Epigenetic editing tool targeting hepatitis B virus genes

Abstract

Belonging to the biopharmaceutical field, we provide an epigenetic editing tool that targets the hepatitis B virus gene and its use.

Description

Technical Field

[0001] This application relates to the field of biopharmaceuticals, specifically to target-specific epigenetic editing tools and their use.

Background Art

[0002] Hepatitis B virus (HBV) is a liver-tropic DNA virus, and the chronic hepatitis B infection it causes leads to persistent inflammation of the liver, thereby significantly increasing the probability of liver cirrhosis and liver cancer in patients. According to the prediction of the World Health Organization (WTO), currently, the number of cases of chronic hepatitis B caused by hepatitis B virus worldwide exceeds 250 million, and among them, more than 800,000 patients die every year, causing serious damage to the world's public health and well-being. China is a populous country, and the number of hepatitis B carriers accounts for about one-third of the world's total. Since the 1980s, with the improvement of the hepatitis B vaccine inoculation rate, new cases of hepatitis B in China have been effectively controlled, but the number of hepatitis B infected persons in China is still extremely large. Currently, therapeutic agents for HBV, such as nucleoside (nucleotide) analogs and IFNs, can effectively inhibit viral replication, but achieving functional cure, i.e., reducing surface antigen (HBsAg) to undetectable levels, is difficult and requires long-term administration. When treatment is stopped, HBV replication rebounds. The main reason for this phenomenon is that after HBV infects hepatocytes, fully closed double-stranded DNA (cccDNA) is formed, and the HBV genome is integrated into the host hepatocyte genome. The cccDNA and integrated DNA are then stably used as templates for viral replication and protein expression for extended periods. Current common treatments do not eliminate both, and therefore, eliminating or silencing cccDNA and integrated DNA could effectively treat hepatitis B. Since cccDNA can bind to histones in the nucleus of host hepatocytes to form chromosome-like structures, its transcriptional regulation can also be influenced by epigenetic modifications. The HBV genome contains three CpG islands, hereafter referred to as CG I, CG II, and CG III, respectively. CpG islands are important regions that enable epigenetic regulation. HBV genome transcription is regulated by four promoters (Xp, Cp, Sp1, Sp2) and two enhancers (Enh I and Enh II). Of these, Xp, Cp, Enh I, and Enh II are located within the CG II region, while Sp1 and Sp2 are located near CG I and CG III. Therefore, epigenetic editing of CpG islands can affect multiple regulatory elements, thereby potentially influencing viral genome transcription. Introducing epigenetic modifications to specific regulatory regions or sites of the HBV genome can alter chromatin structure, thereby regulating the transcriptional repression of target genes, achieving silencing of target genes without DNA cleavage, avoiding the possibility of genome double-strand breaks, activating unpredictable DNA repair mechanisms, and eliminating the risk of immunogenic breaks or mutant protein generation at the underlying mechanism. However, research into epigenetic editing tools that specifically target the HBV genome is currently mostly in its early stages, and the development of epigenetic editing technologies that can permanently cure or eliminate the HBV virus still faces many unknown and limited challenges. [Overview of the project]

[0003] This invention aims to develop safe and effective therapies for silencing and regulating HBV target genes by introducing inhibitory epigenetic modifications to specific regulatory regions of the HBV genome via an epigenetic editing tool, thereby altering the transcriptional activity of hepatitis B virus ccc DNA and integrated genomic DNA, reducing HBV replication and protein expression, and achieving the objective of treating hepatitis B. In one embodiment, the present application provides a composition comprising (1) a fusion molecule comprising at least one DNA-binding protein and at least one gene expression modulator or a nucleic acid sequence encoding the fusion molecule, and (2) at least one single guide RNA (sgRNA) or a nucleic acid sequence encoding the sgRNA, wherein the sgRNA is complementary to a target DNA sequence near the hepatitis B virus (HBV) gene and / or within an HBV gene regulatory element, and the HBV gene comprises a type B HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 1, and a nucleotide sequence shown in SEQ ID NO: 2. The HBV gene is a type C HBV gene or a type D HBV gene containing the nucleotide sequence shown in Sequence ID No. 3, wherein the HBV gene regulatory element includes a transcription start site, a core promoter, a promoter, an enhancer, a silencer, an insulator element, a boundary element and / or a locus regulatory region, and the target DNA sequence is located between nucleotides 1056 to 2354, 2639 to 2658, 2863 to 2930, and / or 3048 to 3067 of the HBV gene. In some embodiments, the target DNA sequence is located between nucleotides 1056 to 1900, 1972 to 2082, 2134 to 2264, 2335 to 2354, 2639 to 2658, 2863 to 2930, and / or between nucleotides 3048 to 3067 of the HBV gene. In some embodiments, the target DNA sequence is located between nucleotides 1060 to 1079, 1149 to 1612, 1693 to 1852, and / or between nucleotides 2863 to 2882 of the HBV gene. In some embodiments, the target DNA sequence is located in one or more regions of the B HBV gene between nucleotides 1149 and 1190, between nucleotides 1210 and 1310, between nucleotides 1350 and 1400, between nucleotides 1420 and 1450, and between nucleotides 1470 and 1592. In some embodiments, the target DNA sequence is located in one or more regions of the C-type HBV gene between nucleotides 1150 to 1180, between nucleotides 1200 to 1310, between nucleotides 1350 to 1390, between nucleotides 1420 to 1460, and between nucleotides 1480 to 1593. In some embodiments, the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1056 to 1079, between nucleotides 1101 to 1900, between nucleotides 1972 to 2082, between nucleotides 2134 to 2264, between nucleotides 2335 to 2354, between nucleotides 2639 to 2658, between nucleotides 2863 to 2882, between nucleotides 2911 to 2930, and between nucleotides 3048 to 3067. In some embodiments, the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1060 to 1079, between nucleotides 1160 to 1310, between nucleotides 1253 to 1284, between nucleotides 1370 to 1470, between nucleotides 1490 to 1612, between nucleotides 1693 to 1852, and between nucleotides 2863 to 2882.

[0004] For example, the whole genome sequence of the aforementioned type B HBV (serotype adw) is shown below.

[0005] For example, the whole genome sequence of the aforementioned type C HBV (serotype adr) is shown below.

[0006] For example, the whole genome sequence of type D HBV (serotype ayw) is shown below.

[0007] In some embodiments, the sgRNA comprises a nucleotide sequence described in any one of SEQ ID NOs: 4 to 1165. In some embodiments, the sgRNA comprises a subsequence of the nucleotide sequence described in any one of sequence numbers 4 to 1165, wherein the length of the subsequence is 15 to 20 base pairs. In some embodiments, the at least one DNA-binding protein is a CRISPR enzyme, a zinc finger nuclease (ZNF), a transcription activator-like effector nuclease (TALEN), a homing endonuclease, a dCas9-FokI nuclease, or a MegaTal nuclease. In some embodiments, the CRISPR enzyme is a class 2Cas protein and / or a variant thereof. In some embodiments, the CRISPR enzyme is one or more Cas proteins from among class 2II-A Cas protein, class 2II-B Cas protein, class 2II-C Cas protein, class 2V-A Cas protein, class 2V-B Cas protein, class 2V-C Cas protein, class 2V-U Cas protein, and variants thereof. In some embodiments, the CRISPR enzyme is the Cas9 protein and / or a variant thereof. In some embodiments, the at least one DNA-binding protein is dCas9. In some embodiments, the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9, Campylobacter jejuni dCas9, Corynebacterium diphtheria dCas9, Eubacterium ventriosum dCas9, Streptococcus pasteurianus dCas9, Lactobacillus farciminis dCas9, Spirochete globus dCas9, Azospirillum (e.g., strain B510) dCas9, Gluconacetobacter diazotrophicus dCas9, Neisseria cinerea dCas9, Roseburia intestinalis dCas9, Parvibaculum lavamentivorans dCas9, Nitratifractor salsuginis (e.g., strain DSM 16511) dCas9, Campylobacter lari (e.g., strain CF89-12) dCas9, Streptococcus thermophilus (e.g., strain LMD-9) Includes dCas9. In some embodiments, the dCas9 includes the amino acid sequence shown in SEQ ID NOs. 1170-1187. In some embodiments, the at least one gene expression modulator provides modification of at least one nucleotide in the vicinity of the HBV gene and / or within the HBV gene regulatory element. In some embodiments, the at least one gene expression modulator includes one or more selected from the group consisting of DNA methyltransferases, DNA hydroxymethyltransferases, DNA demethyltransferases, histone methyltransferases, histone demethyltransferases, histone acetyltransferases, histone deacetyltransferases, phosphatases, kinases, transcription activators, transcription repressors, some of these, and any combination thereof.

[0008] In some embodiments, the modification of the at least one nucleotide is DNA methylation. In some embodiments, the at least one gene expression modulator comprises one or more selected from the group consisting of DNA methyltransferase (DNMT), zinc finger protein-based transcription factors, some of these, and any combination thereof. In some embodiments, the at least one gene expression modulator comprises a DNA methyltransferase (DNMT) or a portion thereof, and a zinc finger protein-based transcription factor or a portion thereof. In some embodiments, the DNA methyltransferase is DNMT3A, DNMT3B, DNMT3L, DNMT1, or DNMT2. In some embodiments, DNMT3A comprises the amino acid sequence shown in SEQ ID NO: 1166, and DNMT3L comprises the amino acid sequence shown in SEQ ID NO: 1167 or 1195. In some embodiments, the zinc finger protein-based transcription factor is a Kruppel-associated inhibitor (KRAB) or a KRAB domain derived from ZIM3 (ZIM3 KRAB). In some embodiments, the zinc finger protein-based transcription factor comprises the amino acid sequence shown in SEQ ID NO: 1168 or 1196. In some embodiments, the DNA methyltransferase is selected from the group consisting of DNMT3A, DNMT3L, and combinations thereof, and the zinc finger protein-based transcription factor is KRAB or ZIM3 KRAB. In some embodiments, the fusion molecule comprises the at least one gene expression modulator fused to the C-terminus, N-terminus, or both ends of the at least one DNA-binding protein. In some embodiments, the at least one gene expression modulator is directly fused to the at least one DNA-binding protein. In some embodiments, the at least one gene expression modulator is indirectly fused to the at least one DNA-binding protein via a non-modulator, a second modulator, or a linker. In some embodiments, the fusion molecule comprises the domain DNMT3A-DNMT3L-dCas9-KRAB or the domain DNMT3A-DNMT3L-ZIM3 KRAB-dCas9, where hyphen indicates that each subdomain of the fusion molecule is directly and / or indirectly linked, and that each subdomain follows an order from the N-terminus to the C-terminus. In some embodiments, the fusion molecule includes the amino acid sequence shown in SEQ ID NO: 1169 or 1194. In some embodiments, the fusion molecule further comprises at least one nuclear localization sequence (NLS). In some embodiments, the at least one nuclear localization sequence is directly or indirectly fused to the C-terminus, N-terminus, or both ends of the at least one DNA-binding protein. In some embodiments, the nucleic acid sequence encoding the fusion molecule is deoxyribonucleic acid (DNA) or messenger ribonucleic acid (mRNA). In some embodiments, the fusion molecule is packaged in liposomes or lipid nanoparticles. In some embodiments, the fusion molecule and the sgRNA are packaged in liposomes or lipid nanoparticles.

[0009] In some embodiments, the fusion molecule and the sgRNA are packaged in the same liposome or lipid nanoparticle, or in different liposomes or lipid nanoparticles. In some embodiments, the liposomes or lipid nanoparticles include ionized lipids (20% to 70% molar ratio), PEGylated lipids (0% to 30% molar ratio), supporting lipids (30% to 50% molar ratio), and cholesterol (10% to 50% molar ratio). In some embodiments, the ionized lipid is selected from the group consisting of pH-responsive ionized lipids, heat-responsive ionized lipids, and photo-responsive ionized lipids. In some embodiments, the fusion molecule is packaged in an AAV vector. In some embodiments, the fusion molecule and the sgRNA are packaged in an AAV vector. In some embodiments, the fusion molecule and the sgRNA are packaged in the same AAV vector or different AAV vectors. In some embodiments, the composition is a pharmaceutical composition comprising a pharmaceutically acceptable carrier. In another embodiment, the present invention provides a single guide RNA (sgRNA) comprising a sequence complementary to a target DNA sequence, the target DNA sequence being located near and / or within an HBV gene regulatory element, the HBV gene being a type B HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 1, a type C HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 2, or a type D HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 3, the HBV gene regulatory element comprising a transcription start site, a core promoter, a promoter, an enhancer, a silencer, an insulator element, a boundary element, and / or a locus regulatory region, and the target DNA sequence being located between nucleotides 1056 to 2354, between nucleotides 2639 to 2658, between nucleotides 2863 to 2930, and / or between nucleotides 3048 to 3067 of the HBV gene. In some embodiments, the target DNA sequence is located between nucleotides 1056 to 1900, 1972 to 2082, 2134 to 2264, 2335 to 2354, 2639 to 2658, 2863 to 2930, and / or between nucleotides 3048 to 3067 of the HBV gene. In some embodiments, the target DNA sequence is located between nucleotides 1060 to 1079, 1149 to 1612, 1693 to 1852, and / or between nucleotides 2863 to 2882 of the HBV gene. In some embodiments, the target DNA sequence is located in one or more regions of the B HBV gene between nucleotides 1149 and 1190, between nucleotides 1210 and 1310, between nucleotides 1350 and 1400, between nucleotides 1420 and 1450, and between nucleotides 1470 and 1592. In some embodiments, the target DNA sequence is located in one or more regions of the C-type HBV gene between nucleotides 1150 to 1180, between nucleotides 1200 to 1310, between nucleotides 1350 to 1390, between nucleotides 1420 to 1460, and between nucleotides 1480 to 1593.

[0010] In some embodiments, the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1056 to 1079, between nucleotides 1101 to 1900, between nucleotides 1972 to 2082, between nucleotides 2134 to 2264, between nucleotides 2335 to 2354, between nucleotides 2639 to 2658, between nucleotides 2863 to 2882, between nucleotides 2911 to 2930, and between nucleotides 3048 to 3067. In some embodiments, the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1060 to 1079, between nucleotides 1160 to 1310, between nucleotides 1253 to 1284, between nucleotides 1370 to 1470, between nucleotides 1490 to 1612, between nucleotides 1693 to 1852, and between nucleotides 2863 to 2882. In some embodiments, the sgRNA comprises a nucleotide sequence described in any one of SEQ ID NOs: 4 to 1165. In some embodiments, the sgRNA comprises a subsequence of the nucleotide sequence set forth in any one of SEQ ID NOs: 4 to 1165, and the length of the subsequence is 15 to 20 base pairs. In another aspect, the present application provides a nucleic acid molecule encoding the sgRNA described in the present application. In another aspect, the present application provides a method for reducing or eliminating the expression of hepatitis B virus (HBV) gene products in cells, the method comprising introducing the composition described in the present application into the cells, thereby reducing or eliminating the expression of the HBV gene products in the cells. In another aspect, the present application provides a method for reducing or eliminating the expression of hepatitis B virus (HBV) gene products in vivo in a subject, the method comprising introducing the composition described in the present application into the cells of the subject, thereby reducing or eliminating the expression of the HBV gene products in the cells of the subject. In another aspect, the present application provides a method for treating hepatitis B virus (HBV) infection-related diseases in a subject or for alleviating the symptoms of HBV infection-related diseases in a subject, the method comprising introducing an effective amount of the composition described in the present application into the cells of the subject. In some embodiments, the subject is a mammal such as a human, a monkey, a mouse, a rat, a rabbit, a pig, a horse, a cat, and a dog. In some embodiments, the method comprises administering the composition to the subject one or more times. In some embodiments, the method comprises administering the composition to the subject at least twice. In some embodiments, the interval between administering the composition one or more times or at least twice is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, or 15 days. For example, the method comprises administering the composition to the subject once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every 7 days, once every 8 days, once every 9 days, once every 10 days, once every 11 days, once every 12 days, once every 13 days, once every 14 days, or once every 15 days until the subject reaches clinical cure. In some embodiments, the HBV infection-related diseases include hepatitis, cirrhosis, liver fibrosis, and hepatocellular carcinoma caused by HBV infection. In some embodiments, the composition is used for treating HBV infection-related diseases in a subject or reducing the symptoms of HBV infection-related diseases in a subject.

