Compositions and methods for MED26-mediated regulation of erythrocyte formation

By enhancing MED26 interaction with transcriptional arrest factors and increasing its occupancy at super-enhancer sites, the method promotes erythroid differentiation, addressing deficiencies in erythropoiesis and improving erythroid differentiation in conditions like myelodysplastic syndromes and megaloblastic anemia.

JP2026521879APending Publication Date: 2026-07-02PEKING UNIV +1

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
PEKING UNIV
Filing Date
2024-06-14
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

There is a lack of understanding of the specific functions of individual mediator subunits, such as MED26, in the progression of erythroid differentiation during erythropoiesis, and how they contribute to context-dependent transcription programs, which is crucial for addressing deficiencies in erythroid differentiation observed in conditions like myelodysplastic syndromes and megaloblastic anemia.

Method used

Administering agents that increase the interaction between MED26 and transcriptional arrest factors, such as NELF, DSIF, and PAF complexes, and enhancing MED26 occupancy at super-enhancer sites, including CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27, to promote erythroid differentiation in erythrocyte progenitor cells.

Benefits of technology

The method effectively promotes erythroid differentiation by increasing transcriptional pauses and enhancing the progression of erythropoiesis, addressing deficiencies in conditions like myelodysplastic syndromes and megaloblastic anemia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026521879000004
    Figure 2026521879000004
  • Figure 2026521879000005
    Figure 2026521879000005
  • Figure 2026521879000006
    Figure 2026521879000006
Patent Text Reader

Abstract

A method for promoting erythrocyte differentiation is provided. A method for increasing RNA polymerase II arrest mediated by the MED26 polypeptide is also provided. Furthermore, a method for delivering reagents to cells is also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to International Application PCT / CN2023 / 100427, filed on 15 June 2023, the disclosure of which is incorporated herein by reference in its entirety.

[0002] This application is in the field of transcription gene regulation. [Background technology]

[0003] Under steady-state erythropoiesis, approximately 2 to 3 million red blood cells are produced per second in the bone marrow (4). Burst-forming unit erythrocytes (BFU-E) cells, which are early erythrocyte progenitor cells, can differentiate into colony-forming unit erythrocytes (CFU-E) cells, which are late progenitor cells (5). CFU-E cells differentiate stepwise into mature red blood cells through 3 to 5 cell divisions; this series of processes is called terminal erythropoiesis (6). During terminal erythropoiesis, erythroblasts undergo dramatic changes including nuclear condensation, widespread transcriptional repression, widespread hemoglobin biosynthesis, enucleation, and organelle clearance (7,8). Deficiencies in erythroid differentiation have been observed in myelodysplastic syndromes and megaloblastic anemia (9). Terminal erythropoiesis is accompanied by a decrease in specific histone marks involved in transcriptional elongation, including H3K36me2, H3K36me3, and H3K79me2 (1,10), as well as an increase in H4K20me (11,12), a modification associated with the pausing of RNA polymerase II (Pol II) and erythroid chromatin condensation. However, this process does not increase H3K27me3 and H3K9me3, which are repressive histone marks associated with heterochromatin formation. Positive transcriptional elongation factors (P-TEFb) containing the catalytic subunit cyclin-dependent kinase 9 (CDK9) enhance transcriptional elongation in cooperation with the master erythrocyte transcription factor GATA1 (13). Hexim1 is a regulator that promotes Pol II pausing, is highly expressed during terminal erythropoiesis, and is associated with the enhanced differentiation of hexamethylene bisacetamide (HMBA)-treated HUDEP-2 erythroid cells (14). In summary, these findings suggest a regulatory role in erythropogenesis related to transcriptional pausing and elongation.

[0004] Phase separation mediated by membrane-free compartmentalizations called biomolecular condensates is a novel model for explaining diverse cellular events, including transcriptional regulation (15-17). Phase separation is involved in transcription initiation and elongation via phosphorylation of Pol II CTD (18). It has been proposed that promoter condensates and gene condensates exist at different stages of transcription (3,19). Several proteins with phase-separating ability, including BRD4, MED1, and Pol II CTD (20-22), have been identified in transcriptional condensates, but it remains unclear whether the dynamic composition of these condensates can contribute to driving the progression of developmental processes.

[0005] Mediator complexes, also known as TRAP / SMCC, CRSP, PC2, or ARC complexes, are large multi-subunit complexes composed of head, middle, tail, and CDK8 kinase modules, and are conserved from yeast to metazoans (23)(24). Mediator complexes form functional crosslinks between gene promoters and enhancers, linking tissue-specific transcription factors (TFs) to general transcription factors (GTFs) and Pol II, thereby functioning as an integrating hub for pre-initiation complex construction, transcriptional elongation, and termination (23,25). Several mediator subunits have been shown to be important for various developmental processes through association with tissue-specific TFs (26). During erythrocyte formation, MED1 is a cofactor of GATA1, and MED1 knockout mice died at E11.5 due to severe anemia (27,28). Previous studies on mediator-regulated developmental processes have often focused on the function of a single subunit and its cooperation with TFs. However, it remains unclear whether individual mediator subunits have different functions throughout the developmental stages and whether they contribute to the establishment of context-dependent transcription programs (29).

[0006] Previous biochemical studies have shown that MED26 is a unique subunit, typically found specifically in the CDK8 kinase module, and has therefore often been understood as a transcription activator (30). MED26 directly interacts with the super-elongation complex (SEC) and the little elongation complex (LEC) containing P-TEFb via its N-terminal domain (NTD) (31-33). MED26 also functions as a molecular switch from its initiation state to its elongation state through its interaction with GTF TFIID (32). However, further investigation is needed to determine the underlying molecular mechanisms between MED26 and various modes of transcription, and its relevance to subsequent developmental processes. [Overview of the Initiative] [Problems that the invention aims to solve]

[0007] A method is provided for promoting erythroid differentiation, comprising administering an agent to erythrocyte progenitor cells that increases the arrest of RNA polymerase II mediated by an intracellular mediator complex subunit (MED26) polypeptide. [Means for solving the problem]

[0008] In certain embodiments, the agent increases the interaction between MED26 in cells and transcriptional arrest factors, such as factors included in negative elongation factor (NELF), DRB-sensitivity inducing factor (DSIF), and factors included in polymerase-related factor (PAF) complexes, particularly PAF1.

[0009] In certain embodiments, the agent has the effect of increasing the occupancy rate of the super-enhancer site by MED26, and the super-enhancer can be selected from CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27.

[0010] In certain embodiments, the agent comprises a MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.

[0011] In certain embodiments, the active fragment comprises an intrinsic disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide that is at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 17.

[0012] In certain embodiments, the active fragment comprises a TFIIS domain and an intrinsic disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide that is at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2.

[0013] In certain embodiments, the agent comprises the MED26 polypeptide or a nucleic acid encoding the MED26 polypeptide, more specifically, the MED26 polypeptide comprises a polypeptide that is at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 1.

[0014] A method for promoting erythroid differentiation is also provided, which includes the step of administering a polypeptide containing the amino acid sequence of Sequence ID No. 17 or a polynucleotide encoding the polypeptide to erythrocyte progenitor cells.

[0015] In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.

[0016] In a particular embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

[0017] In certain embodiments, the erythrocyte progenitor cells are hematopoietic stem cells and progenitor cells (HSPCs), such as CD34-positive HSPCs.

[0018] In certain embodiments, the erythroid progenitor cells are erythroblasts such as erythroblasts derived from CD34-positive HSPCs.

[0019] In certain embodiments, the agent is administered to erythroid progenitor cells in vitro.

[0020] In certain embodiments, the agent is administered to erythroid progenitor cells in vivo in a subject that needs it.

[0021] In certain embodiments, the subject needs treatment for a disease associated with erythroid hypoplasia.

[0022] In certain embodiments, the disease associated with erythroid hypoplasia is myelodysplastic syndrome such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow hypoplasia or megaloblastic anemia.

[0023] A method for identifying an agent that promotes erythroid differentiation is also provided, the method comprising a. providing a composition comprising a MED26 polypeptide or an active fragment thereof; b. contacting the composition with a test agent; c. evaluating whether the test agent increases the ability of MED26 to mediate the arrest of RNA polymerase II and including.

[0024] In certain embodiments, the evaluation step includes evaluating whether the test agent promotes the ability of MED26 to form aggregates, interact with transcription termination factors, and / or occupy super enhancer sites.

[0025] A composition comprising an agent that increases the arrest of RNA polymerase II mediated by the MED26 polypeptide is also provided.

[0026] An agent that increases the arrest of RNA polymerase II mediated by the MED26 polypeptide for use in a method of promoting erythroid differentiation in erythroid progenitor cells is also provided.

[0027] A method for delivering reagents to cells is also provided, which comprises (a) preparing a condensate containing a MED26 polypeptide or its active fragment and a reagent, and (b) contacting the cells with the condensate, thereby delivering the MED26 polypeptide or its active fragment to the cells.

[0028] In certain embodiments, the reagent is a nucleic acid, such as one or more RNA or DNA molecules.

[0029] In certain embodiments, the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75% sequence identity with SEQ ID NO: 16, for example, having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In certain embodiments, the MED26 polypeptide or its active fragment contains an amino acid sequence having at least 75% sequence identity with SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In certain embodiments, the MED26 polypeptide or its active fragment contains the amino acid sequence of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In certain embodiments, the MED26 polypeptide or its active fragment contains the amino acid sequence of SEQ ID NOs: 12. In certain embodiments, the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO: 2.

[0030] In certain embodiments, the nucleic acid encodes one or more components for gene editing. In certain embodiments, the gene editing includes CRISPR gene editing, and the nucleic acid encodes one or more of CRISPR RNA (crRNA), tracrRNA hybridizing with crRNA, and Cas endonucleases (e.g., Cas9, Cas12, Cas13), preferably the nucleic acid encodes a single guide RNA and / or Cas endonuclease comprising crRNA and tracrRNA, and more preferably the nucleic acid encodes a single guide RNA and Cas9 endonuclease.

[0031] In certain embodiments, the nucleic acid is a DNA molecule such as plasmid DNA.

[0032] In certain embodiments, the nucleic acid is RNA such as mRNA.

[0033] In certain embodiments, the reagent is a DNA molecule such as circular DNA (e.g., plasmid DNA) or linear DNA.

[0034] In certain embodiments, the reagent is RNA, such as mRNA, siRNA, antisense RNA, linear RNA, circular RNA, or tRNA.

[0035] In certain embodiments, the step of preparing the condensate includes mixing the reagent with the MED26 polypeptide or its active fragment in a buffer containing water.

[0036] In certain embodiments, the buffer further comprises polyethylene glycol (PEG).

[0037] The method according to claim 34, wherein the buffer solution contains 1 to 30% (w / v) PEG, for example 2 to 20% (w / v) PEG, for example 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% (w / v) PEG, preferably 10% (w / v).

[0038] In certain embodiments, the step of preparing a condensate includes mixing the reagent with 1 to 200 μM, preferably 5 to 150 μM, for example 5, 10, 25, 50, 75, 100, 125, or 150 μM, more preferably 10 μM of the MED26 polypeptide or its active fragment.

