presence or absence of the first complex and / or the second complex and / or the third complex in the sample.

27. The method according to claim 26, wherein the sample is derived from a subject suffering from or suspected of developing a thrombus-promoting condition, including those described in claim 19.

28. The method according to claim 26, wherein the human anti-EIF3L antibody or its antigen-binding portion comprises a detectable label, and / or the anti-EIF3L antibody or its antigen-binding portion is as described in claims 1 to 17.

29. The method according to claim 26, further comprising contacting the sample with a conjugate molecule capable of binding to: i) an anti-CD63 antibody or its antigen-binding portion, and / or ii) an anti-PCA3 antibody or its antigen-binding portion, and / or iii) an anti-EIF3L antibody or its antigen-binding portion, wherein the conjugate molecule includes a detectable label.