[0011] In another aspect, the present application provides a kit comprising the composition described in the present application, a container for containing the composition, and / or an instruction manual. Those skilled in the art can easily understand other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As is obvious to those skilled in the art, according to the content of the present application, those skilled in the art can make modifications to the specific embodiments disclosed without departing from the spirit and scope of the invention related to the present disclosure. Correspondingly, the descriptions in the drawings and the specification of the present application are merely exemplary and not restrictive.

Brief Description of the Drawings

[0012] The specific features of the invention according to the present application are shown in the appended claims. By referring to the exemplary embodiments and drawings described in detail below, the features and advantages of the invention according to the present application can be better understood. The brief description of the drawings is as follows. [Figure 1A] Shows a schematic diagram of a reporter of HBV viral protein expression described in the present application. [Figure 1B] Shows a schematic diagram of a screening method for verifying the function of sgRNA using the reporter cell line shown in Figure 1A. [Figure 2A-2F] Shows the change in fluorescence intensity after epigenetic editing of the hepatitis B virus (HBV) gene type B for 14 days, 21 days, and 28 days respectively using the HBx reporter cell line shown in Figure 1A. [Figure 2G]This diagram shows the relationship between the target site of sgRNAs in the HBV B genome and their knockdown ability (the vertical axis represents the percentage of cells with different sgRNA knockdowns 28 days after transfection, which can represent the editing ability of sgRNAs, and the horizontal axis represents the location of the target sequence start site for each sgRNA in the HBV B genome). [Figure 3A-3B] Figure 1A shows the change in fluorescence intensity after 14 days of epigenetic editing of the type C HBV gene using the HBx reporter cell line shown. [Figure 3C] This diagram shows the relationship between the target site of sgRNAs in the C-type HBV genome and their knockdown ability (the vertical axis represents the percentage of cells with different sgRNA knockdowns 14 days after transfection, which can represent the editing ability of sgRNAs, and the horizontal axis represents the location of the target sequence start site for each sgRNA in the C-type HBV genome). [Figures 4A-4F] Figure 1A shows the changes in fluorescence intensity after epigenetic editing of the type D HBV gene for 16, 21, and 28 days using the HBx reporter cell line shown. [Figure 4G] This shows the relationship between the target site of sgRNAs in the D-type HBV genome and their knockdown ability (the vertical axis represents the percentage of cells with different sgRNA knockdowns 28 days after transfection, which can represent the editing ability of sgRNAs, and the horizontal axis represents the location of the target sequence start site of each sgRNA in the D-type HBV genome). [Figure 5A] A schematic diagram shows the means for verifying the function of epigenetic editing by the method described in this application in a primary hepatocyte (PHH) HBV infection model. [Figure 5B] The following shows the antigen levels 2, 4, 6, 8, and 10 days after delivery of the pharmaceutical compositions described in this application (each containing different sgRNAs) to primary hepatocytes infected with HBV. [Figure 6] This diagram shows a schematic flow of how a reporter cell line screens an sgRNA library. [Figure 7]The results of screening sgRNA libraries using three reporter cell lines with the D-type HBV genes HBx, HBcAg, and HBsAg are shown (the vertical axis represents the change in the number of NGS sequencing reads in the original library in a GFP-negative cell population of different sgRNAs 14 days after transfection, which can represent the editing ability of the sgRNAs, and the horizontal axis represents the position of the target sequence start site in the D-type HBV genome for each sgRNA). [Figure 8] This shows the effects of candidate sgRNAs screened from a library on primary hepatocytes (PHH). The results in the figure show the inhibition levels of various HBV markers and the survival rate of PHH cells 14 days after HBV infection. [Figures 9A-9C] This shows the knockdown effect of EPIREG on HBV markers in transgenic HBV mice. The results shown in the figure are the overall change curve of HBV markers in each control / treatment group, the change curve of HBV markers in each mouse in each treatment group, and the HBsAb change curve of three mice that produced antibodies after administration. The HBV marker content shown in each curve was taken as a base-10 logarithm and used for data analysis. [Figure 10] This figure shows the knockdown effect of EPIREG on HBV markers in AAV-HBV mice. The HBV marker content shown in the figure was calculated using a base-10 logarithm for data analysis. [Modes for carrying out the invention]

[0013] Embodiments of the present invention will be described below by specific examples, and those skilled in the art will be able to easily understand other advantages and effects of the present invention from the contents disclosed herein. Definition of Terms In this application, the term “fusion molecule” generally refers to a bipartite molecule, which, for example, in this application includes and is bound together with at least one DNA-binding protein and at least one gene expression modulator described herein, thereby forming a single entity. For example, the at least one gene expression modulator may be fused to the at least one DNA-binding protein at the N-terminus, C-terminus, or at any amino acid other than a terminal amino acid, and other molecules or parts may be fused to parts already included in the fusion molecule. The parts constituting the fusion molecule may be separated by a linker or directly bound together. In some embodiments, the fusion molecule is a fusion protein, which may be a chimeric protein produced by directly or indirectly covalently or noncovalently bonding two or more genes, the genes initially encoding individual proteins. In some embodiments, translation of the fusion gene produces a single polypeptide having functional properties derived from each of the original proteins. Those skilled in the art will have a good understanding of the optimal sequence and / or combination of measurements for determining the parts in the fusion molecule of this application. In this application, the terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “nucleotide” are used interchangeably. They generally refer to polymeric forms of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and may perform any known or unknown function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, multiple loci (one locus) defined based on ligation analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may include one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Where present, modifications to the nucleotide structure may occur before or after polymer bonding. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, for example, by conjugation with a labeled component. In this application, the term “DNA-binding protein” generally refers to a larger protein comprising one or more DNA-binding domains (domains of different functions), wherein the DNA-binding domains are individually folded protein domains and contain at least one motif that recognizes double-stranded or single-stranded DNA. For example, the DNA-binding domains may recognize a specific DNA sequence (recognition or regulatory sequence) or have a general affinity for DNA. In some cases, other domains of the DNA-binding protein generally modulate the activity of the DNA-binding domains, and the DNA-binding function may be structural, or it may involve transcriptional regulation, and sometimes both roles overlap. In certain embodiments of the methods and compositions provided in this application, the DNA-binding protein may include (DNA)nucleases such as CRISPR-Cas systems, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or meganucleases, which can target DNA in a sequence-specific manner or can guide or direct the targeting of DNA in a sequence-specific manner. In some embodiments, the DNA-binding protein is a DNA nuclease derived from the CRISPR-Cas system. For example, the DNA nuclease derived from the CRISPR-Cas system is a Cas protein.

[0014] In this application, the term “Cas protein” can be used interchangeably with “CRISPR protein,” “CRISPR enzyme,” “CRISPR-Cas protein,” “CRISPR-Cas enzyme,” “Cas,” “CRISPR effector,” or “Cas effector protein,” and is one of the components of the CRISPR-Cas system. A Cas protein (e.g., an engineered Cas protein) may have substantially the same nuclease activity as the wild-type corresponding Cas protein (e.g., between 80% and 100%, between 90% and 100%, between 95% and 100%, between 98% and 100%, between 99% and 100%, between 99.9% and 100%, or about 100%). In some cases, the engineered Cas protein has higher nuclease activity (e.g., at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%) than the wild-type corresponding Cas protein. Selectively or additionally, the Cas protein (e.g., the engineered Cas protein) has at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% higher specificity than the wild-type corresponding Cas protein. In certain examples, the Cas protein (e.g., the engineered Cas protein) has at least 30% higher specificity than the wild-type corresponding Cas protein. As used herein, the term “specificity” of Cas may correspond to the number or percentage of on-target polynucleotide cleavage events (including on-target and off-target events) relative to all polynucleotide cleavage events. The activity and specificity of the Cas protein are consistent with those described in the following literature.Hsu PD et al., DNA targeting specificity of RNA-guided Cas9 nucleases, Nat Biotechnol. September 2013;31(9): 827-832 and Slaymaker IM et al., Rationally engineered Cas9 nucleases with improved specificity, Science. January 1, 2016;351(6268): 84-88, which also describe examples of methods for detecting the activity and specificity of Cas proteins, and are incorporated herein by reference in their entirety.

[0015] Codon optimization can be performed on nucleic acid molecules encoding Cas. Examples of codon-optimized sequences are, in this case, sequences optimized for expression in eukaryotes (e.g., humans) (i.e., optimized for human expression), or sequences optimized for other eukaryotic animals or mammals as discussed herein; see, for example, the SaCas9 human codon-optimized sequence in WO 2014 / 093622 (PCT / US2013 / 074667). While this is preferred, as can be understood, other examples are possible, and codon optimization for non-human host species or for specific organs is known. In some embodiments, the enzyme-coding sequence encoding Cas is codon-optimized for expression in specific cells, such as eukaryotic cells. Eukaryotic cells may be cells of a particular organism (e.g., mammals, but not limited to humans or non-human eukaryotes or animals or mammals as described herein, e.g., mice, rats, rabbits, dogs, livestock or non-human mammals or primates) or cells derived from a particular organism. In some embodiments, methods for altering the genetic characteristics of the human germline and / or for altering the genetic characteristics of animals (such methods may cause suffering to humans or animals without substantial medical benefit), and animals produced by such methods may be excluded. Generally, codon optimization refers to the process of modifying nucleic acid sequences to enhance expression in target host cells by maintaining the native amino acid sequence while replacing at least one codon in the native sequence (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) with a codon that is more or most frequently used in the host cell's gene. Different species exhibit specific biases for specific codons of specific amino acids. Codon bias (differences in codon use between organisms) is generally associated with the translation efficiency of messenger RNA (mRNA), which is thought to depend, in addition, on the nature of the codon being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of selected tRNAs in cells usually reflects the codons most commonly used in peptide synthesis.Therefore, based on codon optimization, genes can be customized for optimal gene expression in a given organism. Codon usage tables can be easily obtained from the "Codon Usage Database," for example, available at www.kazusa.orjp / codon / , and these tables can be modified in various ways. See Nakamura, Y. et al., "Codon usage tabulated from the international DNA sequence databases: status for the year 2000," Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon-optimizing specific sequences for expression in specific host cells, such as Gene Forge (Appagen; Jacobus, PA), are also available. In some embodiments, one or more codons in the sequence encoding Cas (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more, or all codons) correspond to the most commonly used codons of a particular amino acid.

[0016] In some embodiments, the Cas protein may have nucleic acid cleavage activity. The Cas protein may also have RNA binding and DNA cleavage functions. In some embodiments, Cas can direct the cleavage of one or two nucleic acid strands at or near the target sequence, for example, within the target sequence and / or a complementary sequence of the target sequence, or a sequence related to the target sequence, within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500 or more base pairs from the first or last nucleotide of the target sequence. In some embodiments, the Cas protein can direct multiple cleavages (e.g., one, two, three, four, five, or more cleavages) of one or two strands within the target sequence and / or within a sequence complementary to or related to the target sequence and / or within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500 or more base pairs from the first or last nucleotide of the target sequence. In some embodiments, the cleavage may be flat ends that produce flat ends. In some embodiments, the cleavage may be staggered ends that produce adherent ends. In some embodiments, the vector encodes a Cas protein of a target nucleic acid, and the Cas protein can be mutated compared to the corresponding wild-type enzyme, thereby the mutated target nucleic acid Cas protein lacking the ability to cleave one or two strands of a target polynucleotide containing the target sequence. For example, alterations or mutations in the HNH domain produce a mutant Cas lacking substantially all DNA cleavage activity. For instance, the DNA cleavage activity of the mutated enzyme is about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or less than that of the non-mutated form of the enzyme. One example is when the nucleic acid cleavage activity of the mutant form is zero or negligible compared to the non-mutated form. In some embodiments, Cas proteins can form components of an inductive system. The inductive nature of the system allows for spatiotemporal control of gene editing or gene expression using a single energy form. Examples of energy forms include, but are not limited to, electromagnetic radiation, acoustic energy, chemical energy, and thermal energy. Examples of inductive systems include tetracycline-inductive promoters (Tet-On or Tet-Off), small molecule two-hybrid transcriptional activation systems (FKBP, ABA, etc.), or photoinductive systems (phytochrome, LOV domain, or cryptochrome). In one embodiment, a CRISPR effector protein may be part of a photoinductive transcriptional effector (LITE) that directs changes in transcriptional activity in a sequence-specific manner. The photo component may include a CRISPR effector protein, a photoresponsive cytochrome heterodimer (e.g., derived from Arabidopsis thaliana), and a transcriptional activation / repression domain. Other examples of inducible DNA-binding proteins and their uses are provided in US 61 / 736465, US 61 / 721,283, and WO 2014018423 A2 (these are incorporated herein by reference in their entirety).