[0039] The above and other purposes, aspects, features, and advantages of the exemplary embodiments can be better understood by referring to the following description in conjunction with the accompanying drawings. [Brief explanation of the drawing]

[0040] [Figure 1A] Figures 1A to 1F show transcriptional condensates that have been switched to a high-MED26 morphology during erythrocyte differentiation. Figure 1A shows Western blot analysis of the relative abundances of several mediator subunits over time (days 0-20) in human CD34+ erythrocyte cultures using β-actin as a loading control. [Figure 1B] Figure 1B shows the time-course (days 0-20) Western blot analysis of the relative abundances of BRD4 and Rpb1 in human CD34+ erythrocyte cultures using β-actin as a loading control. [Figure 1C] Figure 1C shows a schematic diagram of the OptoDroplet assay at the top and time-lapse images of various mediator subunits analyzed by the OptoDroplet assay at the bottom. The subunits are shown on the left, and their intracellular localization is shown on the right. [Figure 1D] Figure 1D shows a representative image of the FRAP assay for EGFP-MED26 condensates in K562 cells. The normalized fluorescence intensity of EGFP-MED26 is expressed as mean ± sd (n=27, independent observation of 27 isolated aggregates). [Figure 1E] Figure 1E shows the droplet formation assay of gradient-diluted MED26 and MED1 IDR proteins under low-salt buffer without PEG conditions. [Figure 1F]Figure 1F shows a droplet formation assay in which 1,6-hexanediol (1,6-Hex) was added to test the breakdown of the liquid-like condensate. [Figure 1G] Figure 1G shows droplet formation assays performed in 25 mM Tris-HCl (pH 7.4) with various NaCl concentrations.

[0041] [Figure 2A] Figures 2A to 2I show that MED26 is essential for erythropoiesis under normal and PHZ-induced stress conditions. Figure 2A shows a Western blot illustrating the MED26 knockout efficiency in mouse splenocytes using GAPDH as a loading control. [Figure 2B] Figure 2B shows images of the whole mouse, femur, and spleen of control and cko mice after MED26 knockout induced by pIpC injection. [Figure 2C] Figure 2C shows the Prussian blue staining of iron in the spleens of control and cko mice. [Figure 2D] Figure 2D shows graphs of mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) in control mice and MED26 knockout mice 3 days after pIpC injection-induced knockout. [Figure 2E] Figure 2E shows Giemsa staining of peripheral blood smears from control mice and CKO mice. Arrows indicate reticulocytes. [Figure 2F] Figure 2F shows FACS analysis to detect the differentiation state of mouse femoral bone marrow cells using two erythrocyte markers (CD71 and Ter119). [Figure 2G] Figure 2G shows the levels of hemoglobin (HGB), red blood cells (RBCs), and hematocrit (HCT) in control mice and conditional MED26 knockout (cKO) mice that were pretreated with 5ug / g pIpC one day prior to the PHZ (60 mg / kg) injection on day 0. [Figure 2H]Figure 2H shows representative flow cytometry plots of Lin-negative cells, LSK cells, LT-HSC cells, ST-HSC cells, MPP cells, CMP cells, GMP cells, and MEP cells in the bone marrow of control and cko mice (n=3). [Figure 2I] Figure 2I shows the percentages of Lin- cells, LSK cells, LT-HSC cells, ST-HSC cells, MPP cells, CMP cells, GMP cells, and MEP cells in the bone marrow of control and cko mice. The p-values ​​were calculated using an unpaired two-sided Student's t-test (C,F,H), and an asterisk indicates a significant difference by Student's t-test: *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, ns. Not significant.

[0042] [Figure 3A] Figures 3A to 3D demonstrate that MED26 is essential for the normal progression of erythrocyte formation. Figure 3A shows representative colony images from a colony formation assay of human CD34+ cells transduced with control shRNA or shRNA targeting MED26. [Figure 3B] Figure 3B shows the relative MED26 gene expression in human CD34+ cells transduced with control shRNA or shRNA targeting MED26. [Figure 3C] Figures 3C and 3D show the quantified CFU-GM and CFU-GEMM colony sizes after MED26 knockdown in human CD34+ cells. Abbreviations: CFU-GEMM: Colony-forming units - granulocytes, erythrocytes, monocytes, megakaryocytes; CFU-GM: Colony-forming units - granulocytes, macrophages. The p-value was calculated using an unpaired two-tailed Student's t-test (D), and an asterisk is used to indicate statistical significance by Student's t-test: *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, not ns significant. [Figure 3D] Same as above

[0043] [Figure 4A]Figures 4A to 4F show that the phase separation ability of MED26 is related to erythrocyte development. Figure 4A shows a Western blot illustrating the MED26 overexpression efficiency in the ex vivo human CD34+ erythrocyte differentiation system on day 8, using GAPDH as a loading control. [Figure 4B] Figure 4B shows FACS analysis for detecting two erythrocyte markers (CD71 and CD235a) in MED26 overexpression. [Figure 4C] Figure 4C shows photographs of CD34+ cell pellets overexpressing MED26 on days 10 and 12. The dotted circles indicate the location of the cell pellets. [Figure 4D] Figure 4D shows a schematic diagram of the MED26 shortened form of the TFIIS domain, the intrinsic disorder region (IDR), and the mediator complex interaction domain. The results of in vivo condensation formation are summarized on the right. [Figure 4E] Figure 4E shows a representative time-lapse image of the MED26 shortened form shown in the OptoDroplet assay. [Figure 4F] Figure 4F shows fluorescence images from an in vitro phase separation assay of the indicated MED26 shortened form fused with EGFP. [Figure 4G] Figure 4G shows FACS analysis for detecting erythrocyte markers (CD71, CD235a) in ex vivo human CD34+ erythrocyte cultures when full-length or shortened MED26 is overexpressed.

[0044] [Figure 5A] Figures 5A to 5F show that RNA polymerase II exhibits transcriptional pause at the MED26 high-abundance locus. Figure 5A shows a heatmap from a cut-and-tag assay on day 4 in primary human CD34+ erythrocyte cultures, showing the number and distribution of common peaks for MED1, MED26, GATA1, and GATA2, as well as the MED1-specific peak and the MED26-specific peak. [Figure 5B]Figure 5B shows the ratio of MED26 to MED1 signals on all transcription start sites (TSSs) occupying MED1 and / or MED26 in a cut-and-tag assay of primary human erythroblasts on day 4. Each dot represents one gene. [Figure 5C] Figure 5C shows a schematic diagram defining high-abundance or low-abundance mediator loci of MED26. [Figure 5D] Figure 5D shows a heatmap of RNA polymerase II and PRO-seq signals for MED26-high or MED26-low genes from -3kb of the TSS to +3kb of the transcription termination site (TES). [Figure 5E] Figure 5E shows IGV visualizations illustrating examples of MED26 high-abundance (top) and low-abundance (bottom) loci. The gray shaded areas indicate MED26 occupancy around TSS. NC indicates the signal from a negative control sample. RPB1 is the largest component of RNA Pol II. [Figure 5F] Figure 5F shows box plots comparing the pause indices of high-abundance and low-abundance MED26 loci. The pause indices were calculated from Rpb1 CUT&Tag or PRO-seq. The p-values ​​were calculated using a two-tailed Wilcoxon rank-sum test.

[0045] [Figure 6A] Figures 6A–6I show that increased MED26 levels promote transcriptional pauses necessary for erythrocyte formation. Figure 6A shows a heatmap of the relative interaction strengths of the indicated proteins captured with MED1 or MED26 as bait in HEK293 cells. Relative interaction strengths are calculated by NSAF from mass spectrometry data. [Figure 6B]Figure 6B shows co-immunoprecipitation of HEK293 cells transfected with 3XFlag-MED1, 3XFlag-MED26, or 3XFlag-EV (control plasmid). After immunopurification with Flag antibodies, Western blotting was performed on the complexes using antibodies against the components of the pause complex (NELF-A, NELF-D, PAF1, and LEO1), the mediator CDK8 kinase module (CCNC1), and the extension complex (CDK9 and CCNT1). [Figure 6C] Figure 6C shows that recombinant proteins of mCherry and mCherry-PAF1-400-531 (amino acids 400-531, the estimated IDR of PAF1) were purified from a prokaryotic expression system and detected by Coomassie blue staining. [Figure 6D] Figure 6D shows the in vitro phase separation assay of EGFP-fused MED26 1-480 and mCherry-PAF1-400-531 using a buffer containing 5% PEG-8000. [Figure 6E] Figure 6E shows a representative image of MED26 KO K562 cells transfected with MED26 shortened form-EGFP and PAF1-mcherry. The white dotted circle indicates the nuclear region. [Figure 6F] Figure 6F shows a box plot comparing the MED26 vs. MED1 signal ratio of human CD34+-derived erythrocyte cultures at days 4 and 16. (The p-value is calculated using the paired Wilcox test). [Figure 6G] Figure 6G shows a box plot comparing the pause indices of human CD34+-derived erythrocyte cultures at days 4 and 16. (The p-value is calculated using the paired Wilcox test.) [Figure 6H] Figure 6H shows IGV visualization of PRO-seq, MED1, and MED26 CUT&Tag signals at the RPS9 (non-erythroid gene) and HBB (erythroid gene) loci. [Figure 6I]Figure 6I shows the FACS analysis of erythrocyte markers CD71 and CD235a in primary human erythroblasts treated with DRB (5,6-dichloro-1-β-D-ribofuranosylbenzimidazole).

[0046] [Figure 7] Figure 7 shows electron microscope images of MED26-mRNA coacervate uptake by RAW264.7 cells.

[0047] [Figure 8] Figure 8 shows FACS analysis of Jurkat cells transfected with EGFP mRNA (Cy5-labeled) loaded MED26 coacervate formulations characterized by various PEG concentrations.

[0048] [Figure 9A] Figure 9A shows fluorescence micrographs of 293T cells and Jurkat cells transfected with MED26-EGFP mRNA coacervate. The scale bar is 50 μm. [Figure 9B] Figure 9B shows the quantitative mRNA expression in 293T cells and Jurkat cells 24 hours after transfection with MED26 coacervate or lipofectamine MessegerMAX.

[0049] [Figure 10A] Figure 10A shows a schematic diagram of the shortened MED26. [Figure 10B] Figure 10B shows the quantitative mRNA expression in Jurkat cells 24 hours after transfection with coacervates formed by the MED26 truncated protein. [Figure 10C] Figure 10C shows the quantitative mRNA expression in Jurkat cells 24 hours after transfection with coacervate formulations characterized by various MED26 (135-480) concentrations. [Figure 10D]Figure 10D quantifies mRNA expression in Jurkat cells 24 hours after transfection with a coacervate formulation characterized by a higher MED26 (135-480) concentration change.

[0050] [Figure 11] Figure 11 shows the FACS analysis of Jurkat cells 24 hours after treatment with coacervates carrying two mRNAs (EGFP mRNA and tdTomato mRNA).

[0051] [Figure 12A] Figure 12A shows representative confocal laser scanning microscope images of early endosomes, coacervates (Cy5-labeled mRNA), and nuclei (Hoechst 33342) in 293T cells one hour after transfection with MED26 coacervates. The scale bar is 5 μm. [Figure 12B] Figure 12B shows representative confocal laser scanning microscope images of LysoTracker, coacervate (Cy5-labeled mRNA), and nucleus (Hoechst 33342) in Jurkat cells 3 hours after incubation with MED26 coacervate. The scale bar is 5 μm. [Figure 12C] Figure 12C shows the temporal expression profile in 293T cells transfected with MED26-mRNA coacervate. [Figure 12D] Figure 12D shows the time course of MED26 protein levels in Jurkat cells transfected with MED26-mRNA coacervate.

[0052] [Figure 13A] Figure 13A shows the relative mRNA levels in 293T-GFP cells 72 hours after treatment with single-target siRNA-loaded MED26 coacervate. [Figure 13B] Figure 13B shows the relative mRNA levels in 293T-GFP cells 72 hours after treatment with a multi-target siRNA-loading MED26 coacervate.

[0053] [Figure 14A] Figure 14A shows the quantitative expression of plasmids (size: 8kb, 15kb) in Jurkat cells 48 hours after transfection with MED26 coacervate or lipofectamine 3000. [Figure 14B] Figure 14B shows the quantitative expression of plasmids (size: 8kb, 15kb) in 293T cells 48 hours after transfection with MED26 coacervate or lipofectamine 3000. [Figure 14C] Figure 14C quantifies plasmid expression in Jurkat cells 48 hours after transfection with coacervates packaging CRISPR / Cas9 pDNA at different MED26 (135-480) concentrations. [Figure 14D] Figure 14D shows the FACS analysis of Jurkat cells 48 hours after treatment with coacervates packaged with two plasmids (GFP plasmid and tdTomato plasmid). [Figure 14E] Figure 14E shows a schematic diagram of the all-in-one pDNA-CRISPR / Cas9 structure. [Figure 14F] Figure 14F shows the transfection efficiencies at the DNMT1, HBB, and HPRT1 loci in Jurkat cells treated with a single-target pDNA loading MED26 coacervate. [Figure 14G] Figure 14G shows the indel frequencies at the DNMT1, HBB, and HPRT1 loci in Jurkat cells treated with a single-target pDNA-loading MED26 coacervate. [Figure 14H] Figure 14H shows the transfection efficiencies at the DNMT1, HBB, and HPRT1 loci in 293T cells treated with single or triple-target pDNA-loading MED26 coacervates. [Figure 14I]Figure 14I shows the indel frequencies at the DNMT1, HBB, and HPRT1 loci in 293T cells treated with single or triple-target pDNA-loading MED26 coacervate. [Modes for carrying out the invention]

[0054] Various publications, articles, and patents are cited or referenced throughout the background and specification. Each of these references is incorporated herein by reference in its entirety. Discussions of documents, acts, materials, apparatus, articles, etc., included herein are intended to provide context for the invention. Such discussions do not constitute an admission that any or all of these matters form part of the prior art with respect to the disclosed or claimed invention.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art in which the present invention pertains. Otherwise, any specific terms used herein have the meanings set forth herein.

[0056] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise.

[0057] Unless otherwise specified, any numerical values, such as concentrations or concentration ranges, as described herein should be understood in all cases to be modified by the term “approximately.” Therefore, numerical values ​​typically include ±10% of the listed value. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). Where used herein, the use of numerical ranges explicitly includes all possible subranges, all individual numerical values ​​within that range, integers and fractions of values ​​within such ranges, unless the context clearly indicates otherwise.

[0058] Unless otherwise specified, the term “at least” preceding a set of elements should be understood to refer to all elements of that set. Those skilled in the art will be able to recognize or confirm many equivalents to the specific embodiments of the invention described herein without the use of any more than ordinary experiments. Such equivalents are intended to be incorporated into the invention.

[0059] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains,” or “containing,” or any other variation thereof, mean the inclusion of the listed constituent element or set of constituent elements, but not the exclusion of any other constituent element or set of constituent elements, and are intended to be non-exclusive or open-ended. For example, a composition, mixture, process, method, article, or apparatus containing a list of elements is not necessarily limited to those elements alone and may include other elements not expressly enumerated or specific to such composition, mixture, process, method, article, or apparatus. Furthermore, unless expressly stated otherwise, “or” means comprehensive or not exclusive or. For example, condition A or B is satisfied in any one of the following cases: A is true (or exists) and B is false (or does not exist), A is false (or does not exist) and B is true (or exists), and both A and B are true (or exist).

[0060] As used herein, the conjunction term “and / or” between multiple enumerated elements is understood to encompass both individual options and combined options. For example, when two elements are joined by “and / or,” the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within its scope of meaning and thus satisfies the requirements of the term “and / or” as used herein. The simultaneous applicability of two or more options is also understood to fall within its scope of meaning and thus satisfies the requirements of the term “and / or.”

[0061] Where used herein, the term "consists of," or variations such as "consist of" or "consisting of," used herein and throughout the claims, indicates that any enumerated components or groups of components are included, but that no additional components or groups of components may be added to the specified method, structure, or composition.

[0062] Where used herein, the term "consists essentially of," or variations such as "consist essentially of" or "consisting essentially of," as used herein and throughout the claims, means that any enumerated component or group of component is included, and any component or group of component is included that does not substantially alter the basic or novel properties of the specified method, structure, or composition. See MPEP § 2111.03.

[0063] As used herein, “subject” means any animal, preferably a mammal, most preferably a human. As used herein, the term “mammal” encompasses any mammal. Examples of mammals include, but are not limited to, cattle, horses, sheep, pigs, cats, dogs, mice, rats, rabbits, guinea pigs, monkeys, and humans.

[0064] The words "right," "left," "lower," and "upper" specify the direction within the referenced drawing.

[0065] It should also be understood that when referring herein to the dimensions or characteristics of preferred components of an invention, terms such as “about,” “approximately,” “generally,” and “substantially” are used to indicate that the described dimensions / characteristics are not strict boundaries or parameters and do not exclude slight variations from those that are functionally the same or similar, as understood by those skilled in the art. At the very least, such references, including numerical parameters, include variations that do not change the least significant digit, using mathematical and industrial principles accepted in the art (e.g., rounding, measurement or other systematic errors, manufacturing tolerances, etc.).

[0066] In the context of two or more nucleic acid or polypeptide sequences (e.g., the MED26 protein and its fragments, or the encoding polynucleotides), the term “identical” or “identity” percentage refers to two or more sequences or subsequences that are identical or have a specified percentage of identical amino acid residues or nucleotides when compared and aligned for maximum correspondence, which is measured using one of the following sequence comparison algorithms or by visual inspection.

[0067] For sequence comparison, typically one sequence acts as the reference sequence compared to the test sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are entered into a computer, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the sequence identity percentage of one or more test sequences relative to the reference sequence based on the specified program parameters.

[0068] Optimal alignment of sequences for comparison can be performed, for example, by Smith & Waterman's local homology algorithm (Adv.Appl.Math.1981;2:482), Needleman & Wunsch's homology alignment algorithm (J.Mol.Biol.1970;48:443), Pearson & Lipman's similarity search method (Proc.Nat'l.Acad.Sci.USA 1988;85:2444), computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package; Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (generally, Current Protocols in Molecular Biology, FM Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., 1995). (See Supplement(Ausubel)).

[0069] Examples of algorithms suitable for determining sequence identity percentage and sequence similarity include the BLAST and BLAST2.0 algorithms, described in Altschul et al., J.Mol.Biol.1990;215:403-410 and Altschul et al., Nucleic Acids Res.1997;25:3389-3402, respectively. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. This algorithm first identifies high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which, when aligned with words of the same length in the database sequence, either match or satisfy a threshold score T with a positive value. T is called the neighbor word score threshold (Altschul et al., previously cited). These initial neighbor word hits act as seeds to initiate a search to find longer HSPs containing them. Word hits are then extended bidirectionally along each sequence as long as they can increase the cumulative alignment score.

[0070] The cumulative score is calculated for nucleotide sequences using parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, the cumulative score is calculated using a score matrix. Word hit extension in each direction is stopped if: the cumulative alignment score falls by an amount X from its maximum achieved value; the cumulative score becomes 0 or less due to the accumulation of one or more negative score residue alignments; or the end of any sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses word length (W) 11, expected value (E) 10, M=5, N=-4, and comparison of both strands as defaults. For amino acid sequences, the BLASTP program uses, by default, a word length (W) of 3, an expected value (E) of 10, and a BLOSUM62 score matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 1989;89:10915).

[0071] In addition to calculating the sequence identity percentage, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 1993;90:5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indicator of the probability that a match between two nucleotide or amino acid sequences occurs by chance. For example, if the minimum sum probability in the comparison between the test nucleic acid and the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001, the nucleic acid is considered similar to the reference nucleic acid.

[0072] A further indicator that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide if, for example, the two peptides differ only by conservative substitutions. Another indicator that two nucleic acid sequences are substantially identical is that the two molecules hybridize with each other under stringent conditions.

[0073] As used herein, the term “isolated” means that a biological component (e.g., nucleic acid, peptide, or protein) is substantially separated from, produced separately from, or purified from other biological components of an organism that exist naturally in the world, namely other chromosomes and extrachromosomal DNA and RNA, as well as proteins. Therefore, “isolated” nucleic acids, peptides, and proteins include nucleic acids and proteins purified by standard purification methods. “Isolated” nucleic acids, peptides, and proteins may be part of a composition and may still be isolated if the composition is not part of the natural environment of the nucleic acid, peptide, or protein. The term also includes nucleic acids, peptides, and proteins prepared by recombinant expression in host cells, as well as chemically synthesized nucleic acids.

[0074] As used herein, the term “polynucleotide” is synonymous with “nucleic acid molecule,” “nucleotide,” or “nucleic acid,” and refers to any polyribonucleotide or polydeoxyribonucleotide that may be unmodified RNA or DNA, or modified RNA or DNA. “Polynucleotides” include, but are not limited to, single-stranded and double-stranded DNA, DNA which is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA which is a mixture of single-stranded and double-stranded regions, as well as hybrid molecules containing DNA and RNA which may be single-stranded, or more typically double-stranded, or a mixture of single-stranded and double-stranded regions. Furthermore, “polynucleotide” refers to RNA or DNA, or a triple-stranded region containing both RNA and DNA. The term polynucleotide also includes DNA or RNA containing one or more modified bases, and DNA or RNA having a modified backbone for stability or other reasons. “Modified” bases include, for example, unusual bases such as tritylated bases and inosine. Various modifications can be made to DNA and RNA. Therefore, "polynucleotides" encompass chemically, enzymatically, or metabolically modified forms of polynucleotides, as is typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotides" also encompass relatively short nucleic acid chains, often called oligonucleotides.

[0075] As used herein, the term “vector” refers to a replicon into which another nucleic acid segment can be operably inserted to result in the replication or expression of a segment.

[0076] As used herein, the term “host cell” refers to a cell containing the nucleic acid molecule of the present invention. A “host cell” may be any type of cell, such as a primary cell, a cell in culture, or a cell derived from a cell line. In one embodiment, the “host cell” is a cell transfected with the nucleic acid molecule of the present invention. In another embodiment, the “host cell” is a descendant or potential descendant of such a transfected cell. The descendants of the cell may be identical to the parent cell, for example, due to mutations that may occur in subsequent generations, environmental influences, or the integration of the nucleic acid molecule into the host cell genome.

[0077] As used herein, the term “expression” refers to the biosynthesis of a gene product. This term encompasses the transcription of a gene into RNA. This term also encompasses the translation of RNA into one or more polypeptides, and further encompasses all naturally occurring post-transcriptional and post-translational modifications.

[0078] As used herein, the terms “peptide,” “polypeptide,” or “protein” may refer to a molecule composed of amino acids that may be recognized as a protein by those skilled in the art. Conventional one- or three-letter codes for amino acid residues are used herein. The terms “peptide,” “polypeptide,” and “protein” may be used interchangeably herein to refer to a polymer of amino acids of any length. The polymer may be linear or branched and may contain modified amino acids and may be interrupted by non-amino acids. The term also encompasses naturally occurring or intervened amino acid polymers, such modifications including any other operations or modifications such as the formation of disulfide bonds, glycosylation, lipidation, acetylation, phosphorylation, or conjugation with labeling components. For example, polypeptides containing one or more analogues of amino acids (including, for example, non-natural amino acids), as well as other modifications known in the art, are also included in the definition.

[0079] The peptide sequences described herein are written according to the usual convention of having the N-terminal region of the peptide on the left and the C-terminal region on the right. Although the isomer forms of amino acids are known, unless otherwise specified, the L-form of the amino acid is represented.

[0080] Method for promoting erythroid differentiation Erythropoiesis is the process of producing red blood cells. At each stage of maturation, erythroblasts exhibit distinct phenotypes, unique transcriptome profiles, and chromatin landscapes. Morphological changes include a gradual eosinophilic appearance due to hemoglobin accumulation, a steady decrease in cell size, and dramatic nuclear condensation leading to enucleation. This process requires the coordinated efforts of epigenetic regulators and transcription factors, as well as precise regulation of RNA polymerase II activity. The average human produces 2 to 3 million red blood cells per second to maintain a steady state and avoid anemia. Deficiencies in terminal erythrocyte maturation, such as nuclear condensation defects or asynchronous maturation of the nucleus and cytoplasm, are commonly seen in myelodysplastic syndromes and hereditary anemia. Understanding the molecular mechanisms governing final erythrocyte maturation is essential for understanding how mutations or other genetic perturbations lead to erythropoiesis and for designing rational therapies (Wells and Steiner, Front Genet. 2022;13:805265).