[0017] In some embodiments, the mutant Cas may have one or more mutations that result in reduced off-target effects, such as an improved CRISPR enzyme (e.g., when complexed with guide RNA) that results in modification of a target locus but reduces or eliminates off-target activity, or an improved CRISPR enzyme (e.g., when complexed with guide RNA) that enhances CRISPR enzyme activity. As can be understood, the mutant enzymes described below can be used in any way in this application as described elsewhere in this specification. Any methods, products, compositions, and uses described elsewhere in this specification are equally applicable to the mutant CRISPR enzymes described further below. Methods and mutations that can be used in various combinations to enhance or reduce the activity and / or specificity of on-target activity relative to off-target activity, or to enhance or reduce the binding and / or specificity of on-target binding relative to off-target binding, may also be used to compensate for or enhance mutations or modifications made to promote other actions. Such mutations or modifications to promote other actions include mutations or modifications to Cas and / or to guide RNA. The methods and mutations of the present application are used to modulate Cas nuclease activity and / or binding to chemically modified guide RNA. In certain embodiments, the catalytic activity of the Cas protein of this application is altered or modified. As understood, if the catalytic activity differs from that of the corresponding wild-type Cas protein (e.g., non-mutant Cas protein), the mutant Cas has altered or modified catalytic activity. Catalytic activity can be measured by methods known in the art. For example, but not limited to, catalytic activity can be determined in vitro or in vivo by measuring insertion / deletion (indel) percentage (e.g., after a given time or at a given dose). In certain embodiments, catalytic activity is enhanced. In certain embodiments, catalytic activity is enhanced by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%. In certain embodiments, catalytic activity is reduced. In certain embodiments, catalytic activity is reduced by at least 5%, preferably at least 10%, more preferably at least 20%, for example, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or (substantially) 100%. One or more mutations described herein can inactivate catalytic activity, which can significantly reduce all catalytic activity, reduce activity to below an undetectable level, or reduce catalytic activity to an immeasurable level. One or more characteristics of the engineered Cas protein may differ from those of the corresponding wild-type Cas protein. Examples of such characteristics include catalytic activity, gRNA binding, Cas protein specificity (e.g., specificity of the editing decision target), Cas protein stability, off-target binding, target binding, protease activity, nickase activity, and PFS recognition. In some examples, the engineered Cas protein may contain one or more mutations of the corresponding wild-type Cas protein. In some embodiments, the catalytic activity of the engineered Cas protein is enhanced compared to the corresponding wild-type Cas protein. In some embodiments, the catalytic activity of the engineered Cas protein is reduced compared to the corresponding wild-type Cas protein. In some embodiments, gRNA binding of the engineered Cas protein is increased compared to the corresponding wild-type Cas protein. In some embodiments, gRNA binding of the engineered Cas protein is decreased compared to the corresponding wild-type Cas protein. In some embodiments, the specificity of the Cas protein is enhanced compared to the corresponding wild-type Cas protein. In some embodiments, the specificity of the Cas protein is reduced compared to the corresponding wild-type Cas protein. In some embodiments, the stability of the Cas protein is enhanced compared to the corresponding wild-type Cas protein. In some embodiments, the stability of the Cas protein is reduced compared to the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein further includes one or more mutations that inactivate catalytic activity. In some embodiments, the off-target binding of the Cas protein is increased compared to the corresponding wild-type Cas protein. In some embodiments, the off-target binding of the Cas protein is decreased compared to the corresponding wild-type Cas protein. In some embodiments, the target binding of the Cas protein is increased compared to the corresponding wild-type Cas protein. In some embodiments, the target binding of the Cas protein is decreased compared to the corresponding wild-type Cas protein.In some embodiments, the engineered Cas protein has higher protease activity or polynucleotide binding capacity compared to the corresponding wild-type Cas protein. In some embodiments, PFS recognition is altered compared to the corresponding wild-type Cas protein.

[0018] Examples of Cas proteins include Class I (e.g., types I, III, and IV) and Class II (e.g., types II, V, and VI) Cas proteins, e.g., Cas9, Cas12 (e.g., Cas12a, Cas12b, Cas12c, Cas12d), Cas13 (e.g., Cas13a, Cas13b, Cas13c, Cas13d), CasX, CasY, Cas14, their variants (e.g., displaced, cleaved), their homologs, and their orthologues. The terms “orthologue” and “homolog” are known in this art. As further guidance, a “homolog” of a protein as used herein is a protein of the same species that performs the same or similar function as its homolog. Homologous proteins may, but do not necessarily, be structurally related, and may only be partially structurally related. An “orthologue” of a protein as used herein is a protein of a different species that performs the same or similar function as its orthologue. Orthologous proteins may be structurally related, but they do not necessarily have to be; they may only be partially structurally related. In some embodiments, the Cas protein is a class 2 Cas protein, i.e., a Cas protein of the class 2 CRISPR-Cas system. The class 2 CRISPR-Cas system may have subtypes such as type II-A, type II-B, type II-C, type VA, type VB, type VC, or type VU. In some embodiments, the Cas protein is Cas9, Cas12a, Cas12b, Cas12c, or Cas12d. In some embodiments, Cas9 may be SpCas9, SaCas9, StCas9, or other Cas9 orthologues. Cas12 may be Cas12a, Cas12b, and Cas12c, and may include FnCas12a or its homolog or orthologue. The following literature provides definitions and exemplary members of the CRISPR-Cas system: Kira S. Makarova and Eugene V. Koonin, Annotation and Classification of CRISPR-Cas systems, Methods Mol Biol. 2015; 1311: 47-75 and Sergey Shmakov et al., Diversity and evolution of class 2 CRISPR-Cas systems, Nat Rev Microbial. March 2017; 15(3): 169-182.

[0019] In some cases, Cas proteins contain at least one RuvC domain and at least one HNH domain. Cas proteins may further contain first and second linker domains that ligate the RuvC domain to the HNH domain. The first (L1) and second (L2) linkers that ligate HNH to the RuvC domain in Cas9 are described in the studies by Nishimasu, H. et al., "Crystal structure of Cas9 in complex with guide RNA and target RNA," Cell 156 (February 27, 2014): 935-949, and Ribeiro, L. et al. (2018), "Protein engineering strategies to expand CRISPR-Cas9 applications," International Journal of Genomics Volume 2018, Article ID 1652567 (doi.org / 10.1155 / 2018 / 1652567). Figure 1 by Ribeiro shows the overall composition, structure, and function of Cas9, and the literature is incorporated herein by special reference. Specifically, Figure 1A shows a schematic diagram of the domain composition of SpCas9, showing the gene structure of the HNH and RuvC domains, including linkers L1 (extending amino acids 765-780) and L2 (extending amino acids 906-918) as described herein. Similarly, when referring to the first and second linker domains, the domain composition of Staphylococcus aureus Cas9 (SaCas9) can be used. On the one hand, the linker 1 domain region extends from residues 481-519 and links the RuvC-II domain to the HNH domain in SaCas9. In some embodiments, the linker 2 region extends from residues 629-649 and links the RuvC-III domain of SaCas9 to the HNH domain. Therefore, the first and / or second linker domains can be mutated in Cas9 orthologs, and amino acid residues corresponding to those of wild-type SaCas9 can be referenced.Nishimasu, Cell. 27 Aug. 2015; 162(5): 1113-1126; doi: 10.1016 / j.cell.2015.08.007 is incorporated herein by reference. In particular, Figure 1, in which Nishimasu's S1-S3 describes in detail the domain structure of the Cas9 protein, the teachings of which are specifically incorporated herein by reference. The first and second linkers may contain about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 or more amino acids. The first and second linkers can correspond to wild-type linkers. In one embodiment, the first and second linkers may contain one or more mutations in the first and / or second linker. In one embodiment, the first and / or second linker contains one or more mutations that improve Cas9 protein specificity. In some embodiments, linkers L1 and L2 that link the HNH of Cas9 to the RuvC domain contain wild-type amino acid sequences. In some embodiments, the linker that links the HNH to the RuvC domain contains mutations in one or more amino acids. In an embodiment, the first linker (L1) contains a mutation corresponding to the amino acid T769I of SpCas9, and / or the second linker (L2) contains a mutation corresponding to the amino acid G915M of SpCas9. In an embodiment, one or more linker mutations, such as T769I and G915M, confer improved specificity to the Cas9 protein. In one embodiment, as described herein, one or more mutations in the first and second linkers can be combined with one or more mutations in other parts of the Cas9 protein to further improve specificity and / or retain substantially equivalent activity to that of the wild-type Cas9 protein. In one embodiment, mutations in the linkers and / or further mutations in the Cas protein can be identified using the methods detailed herein, the methods enhance / improve specificity to wild-type Cas9 and substantially retain its wild-type activity.

[0020] In some embodiments, the Cas protein may be a Cas protein of the class 2 type II CRISPR-Cas system (type II Cas protein). In some embodiments, the Cas protein may be a class 2 type II Cas protein such as Cas9. In some embodiments, the CRISPR / Cas9-based system may include a Cas9 protein or fragment thereof, a Cas9 fusion protein, a nucleic acid encoding a Cas9 protein or fragment thereof, or a nucleic acid encoding a Cas9 fusion protein. "Cas9 (CRISPR-related protein 9)" refers to a polypeptide or fragment thereof having at least about 85% amino acid identity with NCBI accession number NP_269215 and possessing RNA-binding activity, DNA-binding activity and / or DNA-cleaving activity (e.g., endonuclease or nickase activity). The function of Cas9 can be defined by any of a variety of assays, including but not limited to fluorescence-polarized nucleic acid binding assays, fluorescence-polarized strand entry assays, transcription assays, EGFP disruption assays, DNA cleavage assays and / or Surveyor assays. The term "Cas9 nucleic acid molecule" refers to a polynucleotide encoding a Cas9 polypeptide or a fragment thereof. An exemplary Cas9 nucleic acid molecule sequence is provided in genome sequence number NC_002737. In some embodiments, this specification discloses Cas9 inhibitors, such as naturally occurring Cas9 or variants thereof in Streptococcus pyogenes (SpCas9) or Staphylococcus aureus (SaCas9). Cas9 recognizes foreign DNA by utilizing a protospacer adjacent motif (PAM) sequence and base pairing of target DNA with guide RNA (gRNA). The relative ease with which Cas9 induces target strand breaks at any genomic locus enables efficient genome editing in various cell types and organisms. Cas9 derivatives can also be used as transcription activators / repressors.

[0021] In some cases, the CRISPR-Cas protein is Cas9 or a variant thereof. In some examples, Cas9 may be wild-type Cas9, including any naturally occurring bacterial Cas9, or may be a codon-optimized or modified form, including any chimera, variant, homolog or orthologue. In another aspect of the Application, the Cas9 enzyme may contain one or more mutations and can be used as a universal DNA-binding protein, which may or may not be fused to a functional domain. The mutations may be artificially introduced mutations or gain-of-function or loss-of-function mutations. Another aspect of the Application relates to a mutant Cas9 enzyme fused to a domain, wherein the domain includes, but is not limited to, nucleases, transcriptional activators, transcriptional repressors, recombinases, transposases, histone remodeling enzymes, demethylases, DNA methyltransferases, cryptopigments, photoinducible / controllable domains or chemoinducible / controllable domains. In some cases, the Cas9 enzyme may be derived from or derived from SpCas9 (Streptococcus pyogenes Cas9), saCas9 (Staphylococcus aureus Cas9), or StCas9 (Streptococcus thermophilus wild-type Cas9). As used herein, the term “derived” with respect to an enzyme means that the derived enzyme has been mutated (modified) in some way known in the art or described herein, but primarily based on the fact that it has a high degree of sequence homology with the wild-type enzyme. For example, the mutation may include one or more mutations in the first linker domain, the second linker domain and / or other parts of the protein. A high degree of sequence homology with respect to the wild-type enzyme includes at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.

[0022] In certain embodiments, the CRISPR enzyme may be a Cas9 protein derived from organisms including the following genera: Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Spirochete, and Lactobacillus. (Lactobacillus), Eubacterium, Corynebacterium, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella ( Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum num), Opitutaceae, Tuberbacillus, Bacillus, Brevibacilus, Methylobacterium or Acidaminococcus, Streptococcus, Campylobacter, Nitrate bacteria, Staphylococcus, Parvibaculum, Rosebria, Neisseria, Gluconacetobacter, Azospirillum,Spirochetes, Lactobacillus, Eubacterium, Corynebacterium, Sutterella, Legionella (Treponema), Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Spirochetes, Azospirillum, Gluconacetobacter, Neisseria, Rosebria, Parvibacrum, Staphylococcus, Nitrate bacteria, Mycoplasma, or Campylobacter. In some embodiments, the CRISPR enzyme may be a Cas9 protein derived from an organism including the following: Staphylococcus mutans, Staphylococcus agalactiae, Staphylococcus equisimilis, Staphylococcus sanguinis, Streptococcus pneumoniae, Campylobacter jejuni, Campylobacter coli; Nitratefractor sarsugainis, N. tergarcus; S. auricularis, Staphylococcus carnosus; Neisseria meningitidis, Neisseria gonorrhoeae, Listeria monocytogenes, Listeria ivanovii; Clostridium botulinum, C. difficile, Clostridium tetanus Clostridium sordellii (tetani), Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011 GWA2_33_10, Parcubacteria bacterium GW2011 GWC2_44_17, SCADC species of Smithella (Smithella sp. SCADC), six species of Acidaminococcus BV3L (Acidaminococcus sp.)BV3L6), Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. In some embodiments, the Cas9 protein is derived from organisms whose Cas9 is derived from *Streptococcus pyogenes*, *Staphylococcus aureus*, or *Streptococcus thermophilus*.

[0023] In a more preferred embodiment, the Cas9 protein is derived from a bacterial species selected from Cas9 of Streptococcus pyogenes, Staphylococcus aureus, or Streptococcus thermophilus. In certain embodiments, Cas9 is derived from a bacterial species, which is selected from Tularemia bacilli 1, Prevotella arvensis, Lachnospira MC20171, Butyrivibrio proteoclasticus, Peregrinibacterium GW2011 GWA2 33 JO, Percibacterium GW2011 GWC2_44_17, SCADC species of the genus Sumicella, Acidaminococcus BV3L6 BV3L6 species, Lachnospira MA2020, Metanoplasma thermitum, Eubacterium erigens, Moraxella bobocri 237237, Leptospira inadai, Lachnospirae ND2006, Porphyromonas creviolicanis 3, Prevotella diciens, and Porphyromonas macacae. In certain embodiments, the Cas9 protein is derived from or selected from the bacterial species BV3L6 of Acidaminococcus or Lachnospira MA2020. In certain embodiments, the effector protein is derived from a subspecies of Tularemia 1, including but not limited to the subspecies novicida. Cas9 protein is found in *Streptococcus pyogenes* M1 serotype (UniProt ID: Q99ZW2), *Staphylococcus aureus* Cas9 (UniProt ID: J7RUA5), *Eubacterium ventriosum* Cas9 (UniProt ID: A5Z395), *Azospirillum* (B510 strain) Cas9 (UniProt ID: D3NT09), *Acetobacter diazotropicus* (ATCC 49037 strain) Cas9 (UniProt ID: A9HKP2), *Neisseria cinerea* Cas9 (UniProt ID: D0W2Z9), *Rosebria intestinalis* Cas9 (UniProt ID: C7G697), and *Parvivacrum lavamentivorans* (DS-1 strain) Cas9 (UniProt ID: This includes, but is not limited to, A7HP89, Nitratefractor sarsugainis (DSM 16511 strain) Cas9 (UniProt ID: E6WZS9), and Campylobacter lari Cas9 (UniProt ID: G1UFN3). The enzymatic activity of Cas9 derived from Streptococcus pyogenes or any closely related Cas9 generates a double-strand break at a target site sequence, the target site sequence hybridizes to a 20-nucleotide length of the guide sequence, and has a protospacer adjacent motif (PAM) sequence following the 20-nucleotide length of the target sequence (for example, NGG / NRG, which can be determined as described herein). The CRISPR activity of site-specific DNA recognition and cleavage by Cas9 is defined by the guide sequence, the tracr sequence that hybridizes to the guide sequence portion, and the PAM sequence. Further embodiments of the CRISPR system are described in Karginov and Hannon, The CRISPR system: small RNA-guided defense in bacteria and archaea, Mole Cell January 15, 2010;37(1): 7. A type II CRISPR locus derived from Streptococcus pyogenes SF370 comprises four genes, Cas9, Cas1, Cas2, and Csnl, and two non-coding RNA components, tracrRNA, and a characteristic array of repetitive sequences (forward repetitive sequences), the repetitive sequences being separated by short segments of non-repetitive sequences (spacers, each approximately 30 bp). In this system, target DNA double-strand breaks (DSBs) are generated in four consecutive steps. First, two non-coding RNAs (pre-crRNA array and tracrRNA) are transcribed from the CRISPR locus. Second, the tracrRNA hybridizes to the forward repetitive sequence of the pre-crRNA and is then processed into a mature crRNA containing a single spacer sequence. Third, the mature crRNA:tracRNA complex is formed via a heteroduplex between the crRNA spacer and the pre-spacer DNA, guiding Cas9 to a DNA target consisting of the pre-spacer and the corresponding PAM. Finally, Cas9 mediates the cleavage of DNA upstream of the PAM, generating a double-sided block (DSB) within the original spacer. In certain embodiments, Cas9 may be constitutively, inductively, or conditionally present, or administered or delivered. Cas9 optimization can be used for functional enhancement or novelty development.A chimeric Cas9 protein can be generated, and Cas9 can be used as a universal DNA-binding protein. The structural information provided to Cas9 can be used to further manipulate and optimize the CRISPR-Cas system, which can also be used to infer structure-function relationships in other CRISPR enzyme systems, particularly in other type II CRISPR enzymes or Cas9 orthologues. Furthermore, the Cas9 protein contains an easily identifiable C-terminal region homologous to the transposon ORF-B and contains an active RuvC-like nuclease (including an algin-rich region).

[0024] In this application, the term “gene expression modulator” may generally be selected from gene expression repressors (e.g., KRAB), gene expression activators, or epigenetically modified modulators (e.g., DNMT3A, DNMT3L, DNMT3A-DNMT3L fusion peptides), or any combination thereof. For different gene expression modulators known in the art, see, for example, Thakore et al., Nat Methods. 2016; 13: 127-37, which is incorporated herein by reference in its entirety. In some embodiments, the gene expression modulator includes a gene expression repressor. The repressor may be any known gene expression repressor, selected from, for example, the Kruppel-associated box (KRAB) domain, mSin3 interaction domain (SID), MAX-interaction protein 1 (MXI1), chromo shadow domain, EAR transcription repressor domain (SRDX), eukaryotic termination factor 1 (ERFl), eukaryotic termination factor 3 (ERF3), tetracycline repressor, lad repressor, Catharanthus roseus G-box binding factors 1 and 2, Drosophila Groucho, tripartite motif 28 (TRTM28), nuclear receptor co-repressor 1, nuclear receptor co-repressor 2, or fragments or fusions thereof. For example, the Kruppel-associated box (KRAB) domain is a type of transcription repressor domain and is present in the N-terminal portion of many zinc finger protein-based transcription factors. The KRAB domain, when linked to target DNA via its DNA-binding domain, functions as a transcriptional repressor. The KRAB domain is rich in charged amino acids and is classified into subdomains A and B. The KRAB A and B subdomains can be separated by a variable spacer segment, and many KRAB proteins contain only the A subdomain. A sequence of 45 amino acids in the KRAB A subdomain has been proven crucial for transcriptional inhibition. The B subdomain itself does not inhibit transcription but enhances the inhibitory effect exerted by the KRAB A subdomain. The KRAB domain recruits the corepressor KAP1 (also known as KRAB-related protein-1, transcription intermediary factor 1 beta, KRAB-A interacting protein, and tripartite motif protein 28) and heterochromatin protein 1 (HP1), and other chromatin regulatory proteins, resulting in transcriptional inhibition via heterochromatin formation. In some embodiments, the methods and compositions provided herein include fusion molecules comprising dCas9 fused to a KRAB domain or a fragment thereof.In some embodiments, the KRAB domain or a fragment thereof is fused to the N-terminus of dCas9. In some embodiments, the KRAB domain or a fragment thereof is fused to the C-terminus of dCas9. In one embodiment, the KRAB domain or a fragment thereof is fused to both the N-terminus and the C-terminus of the dCas9 molecule. In some embodiments, the fusion molecule comprises a KRAB domain, the domain comprising the sequence shown in SEQ ID NO: 1168, a sequence substantially identical to SEQ ID NO: 1168 (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identity), or a sequence having one, two, three, four, five or more modifications (e.g., amino acid substitutions, insertions, or deletions) to SEQ ID NO: 1160, or any fragment thereof. In some embodiments, the zinc finger protein-based transcription factor is a KRAB domain found in many Kruppel-type C2H2 zinc finger proteins, for example, a KRAB domain derived from ZIM3 (ZIM3 KRAB). For example, the fusion molecule includes a ZIM3 KRAB domain, the domain including the sequence shown in SEQ ID NO: 1196, a sequence that is essentially identical to SEQ ID NO: 1196 (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or more identical), or a sequence having one, two, three, four, five or more modifications (e.g., amino acid substitutions, insertions, or deletions) to SEQ ID NO: 1196, or any fragment thereof. Other KRAB domain active fragments can be identified by any appropriate comparative method in the art.

[0025] In some embodiments, the gene expression modulator includes a gene expression activator. The activator may be any known gene expression activator, e.g., the VP16 activation domain, the VP64 activation domain, the p65 activation domain, the Epstein-Barr virus R transactivator Rta molecule, or fragments thereof. Activation for dCas9 is known in the art. See, for example, Chavez et al., Nat Methods. (2016) 13: 563-67, which is incorporated herein by reference in its entirety. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to VP64, p65, Rta, or any combination thereof. The triactivator VP64-p65-Rta (also referred to as VPR) (where the three transcriptional activation domains are fused using a short amino acid linker) can effectively upregulate gene expression when fused with dCas9. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to VPR. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to a gene expression modulator, wherein the gene expression modulator comprises an epigenetic modification modulator. In some embodiments, the fusion molecule modulates the expression of a target gene at a regulatory element of the target gene (e.g., promoter, enhancer, or transcription start site) via epigenetic modification, such as histone acetylation or methylation, or DNA methylation. The modulator may be any known epigenetic modification modulator, such as a histone acetyltransferase (e.g., p300 catalytic domain), a histone deacetylase, a histone methyltransferase (e.g., SUV39H1 or G9a (EHMT2)), a histone demethylase (e.g., LSD1), a DNA methyltransferase (e.g., DNMT3A or DNMT3A-DNMT3L), a DNA demethylase (e.g., TET1 catalytic domain or TDG), or a fragment thereof. In some embodiments, the epigenetic modification modulator may have histone modification activity, which may include, but is not limited to, histone deacetylase, histone acetyltransferase, histone demethylase, or histone methyltransferase activity. For example, the epigenetic modification modulator may have histone acetyltransferase activity, and the histone acetyltransferase may be p300 or a CREB-binding protein (CBP) protein or a fragment thereof. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to acetyltransferase p300 or a fragment thereof (e.g., a catalytic core of p300). In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to a CREB-binding protein (CBP) protein or a fragment thereof. Furthermore, for example, the epigenetic modification modulator may have histone demethylase activity. In some embodiments, the epigenetic modification modulator may include an enzyme that removes a methyl (CH3-) group from a nucleic acid or protein (e.g., a histone). In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to Lys-specific histone demethylase 1 (LSD1) or a fragment thereof. Furthermore, for example, the epigenetic modification modulator may have histone methyltransferase activity. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to SUV39H1 or a fragment thereof. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to G9a (EHMT2) or a fragment thereof.

[0026] In some embodiments, the epigenetic modification modulator may have DNA demethylase activity. In some embodiments, the epigenetic modification modulator can convert methyl groups to hydroxymethylcytosine as a DNA demethylation mechanism. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to 10-11 position metathesis methylcytosine dioxygenase 1 (TET1) or a fragment thereof. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to thymine DNA glycosylase (TDG) or a fragment thereof. Furthermore, for example, the epigenetic modification modulator may have DNA methylase activity. In some embodiments, the epigenetic modification modulator may have methylase activity involved in the transfer of methyl groups to DNA, RNA, proteins, small molecules, cytosine, or adenine. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to DNMT3A or a fragment thereof. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to DNMT3L or a fragment thereof. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising DNMT3L and dCas9 fused to DNMT3L or a fragment thereof. In some embodiments, the methods and compositions provided herein include a fusion molecule comprising dCas9 fused to a DNMT3A-DNMT3L fusion peptide. In some embodiments, the epigenetic modification modulator having DNA methyltransferase activity is human-derived DNMT3L and comprises the amino acid sequence shown in SEQ ID NO: 1195. In this application, the term “guide RNA (gRNA)” is used interchangeably with “guide molecule,” “guide sequence,” and “single guide RNA (sgRNA),” and in the context of the CRISPR-Cas system, generally includes any polynucleotide sequence that is sufficiently complementary to the target DNA sequence, hybridizes with the target DNA sequence, and directs the specific binding of the nucleic acid target complex (e.g., the composition described herein) to the target DNA sequence. The guide RNA can form a double helix with the target DNA sequence. In some embodiments, the guide RNA can form a complex with the CRISPR-Cas protein and includes a guide sequence that is sufficiently complementary to the target DNA sequence to hybridize with the target DNA sequence and directs the sequence-specific binding of the complex to the target DNA sequence. The guide molecule or guide RNA of the CRISPR-Cas protein may include a tracr-mate sequence (including a “forward repeat sequence” in the case of the endogenous CRISPR system) and a guide sequence (also referred to as a “spacer” in the case of the endogenous CRISPR system). In some embodiments, the CRISPR-Cas systems or complexes described herein do not include and / or depend on the presence of tracr sequences. In certain embodiments, the guide molecule includes, or substantially consists of, a forward repeat sequence fused to or ligated to a guide sequence or spacer sequence. Generally, the characteristic feature of CRISPR-Cas systems lies in components that promote the formation of the CRISPR complex at the target DNA sequence site, where hybridization between the target DNA sequence and the guide sequence promotes the formation of the CRISPR complex.

[0027] In certain embodiments, the length of the guide sequence or spacer of the guide molecule is 15 to 50 nucleotides. In certain embodiments, the length of the spacer of the guide RNA is at least 15 nucleotides. In certain embodiments, the length of the spacer is 15 to 17 nucleotides, 17 to 20 nucleotides, 20 to 24 nucleotides, 23 to 25 nucleotides, 24 to 27 nucleotides, 27 to 30 nucleotides, 30 to 35 nucleotides, or greater than 35 nucleotides. In some embodiments, the length of the guide array is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, The length is 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides. In some embodiments, the sequence of the guide molecule (forward repeat sequence and / or spacer) is selected to reduce the degree of secondary structure within the guide molecule. In some embodiments, for optimal folding, approximately 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or less of the nucleotides of the nucleic acid target guide RNA are involved in self-complementary base pairing. Optimal folding can be determined by any suitable polynucleotide folding algorithm. Some processes are based on the calculation of the minimum Gibbs free energy. An example of such an algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res9 (1981), 133-148). Another example of a folding algorithm is RNAfold, an online network server developed by the Institute for Theoretical Chemistry at the University of Vienna, which uses a center-of-mass structure prediction algorithm (see, for example, AR Gruber et al., 2008, Cell 106(1): 23-24 and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62). As described above, the CRISPR / Cas9 system utilizes gRNA to provide targeting for CRISPR / Cas9-based systems. gRNA is a fusion of two non-coding RNAs, crRNA and tracrRNA. By swapping the sequences encoding a 20 bp prespacer sequence, sgRNA can target any desired DNA sequence, the prespacer conferring target specificity through complementary base pairing with the desired DNA target. gRNA mimics the naturally occurring crRNA:tracrRNA double-stranded sequence involved in type II effector systems. This double-stranded sequence (which may, for example, consist of a 42-nucleotide crRNA and a 75-nucleotide tracrRNA) acts as a guide for Cas9 to cleave the target nucleic acid.

[0028] In another embodiment, the sgRNA provided by the present application may further include a scaffold sequence, the scaffold sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9%, or at least 100% sequence identity with the nucleotide sequence shown in SEQ ID NO: 1190 and retaining its biological activity, or having a nucleotide sequence manipulated based on the nucleotide sequence described in SEQ ID NO: 1190 and retaining its biological activity. For example, the manipulation may be one or more of base phosphorylation, base sulfation, base methylation, base hydroxylation, sequence shortening, and sequence lengthening. Furthermore, the sequence shortening and sequence lengthening may include deletions or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases relative to the base sequence. For example, the scaffold sequence is: NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 1190) is also acceptable. In some embodiments, the sgRNA provided herein may further include the CRISPR spacer sequence at the 5' end of the scaffold sequence, wherein the CRISPR spacer sequence is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long and is capable of complementary pairing with a target sequence. In preferred embodiments, the CRISPR spacer sequence is 20 or 21 nucleotides long and is capable of complementary pairing with a target sequence. In some embodiments, the sgRNA may further include a terminator at the 3' end of the spacer sequence. For example, the terminator is a plurality of terminators consisting of at least six (e.g., seven or eight) Us. In this application, the terms “target DNA” and “target sequence” or “prespacer” are used interchangeably and generally refer to a nucleotide sequence present in the target nucleic acid, including a nucleic acid base sequence complementary to the oligonucleotide of this application (e.g., guide RNA). In some cases, the target sequence consists of a region on the target nucleic acid complementary to a contiguous nucleotide sequence of the oligonucleotide of this application. In some cases, the target sequence may represent a selectable region of the target nucleic acid that is longer than the complementary sequence of a single oligonucleotide and can be targeted by, for example, several oligonucleotides of this application. In some cases, “target sequence” may mean a part of the target gene, for example, one or more exon sequences, intron sequences, or regulatory sequences of the target gene, or exon and intron sequences, intron and regulatory sequences, exon and regulatory sequences, or combinations of exons, introns and regulatory sequences of the target gene. In the context of CRISPR complex or system formation in this application, “target DNA” refers to a sequence to which the guide RNA sequence is designed to be complementary, and hybridization between the target DNA and the guide RNA sequence promotes the formation of the CRISPR complex or system. In some examples, the target DNA is located in the cell nucleus or cytoplasm. The CRISPR / Cas9-based system may include at least one gRNA that targets different DNA sequences. The target DNA sequences may be duplicated. Following the target sequence or prespacer is a PAM sequence located at the 3' end of the prespacer. Different type II systems have different PAM requirements. For example, the type II Streptococcus pyogenes system uses the "NGG" sequence, where "N" may be any nucleotide.