[0081] In a general embodiment, this application provides a method for promoting erythrocyte differentiation.

[0082] In certain embodiments, a method for promoting erythroid differentiation includes administering erythrocyte progenitor cells with an agent that increases RNA polymerase II arrest mediated by the intracellular mediator complex subunit 26 (MED26) polypeptide.

[0083] As used herein, the term “stem cell” refers to an undifferentiated cell of a multicellular organism that has the ability to self-replicate and produce daughter cells that can undergo terminal differentiation into two or more different cell types having specific functions. Stem cells have the potential to differentiate into multiple types of cells and are capable of unlimited self-replication through asymmetric cell division (a process known as self-replication). In preferred embodiments, the stem cells are adult stem cells, also called somatic stem cells, that are pluripotent and capable of producing cell types within a specific lineage, such as blood cells or endothelial cells.

[0084] In certain embodiments, the stem cells are hematopoietic stem cells. As used herein, the term “hematopoietic stem cell” (“HSC”) refers to an immature cell that has the ability to self-replicate and differentiate into one or more mature blood cells. Examples of mature blood cells include, but are not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), platelets (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes, dendritic cells, microglia, osteoclasts, and lymphocytes.

[0085] As used herein, the term “progenitor cell” refers to a cell that is a descendant of a stem cell and can further differentiate to create a specific cell type. The term is not restrictive and does not limit these cells to any particular lineage. Unlike stem cells, progenitor cells have a lower capacity for self-renewal. Furthermore, the cell differentiation capacity of progenitor cells is generally more limited than that of stem cells. Progenitor cells can usually only differentiate into cells belonging to the same tissue or organ. Some progenitor cells have only one final target cell to which they differentiate (unipotency), while others have the potential to reach two or more cell types (oligopotency or pluripotency).

[0086] As used herein, “erythrocyte progenitor cell” refers to any cell involved in the erythropoiesis process. In certain embodiments, the erythrocyte progenitor cell is a hematopoietic stem cell and progenitor cell (HSPC), such as a CD34-positive HSPC. In certain embodiments, the erythrocyte progenitor cell is an erythroblast, such as an erythroblast derived from a CD34-positive HSPC.

[0087] It should be understood that the present invention intends to utilize any agent capable of increasing MED26 polypeptide-mediated RNA polymerase II pause. A wide variety of agents can be used to increase MED26 polypeptide-mediated RNA polymerase II pause. These agents include, but are not limited to, small molecules, peptides, polypeptides, nucleic acids, oligonucleotides, antibodies, and the like. In certain embodiments, the increase in interaction or occupancy may be due to an increase in affinity and / or an increase in quantity or concentration.

[0088] As used herein, the terms “MED26” or “MED26 polypeptide” refer to the mediator complex subunit 26 protein, which is a mediator of RNA polymerase II transcription subunit 26, or a component or subunit of the CRSP (Cofactor required for SP1 activation) complex. Embodiments of this application relate to the MED26 polypeptide or its active fragment. Preferably, MED26 is mammalian MED26, such as human MED26. In certain embodiments, the MED26 polypeptide is human MED26 polypeptide. In certain embodiments, the human MED26 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or its active fragment.

[0089] In certain embodiments, the agent comprises a MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding an active fragment. As used herein, the term “active fragment” refers to a fragment of MED26 or a derivative thereof that can interact with a transcription pause factor to mediate the pause of RNA polymerase II, or form a condensate with a reagent to deliver the reagent to a cell.

[0090] In certain embodiments, the active fragment comprises an intrinsically disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide that is at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 17. In certain embodiments, the active fragment comprises a TFIIS domain and an intrinsic disorder region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide that is at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2.

[0091] In certain embodiments, the agent comprises a MED26 polypeptide or a nucleic acid encoding a MED26 polypeptide, more specifically, the MED26 polypeptide comprises a polypeptide that is at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 1.

[0092] The MED26 polypeptide or its active fragment can be produced by any suitable method in consideration of this disclosure. In some embodiments, the MED26 polypeptide or its active fragment is produced by recombinant production encoded by a nucleic acid or fragment thereof, for example, containing the polynucleotide sequence of GenBank accession number NM_004831.5. In certain embodiments, the nucleic acid may be optimized for protein expression.

[0093] As used herein, “enhancer” refers to a short region of DNA to which a protein (e.g., a transcription factor) binds to enhance gene transcription. As used herein, “transcriptional coactivator” refers to a protein or protein complex that interacts with a transcription factor to stimulate gene transcription. As used herein, “super-enhancer” or “super-enhancer site” is a region of DNA containing two or more enhancers collectively bound by an array of transcription factor proteins that drive the transcription of genes involved in cell identity. Examples of super-enhancers include, but are not limited to, those described in U.S. Patent Application Publication 2014 / 0287932, the entirety of which is incorporated herein by reference.

[0094] In certain embodiments, the agent increases the interaction between MED26 in cells and transcriptional arrest factors, such as factors included in negative elongation factor (NELF), DRB-sensitivity inducing factor (DSIF), or factors included in polymerase-related factor (PAF) complexes, particularly PAF1.

[0095] In certain embodiments, the agent has the effect of increasing the occupancy rate of the super-enhancer site by MED26, and such super-enhancers include super-enhancers for genes selected from cyclin-dependent kinase 6 (CDK6), apoptosis regulator Bcl-2 (BCL2), high-mobility group proteins HMG-I / HMG-Y (HMGA1), transcription activator Myb (MYB), 40S ribosomal protein S14 (RPS14), 60S ribosomal protein L36a-like R (PL36AL), and 60S ribosomal protein L27 (RPL27).

[0096] A method for promoting erythroid differentiation is also provided, comprising the step of administering a polypeptide containing the amino acid sequence of SEQ ID NO: 17 or a polynucleotide encoding a polypeptide to erythrocyte progenitor cells.

[0097] In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

[0098] In certain embodiments, the agent is administered to erythrocyte progenitor cells in vitro. In certain embodiments, the agent is administered to erythrocyte progenitor cells in vivo in a subject requiring it.

[0099] In certain embodiments, the subject requires treatment for a disorder associated with erythroid differentiation disorder. In certain embodiments, the disorder associated with erythroid differentiation disorder is myelodysplastic syndrome such as refractory anemia or refractory cytopenia, erythrodysplasia, bone marrow failure, or megaloblastic anemia.

[0100] A method for delivering reagents to cells is also provided, and this method is a. Prepare a condensate containing the MED26 polypeptide or its active fragment and the aforementioned reagent, b. Including bringing the cells into contact with the condensate, This allows the MED26 polypeptide or its active fragment to deliver the reagent to the cells.

[0101] Condensates have been studied as potential delivery systems for various substances due to their ability to encapsulate molecules within droplets.

[0102] In certain embodiments, the reagent is a small molecule such as a protein, peptide, RNA, DNA, or CRISPR component for gene editing. In certain embodiments, the condensate provides a protective environment that enhances the stability, solubility, and / or controlled release of the reagent. In certain embodiments, the reagent is a nucleic acid such as one or more RNA or DNA molecules.

[0103] In certain embodiments, the nucleic acid encodes one or more components for gene editing. In certain embodiments, the gene editing includes CRISPR gene editing, where the nucleic acid encodes one or more of CRISPR RNA (crRNA), tracrRNA hybridizing with crRNA, and Cas endonucleases (e.g., Cas9, Cas12, Cas13), preferably the nucleic acid encodes a single guide RNA and / or Cas endonuclease comprising crRNA and tracrRNA, and more preferably the nucleic acid encodes a single guide RNA and Cas9 endonuclease.

[0104] In certain embodiments, the nucleic acid is a DNA molecule such as plasmid DNA. The reagent is a DNA molecule such as circular DNA (e.g., plasmid DNA) or linear DNA (e.g., antisense DNA).

[0105] In certain embodiments, the nucleic acid is RNA, such as mRNA. The reagent is RNA, such as mRNA, siRNA, antisense RNA, linear RNA, circular RNA, or tRNA. The RNA can be modified with one or more chemical modifications.

[0106] In certain embodiments, the MED26 polypeptide or its active fragment contains an amino acid sequence having at least 75% sequence identity with SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In certain embodiments, the MED26 polypeptide or its active fragment contains an amino acid sequence having at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In certain embodiments, the MED26 polypeptide or its active fragment contains the amino acid sequence of SEQ ID NO: 12. In certain embodiments, the MED26 polypeptide or its active fragment contains the amino acid sequence of SEQ ID NO: 2.

[0107] In certain embodiments, the step of preparing a condensate includes mixing a reagent with the MED26 polypeptide or its active fragment in a buffer containing water.

[0108] In certain embodiments, the buffer further comprises polyethylene glycol (PEG). In certain embodiments, the buffer comprises 1 to 30% (w / v) of PEG, for example 2 to 20% (w / v) of PEG, for example 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% (w / v) of PEG, preferably 10% (w / v) of PEG. In certain embodiments, the step of preparing the condensate comprises mixing the reagent with 1 to 200 μM, preferably 5 to 150 μM, for example 5, 10, 25, 50, 75, 100, 125, or 150 μM, more preferably 10 μM of MED26 polypeptide or its active fragment.

[0109] composition Compositions (such as pharmaceutical compositions) containing agents that increase RNA polymerase II arrest mediated by the MED26 polypeptide are also provided herein.

[0110] Also provided are agents or compositions containing agents that increase RNA polymerase II arrest mediated by MED26 polypeptide, for use in methods that promote erythroid differentiation in erythrocyte progenitor cells.

[0111] As used herein, “carrier” includes pharmaceutically acceptable carriers, excipients, or stabilizers that are nontoxic to cells or mammals to which the substance is exposed at the dose and concentration used. In many cases, physiologically acceptable carriers are pH-buffered aqueous solutions. Non-limiting examples of physiologically acceptable carriers include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants, e.g., TWEEN®, polyethylene glycol (PEG), and PLURONICS®.

[0112] As used herein, the terms “effective dose” or “therapeutic effective dose” of a substance mean at least the minimum concentration required to produce a measurable improvement or prevention of a particular disorder. Effective doses as used herein may vary depending on factors such as the disease state, the patient’s age, sex, and weight, and the substance’s ability to induce a desired response in an individual. An effective dose is also the amount in which any toxic or adverse effects of treatment outweigh the therapeutically beneficial effects. With respect to cancer, an effective dose includes an amount sufficient to shrink a tumor and / or reduce the rate of tumor growth (e.g., inhibit tumor growth), or to prevent or delay other undesirable cell proliferation in cancer. In some embodiments, an effective dose is sufficient to delay the onset of cancer. In some embodiments, an effective dose is sufficient to prevent or delay recurrence. In some embodiments, an effective dose is sufficient to reduce the recurrence rate in an individual. An effective dose may be administered in one or more doses. For the purposes of this disclosure, an effective dose of a drug, compound, or pharmaceutical composition is sufficient to achieve a prophylactic or therapeutic treatment, either directly or indirectly. As understood in a clinical context, an effective dose of a drug, compound, or pharmaceutical composition may or may not be achieved in combination with another drug, compound, or pharmaceutical composition. Therefore, “effective dose” may be considered in a situation where one or more therapeutic agents are administered, and a single agent may be considered to be given in an effective dose if, in combination with one or more other agents, the desired outcome can or does not occur.

[0113] Examples The following embodiments of the present invention are for the purpose of further illustrating the nature of the invention. It should be understood that the following embodiments are not intended to limit the invention, and the scope of the invention should be determined by the appended claims.

[0114] Example 1. MED26 expression during erythrocyte formation Given the importance of the mediator complex in regulating various transcriptional processes, its expression was detected in a human CD34+ erythrocyte culture system. CD34+ cells were purified from human umbilical cord blood (Cord Blood Bank of Beijing) using the MACS MicroBead kit (Miltenyi Biotec, Bergisch Gladbach, Germany). The biphase erythrocyte differentiation protocol was modified from that of previous studies (38). The basic culture medium contained IMDM (Gibco, Waltham, MA, USA), 5% human AB serum (Wokavi Biotech, Beijing, China), 10% FBS (Gibco), 10 ng / mL heparin (Sigma, St. Louis, MO, USA), 10 μg / mL insulin (Sigma), 2 mM L-glutamine (Gibco), 3 IU / mL erythropoietin (Amgen, Thousand Oaks, CA, USA), and 300 μg / mL holo-transferrin (Sigma). 50 ng / mL human recombinant SCF (Stem Cell Technologies, Vancouver, BC, Canada) and 10 ng / mL human recombinant IL-3 (Stem Cell Technologies) were added to the Phase I medium. Only 50 ng / mL human recombinant SCF was added to the Phase II medium. Cells were cultured in Phase I medium for 8 days, then transferred to Phase II medium for 6-8 days. All mouse and human cells were cultured in a 90% (v / v) humidified atmosphere at 37°C containing 5% (v / v) CO2.

[0115] While protein levels of most mediator subunits substantially decreased during the final stages of erythroid differentiation, MED26 protein levels unexpectedly remained detectable throughout (Figure 1A). Consistently, immunofluorescence imaging of primary erythroblasts isolated from E14.5 mouse fetal liver revealed that MED1 levels decreased while MED26 remained detectable from early to late erythrogenesis (data not shown). Given the relative abundance of MED26 in final erythrogenesis and the important role of the mediator complex in transcriptional regulation, MED26 may play a unique role in late erythrogenesis.

[0116] Example 2. MED26 shows biomolecular condensation formation. During erythrocyte formation, not only were the levels of most mediator subunits, including MED1, decreased, but the levels of representative transcription condensate-forming proteins such as BRD4 and RPB1 were also substantially reduced (Figure 1A, Figure 1B). In summary, these findings suggest that transcription condensates have a distinct composition during terminal erythrocyte differentiation.

[0117] Next, we tested whether MED26 has the ability to form condensates with other mediator subunits by performing an OptoDroplet assay. The OptoDroplet assay was performed as described in a previous report (35). Plasmids containing the indicated mediator subunits were transfected into 293T cells with Lipo2000 reagent. The transfected 293T cells were cultured at 37°C for 48 hours. For blue light activation and imaging, the cells were imaged using two laser wavelengths, 488 nm and 568 nm, every 2 seconds. Proteins with phase separation ability aggregate when induced by blue light (Figure 1C). This assay revealed that MED1, MED4, MED26, and MED28 have droplet-forming ability (Figure 1C), and provided structural evidence that the majority of these proteins are unstructured.

[0118] We investigated whether MED26 exhibits droplet properties in vivo using a photobleaching fluorescence recovery (FRAP) assay. Briefly, the FRAP experiment was performed using a rotating disk microscope with a 63x oil immersion objective lens. MED26 droplets were photobleached for 30 cycles using 80% laser intensity at 480 nm (for GFP). Fluorescence recovery was recorded accordingly, and the fluorescence intensity of the photobleached region was normalized relative to the intensity of the unbleached region. The FRAP assay showed that enhanced green fluorescent protein fused with MED26 (EGFP-MED26) could form a condensate in K562 erythroleukemia cells, and the signal was rapidly recovered after photobleaching (Figure 1D).

[0119] To verify the intrinsic condensate-forming ability of MED26, putative EGFP-MED26-IDR was expressed and purified. The DNA sequence of the target gene's IDR was cloned into a pET28a prokaryotic expression vector containing a 5'6xHis tag, followed by either mCherry or EGFP, and a sequence encoding the artificially synthesized amino acid linker GAPGSAGSAAGGSG (SEQ ID NO: 18) in its backbone. The DNA sequence was inserted in-frame into the backbone and terminated with a stop codon. For protein expression, the plasmid was first transformed into Rosetta-competent cells (Tsingke, Beijing, China). Fresh bacterial colonies were inoculated into 15 mL LB medium containing kanamycin and chloramphenicol and grown overnight at 37°C. The bacteria were then transferred to a 500 mL culture medium and incubated until the optical density (OD) reached approximately 0.3. After pre-cooling the cells to 16°C, they were inducing 1 mM IPTG and then grown overnight in a centrifuge at 130 rpm at 16°C. The bacterial pellet was collected and stored at -80°C before further processing.

[0120] The bacterial pellet was resuspended in buffer A (50 mM Tris pH 7.5, 500 mM NaCl) containing a cocktail of 10 mM imidazole, lysozyme, and a protease inhibitor. The cell resuspension was completely dissolved on ice for approximately 30 minutes and sonicated until the lysate became slightly clear (15 seconds on, 60 seconds off for 10 cycles). The lysate was centrifuged at 12,000 g for 30 minutes to remove insoluble impurities. The supernatant was incubated with 1 mL of pre-equilibrated Ni-NTA agarose at 4°C for at least 1.5 hours. The slurry was transferred to a column and washed with 15 volumes of buffer A containing 10 mM imidazole. The purified proteins were sequentially eluted with 2 volumes of buffer A containing 50 mM imidazole, 2 volumes of buffer A containing 100 mM imidazole, and 3 volumes of buffer A containing 250 mM imidazole. The composition and purity of each fraction were analyzed using SDS-PAGE electrophoresis followed by Coomassie blue staining. The fractions containing the target protein were concentrated to an appropriate volume and stored at -80°C.

[0121] For droplet formation assays with and without crowding agents, buffers containing 10% PEG8000 in phosphate-buffered saline (PBS) or low-salt buffers containing 50 mM Tris-HCl (pH 7.5) and 25 mM NaCl, respectively, were used. Recombinant proteins were replaced with droplet-forming buffers using an Amicon Ultra centrifugation filter (30 kDa MWCO, Millipore, Burlington, MA, USA). The protein solutions were immediately loaded into a custom-made chamber containing a slide glass with a coverslip attached using two parallel strips of double-sided tape. The slides were then imaged using an Andor confocal microscope equipped with a 63x objective lens (Oxford Instruments, Abingdon, UK).

[0122] EGFP-MED26-IDR was observed to form phase-separated droplets in vitro, both with and without the presence of a molecular crowding factor (10% PEG8000) (Figure 1E, F). Time-lapse imaging was used to capture the fusion events of MED26 droplets and to show their fluid characteristics (data not shown). Next, droplet formation assays were performed using various concentrations of EGFP-MED1-IDR, EGFP-MED26-IDR, and EGFP, and it was shown that MED26-IDR had a lower saturation concentration for phase separation than MED1-IDR (Figure 1E).

[0123] Furthermore, the MED26-IDR droplets were sensitive to 1,6-HD and high-salt treatment, indicating that hydrophobic and electrostatic interactions contribute to droplet formation (Figure 1F). In summary, these results demonstrate that MED26, a subunit in the core mediator complex, can undergo phase separation in vitro and in vivo, suggesting that the transcription condensate switches to a "high-MED26 morphology" during final erythroid differentiation.

[0124] Example 3. MED26 plays an important role in hematopoietic development in mice and humans. To investigate the role of Med26 in vivo, Med26 conditional knockout (cKO) mice were constructed, and their function in the hematopoietic system was examined. To construct Med26 conditional knockout mice, the Med26 gene was modified using CRISPR / Cas9 technology. Flox sequences were inserted bilaterally into the Med26 locus. The process outline is as follows: sgRNA, Cas9, and flox sequence donors were microinjected into C57BL / 6JGpt mouse fertilized eggs. The fertilized eggs were transplanted, and positive F0 mice were obtained, confirmed by PCR and sequencing. A stable F1 generation mouse model was obtained by crossing the positive F0 generation mice with C57BL / 6JGpt mice. Mx1-iCre mice were also constructed using CRISPR / Cas9 technology, and the Mx1-iCre-polyA gene fragment was inserted into the H11 region of the mouse. The process outline is similar to that for Med26 conditional knockout mice. Med26 flox / flox;wt / wt (control) or Med26 flox / flox;Mx1-iCre / wt (cko) mice were generated by natural breeding. To induce iCre expression in vivo, 10 μg g-1 polyinosinate-polycytidylic acid (pIpC-HMW, InvivoGen) was injected into the mice. After one week, the mice were sacrificed, and the desired organs were isolated for the following analyses.

[0125] Following Cre induction by pIpC injection, recombination occurred at the Med26 genomic locus, resulting in decreased protein expression (Figure 2A). cKO mice exhibited smaller body size, whiter fur, and reduced survival rates (Figure 2B). Prussian blue staining of spleen sections showed greater iron deposition and an increase in abnormal erythroblasts in cKO mice, suggesting their removal by the spleen (Figure 2C). Peripheral blood whole blood count (CBC) analysis showed that cKO mice had lower mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) compared to wild-type mice, but possessed similar RBCs, HGB, and hematocrit (Figure 2D). Giemsa staining of peripheral blood smears also showed the presence of irregularly shaped RBCs and sparse reticulocytes (Figure 2E). The bone marrow of Med26 cKO mice lacks erythrocyte precursors (especially at the S3 stage) (Figure 2F), which reproduces a phenotype similar to that of Gata1 cKO mice, which are master erythrocyte transcription factors (37).

[0126] Next, the erythrocyte regeneration capacity of cKO mice was tested under phenylhydrazine (PHZ)-induced acute hemolytic anemia conditions. Briefly, Med26 flox / flox;wt / wt (control) or Med26 flox / flox;Mx1-iCre / wt (cko) mice (6-8 weeks old, randomized by body weight) were pretreated with pIpC (5 μg g-1) for 1 day (day-1). On day 0, phenylhydrazine (PHZ, sigma) (60 mg kg-1) was injected into the mice. Whole blood samples were collected on each day from 1 to 7 for complete blood cell count (CBC) analysis. The results showed that cKO mice could not recover after PHZ treatment (Figure 2G), which was consistent with a significantly smaller spleen, poor reticulocytes in peripheral blood, and a decrease in erythroblasts at the S3 stage in the bone marrow. These results demonstrated that MED26 is essential for erythropoiesis under normal and stressful conditions. Analysis of the composition of hematopoietic stem cells and progenitor cells (HSPCs) and leukocytes (WBCs) in cKO mice also showed that MED26 deficiency impaired LT-HSCs, ST-HSCs, MPPs, CMPs, GMPs, MEPs, B cells, and neutrophils (Figures 2H and 2I).

[0127] To test the effect of MED26 knockdown in human cells, CD34+ cells were purified from human umbilical cord blood as described above. A miR-30-based shRNA vector was used for gene knockdown in CD34+ cells. This was constructed by inserting the target gene into the EcoRI and XhoI sites, as described in a previous report (60). MED26 knockdown was observed to significantly reduce the colony-forming ability of human CD34-positive HSPCs (Figures 3A-3D). In summary, Med26 was demonstrated to be essential for mouse and human erythropogenesis.

[0128] Example 4. The ability of MED26 to form condensates is essential for erythrocyte formation. To elucidate the function of MED26 during erythrocyte development, a gain-of-function assay was performed in a primary human erythrocyte culture system. For gene overexpression in CD34+ cells, the gene's coding sequence was amplified using PCR and cloned into the BamHI and NotI sites of the MSCV-3XFlag-T2A-copGFP vector. The results showed that MED26 overexpression promoted erythrocyte differentiation but inhibited enucleation (Figures 4A-4C).