[0029] In some embodiments, the amount of gRNA administered to the cells may be at least one type of gRNA, at least two different gRNAs, at least three different gRNAs, at least four different gRNAs, at least five different gRNAs, at least six different gRNAs, at least seven different gRNAs, at least eight different gRNAs, at least nine different gRNAs, at least ten different gRNAs, at least eleven different gRNAs, at least twelve different gRNAs, at least thirteen different gRNAs, at least fourteen different gRNAs, at least fifteen different gRNAs, at least sixteen different gRNAs, at least seventeen different gRNAs, at least eighteen different gRNAs, at least nineteen different gRNAs, at least twenty different gRNAs, at least twenty-five different gRNAs, at least thirty different gRNAs, at least thirty-five different gRNAs, at least forty different gRNAs, at least forty-five different gRNAs, or at least fifty different gRNAs. In some embodiments, the amount of gRNA administered to cells is: at least 50 different gRNAs from at least 1 gRNA; at least 45 different gRNAs from at least 1 gRNA; at least 40 different gRNAs from at least 1 gRNA; at least 35 different gRNAs from at least 1 gRNA; at least 30 different gRNAs from at least 1 gRNA; at least 25 different gRNAs from at least 1 gRNA; at least 20 different gRNAs from at least 1 gRNA; at least 16 different gRNAs from at least 1 gRNA; at least 12 different gRNAs from at least 1 gRNA; at least 8 different gRNAs from at least 1 gRNA; at least 4 different gRNAs from at least 1 gRNA; at least 50 different gRNAs from at least 4 different gRNAs; at least 45 different gRNAs from at least 4 different gRNAs; at least 40 different gRNAs from at least 4 different gRNAs. NA, at least 35 different gRNAs from at least 4 different gRNAs, at least 30 different gRNAs from at least 4 different gRNAs, at least 25 different gRNAs from at least 4 different gRNAs, at least 20 different gRNAs from at least 4 different gRNAs, at least 16 different gRNAs from at least 4 different gRNAs, at least 12 different gRNAs from at least 4 different gRNAs, at least 8 different gRNAs from at least 4 different gRNAs, at least 50 different gRNAs from at least 8 different gRNAs, at least 45 different gRNAs from at least 8 different gRNAs, at least 40 different gRNAs from at least 8 different gRNAs, at least 35 different gRNAs from at least 8 different gRNAs, at least 30 different gRNAs from 8 different gRNAs, at least 25 different gRNAs from at least 8 different gRNAs, at least 20 different gRNAs from 8 different gRNAs,The selection may involve at least 16 different gRNAs from at least 8 different gRNAs, or at least 12 different gRNAs from 8 different gRNAs. In some embodiments, the transcription of the target gene is increased or decreased by the selection of gRNAs.

[0030] As used herein, the term “regulatory element” refers to a genetic element capable of controlling the expression of a nucleic acid sequence. For example, splicing signals, promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRESs"), and enhancers jointly provide replication, transcription, and translation of coding sequences in recipient cells. Not all of these regulatory sequences are necessarily present. Transcriptional regulatory signals in eukaryotes typically include “promoter” and “enhancer” elements. Promoters and enhancers consist of short arrays of DNA sequences; promoters are regulatory elements that promote transcription initiation of operably linked coding regions, and enhancers are regulatory elements that increase the rate of genetic transcription by increasing the activity of the nearest promoter located on the same DNA molecule; these sequences specifically interact with cellular proteins involved in transcription (Maniatis et al., Science 236:1237 (1987), the entire work incorporated herein by reference). Promoter and enhancer elements have been isolated from various eukaryotic sources, including genes in yeast, insect, and mammalian cells, as well as viruses (similar regulatory sequences, i.e., promoters, have also been found in prokaryotes). The selection of specific promoters and enhancers depends on the type of recipient cell. Some eukaryotic promoters and enhancers have a broad host range, while others function within a limited subset of cell types (for reviews, see, for example, Voss et al., Trends Biochem. Sci., 11:287 (1986); and Maniatis et al. (ibid.), the entire work of which is incorporated herein by reference). For example, the SV40 early gene enhancer is highly active in various cell types derived from many mammals and has been used to express proteins in various mammalian cells (Dijkema et al., EMBO J.4:761 (1985), the entire work of which is incorporated herein by reference).Promoter and enhancer elements derived from the human elongation factor 1-α gene (Uetsuki et al., J. Biol. Chem., 264:5791 (1989); Kim et al., Gene 91:217 (1990); and Mizushima and Nagata, Nucl. Acids. Res., 18:5322 (1990)), long-terminal repeat sequences of Roussarcoma virus (Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777 (1982)), and human cytomegalovirus (Boshart et al., Cell 41:521 (1985)) can also be used to express proteins in different mammalian cell types, and the aforementioned references are incorporated herein by reference in their entirety. Promoter and enhancer elements can exist naturally, either alone or together. For example, retroviral long-terminal repeat sequences contain promoter and enhancer elements. Generally, the roles of promoters and enhancers are independent of the gene being transcribed or translated. Therefore, the enhancers and promoters used may be “endogenous,” “exogenous,” or “heterogeneous” with respect to the gene to which they are operably ligated. “Endogenous” enhancers / promoters are those naturally ligated to a given gene in the genome. “Exogenous” or “heterogeneous” enhancers or promoters are those juxtaposed with a gene by genetic engineering (i.e., molecular biology techniques), where the transcription of the gene is directed by the ligated enhancer / promoter. The presence of a “splicing signal” on an expression vector typically results in high levels of recombinant transcript expression.

[0031] In certain embodiments, the “splicing signal” mediates the removal of introns from the primary RNA transcript and consists of splice donor and acceptor sites (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, New York (1989), pp. 16.7–16.8, the entire text is incorporated herein by reference). A common splice donor and acceptor site is the splice site of SV40 16S RNA. In certain embodiments, the “transcription termination signal” is typically located downstream of the polyadenylation signal and is several hundred nucleotides long. For example, the terms “poly A signal” or “poly A sequence” refer to the DNA sequence that directs the termination and polyadenylation of nascent RNA transcripts. Transcripts lacking a poly A signal are unstable and rapidly degraded, so efficient polyadenylation of recombinant transcripts is often required. The poly A signal used in expression vectors may be “heterogeneous” or “endogenous.” An endogenous poly A signal is a signal that naturally exists at the 3' end of the coding region of a given gene in the genome. A heterogeneous poly A signal is a signal isolated from one gene and operably ligated to the 3' end of another gene. A common heterogeneous poly A signal is the SV40 poly A signal. The SV40 poly A signal is contained within the 237 bp BamHI / BclI restriction fragment and indicates termination and polyadenylation (Sambrook et al., ibid., 16.6-16.7, the whole is incorporated by reference).

[0032] In this application, the term "inactivated Cas9 protein" may be referred to as the "dCas9" protein. Known methods for generating Cas9 proteins (or fragments thereof) having an inactive DNA cleavage domain can be seen, for example, in Science.337:816-821 (2012) by Jinek et al., and in "Repurposing CRISPR as an RNA-GuidedPlatform for Sequence-Specific Control of Gene Expression" by Qi et al., Cell.28,152(5):1173-83 (2013), both of which are incorporated herein by reference in their entirety. For example, the DNA cleavage domain of Cas9 is known to contain two subdomains: the HNH nuclease subdomain and the RuvC1 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC1 subdomain cleaves the strand non-complementary. Mutations in these subdomains can silence the nuclease activity of Cas9. For example, the D10A and H840A mutations completely inactivate the nuclease activity of Streptococcus pyogenes Cas9 (Jinek et al. Science. 337:816-821 (2012), Qi et al. Cell. 28;152(5):1173-83 (2013)). Appropriate CRISPR-inactive or nick DNA-binding domains include, but are not limited to, the nuclease-inactive variant Cas9 domain, and include the D10A, D10A / D839A / H840A and D10A / D839A / H840A / N863A mutation domains, as described in WO2015089406A1, which is incorporated herein by reference. In some cases, endonuclease-inactive dCas9 derived from Streptococcus pyogenes targets genes in bacterial, yeast, and human cells via gRNA, silencing gene expression through steric hindrance. As used herein, "dCas" may refer to a dCas protein or a fragment thereof. As used herein, "dCas9" may refer to a dCas9 protein or a fragment thereof.As used herein, "iCas" and "dCas" are interchangeable and refer to CRISPR-related proteins that are inactive as catalysts. In one embodiment, the dCas protein contains one or more mutations in the DNA cleavage domain. In one embodiment, the dCas protein contains one or more mutations in the RuvC or domain. In one embodiment, the dCas molecule contains one or more mutations in both the RuvC and HNH domains. In one embodiment, the dCas protein is a fragment of the wild-type Cas protein. In one embodiment, the dCas protein is a functional domain derived from the wild-type Cas protein, the functional domain being selected from the Reel domain, the cross-linking helix domain, or the PAM interaction domain. In one embodiment, the nuclease activity of dCas is reduced by at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to the nuclease activity of the corresponding wild-type Cas protein.

[0033] A suitable dCas may be derived from the wild-type Cas protein. The Cas protein may be derived from the type I, type II, or type III CRISPR-Cas system. In one embodiment, a suitable dCas may be derived from Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, or Cas10. In one embodiment, the dCas is derived from the Cas9 protein. For example, dCas9 can be obtained by introducing a point mutation (e.g., substitution, deletion, or addition) into the DNA cleavage domain (e.g., nuclease domain, e.g., RuvC and / or HNH domain) of the Cas9 protein. See, for example, Jinek et al., Science (2012) 337:816-21, which is incorporated herein by reference in its entirety. For example, the introduction of two point mutations in the RuvC and HNH domains reduces Cas9 nuclease activity while retaining Cas9 sgRNA and DNA binding activity. In one embodiment, the two point mutations in the RuvC and HNH active sites are the D10A and H840A mutations of Streptococcus pyogenes Cas9. Alternatively, D10 and H840 of Streptococcus pyogenes Cas9 can be deleted to remove Cas9 nuclease activity while simultaneously retaining its sgRNA and DNA binding activity. In one embodiment, the two point mutations in the RuvC and HNH active sites are the D10A and N580A mutations of Streptococcus pyogenes Cas9.

[0034] In each embodiment, the present application relates to the dCas protein or any variant or variant. All variants and variants of dCas9 can be used in the methods, compositions, fusion molecules or kits disclosed herein, and such variants and variants include, but are not limited to, SpCas9 (Cas9 isolated from Streptococcus pyogenes), SaCas9 (Cas9 isolated from Staphylococcus aureus), StCas9 (Cas9 isolated from Thermophilus), NmCas9 (Cas9 isolated from Neisseria meningitidis), FnCas9 (Cas9 isolated from Francisella novicida), CjCas9 (Cas9 isolated from Campylobacter jejuni), ScCas9 (Cas9 isolated from Streptococcus canis) and any variant and variant forms derived from the above Cas9, and high-fidelity Cas9 These include variants and mutants such as (Kleinstiver et al., Nature. January 28, 2016) and enhanced SpCas9 (Slaymaker et al., Sciences. January 1, 2016). For example, the dCas9 sequences shown in SEQ ID NOs. 1170-1187 in this application provide only a few exemplary options and are not exclusive. In one embodiment, the dCas protein is a Streptococcus pyogenes dCas9 protein containing mutations in D10 and / or H840 (e.g., shown in SEQ ID NO. 1170). In one embodiment, the dCas protein is a Streptococcus pyogenes dCas9 protein containing D10A and / or H840A mutations (e.g., shown in SEQ ID NO. 1170).In one embodiment, the dCas9 protein is a Staphylococcus aureus dCas9 protein and includes an amino acid sequence shown in any one of sequence numbers 1171-1173, a sequence substantially identical to any one of sequence numbers 1171-1173 (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity), or a sequence having one, two, three, four, five, or more modifications (e.g., amino acid substitutions, insertions, or deletions) to any one of sequence numbers 1171-1173, or any fragment thereof.

[0035] Similar mutations can be applied to any other naturally occurring Cas9 (e.g., Cas9 from other species) or engineered Cas9. In certain embodiments, dCas9 may refer to Streptococcus pyogenes dCas9, Staphylococcus aureus dCas9, Campylobacter jejuni dCas9, Corynebacterium diphtheria dCas9, Eubacterium ventriosum dCas9, Streptococcus pasteurianus dCas9, Lactobacillus farciminis dCas9, Sphaerochaeta globus dCas9, or Azospirillum (e.g., strain B510). The vectors include dCas9, Gluconacetobacter diazotrophicus dCas9, Neisseria cinerea dCas9, Roseburia intestinalis dCas9, Parvibaculum lavamentivorans dCas9, Nitratifractor salsuginis (e.g., strain DSM 16511) dCas9, Campylobacter lari (e.g., strain CF89-12) dCas9, Streptococcus thermophilus (e.g., strain LMD-9) dCas9, or fragments thereof. In certain embodiments, the present application further provides vectors comprising nucleotides encoding the following protein molecules.The protein molecules include Streptococcus pyogenes dCas9, Staphylococcus aureus dCas9, Campylobacter jejuni dCas9, Neisseria diphtheriae dCas9, Eubacterium bentriosa dCas9, Streptococcus pasteurianus dCas9, Lactobacillus farciminis dCas9, Sphaerocaeta globus dCas9, Azospirillum (B510 strain) dCas9, Gluconacetobacter diazotropicus dCas9, Neisseria cinerea dCas9, Rosbria intestinalis dCas9, Parvibacrum labmentivoran dCas9, Nitratifractor salsinus (DSM 16511 strain) dCas9, and Campylobacter lari (CF89-12 strain). dCas9, Streptococcus thermophilus (LMD-9 strain) dCas9, or fragments thereof. In this application, the term “nucleotide modification” may mean synthesizing or modifying nucleic acids described in the present invention by mature methods in the art, such as those described in “Current protocols innucleic acid chemistry” Beaucage, SL et al., (Edrs.), John Wiley & Sons, Inc., New York, NY, USA (which are incorporated herein by reference). Such modifications include, but are not limited to, terminal modifications such as 5'-terminal modifications (e.g., phosphorylation, conjugation, inverted linkage) or 3'-terminal modifications (e.g., conjugation, DNA nucleotide, trans linkage, etc.), base modifications such as substitution with stabilizing bases, destabilizing bases or bases that form base pairs with an extended base pair library, base removal (debastic nucleotide), or base conjugation, sugar modifications (e.g., sugar modifications at the 2'- or 4'-position) or sugar substitutions, or skeletal modifications including modifications or substitutions to phosphate diester bonds. In this application, the terms “DNA methylation” and “nucleic acid methylation” are used interchangeably and generally refer to the methylation state of a gene fragment, nucleotide, or its base in this application, a process that often occurs inside a cell transfected with nucleic acid, the cell being transfected with a nucleic acid containing a structural gene encoding a polypeptide operably linked to a promoter, in which cytosines in the promoter nucleic acid are converted to 5-methylcytosine. A promoter nucleic acid in which at least one cytosine is converted to 5-methylcytosine is called a “methylated” nucleic acid or DNA. The DNA fragment in which a gene is located in this application may have methylation on one or more strands, or methylation at one or more positions.

[0036] In this application, the term “part of” generally refers to a portion or fragment of a specified whole. For example, when used in this application for a specified polypeptide sequence, the term “part of” means a specified polypeptide sequence that has a continuous length shorter than the full-length sequence of the specified polypeptide. A portion of a specified polypeptide can be defined by its first and last positions, where the first and last positions correspond to positions in the specified polypeptide sequence, respectively, where the sequence position corresponding to the first position is located at the N-terminus of the sequence position corresponding to the last position, and the sequence of the portion is a continuous amino acid sequence in the specified polypeptide, beginning at the sequence position corresponding to the first position and ending at the sequence position corresponding to the last position. A portion can also be defined by referring to the length of residues relative to positions and reference positions in the specified polypeptide sequence, where the sequence of the portion is a continuous amino acid sequence in the specified polypeptide, having a defined length and positioned within the specified polypeptide based on the defined positions. In this application, the term "directly or indirectly fused" generally refers to relative "direct fusion" or "indirect fusion." The term "direct fusion" generally refers to direct linking or direct bonding. For example, such direct linking may occur even if there are no segment components (e.g., amino acid residues or their derivatives) between the linked substances (e.g., amino acid sequence segments), and they are directly linked. For example, amino acid sequence segment X and another amino acid sequence segment Y are directly linked by an amide bond formed between the C-terminal amino acid of amino acid sequence segment X and the N-terminal amino acid of amino acid sequence segment Y. "Indirect fusion" generally refers to cases where there are segment components (e.g., amino acid residues or their derivatives) between the linked substances (e.g., amino acid sequence segments), and they are indirectly linked.