[0129] Furthermore, to investigate whether the function of MED26 in erythrocyte formation is mediated by its phase separation ability, the function of shortened MED26 mutants was first evaluated using the OptoDroplet assay (Figure 4D). The results showed that the shortened MED26 mutant containing amino acid residues 88-480, which are the putative IDR region, possessed the ability to form aggregates (Figure 4D). Interestingly, amino acid residues 1-480 formed more pronounced aggregates than all other shortened mutants, suggesting that amino acid residues 1-87 may promote the phase separation ability of the MED26 IDR. In vitro assays further confirmed that amino acid residues 88-480 of MED26 possessed phase separation ability, while amino acid residues 1-87 or 480-600 did not (Figure 4E). Previous reports have shown that amino acid residues 1-87 constitute the TFIIS domain, and amino acid residues 480-600 contain a surface that interacts with the remaining mediator complex (36,39). Next, when these three segments of MED26 were overexpressed in human CD34-positive HSPCs, it was shown that amino acid residues 88–480 alone could sufficiently promote erythroid differentiation compared to full-length MED26 (Figure 4F). In summary, these results indicate that the phase separation ability of MED26 is an important regulatory factor for promoting erythroid differentiation.

[0130] Example 5. High-abundance MED26 transcription condensates are preferentially associated with the arrest of RNA polymerase II. To further analyze the molecular basis underlying the function of MED26, the CUT&Tag signal of MED26 was analyzed in human CD34+ erythroid cultured cells on day 4 and compared to the CUT&Tag signal of MED1, which is often considered a representative subunit of the mediator. The CUT&Tag assay was performed as described in a previous report (59) and in accordance with the kit manufacturer's instructions (Vazyme, Nanjing, China). Briefly, 100,000 fresh cells were harvested and captured using Concanavalin A (ConA) beads at room temperature. The cell / ConA bead complex was permeabilized and incubated overnight at 4°C with primary antibody (1:100 dilution). Secondary antibody was added to the solution and incubated at room temperature for 1 hour. After washing off the secondary antibody, pA / G-Tn5 was added to the cell suspension and incubated at room temperature for 1 hour. The adapter was then inserted into the Tn5-tagged genome using TruPrep Tagment Buffer L (TTBL). Genomic DNA was extracted using DNA beads, and tagged DNA fragments were amplified by 16 cycles of PCR using a next-generation sequencing (NGS) adapter. Adapter dimers were removed from the PCR product using DNA Clean Beads (Vazyme, Nanjing, China). The library was quantified before sequencing.

[0131] Unexpectedly, the results showed that approximately 60% of chromatin regions exhibiting MED1 or MED26 occupation were not colocalized (Figure 5A). Interestingly, MED26 colocalized better with GATA1 and GATA2 than MED1, suggesting a potential functional relationship between MED26 and GATA factors. The presence of high-abundance MED1 or MED26 condensates was observed in primary human erythroblasts and other cell types. Next, the signal ratio of MED26 to MED1 was calculated at the transcription start site (TSS) of their occupied loci. While most genes occupied by MED1 and / or MED26 had a relatively constant MED26 / MED1 signal ratio, a considerable number of genes had different MED26 / MED1 ratios, indicating that chromatin occupation by MED26 and MED1 is not necessarily correlated with each other. We defined chromatin regions with a ratio in the top 10% as "MED26 high-abundance chromatin regions" and those in the bottom 10% as "MED26 low-abundance chromatin regions" (Figures 5B-C).

[0132] To elucidate how high levels of MED26 affect transcription, Pol II cut-and-tag assays and precision nuclear run-on sequencing (PRO-seq) were performed on 4-day-old human CD34+ erythrocyte cultures. The results showed that in chromatin regions with low levels of MED26, Pol II was more readily distributed throughout the gene body, while in chromatin regions with high levels of MED26, Pol II was clearly more abundant in the transcription start site (TSS) region, resulting in a higher proportion of short RNA transcription, indicating Pol II arrest (Figures 5D-E). To better characterize these observations, an arrest index (PI) was calculated. The PI is defined as the ratio of the "read count in the TSS region" to the "read count in the gene body region" after normalizing both read counts by the length of the corresponding genomic regions (40). Analysis revealed that loci with high MED26 abundance had a significantly higher PI (p<2.2×10) compared to loci with low MED26 abundance. -16 ), longer gene length (p=4.092×10 -10It was revealed that they possessed similar exon numbers (p=0.09774) (Figure 5F). The same conclusion could be drawn from the CUT&Tag assay of Ser5 phosphorylation of the RNA polymerase II carboxy-terminal domain (Rpb1-S5) and Rpb1-S2 (Figure 5F). Based on overall quantification, Pol II in MED26-high-abundance transcription condensates was found to transcribe genes with a higher arrest index, lower elongation efficiency, and a higher proportion of short RNAs.

[0133] Example 6. MED26 recruits a termination factor to form a biomolecular condensate. To investigate how MED26 can mediate transcriptional arrest, immunoprecipitation combined with mass spectrometry (IP-MS) was performed to identify proteins that interact with MED1 and MED26. HEK293T cells transfected with the indicated bait constructs (3XFlag, 3XFlag-MED1, or 3XFlag-MED26) were harvested, resuspended in lysis buffer (Beyotime, China), and incubated on ice for 30 minutes. Soluble protein complexes were collected by centrifugation at 15,000 g for 15 minutes, and the supernatant was incubated with anti-Flag agarose beads (Sigma) at 4°C for 1.5 hours. After washing five times with lysis buffer, the protein complexes were eluted with 100 μg / mL of 3XFlag peptide (Beyotime, China), denatured with 2× SDS sample buffer, and analyzed by SDS-PAGE electrophoresis followed by Coomassie blue staining. PAGE gel bands representing the expected molecular weight of the target protein were cut to the appropriate size, digested with trypsin, and analyzed using a Q Exactive Plus mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) to identify interacting proteins. The MS data were matched against the Human Reviewed Swiss-Port database using Proteome Discoverer 2.2 software. NSAF was calculated for each detected protein (32, 61-63). The NSAF for protein k is proportional to the amount of protein present in the sample and is calculated using the following formula.

[0134]

number

[0135] In the formula, SpC is the spectral count, L is the protein length in amino acid units, and i is the total number of proteins detected in the MudPIT run.

[0136] While MED26 and MED1 co-immunoprecipitated as well as most other mediator subunits (head, middle, and tail modules) and the elongation complex, MED26 interacted far less with the CDK8 kinase module compared to MED1. This was consistent with previous studies (30). In particular, MED26 interacted with more transcriptional arrest factors (NELF, DSIF, and PAF complexes) than MED1, supporting the idea that MED26 is associated with pause (Figure 6A-B). To determine whether the recruitment of arrest factors depends on the phase separation of MED26, we purified mCherry fused with the disordered region of PAF1 (Figure 6C). In vitro droplet formation assays not only show that amino acid residues 1-480 of MED26 can recruit the arrest factor PAF1 (Figure 6D), but also suggest that the presence of the arrest factor may conversely promote condensate formation of MED26. Previous studies have shown that amino acid residues 1–87 of MED26 contain a TFIIS domain, which can interact with the TFIIS interaction motif (TIM), which is ubiquitous in the disordered regions of transcription factors (41). In fact, the PAF1 complex subunits PAF1, LEO1, and CTR9 all contain TIM sequences. Therefore, both the TFIIS domain and the IDR domain of MED26 may be key segments for promoting condensate formation. To investigate whether the IDR of MED26 contributes to the recruitment of arrest factors, EGFP was constructed fused with various truncated forms of MED26 and tested for PAF1-mCherry recruitment. The results demonstrate that the ability of MED26 to recruit PAF1 is dependent on its IDR, and that its IDR cannot be substituted by the IDR domain of FUS (Figure 6E). These findings suggest that the IDR domain of MED26 plays a unique role in PAF1 recruitment. In summary, both the IDR domain and the TFIIS domain of MED26 are necessary for the recruitment of the arresting factor, and the presence of the arresting factor enhances the formation of MED26 condensates.

[0137] To investigate the effect of high MED26 levels on transcription during erythrocyte formation, the ratio of MED26 to MED1 chromatin occupancy in primary human CD34+ erythroblasts at days 4 and 16 was analyzed using a cut-and-tag assay. The results showed that the MED26 to MED1 ratio increased in both erythrocyte and non-erythrocyte genes during differentiation, with the ratio increasing more significantly in erythrocyte genes at day 16 compared to non-erythrocyte genes (Figure 6F-G).

[0138] Next, PRO-seq was performed on ex vivo cultured erythroblasts on day 4 or day 16. The PRO-seq library was prepared as described in a previous report (58). In short, 2 × 10¹⁶ nuclei of cleaved CD34 cells cultured ex vivo on day 4 or day 16 were prepared. 7 The RNA molecules were added to a 2× Nuclear Run-On (NRO) reaction mixture and incubated at 37°C for 3 minutes. The nascent RNA was extracted and fragmented by base hydrolysis in 0.2N NaOH on ice for 10 minutes, and neutralized by adding 1× volume of 1M Tris-HCl (pH 6.8). The fragmented nascent RNA was buffer-exchanged, purified using streptavidin beads, ligated with a reverse 3' RNA adapter VRA3 (5'p-GAUCGUCGGACUGUAGAACUCUGAAC (SEQ ID NO: 19)- / 3' inverted dT / ), and the product was enriched by a second streptavidin enrichment. Subsequently, the RNA product was treated with RppH (Thermo Fisher) and polynucleotide kinase (PNK,NEB) for 5' end repair. Prior to the third streptavidin bead enrichment, the 5' repair RNA was ligated to the reverse 5' RNA adapter VRA5 (5'-CUGAACAAGCAGAAGACGGCAUACGA (SEQ ID NO: 20)-3'). The RNA was reverse transcribed using the RT primer (5'AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA (SEQ ID NO: 21)-3'). The cDNA product was amplified for 18 cycles, and libraries larger than 150 bp (inserts > 70 bp) were purified from the PAGE gel. The libraries were quantified before NGS.

[0139] As a result, with increasing MED26 to MED1 ratio during red blood cell development, non-red blood cell genes (p<2.2×10) -16 ) and red blood cell genes (p<2.2×10 -16 It was found that PI increased in both cases (Figures 6G-6H). To test whether increased transcriptional arrest promotes erythropoiesis, 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB), which inhibits transcriptional elongation by inhibiting CDK9(42), was added to ex vivo cultured human erythroblasts on day 6. With the addition of DRB, CD71 was increased compared to the control group. + CD235a + The number of erythroblasts increased (Figure 6I). In summary, it was found that increased abundance of MED26 is associated with increased transcriptional arrest at the final erythrocyte stage, which may promote erythrocyte development.

[0140] Example 7. mRNA delivery mediated by MED26 coacervate mRNA therapy holds promising potential as a revolutionary approach in the field of medicine. Its ability to leverage the body's natural cellular mechanisms for protein production offers targeted and precise treatment for a variety of diseases. Therefore, we evaluated the potential of the MED26 condensate to function as a means of intracellular transport of mRNA.

[0141] MED26 (1-480 amino acids; SEQ ID NO: 2) and mRNA condensates were prepared by adding MED26 and mRNA to ddH2O and gently mixing for 30-60 seconds. Phase separation patterns were identified by microscopic observation for a certain range of MED26 (1-480 amino acids; SEQ ID NO: 2) concentrations (0.1-100 μM) and mRNA concentrations (0.01-0.6 μM).

[0142] PEG was dissolved in ddH2O at a series of concentrations (0, 2, 5, 10, 15, 20%, wt / v). MED26 (1 - 480 amino acids; SEQ ID NO: 2) (10 μM) and EGFP mRNA (0.1 μM) were introduced into the polyethylene glycol (PEG) solution and gently mixed for 30 - 60 seconds to form coacervates. 1×10 5 Jurkat cells were suspended in 20 μL of Opti - MEM and combined with 40 μL of the coacervate solution. After incubation at 37 °C, 5% CO2 in a 96 - well plate for 2 hours, 200 μL of cell medium (RPMI - 1640, 10% FBS, antibiotics) was added and the cells were cultured for 18 hours.