[0037] In this application, the vector for packaging the composition, fusion molecule and / or guide molecule (sgRNA) described herein may include lipid particles, for example, the lipid particles may be lipid nanoparticles (LNPs) and liposomes. For example, as used herein, the terms “lipid nanoparticles (LNPs),” “one LNP,” or “multiple LNPs” generally refer to particles containing multiple (i.e., more than one) lipid molecules physically bound to one another by intermolecular forces (e.g., covalent or non-covalent). LNPs may be, for example, microspheres (monolayer and multilayer vesicles, including liposomes), dispersed phases in emulsions, micelles, or inner phases in suspensions. LNPs can encapsulate nucleic acids within cationic lipid particles (e.g., liposomes) and deliver them to cells relatively easily. In some examples, the lipid nanoparticles do not contain any viral components, thereby minimizing safety and immunogenicity issues. The lipid particles can be used for inhydro, ex vivo, and in vivo delivery. The lipid particles can also be used for cell populations of various sizes. The LNPs of this application can be readily produced by various methods known in the art, for example, by mixing an organic phase and an aqueous phase. Mixing of the two phases can be achieved by microfluidic devices and impinging flow reactors. The more thoroughly the organic phase and aqueous phase are mixed, the higher the encapsulation efficiency and particle size distribution of the resulting LNPs. Preferably, the particle size of the LNPs can be adjusted by changing the mixing rate of the organic phase and aqueous phase. The faster the mixing rate, the smaller the particle size of the LNPs produced. Capture efficiency is optimized by adjusting the N / P (ionizable lipid / nucleic acid) ratio of the LNP system. In some preferred embodiments, the N / P ratio is 1:1 to 9:1. In some examples, LNPs can be used to deliver DNA molecules (e.g., molecules containing the coding sequence of DNA-binding proteins and / or sgRNA) and / or RNA molecules (e.g., mRNA of Cas and sgRNA). In certain cases, LNPs can be used to deliver the RNP complex of Cas / gRNA.In some embodiments, LNPs are used to deliver mRNA and gRNA (for example, mRNA fusion molecules containing DNMT3A-DNMT3L(3A-3L)-dCas9-KRAB or DNMT3A-DNMT3L-ZIM3 KRAB-dCas9, and at least one sgRNA targeting the HBV gene).

[0038] The components of LNP may include the cationic lipids 1,2-3-dimethylammonium phthalate-propane (DLinDAP), 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxyketone-N,N-dimethyl-3-aminopropane (DLinK-DMA), and 1,2-dilinoleyl-4-(2-dimethylaminoethyl)-. In some embodiments, LNP may contain ionized lipids. In some embodiments, the ionized lipids include, but are not limited to, pH-responsive ionized lipids, thermoresponsive ionized lipids, and photoresponsive ionized lipids. In some embodiments, the ionized lipids include cationic and anionic lipids that ionize under certain conditions (such as, but not limited to, pH, temperature, or light). In some embodiments, the molar ratio of ionized lipids in LNP is 20% to about 70%. (For example, approximately 20% to 70%, approximately 20% to 65%, approximately 20% to 60%, approximately 20% to 55%, approximately 20% to 50%, approximately 20% to 45%, approximately 20% to 40%, approximately 20% to 35%, approximately 20% to 30%, approximately 20% to 25%, approximately 30% to 70%, approximately 30% to 65%, approximately 30% to 60%, approximately 30% to 55%, approximately 30% to 50%) The percentages are approximately 30% to 45%, 30% to 40%, 30% to 35%, 40% to 70%, 40% to 65%, 40% to 60%, 40% to 55%, 40% to 50%, 40% to 45%, 50% to 70%, 50% to 65%, 50% to 60%, 50% to 55%, 60% to 70%, or 60% to 65%. In some embodiments, the LNP may include PEGylated lipids. In some embodiments, the molar ratio of PEGylated lipids to LNPs is 0% to about 30% (e.g., about 0% to about 30%, about 0% to about 25%, about 0% to about 20%, about 0% to about 15%, about 0% to about 10%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 10% to about 15%, about 20% to about 30%, or about 20% to about 25%). In some embodiments, LNPs may contain supporting lipids.In some embodiments, the molar ratio of the supporting lipids to the LNP is 30% to about 50% (e.g., about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 40% to about 50%, or about 40% to about 45%), and in some embodiments, the LNP may contain cholesterol. In some embodiments, the molar ratio of cholesterol in LNP is 10% to about 50% (e.g., about 10% to about 50%, about 10% to about 45%, about 10% to about 40%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 10% to about 15%, about 20% to about 50%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 20% to about 25%, about 30% to about 50%, about 30% to about 45%, about 30% to about 40%, about 30% to about 35%, about 40% to about 50%, or about 40% to about 45%). In some embodiments, the LNP may consist of a mixture of ionized lipids (20% to 70%, molar ratio), PEGylated lipids (0% to 30%, molar ratio), supporting lipids (30% to 50%, molar ratio), and cholesterol (10% to 50%, molar ratio).

[0039] For example, as used herein, the term “liposome” generally refers to a vesicle having an internal space separated from an external medium by one or more bilayer membranes. In some embodiments, the bilayer membrane may be formed of amphiphilic molecules such as synthetic or naturally occurring lipids containing spatially separated hydrophilic and hydrophobic domains, and in other embodiments, the bilayer membrane may be formed of amphiphilic polymers and surfactants. In some embodiments, the liposome is a spherical vesicle structure consisting of a monolayer or multilayer lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. In some embodiments, liposomes are biocompatible and non-toxic, capable of delivering hydrophilic and lipophilic drug molecules, protecting their encapsulated substances from degradation by plasma enzymes, and transporting their cargo across biological membranes and the blood-brain barrier (BBB). Liposomes can be manufactured from several different types of lipids, such as phospholipids. The liposomes may contain natural phospholipids and lipids (e.g., 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (DSPC), sphingomyelin, egg phosphatidylcholine, monosialoganglioside, or any combination thereof). Several other additives may be added to the liposomes to modify their structure and properties. For example, the liposomes may further contain cholesterol, sphingomyelin, and / or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) to increase stability and / or prevent leakage of the encapsulated material of the liposomes.

[0040] In this application, the term “adeno-associated virus (AAV) vector” generally refers to a vector having a functional or partially functional ITR sequence and a transgene. As used herein, the term “ITR” refers to a reverse terminal repeat. The ITR sequence may be derived from adeno-associated virus serotypes, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13, and any AAV variant or mixture. However, the ITR does not need to be a wild-type nucleotide sequence and can be modified (e.g., by nucleotide insertion, deletion, or substitution) as long as the sequence retains its function of providing functional rescue, replication, and packaging. An AAV vector may have one or more genes that have all or part of the AAV wild-type gene, preferably the rep and / or cap gene, removed, but retain functionally adjacent ITR sequences. Functional ITR sequences play a role in rescuing, replicating, and packaging AAV virions or particles. Therefore, in this application, an "AAV vector" is defined as containing at least the sequences necessary for the insertion of a transgene into a target cell. Cis-sequences necessary for viral replication and packaging (e.g., functional ITRs) are optionally included. In this application, the term “pharmaceutically acceptable carrier” generally refers to a carrier for administering therapeutic agents such as antibodies or polypeptides, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that can be administered without inducing the production of antibodies harmful to the individual receiving the composition and without causing excessive toxicity. Suitable carriers may be large, slowly metabolized polymers such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, lipid aggregates, and inactivated virus particles. Such carriers are well known to those skilled in the art. The pharmaceutically acceptable carrier in the therapeutic composition may include liquids such as water, saline, glycerol, and ethanol. Auxiliary substances, such as wetting agents or emulsifiers, and pH buffers, may be present in these carriers.

[0041] In this application, the terms "...coding sequence" or "...coding nucleic acid" generally refer to nucleic acids (RNA or DNA molecules) containing nucleotide sequences that code for proteins. The coding sequence may further include start and end signals operably linked to a regulatory element, the regulatory element including a promoter and a polyadenylation signal that direct expression in solid or mammalian cells to which the nucleic acid is administered. Codon optimization can be performed on the coding sequence. In some embodiments, the coding nucleic acid may be mRNA, and one or more modification techniques can be used to produce more stable mRNA. Known mRNA modification techniques can be broadly divided into three types: synthesizing mRNA using artificially synthesized non-natural ribonucleic acid instead of natural ribonucleic acid; adding 5' caps, 3' poly(A) "tails," and UTR (untranslated region) sequences; and effectively protecting mRNA using special novel formulation techniques. Here, a preferred mRNA modification technique is the synthesis of mRNA using artificially synthesized non-natural ribonucleic acid instead of natural ribonucleic acid. Chemical modifications on eukaryotic mRNA can be broadly classified into three categories: methylation, pseudouridine (Ψ), and hypoxanthine. For example, the aforementioned chemical modifications may be selected from pseudouridine, N1-methylpseudridine, N1-ethylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudridine, 2-thio-dihydrouridine, 2-thiopseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-1-methylpseudridine, 4-thiopseudridine, 5-aza-uridine, dihydropseudridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. In this application, the term “complementary” generally refers to the Wolson-Crick (e.g., AT / U sum CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules. “Complementarity” refers to a property shared between two nucleic acid sequences, so that when they are arranged parallel to each other in opposite directions, the nucleotide bases at each position are complementary.

[0042] In this application, the terms “subject” and “patient” are used interchangeably and generally refer to humans and non-human animals. The term “non-human animal” as used in this application includes all vertebrates, such as mammals and non-mammals, including non-human primates, sheep, dogs, cats, horses, cattle, chickens, amphibians, reptiles, etc. In this application, the terms “effective amount” and “therapeutic effective amount” or “therapeutic effective dose” are used interchangeably and generally refer to an amount or dose of a fusion molecule (protein), polypeptide, nucleic acid, lipid nanoparticle, liposome, one or more AAV particles, or one or more virions that can modulate protein activity in a desired manner and thereby produce a sufficient amount of the desired protein to provide a palliative tool for clinical intervention. In some embodiments, a therapeutic effective amount or dose such as the transfected fusion protein, polypeptide, nucleic acid, one or more AAV particles, or one or more virions described herein is sufficient to confer inhibition of the gene targeted by the fusion protein / gene therapy construct. As used herein, the term “treatment” means, for example, in a disease, that when a fusion molecule or nucleic acid and / or gRNA encoding such fusion molecule or nucleic acid encoding such gRNA is administered, a subject (e.g., human) who is ill, at risk of ill, and / or experiencing symptoms of the disease experiences, in one embodiment, milder symptoms and / or a more rapid recovery, compared to when such fusion molecule or nucleic acid and / or gRNA encoding such gRNA is not administered. We do not wish to be bound by any theory, and the following examples are merely for the purpose of illustrating the composition, method of use, and use of the present invention, and do not limit the scope of the present invention.

[0043] Examples Example 1 Construction of sgRNA libraries targeting the hepatitis B virus (HBV) gene and functional screening thereof. (1) Construction of sg RNA libraries for HBV types B, C, and D The genome sequence used in this embodiment is that of the hepatitis B virus (HBV), and includes the entire genome of polynucleotides encoding HBV polymerase Pol, surface antigen HBsAg, HBV X protein, and core region antigen precursor HBcAg. These genomes are divided into type B HBV (serotype adw subtype), type C HBV (serotype adr subtype), and type D HBV (serotype ayw subtype), as shown in the table below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 1-16 Table 1-17 Table 1-18 Table 1-19 Table 1-20 Table 1-21 Table 1-22 [Table 1-23] [Table 1-24] [Table 1-25] [Table 1-26] [Table 1-27] [Table 1-28] [Table 1-29] [Table 1-30] [Table 1-31] [Table 1-32] [Table 1-33] [Table 1-34] (2) sgRNA functional screening Using 293FT, reporter cell lines were constructed for type B, C, and D HBV surface antigens (HBsAg), core antigen (HBcAg), X protein (HBx), and polymerase (Pol), a schematic diagram of which is shown in Figure 1A. Before retaining the protein transcription start sites, the genomic sequences of CpG islands and regulatory elements were included, and after the 38th amino acid of the HBV surface antigen (HBsAg), the 129th amino acid of the core antigen (HBcAg), the 77th amino acid of the X protein (HBx), and the 177th amino acid of the polymerase (Pol), respectively, the gene sequences of the cleaved peptides P2A and EGFP were fused. The reporter genes were incorporated into the 293FT genome using the PiggyBac transposon system to construct stable transformed cell lines, and the intensity of fluorescence was used to react with protein expression levels, thereby allowing for rapid functional verification and initial screening of sgRNAs near CpG islands. The coding sequence of the cleaved peptide P2A used in this example is GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCTGCCACC (Sequence ID 1188). The coding sequence of the EGFP used was ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCT (SEQ ID NO: 1189). The design of the screening method for verifying sgRNA function using the above reporter cell line is as follows (Figure 1B). After plating the reporter cells, the composition EPIREG described in this application, containing different sgRNAs (the composition domain is DNMT3A-hDNMT3L-xten80-ZIM3-xten80-dCas9, its amino acid sequence is shown in SEQ ID NO: 1194, and its nucleic acid sequences are shown in SEQ ID NO: 1192 (CDS sequence) and 1193 (plasmid sequence), respectively), was delivered to the cells by transfection carrying red and blue fluorescence, respectively. Double-positive cell populations for red and blue fluorescence were selected using flow cytometry and cultured for a long period. Flow analysis was performed once every week to detect changes in the fluorescence intensity of the reporter cells, i.e., changes in the protein expression level after epigenetic editing could be detected. (3) Analysis of experimental results As can be seen from the results shown in Figures 2A-2F, 14 days after transfection with the compositions described in this application containing different sgRNAs, the fluorescence intensity of HBx reporter cell lines of type B HBV decreased significantly, indicating a significant suppression of HBx expression. On day 21 after transfection, the results for each cell line were largely maintained, indicating that the inhibitory effect on epigenetic editing was sustained. This example comprehensively analyzes the editing ability of each sgRNA in the cell line at these different time points, and among them, BSG30, BSG35, BSG43, and BSG50 all exhibited extremely high editing efficacy and targeted relatively concentrated regions in the genome. Figure 2G shows the relationship between the target location of sgRNAs in the type B HBV genome and the percentage of knockdownable cells 28 days post-transfection. The results show that sgRNAs that exhibit a good knockdown effect are mainly concentrated in the regions near both sides of the BSG35 and BSG29 target sequences. This indicates that epigenetic editing of this region can effectively suppress HBx expression. Figures 3A-3B show the transfection results of HBx reporter cell lines of type C HBV, indicating a significant decrease in fluorescence intensity 14 days post-transfection, demonstrating a marked suppression of HBx expression. Figure 3C examines the relationship between the target location of sgRNAs in the type C HBV genome and the percentage of knockdownable cells 14 days post-transfection. The results show that sgRNAs exhibiting a good knockdown effect are mainly concentrated in the regions near both sides of the BSG35, SG75, and BSG29 target sequences, indicating that epigenetic editing of this region can effectively suppress HBx expression. Figures 4A-4F show the transfection results of HBx reporter cell lines of type D HBV, indicating a significant decrease in fluorescence intensity and a marked suppression of HBx expression 16 days post-transfection. On days 21 and 28 post-transfection, the results for each cell line were largely maintained, demonstrating the sustained inhibitory effect of epigenetic editing. Figure 4G examines the relationship between the target site of sgRNA in the type D HBV genome and the percentage of knockdownable cells 28 days post-transfection. The results show that sgRNAs that exhibit a good knockdown effect are mainly concentrated in the regions near both sides of the BSG35 and BSG29 target sequences, indicating that epigenetic editing of this region can effectively suppress HBx expression. A comprehensive analysis of transfection results from three genotype HBx reporter cell lines shows that targeting the B, C, and D HBV genomes using the epigenetic editing tools provided in this invention significantly suppresses HBx expression in all three genotypes, and this suppressive effect is long-lasting, maintaining for at least 28 days. BSG29, BSG31, BSG34, and BSG35, which can simultaneously target all three genomes, exhibit nearly optimal inhibitory effects on HBx expression in all three genotypes of HBV. In the three genotype cell lines, the sgRNAs with the highest editing effect were concentrated mainly in the regions on both sides of the BSG35 and BSG29 target sequences, suggesting that these regions may be important areas for epigenetic regulation of the HBV gene. A summary of the sgRNAs whose functionality was verified in this embodiment is shown in the table below (sequenced according to the target sequence start position of each sgRNA). [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0044] Example 2 Knockdown effect of the present composition on HBV markers in primary hepatocytes (PHH) In this example, primary hepatocyte (PHH) cell lines infected with hepatitis D and B viruses (GenBank: U95551) were used. Based on the screening results of the HBx reporter cell lines described in Example 1, BSG29, BSG31, BSG34, and BSG35 were located in genome-conserved regions and exhibited the highest inhibitory effect. Therefore, the pharmaceutical composition provided by this application was prepared using these four sgRNAs, and epigenetic editing was performed in primary hepatocytes to verify the inhibitory effect on HBV gene expression. The experimental method is shown in Figure 5A. Two days after HBV infection of primary hepatocytes, a composition of mRNA encoding EPIREG (SEQ ID NO: 1191) and various sgRNAs (BSG29, BSG31, BSG34, BSG35) was delivered to primary hepatocytes using lipid nanoparticles (LNPs) (see reference: https: / / doi.org / 10.1038 / s41586-021-03534-y for LNP preparation). (The dose was 2.5 ug / ml, and the mass ratio of EPIREG to sgRNA was 1:1.) After administration, the supernatant was collected every two days, and the expression levels of HBV surface antigen (HBsAg) and core antigen (HBcAg) secreted by the cells were detected. Cell samples were collected up to 14 days after administration, and DNA and RNA were extracted from the cells to detect changes in HBV mRNA levels and cccDNA of the HBV gene. Two sets of positive controls were prepared using Myrcludex B (Yakumei Kang-deok, C9023GE070-1 / PE0723) and RG7834 (Yakumei Kang-deok, ET25747-14-P1), respectively. Myrcludex B inhibited HBV-infected hepatocytes, and RG7834 inhibited viral protein synthesis. RG7834 was stopped on day 13 of the experiment, and the rebound of viral antigen proteins was observed. (Specific detection methods were followed according to the instructions for the following kits: HBsAg ELISA kit, Antu-CL 0310; HBeAg ELISA kit, Antu-CL 0312; RNeasy 96 Kit (12), QIAGEN # 74182) Figure 5B summarizes the experimental results at 2, 4, 6, 8, and 10 days after administration. After delivering compositions containing BSG29, BSG31, BSG34, BSG35, and BSG34+BSG35 (the mass ratio of EPIREG to sgRNA in BSG34+BSG35 is 1:0.5:0.5) to primary hepatocytes infected with HBV, the expression levels of HBsAg and HBeAg / HBcAg in the supernatant decreased to varying degrees. BSG35 showed the highest effect, simultaneously reducing the expression levels of HBsAg and HBeAg / HBcAg by approximately 80%. Furthermore, the binding of two sgRNAs (BSG34+BSG35) further enhanced the inhibitory effect, thereby further reducing the expression levels of HBsAg and HBeAg / HBcAg. In the control group, the expression levels of HBsAg and HBeAg / HBcAg continued to rise with the progression of infection days, peaking around 14th and 12th day post-infection, respectively. However, in the BSG35 experimental group, the expression levels of HBsAg and HBeAg / HBcAg approached near-stabilization 4 days after administration. The inhibitory effect of the BSG35 experimental group was similar to that of the two reference inhibitors Myrcludex B and RG7834. After discontinuation of RG7834, a significant rebound (increase) trend was observed in the expression of both HBsAg and HBeAg / HBcAg. In the BSG35 experimental group, there was no subsequent administration 4 hours after drug treatment on the day of administration, and the levels of viral antigen proteins remained stable at low levels throughout the entire experimental period. The results in this section demonstrate that epigenetic editing significantly reduces the expression of viral proteins in HBV infection-induced hypertension (PHH), and that epigenetic editing using a single sgRNA can simultaneously regulate the expression of multiple viral proteins.

[0045] Example 3 Construction of sgRNA lentiviral libraries and functional screening thereof. This example involved library screening using D-type HBV X protein (HBx), core antigen (HBcAg), and surface antigen (HBsAg) reporter cell lines. First, an sgRNA cell library of the D-type HBV gene was constructed using a reporter cell line based on the method described in Example 1. The sgRNA library was packaged in a lentivirus to obtain an sgRNA lentiviral library (with red fluorescence). The lentiviral library was then used to infect the reporter cell line, and the sgRNA cell library was obtained by selecting cells with red fluorescence. Each cell in the selected cell library incorporated one sgRNA from the library and simultaneously possessed a reporter sequence itself (with green fluorescence). The EPIREG tool described in Example 2 (the amino acid sequence of the tool is SEQ ID NO: 1194) (having blue fluorescence) was transfected and delivered to a cell library containing both sgRNA and reporter sequences. Triple-positive cells with red / green / blue fluorescence were selected using a flow analyzer and cultured for a long period. The EPIREG transfected into the cells could silence GFP in the reporter along with the sgRNA. On day 14 after transfection, a GFP-negative cell population was selected from the cell library, the genomic DNA of the negative cell population was extracted and NGS sequencing was performed, and the untreated cell library was used as a control reference. The sgRNAs with high sequencing read counts in the negative cell population were compared, thereby obtaining candidate sgRNAs capable of exhibiting editing effects corresponding to each reporter (a schematic diagram of this screening method is shown in Figure 6, and the analytical method is described in reference DOI: 10.1186 / s13059-014-0554-4). A summary of the sgRNAs whose functionality was verified for each reporter cell line is shown in the table below (sequenced according to the target sequence start position of each sgRNA). The following is a summary of the sgRNA information obtained from HBx reporter screening (shown in the upper part of Figure 7). [Table 3-1] [Table 3-2] [Table 3-3] Note: In Log2FC, FC stands for fold change, and it is the value obtained after taking the base-2 logarithm of the ratio of expression levels between two samples (groups). This is used to indicate the difference in expression levels between the two. For example, generally, the absolute value of Log2FC being greater than 1 is set as the initial screening criterion for genes. The following is a summary of the sgRNA information obtained from HBcAg reporter screening (shown in the center figure of Figure 7). [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] The following is a summary of the sgRNA information obtained from the HBsAg reporter screening (shown in the lower part of Figure 7). [Table 5-1] [Table 5-2] [Table 5-3]

[0046] Example 4 Experiment to validate the effects of candidate sgRNAs in library screening. Verification of efficacy in primary hepatocytes (PHH) In this validation experiment, primary hepatocyte (PHH) cell lines (Yasutaka Yakkyō, M00995-P) infected with hepatitis D and B viruses (GenBank: U95551) were used. Based on the combined screening results of the three libraries in Example 3, and taking into account factors such as conservatism, 20 sgRNAs shown in the table below were selected to prepare the pharmaceutical composition provided by this application. Epigenetic editing was then performed in the primary hepatocytes, and the inhibitory effect of the candidate sgRNAs obtained through screening on HBV gene expression was verified. The 20 sgRNA sequences used for verification in this example are as follows: [Table 6]

[0047] The experimental method is shown in Figure 5A. Two days after HBV infection of primary hepatocytes, a composition of mRNA encoding EPIREG (SEQ ID NO: 1191) and their respective sgRNAs was delivered to primary hepatocytes using lipid nanoparticles (LNPs) (for LNP preparation, see reference: https: / / doi.org / 10.1038 / s41586-021-03534-y) (the dose was 2.5 ug / ml, and the mass ratio of EPIREG to sgRNA was 1:1). Myrcludex B (provided by Yasutaka Yakkyung, C9023GE070-1 / PE0723) was used as a positive control, and Myrcludex B can inhibit HBV-infected hepatocytes. After administration to each group, the supernatant was collected every two days, and the expression levels of HBV surface antigen (HBsAg), core antigen (HBcAg / HBeAg), and HBV DNA secreted by cells were detected. Cell samples were collected up to 14 days post-infection, and DNA and RNA were extracted from the cells to detect HBV mRNA levels. (Specific detection methods were followed according to the instructions for the following kits: HBsAg ELISA kit, Antu-CL 0310; HBeAg ELISA kit, Antu-CL 0312; RNeasy 96 Kit (12), QIAGEN # 74182)

[0048] A summary of the experimental results on day 14 after infection is shown in Figure 8. After delivering compositions of 20 sgRNAs and EPIREGs to primary hepatocytes infected with HBV, the expression levels of HBsAg, HBeAg / HBcAg, and HBV DNA in the supernatant were all reduced to varying degrees. Of these, 17 sgRNAs reduced the expression of HBV viral antigens and DNA by more than 50% (except for D409, D199, and D16), and the inhibition rate of 9 sgRNAs reached almost 80% or more (D340, D75, D97, D99, D100, D101, D108, D111, and D113), with D99 ​​(i.e., BSG35) showing the highest inhibition level. Inhibition of HBV total RNA and pgRNA by EPIREG showed the same efficiency and trend as HBV antigen and DNA, indicating that the epigenetic editing tool effectively inhibited HBV transcription. At the same time, none of the 20 sgRNA and EPIREG compositions affected PHH cell viability, demonstrating the safety of the epigenetic editing tool. In summary, as validated in PHH cell lines, most candidate sgRNAs obtained from library screening showed significant inhibitory effects against HBV. Knockdown effect of composition on HBV markers in transgenic HBV mice In this validation experiment, transgenic HBV mice (Beijing Weitongda Biotechnology Co., Ltd., C57BL / 6-HBV; subsequent rearing and detection were completed at Beijing Weitongda) were used, and a 1.28-fold length HBV genome (Type A, GenBank: AF305422.1) was inserted into the mouse genome of this strain. Based on all screening results, sgRNA number D99 (BSG35) was found to be located in a genome-conserved region and exhibited the highest inhibitory effect. Therefore, the pharmaceutical composition provided by this application was prepared using this sgRNA, and epigenetic editing was performed in transgenic HBV mice to verify the inhibitory effect of this drug on integrated HBV gene expression in an in vivo model. Transgenic HBV mice were delivered (dose: 10 mg / kg) by tail vein injection of lipid nanoparticles (LNPs) (see reference: https: / / doi.org / 10.1038 / s41586-021-03534-y for LNP preparation). The composition consisted of mRNA encoding EPIREG (sequence number 1191) and sgRNA number D99 (BSG35) (mRNA to sgRNA mass ratio: 1:1). Negative controls were injected with PBS (200 ul), and positive controls were treated with the antisense oligonucleotide (ASO) drug Bepirovirsen (GSK3228836, dose: 200 mg / kg) to target all HBV RNA and reduce HBV antigen expression. Blood samples were taken regularly from each group after administration, and the levels of HBV surface antigen (HBsAg) and core antigen (HBcAg / HBeAg) secreted into the serum were detected. The level of HBV DNA was detected using qPCR. (Hepatitis B virus e antigen quantitative kit: Macula Biotechnology, catalog number IM4403003; Hepatitis B virus surface antigen quantitative kit: Macula Biotechnology, catalog number IM4403001; Hepatitis B virus nucleic acid quantitative kit: Sunsure Biotech, 2015340008; Detection method was performed according to the kit instructions). A summary of the experimental results after administration is shown in Figures 9A-9C. After a single EPIREG injection, the expression levels of HBsAg, HBeAg, and HBV DNA in the serum of transgenic HBV mice rapidly decreased within one week, with a decrease similar to or better than that of the ASO group. However, the HBV markers in the ASO group gradually recovered to their original levels, while the HBV markers in the EPIREG group obtained stable and sustained suppression, with HBsAg and HBV DNA continuing to decrease after approximately two months of administration (Figure 9A). As can be seen from the analysis of the HBV marker expression curves of each mouse in the EPIREG group (Figure 9B), after a single EPIREG administration, HBsAg and HBV DNA spontaneously decreased further in three mice after about two months, with HBsAg decreasing to the lower limit of detection, and stepwise expression of HBsAb could be detected in the serum of these three mice (Figure 9C). As these results show, in a transgenic HBV mouse model, the epigenetic editing composition comprising the mRNA encoding EPIREG and the sgRNA provided herein can significantly and sustainably silence the expression of the integrated HBV genome in vivo. Long-term silencing of HBV allows mice to gradually recover their immune response to the surface antigen HBsAg, thereby further reducing the expression of HBV markers. Knockdown effect of the composition on HBV markers in AAV-HBV mice In this validation experiment, an AAV-HBV mouse model (model construction, subsequent rearing, and detection were completed by Beijing Weitongda Biotechnology Co., Ltd.) was used, and adenovirus-associated virus (AAV) infected mice with a 1.3 times longer HBV genome (type D, GenBank: U95551) were utilized to mimic the in vivo expression of the free HBV genome. Based on all screening results, sgRNA number D99 (BSG35) was found to be located in a genome-conserved region and exhibited the highest inhibitory effect. Therefore, the pharmaceutical composition provided by this application was prepared using this sgRNA, and epigenetic editing was performed in AAV-HBV mice to verify the inhibitory effect of this drug on free HBV gene expression in an in vivo model. AAV (AMV-002) containing two titers (1E10 and 1E11) and 1.3 times the length of HBV genomes was delivered to mice via tail vein injection to achieve stable expression of the HBV genome to varying degrees in vivo. Subsequently, on the first day of administration (D0) and day 15 (D15), AAV-HBV mice were delivered via tail vein injection of lipid nanoparticles (LNPs) (see reference: https: / / doi.org / 10.1038 / s41586-021-03534-y for LNP preparation) consisting of mRNA encoding EPIREG (sequence number 1191) and sgRNA number D99 (BSG35) (mass ratio of mRNA to sgRNA was 1:1) (both injection doses were 5 mg / kg). Negative controls were injected with PBS (200 ul). Blood samples were taken regularly from each group after administration, and the levels of HBV surface antigen (HBsAg) and core antigen (HBcAg / HBeAg) secreted into the serum were detected. The level of HBV DNA was then detected using qPCR (all detection kits are as described in the upper part of this example). A summary of the post-administration experimental results is shown in Figure 10. After two EPIREG injections, AAV-HBV mice showed a rapid decrease in serum HBsAg, HBeAg, and HBV DNA expression levels. The 1E10 AAV group had low viral expression levels, and viral markers were reduced to near the detection limit in a short period after administration. The 1E11 AAV group had high viral expression levels and achieved a greater reduction in viral markers after administration. Ultimately, the epigenetic editing tool was able to stably and sustainably reduce HBV markers in both the 1E10 and 1E11 AAV groups. As these results show, in the AAV-HBV mouse model, this epigenetic editing can significantly and sustainably silence the expression of the free HBV genome in vivo.