[0143] For adherent cells, 5×10 4 293T cells were seeded in a 96 - well plate one day before treatment. After removing the culture medium, they were washed once with Opti - MEM to remove FBS, and 20 μL of Opti - MEM and 40 μL of the coacervate (10% PEG formulation) solution were added for incubation for 2 hours. Then, 200 μL of cell medium (DMEM, 10% FBS, antibiotics) was supplemented and the cells were cultured for 18 hours before testing. The expression efficiency was evaluated by flow cytometry (Cytoflex LX). GFP fluorescence images were acquired using (TSKON TS2 - FL).

[0144] When MED26 - mRNA condensates were delivered to the mouse monocyte / macrophage - like cell line RAW264.7, electron microscopy revealed various stages of cellular uptake. This process exhibited features of micropinocytosis and phagocytosis, including stages such as contact - free, attachment to the cell surface, coacervate wrapping by flat membrane protrusions, and partial membrane engulfment (Figure 7).

[0145] PEG is widely used to enhance LLPS as a molecular crowding factor and dehydration inducer. By detecting Cy5-labeled mRNA, it was observed that coacervates formed in PEG solution showed higher efficiency in cell entry in a concentration-dependent manner (Figure 8). The relationship between PEG concentration and expression efficiency during MED26-mRNA coacervate formation was also investigated. Figure 8 shows that when coacervates were constructed in PEG solution, the expression level of the mRNA-encoded protein was higher, and high expression was achieved in PEG solutions of 10% or more. MED26-EGFP mRNA coacervates efficiently transfected 293T cells, thereby expressing EGFP mRNA with efficiency comparable to that of the Lipofectamine MessengerMAX reagent (Figures 9A-B). Importantly, MED26 coacervates showed a remarkable ability to deliver mRNA to Jurkat cells, outperforming the performance of the Lipofectamine MessengerMAX reagent (Figures 9A-9B).

[0146] The primary function of the MED26 protein is its involvement in gene transcription within the cell nucleus. A series of truncated forms of the MED26 protein were designed and purified to preserve its delivery capability while losing its primary function (Figure 10A). All truncated forms tested showed the ability to form coacervates with mRNA. Therefore, their delivery efficiencies in Jurkat cells were compared and screened (Figure 10B). Considering the removal of nuclear localization sequences and expression efficiency, a fragment of MED26 from amino acid residues 135 to 480, i.e., the MED26(135-480; SEQ ID NO: 12) protein, was selected for subsequent experiments. To determine the optimal concentration of the MED26(135-480; SEQ ID NO: 12) protein, the delivery efficiency of various protein concentrations was evaluated with 0.1 μM mRNA, and it was found that 10 μM of protein was sufficient to achieve high mRNA delivery efficiency in Jurkat cells (Figure 10C). Coacervates produced by higher MED26 concentrations also successfully delivered mRNA to Jurkat cells (Figure 10D).

[0147] Furthermore, MED26 coacervates are not limited to carrying a single mRNA; confocal observation revealed that two mRNAs are completely co-localized within the MED26 coacervate (data not shown). FACS analysis and confocal observation confirmed a high correlation in expression between EGFP mRNA and tdTomato mRNA in Jurkat cells (Figure 11) and 293T cells.

[0148] Example 8. Internalization mechanism and duration of MED26 coacervate Confocal observation revealed that MC38 cells exhibited deformation and extended pseudopods to take up MED26 coacervates, a characteristic feature of macropinocytosis (Figure 12A). To gain deeper insight into the mechanism of MED26 coacervate internalization, their localization to early endosomes was investigated. 5×10 4 293T cells were seeded in a confocal dish (solarbio) and transfected for 16 hours with a plasmid expressing early endosome-GFP (Rab5a, BacMam 2.0, CellLight, Thermo Fisher Scientific). Subsequently, the cells were treated with MED26(135-480; SEQ ID NO: 12)-luciferase mRNA (Cy5 labeled) coacervate for 30 minutes, followed by a medium change to DMEM (10% FBS, antibiotic). Images were acquired using laser scanning confocal microscopy (Zeiss LSM980).

[0149] Twenty minutes after transfection with MED26 coacervate, the majority of coacervate signaling in 293T cells did not colocalize with Rab5 signaling (Figure 12A). Even after 40 minutes, no significant colocalization was observed (Figure 12B), suggesting that the aforementioned internalization mechanism does not involve endosomes.

[0150] To further confirm that MED26 coacervates are not trapped in endosomal compartments, 293T cells were stained with LysoTracker to reveal lysosome-like acidic organelles 3 hours after transfection. The image in Figure 12C, taken 4 hours after transfection, clearly demonstrates that almost all coacervates did not colocalize with lysosomes and maintained high fluorescence intensity. These findings strongly suggest that the internalization of MED26 coacervates, characterized by their microscale and liquid-like droplets, is distinctly different from endocytosis.

[0151] Because there was no capture within endosomes and no need to escape from them, the GFP signal became detectable as early as 30 minutes after transfection and reached its peak expression ratio within 8 hours in Jurkat cells (Figure 12D). The intensity of GFP fluorescence reached its maximum 1 day after transfection and then decreased. Simultaneously, mRNA levels in cells rapidly decreased within 1 day. The MED26 protein was barely detectable 1 day after transfection (Figure 12E). The data indicated that the MED26 protein does not persist long-term in cells.

[0152] Example 9. siRNA delivery and gene knockdown mediated by MED26 coacervate This study investigated the effective delivery of siRNA via MED26 coacervate. For single-gene siRNA knockdown experiments, 293T-GFP cells expressing stable GFP were placed in 24-well cell culture plates 1 day prior to the experiment (2.5 × 10⁶ cells). 5Cells were seeded at a cell / well density. A coacervate mixture containing 10 μM MED26 (135-480; SEQ ID NO: 12), 10% PEG, and 1 μM siRNA was prepared by thoroughly mixing for 30–60 seconds. Existing culture medium was removed from each well, and 200 μL of the coacervate mixture, combined with 100 μL of Opti-MEM medium, was added to each well. The plates were then incubated in a cell culture incubator for 2 hours in a static state. After transfection, 1 mL of complete DMEM growth medium was added to each well, and the plates were further incubated in an incubator at 37°C for 72 hours to evaluate the knockdown effect of siRNA on the target gene.

[0153] For the multi-gene co-knockdown experiment, siRNAs targeting different genes were completely mixed, and the siRNA mixture, at a final concentration of 1 μM, was used for coacervate preparation. The remaining transfection conditions were kept unchanged.

[0154] 72 hours after transfection with siGFP-loaded MED26 coacervate, GFP fluorescence intensity and GFP mRNA levels were significantly reduced in GFP-stable expressing 293T cells (data not shown). Furthermore, when other siRNA targets were tested in 293T-GFP cells, all showed significant knockdown efficiency (Figure 13A). Due to MED26's high loading capacity, the functionality of simultaneous knockdown of multiple genes was evaluated. Transfection of cells with MED26 coacervate loaded with quadruple siRNA showed significant target gene knockdown, suggesting the possibility of simultaneous multiple gene knockdown using MED26 coacervate (Figure 13B).

[0155] Example 10. DNA delivery and pDNA-based genome editing mediated by MED26 coacervate CRISPR / Cas9-mediated gene knockout using plasmid DNA (pDNA) is accessible and cost-effective. Initially, pDNA delivery was evaluated using the MED26 coacervate. The MED26-GFP pDNA coacervate successfully transfected Jurkat cells, surpassing the capabilities of Lipofectamine 3000 (Figure 14A). Transfection efficiency in 293T cells was comparable for small plasmid delivery, but notably, the MED26 coacervate showed improved performance in large plasmid delivery (Figure 14B). Furthermore, the MED26 coacervate outperformed Lipofectamine 3000 when co-transfecting cells with two pDNAs simultaneously (Figures 14C-14D). To evaluate transfection efficiency, an all-in-one plasmid encoding sgRNA and a Cas9-tdTomato fusion protein sequence was selected for use with the MED26 coacervate (Figure 14E). Next, the MED26 protein and pDNA preparations were optimized, and it was determined that 10 μM MED26 and 20 μg / μL pDNA were the optimal concentrations. Next, the gene editing efficiency facilitated by MED26 coacervates was evaluated. Jurkat cells were exposed to CRISPR / Cas9 pDNA-loaded MED26 coacervates targeting DNA methyltransferase 1 (DNMT1), hemoglobin subunit beta (HBB), hypoxanthine phosphoribosyltransferase 1 (HPRT1), and a pDNA mixture of these three targets. To evaluate genome editing efficiency, cells were treated with MED26 coacervates carrying all-in-one plasmids (containing gRNAs for specific targets). After 48 hours of transfection, cells were harvested and genomic DNA was extracted using QuickExtract® DNA Extraction Solution (Lucigen). Target genomic loci were amplified by nested PCR using PrimeSTAR® Max DNA Polymerase (Takara) and primers listed in Table 1, and purified using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit (Takara). Subsequently, 200 ng of PCR product was subjected to the T7EN1 assay, and indel frequency was evaluated according to the recommended protocol (Vazyme Biotech). The digested products were analyzed using a 2% agarose gel and imaged with a gel imaging system (Tanon). Indel percentages were measured using ImageJ software and calculated using the following formula: Indel (%) = 100 × [1 - (1 - segmented fraction)] 1 / 2 Here, the segmented fraction is defined as the sum of the individual digestion product intensities divided by the sum of the individual digestion product intensities and the undigested product intensities.

[0156] 48 hours after transfection, approximately 73.9%, 67.9%, 59.6%, and 58.1% of cells expressed tdTomato, representing the percentage of cells expressing the target sgRNA and Cas9 (Figure 14F).

[0157] The analyzed indel efficiencies were 23.8%, 17.55%, and 34.79% for the single-target DNMT1, HBB, and HPRT1 loci, respectively (Figure 14G). In particular, genome editing efficiencies were 16.43%, 10.29%, and 28.05% for the DNMT1, HBB, and HPRT1 loci in the triple-target sample, suggesting the significant potential for simultaneous multi-gene editing (data not shown). Due to its ability to hold larger, more plasmids, MED26 coacervate showed higher plasmid expression efficiency compared to lipofectamine 3000 reagent in 293T cells (Figure 14H). As a result, MED26 coacervate mediated higher genome editing efficiencies for DNMT1, HBB, HPRT1, and multi-target loci (Figure 14I).

[0158] [Table 1-1]

[0159] [Table 1-2]

[0160] Our all-in-one Crispr / Cas9 pDNA design successfully transfected Jurkat cells with three targets at a high transfection rate. Importantly, the MED26 coacervate enables multiple gene editing via one-step transfection, particularly in Jurkat cells, which are difficult to transfect, without the need for Cas9 protein or gRNA. Furthermore, these coacervates can combine different gene categories, such as pDNA and siRNA, within a single coacervate (data not shown), providing more options for multi-target drug discovery.