Claims

1. (1) A fusion molecule comprising at least one DNA-binding protein and at least one gene expression modulator, or a nucleic acid sequence encoding the fusion molecule, (2) comprising at least one single guide RNA (sgRNA), or a nucleic acid sequence encoding the sgRNA, The sgRNA is complementary to a target DNA sequence near the hepatitis B virus (HBV) gene and / or within the HBV gene regulatory element, the HBV gene is a type B HBV gene containing the nucleotide sequence shown in SEQ ID NO: 1, a type C HBV gene containing the nucleotide sequence shown in SEQ ID NO: 2, or a type D HBV gene containing the nucleotide sequence shown in SEQ ID NO: 3, the HBV gene regulatory element includes a transcription start site, a core promoter, a promoter, an enhancer, a silencer, an insulator element, a boundary element, and / or a locus regulatory region, and the target DNA sequence is located between nucleotides 1056 to 2354, 2639 to 2658, 2863 to 2930, and / or between nucleotides 3048 to 3067 of the HBV gene.

2. The composition according to claim 1, wherein the target DNA sequence is located between nucleotides 1056 to 1900, 1972 to 2082, 2134 to 2264, 2335 to 2354, 2639 to 2658, 2863 to 2930, and / or 3048 to 3067 of the HBV gene.

3. The composition according to claim 1 or 2, wherein the target DNA sequence is located between nucleotides 1060 to 1079, between nucleotides 1149 to 1612, between nucleotides 1693 to 1852, and / or between nucleotides 2863 to 2882 of the HBV gene.

4. The composition according to any one of claims 1 to 3, wherein the target DNA sequence is located in one or more regions of the B-type HBV gene between nucleotides 1149 to 1190, between nucleotides 1210 to 1310, between nucleotides 1350 to 1400, between nucleotides 1420 to 1450, and between nucleotides 1470 to 1592.

5. The composition according to any one of claims 1 to 3, wherein the target DNA sequence is located in one or more regions of the C-type HBV gene between nucleotides 1150 to 1180, between nucleotides 1200 to 1310, between nucleotides 1350 to 1390, between nucleotides 1420 to 1460, and between nucleotides 1480 to 1593.

6. The composition according to any one of claims 1 to 3, wherein the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1056 to 1079, between nucleotides 1101 to 1900, between nucleotides 1972 to 2082, between nucleotides 2134 to 2264, between nucleotides 2335 to 2354, between nucleotides 2639 to 2658, between nucleotides 2863 to 2882, between nucleotides 2911 to 2930, and between nucleotides 3048 to 3067.

7. The composition according to any one of claims 1 to 3 and 6, wherein the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1060 to 1079, between nucleotides 1160 to 1310, between nucleotides 1253 to 1284, between nucleotides 1370 to 1470, between nucleotides 1490 to 1612, between nucleotides 1693 to 1852, and between nucleotides 2863 to 2882.

8. The composition according to any one of claims 1 to 7, wherein the sgRNA comprises the nucleotide sequence described in any one of SEQ ID NOs: 4 to 1165.

9. The composition according to any one of claims 1 to 7, wherein the sgRNA comprises a partial sequence of a nucleotide sequence described in any one of SEQ ID NOs: 4 to 1165, and the length of the partial sequence is 15 to 20 base pairs.

10. The composition according to any one of claims 1 to 9, wherein the at least one DNA-binding protein is a CRISPR enzyme, a zinc finger nuclease (ZNF), a transcription activator-like effector nuclease (TALEN), a homing endonuclease, a dCas9-FokI nuclease, or a MegaTal nuclease.

11. The composition according to claim 10, wherein the CRISPR enzyme is a class 2 Cas protein and / or a variant thereof.

12. The composition according to claim 10 or 11, wherein the CRISPR enzyme is one or more Cas proteins selected from class 2II-A type Cas protein, class 2II-B type Cas protein, class 2II-C type Cas protein, class 2V-A type Cas protein, class 2V-B type Cas protein, class 2V-C type Cas protein, class 2V-U type Cas protein, and variants thereof.

13. The composition according to any one of claims 10 to 12, wherein the CRISPR enzyme is the Cas9 protein and / or a variant thereof.

14. The composition according to any one of claims 1 to 13, wherein the at least one DNA-binding protein is dCas9.

15. The aforementioned dCas9 includes Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9, Campylobacter jejuni dCas9, Corynebacterium diphtheria dCas9, Eubacterium ventriosum dCas9, and Streptococcus pasteurianus. dCas9, Lactobacillus farciminis; dCas9, Spirochetea globus; dCas9, Azospirillum (e.g., strain B510); dCas9, Gluconacetobacter diazotropicus; dCas9, Neisseria cinerea; dCas9, Roseburia intestinalis The composition according to claim 14, comprising dCas9, Parvibaculum lavamentivorans, dCas9, Nitratefractor salsuginis (e.g., strain DSM 16511), dCas9, Campylobacter lari (e.g., strain CF89-12), dCas9, Streptococcus thermophilus (e.g., strain LMD-9), and dCas9.

16. The composition according to claim 14 or 15, wherein the dCas9 comprises the amino acid sequence shown in SEQ ID NOs. 1170 to 1187.

17. The composition according to any one of claims 1 to 16, wherein the at least one gene expression modulator provides modification of at least one nucleotide in the vicinity of the HBV gene and / or within the HBV gene regulatory element.

18. The composition according to any one of claims 1 to 17, wherein the at least one gene expression modulator comprises one or more selected from the group consisting of DNA methyltransferase, DNA hydroxymethyltransferase, DNA demethyltransferase, histone methyltransferase, histone demethyltransferase, histone acetyltransferase, histone deacetyltransferase, phosphatase, kinase, transcription activator, transcription repressor, some thereof, and any combination thereof.

19. The composition according to claim 17, wherein the modification of the at least one nucleotide is DNA methylation.

20. The composition according to any one of claims 1 to 19, wherein the at least one gene expression modulator comprises one or more selected from the group consisting of DNA methyltransferase (DNMT), zinc finger protein-based transcription factors, some thereof, and any combination thereof.

21. The composition according to any one of claims 1 to 20, wherein the at least one gene expression modulator comprises a DNA methyltransferase (DNMT) or a portion thereof, and a zinc finger protein-based transcription factor or a portion thereof.

22. The composition according to claims 18, 20, and 21, wherein the DNA methyltransferase is DNMT3A, DNMT3B, DNMT3L, DNMT1, or DNMT2.

23. The composition according to claim 22, wherein DNMT3A comprises the amino acid sequence shown in SEQ ID NO: 1166, and DNMT3L comprises the amino acid sequence shown in SEQ ID NO: 1167 or 1195.

24. The composition according to claim 20 or 21, wherein the zinc finger protein-based transcription factor is a Kruppel-associated inhibitor (KRAB) or a ZIM3-derived KRAB domain (ZIM3 KRAB).

25. The composition according to claim 24, wherein the zinc finger protein-based transcription factor comprises the amino acid sequence shown in SEQ ID NO: 1168 or 1196.

26. The composition according to any one of claims 18 and 20-25, wherein the DNA methyltransferase is selected from the group consisting of DNMT3A, DNMT3L and combinations thereof, and the zinc finger protein-based transcription factor is KRAB or ZIM3 KRAB.

27. The composition according to any one of claims 1 to 26, wherein the fusion molecule comprises the at least one gene expression modulator fused to the C-terminus, N-terminus, or both ends of the at least one DNA-binding protein.

28. The composition according to any one of claims 1 to 27, wherein the at least one gene expression modulator is directly fused to the at least one DNA-binding protein.

29. The composition according to any one of claims 1 to 27, wherein the at least one gene expression modulator is indirectly fused to the at least one DNA-binding protein via a non-modulator, a second modulator, or a linker.

30. The composition according to any one of claims 1 to 29, wherein the fusion molecule comprises the domain DNMT3A-DNMT3L-dCas9-KRAB or the domain DNMT3A-DNMT3L-ZIM3 KRAB-dCas9, where - indicates that each subdomain of the fusion molecule is directly and / or indirectly linked, and that each subdomain follows an order from the N-terminus to the C-terminus.

31. The composition according to any one of claims 1 to 30, wherein the fusion molecule comprises the amino acid sequence shown in SEQ ID NO: 1169 or 1194.

32. The composition according to any one of claims 1 to 31, wherein the fusion molecule further comprises at least one nuclear localization sequence (NLS).

33. The composition according to claim 32, wherein the at least one nuclear localization sequence is directly or indirectly fused to the C-terminus, N-terminus, or both ends of the at least one DNA-binding protein.

34. The composition according to any one of claims 1 to 33, wherein the nucleic acid sequence encoding the fusion molecule is deoxyribonucleic acid (DNA) or messenger ribonucleic acid (mRNA).

35. The composition according to any one of claims 1 to 34, wherein the fusion molecule is packaged in liposomes or lipid nanoparticles.

36. The composition according to any one of claims 1 to 35, wherein the fusion molecule and the sgRNA are packaged in liposomes or lipid nanoparticles.

37. The composition according to any one of claims 1 to 36, wherein the fusion molecule and the sgRNA are packaged in the same liposome or lipid nanoparticles, or in different liposomes or lipid nanoparticles.

38. The composition according to any one of claims 1 to 37, wherein the liposome or lipid nanoparticles comprises ionized lipids (20% to 70%, molar ratio), PEGylated lipids (0% to 30%, molar ratio), supporting lipids (30% to 50%, molar ratio), and cholesterol (10% to 50%, molar ratio).

39. The composition according to claim 38, wherein the ionized lipid is selected from the group consisting of pH-responsive ionized lipids, heat-responsive ionized lipids, and photo-responsive ionized lipids.

40. The composition according to any one of claims 1 to 34, wherein the fusion molecule is packaged in an AAV vector.

41. The composition according to any one of claims 1 to 34 and 40, wherein the fusion molecule and the sgRNA are packaged in an AAV vector.

42. The composition according to any one of claims 1 to 34, 40, and 41, wherein the fusion molecule and the sgRNA are packaged in the same AAV vector or different AAV vectors.

43. The composition according to any one of claims 1 to 42, which is a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

44. A single guide RNA (sgRNA) comprising a sequence complementary to a target DNA sequence, wherein the target DNA sequence is located near the hepatitis B virus (HBV) gene and / or within the HBV gene regulatory element, the HBV gene being a type B HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 1, a type C HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 2, or a type D HBV gene comprising the nucleotide sequence shown in SEQ ID NO: 3, the HBV gene regulatory element comprising a transcription start site, a core promoter, a promoter, an enhancer, a silencer, an insulator element, a boundary element, and / or a locus regulatory region, and the target DNA sequence being an sgRNA located between nucleotides 1056 to 2354, between nucleotides 2639 to 2658, between nucleotides 2863 to 2930, and / or between nucleotides 3048 to 3067 of the HBV gene.

45. The sgRNA according to claim 44, wherein the target DNA sequence is located between nucleotides 1056 to 1900, 1972 to 2082, 2134 to 2264, 2335 to 2354, 2639 to 2658, 2863 to 2930, and / or 3048 to 3067 of the HBV gene.

46. The sgRNA according to claim 44 or 45, wherein the target DNA sequence is located between nucleotides 1060 to 1079, 1149 to 1612, 1693 to 1852, and / or 2863 to 2882 of the HBV gene.

47. The sgRNA according to any one of claims 44 to 46, wherein the target DNA sequence is located in one or more regions of the B-type HBV gene between nucleotides 1149 to 1190, between nucleotides 1210 to 1310, between nucleotides 1350 to 1400, between nucleotides 1420 to 1450, and between nucleotides 1470 to 1592.

48. The sgRNA according to any one of claims 44 to 46, wherein the target DNA sequence is located in one or more regions of the C-type HBV gene between nucleotides 1150 to 1180, between nucleotides 1200 to 1310, between nucleotides 1350 to 1390, between nucleotides 1420 to 1460, and between nucleotides 1480 to 1593.

49. The composition according to any one of claims 44 to 46, wherein the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1056 to 1079, between nucleotides 1101 to 1900, between nucleotides 1972 to 2085, between nucleotides 2134 to 2264, between nucleotides 2335 to 2354, between nucleotides 2639 to 2658, between nucleotides 2863 to 2882, between nucleotides 2911 to 2930, and between nucleotides 3048 to 3067.

50. The sgRNA according to any one of claims 44 to 46 and 49, wherein the target DNA sequence is located in one or more regions of the D-type HBV gene between nucleotides 1060 to 1079, between nucleotides 1160 to 1310, between nucleotides 1253 to 1284, between nucleotides 1370 to 1470, between nucleotides 1490 to 1612, between nucleotides 1693 to 1852, and between nucleotides 2863 to 2882.

51. The sgRNA according to any one of claims 44 to 50, wherein the sgRNA comprises the nucleotide sequence described in any one of SEQ ID NOs: 4 to 1165.

52. The sgRNA according to any one of claims 44 to 50, wherein the sgRNA comprises a partial sequence of the nucleotide sequence described in any one of Sequence IDs 4 to 1165, and the length of the partial sequence is 15 to 20 base pairs.

53. A nucleic acid molecule encoding sgRNA according to any one of claims 44 to 52.

54. A method for reducing or eliminating the expression of a hepatitis B virus (HBV) gene product in cells, the method comprising the step of introducing a composition according to any one of claims 1 to 43 into the cells, thereby reducing or eliminating the expression of the HBV gene product in the cells.

55. A method for reducing or eliminating the expression of a hepatitis B virus (HBV) gene product in vivo in a target, the method comprising the step of introducing a composition according to any one of claims 1 to 43 into the target cells, thereby reducing or eliminating the expression of the HBV gene product in the target cells.

56. A method for treating hepatitis B virus (HBV) infection-related disease in a subject or for alleviating the symptoms of HBV infection-related disease in a subject, the method comprising the step of introducing an effective amount of the composition according to any one of claims 1 to 43 into the cells of the subject.

57. The method according to claim 55 or 56, wherein the subject is a mammal such as a human, monkey, mouse, rat, rabbit, pig, horse, cat, and dog.

58. The method according to any one of claims 55 to 57, comprising administering the composition to the subject once or more times.

59. The method according to any one of claims 55 to 58, comprising administering the composition to the subject at least twice.

60. The method according to any one of claims 55 to 59, wherein the interval between administering the composition once or at least twice is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, or 15 days.

61. The method according to claim 56, wherein the HBV infection-related diseases include hepatitis, cirrhosis, liver fibrosis, and hepatocellular carcinoma caused by HBV infection.

62. A composition according to any one of claims 1 to 43, used for treating hepatitis B virus (HBV) infection-related disease in a subject or for alleviating the symptoms of HBV infection-related disease in a subject.

63. A kit comprising a composition according to any one of claims 1 to 43, and a container for holding the composition and / or instructions for use.

Images