[0161] References 1. P. Wong et al., Gene induction and repression during terminal erythropoiesis are mediated by distinct epigenetic changes. Blood 118, e128-138 (2011). 2. D. Hnisz, K. Shrinivas, R. A. Young, A. K. Chakraborty, P. A. Sharp, A Phase Separation Model for Transcriptional Control. Cell 169, 13-23 (2017). 3. P. Cramer, Organization and regulation of gene transcription. Nature 573, 45-54 (2019). 4. J. Palis, Primitive and definitive erythropoiesis in mammals. Front Physiol 5, 3 (2014). 5. S. M. Hattangadi, P. Wong, L. Zhang, J. Flygare, H. F. Lodish, From stem cell to red cell: regulation of erythropoiesis at multiple levels by multiple proteins, RNAs, and chromatin modifications. Blood 118, 6258-6268 (2011). 6. H. Lodish, J. Flygare, S. Chou, From stem cell to erythroblast: regulation of red cell production at multiple levels by multiple hormones. IUBMB Life 62, 492-496 (2010). 7. Y. Mei, Y. Liu, P. Ji, Understanding terminal erythropoiesis: An update on chromatin condensation, enucleation, and reticulocyte maturation. Blood Rev 46, 100740 (2021). 8. M. Moras, S. D. Lefevre, M. A. Ostuni, From Erythroblasts to Mature Red Blood Cells: Organelle Clearance in Mammals. Front Physiol 8, 1076 (2017). 9. P. Valent et al., Normal and pathological erythropoiesis in adults: from gene regulation to targeted treatment concepts. Haematologica 103, 1593-1603 (2018). 10. Z. C. Murphy et al., Regulation of RNA polymerase II activity is essential for terminal erythroid maturation. Blood 138, 1740-1756 (2021). 11. J. Malik, J. A. Lillis, T. Couch, M. Getman, L. A. Steiner, The Methyltransferase Setd8 Is Essential for Erythroblast Survival and Maturation. Cell Rep 21, 2376-2383 (2017). 12. P. Kapoor-Vazirani, J. D. Kagey, P. M. Vertino, SUV420H2-mediated H4K20 trimethylation enforces RNA polymerase II promoter-proximal pausing by blocking hMOF-dependent H4K16 acetylation. Mol Cell Biol 31, 1594-1609 (2011). 13. S. Bottardi et al., Ikaros interacts with P-TEFb and cooperates with GATA-1 to enhance transcription elongation. Nucleic Acids Res 39, 3505-3519 (2011). 14. R. Kurita et al., Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells. PLoS One 8, e59890 (2013). 15. P. Li et al., Phase transitions in the assembly of multivalent signalling proteins. Nature 483, 336-340 (2012).

[0162] 16. S. Boeynaems et al., Protein Phase Separation: A New Phase in Cell Biology. Trends Cell Biol 28, 420-435 (2018). 17. S. F. Banani, H. O. Lee, A. A. Hyman, M. K. Rosen, Biomolecular condensates: organizers of cellular biochemistry. Nat Rev Mol Cell Biol 18, 285-298 (2017). 18. M. Boehning et al., RNA polymerase II clustering through carboxy-terminal domain phase separation. Nat Struct Mol Biol 25, 833-840 (2018). 19. Y. E. Guo et al., Pol II phosphorylation regulates a switch between transcriptional and splicing condensates. Nature 572, 543-548 (2019). 20. H. Lu et al., Phase-separation mechanism for C-terminal hyperphosphorylation of RNA polymerase II. Nature 558, 318-323 (2018). 21. B. R. Sabari et al., Coactivator condensation at super-enhancers links phase separation and gene control. Science 361, (2018). 22. A. Boija et al., Transcription Factors Activate Genes through the Phase-Separation Capacity of Their Activation Domains. Cell 175, 1842-1855 e1816 (2018). 23. J. Soutourina, Transcription regulation by the Mediator complex. Nat Rev Mol Cell Biol 19, 262-274 (2018). 24. S. Sato et al., A set of consensus mammalian mediator subunits identified by multidimensional protein identification technology. Mol Cell 14, 685-691 (2004). 25. L. El Khattabi et al., A Pliable Mediator Acts as a Functional Rather Than an Architectural Bridge between Promoters and Enhancers. Cell 178, 1145-1158 e1120 (2019). 26. J. W. Yin, G. Wang, The Mediator complex: a master coordinator of transcription and cell lineage development. Development 141, 977-987 (2014). 27. M. Stumpf et al., The mediator complex functions as a coactivator for GATA-1 in erythropoiesis via subunit Med1 / TRAP220. Proc Natl Acad Sci U S A 103, 18504-18509 (2006). 28. M. Stumpf et al., Specific erythroid-lineage defect in mice conditionally deficient for Mediator subunit Med1. Proc Natl Acad Sci U S A 107, 21541-21546 (2010). 29. S. I. Kim, E. H. Bresnick, Transcriptional control of erythropoiesis: emerging mechanisms and principles. Oncogene 26, 6777-6794 (2007). 30. S. Malik, R. G. Roeder, Dynamic regulation of pol II transcription by the mammalian Mediator complex. Trends Biochem Sci 30, 256-263 (2005).

[0163] 31. H. Takahashi et al., The role of Mediator and Little Elongation Complex in transcription termination. Nat Commun 11, 1063 (2020). 32. H. Takahashi et al., Human mediator subunit MED26 functions as a docking site for transcription elongation factors. Cell 146, 92-104 (2011). 33. H. Takahashi et al., MED26 regulates the transcription of snRNA genes through the recruitment of little elongation complex. Nat Commun 6, 5941 (2015). 34. H. M. Bourbon, Comparative genomics supports a deep evolutionary origin for the large, four-module transcriptional mediator complex. Nucleic Acids Res 36, 3993-4008 (2008). 35. Y. Shin et al., optoDroplets-Spatiotemporal Control of Intracellular Phase Transitions Using Light-Activated optoDroplets. Cell 168, 159-171 e114 (2017). 36. X. Chen et al., Structures of the human Mediator and Mediator-bound preinitiation complex. Science 372, (2021). 37. L. Gutierrez et al., Ablation of Gata1 in adult mice results in aplastic crisis, revealing its essential role in steady-state and stress erythropoiesis. Blood 111, 4375-4385 (2008). 38. H. Y. Lee et al., PPAR-alpha and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal. Nature 522, 474-477 (2015). 39. R. Peruzzini et al., 1H, 15N and 13C assignments of the N-terminal domain of the Mediator complex subunit MED26. Biomol NMR Assign 10, 233-236 (2016). 40. D. S. Day et al., Comprehensive analysis of promoter-proximal RNA polymerase II pausing across mammalian cell types. Genome Biol 17, 120 (2016). 41. K. Cermakova et al., A ubiquitous disordered protein interaction module orchestrates transcription elongation. Science 374, 1113-1121 (2021). 42. K. Yankulov, K. Yamashita, R. Roy, J. M. Egly, D. L. Bentley, The transcriptional elongation inhibitor 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole inhibits transcription factor IIH-associated protein kinase. J Biol Chem 270, 23922-23925 (1995). 43. B. Gaertner, J. Zeitlinger, RNA polymerase II pausing during development. Development 141, 1179-1183 (2014). 44. S. Alberti, A. Gladfelter, T. Mittag, Considerations and Challenges in Studying Liquid-Liquid Phase Separation and Biomolecular Condensates. Cell 176, 419-434 (2019). 45. A. G. Larson et al., Liquid droplet formation by HP1alpha suggests a role for phase separation in heterochromatin. Nature 547, 236-240 (2017).

[0164] 46. A. R. Strom et al., Phase separation drives heterochromatin domain formation. Nature 547, 241-245 (2017). 47. M. Yu et al., Visualizing the disordered nuclear transport machinery in situ. Nature, (2023). 48. A. Molliex et al., Phase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillization. Cell 163, 123-133 (2015). 49. D. S. W. Protter, R. Parker, Principles and Properties of Stress Granules. Trends Cell Biol 26, 668-679 (2016). 50. M. Boehning et al., RNA polymerase II clustering through carboxy-terminal domain phase separation. Nature Structural & Molecular Biology 25, 833-+ (2018). 51. X. Han et al., Roles of the BRD4 short isoform in phase separation and active gene transcription. Nat Struct Mol Biol 27, 333-341 (2020). 52. F. X. Chen, E. R. Smith, A. Shilatifard, Born to run: control of transcription elongation by RNA polymerase II. Nat Rev Mol Cell Biol 19, 464-478 (2018). 53. X. Bai et al., TIF1gamma controls erythroid cell fate by regulating transcription elongation. Cell 142, 133-143 (2010). 54. A. A. Perreault, J. D. Brown, B. J. Venters, Erythropoietin Regulates Transcription and YY1 Dynamics in a Pre-established Chromatin Architecture. iScience 23, 101583 (2020). 55. D. J. Taatjes, A. M. Naar, F. Andel, 3rd, E. Nogales, R. Tjian, Structure, function, and activator-induced conformations of the CRSP coactivator. Science 295, 1058-1062 (2002). 56. D. J. Taatjes, R. Tjian, Structure and function of CRSP / Med2; a promoter-selective transcriptional coactivator complex. Mol Cell 14, 675-683 (2004). 57. F. A. Ran et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308 (2013). 58. D. B. Mahat et al., Base-pair-resolution genome-wide mapping of active RNA polymerases using precision nuclear run-on (PRO-seq). Nat Protoc 11, 1455-1476 (2016). 59. H. S. Kaya-Okur et al., CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat Commun 10, 1930 (2019). 60. C. Fellmann et al., An optimized microRNA backbone for effective single-copy RNAi. Cell Rep 5, 1704-1713 (2013). 61. L. Florens et al., Analyzing chromatin remodeling complexes using shotgun proteomics and normalized spectral abundance factors. Methods 40, 303-311 (2006).

[0165] 62. Y. Zhang, Z. Wen, M. P. Washburn, L. Florens, Refinements to label free proteome quantitation: how to deal with peptides shared by multiple proteins. Anal Chem 82, 2272-2281 (2010). 63. A. C. Paoletti et al., Quantitative proteomic analysis of distinct mammalian Mediator complexes using normalized spectral abundance factors. Proc Natl Acad Sci U S A 103, 18928-18933 (2006). 64. S. Pott, J. D. Lieb, What are super-enhancers? Nat Genet 47, 8-12 (2015). 65. D. Hnisz et al., Super-enhancers in the control of cell identity and disease. Cell 155, 934-947 (2013). 66. L. S. Ludwig et al., Transcriptional States and Chromatin Accessibility Underlying Human Erythropoiesis. Cell Rep 27, 3228-3240 e3227 (2019). 67. B. D. Pope et al., Topologically associating domains are stable units of replication-timing regulation. Nature 515, 402-405 (2014)

Claims

1. A method for promoting erythroid differentiation, comprising administering an agent to erythrocyte progenitor cells that increases the arrest of RNA polymerase II mediated by the intracellular mediator complex subunit 26 (MED26) polypeptide.

2. The method according to claim 1, wherein the agent increases the interaction between the MED26 in the cells and transcriptional arrest factors, such as factors included in negative elongation factors (NELF), DRB sensitivity inducing factors (DSIF), or factors included in polymerase-related factor (PAF) complexes, particularly PAF1.

3. The method according to claim 1, wherein the agent increases the occupancy rate of the super-enhancer site by MED26, wherein the super-enhancer is a super-enhancer for a gene selected from, for example, CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27.

4. The method according to any one of claims 1 to 3, wherein the agent comprises a MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.

5. The method according to claim 4, wherein the active fragment comprises an intrinsic disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide which is at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

17.

6. The method according to claim 5, wherein the active fragment comprises a TFIIS domain and an intrinsic disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide which is at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

2.

7. The method according to any one of claims 1 to 6, wherein the agent comprises the MED26 polypeptide or a nucleic acid encoding the MED26 polypeptide, more specifically, the MED26 polypeptide comprises a polypeptide which is at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

1.

8. A method for promoting erythroid differentiation, comprising the step of administering a polypeptide containing the amino acid sequence of Sequence ID No. 17 or a polynucleotide encoding the polypeptide to erythrocyte progenitor cells.

9. The method according to claim 8, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:

2.

10. The method according to claim 9, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:

1.

11. The method according to any one of claims 1 to 10, wherein the erythrocyte progenitor cells are hematopoietic stem cells and progenitor cells (HSPCs), for example, CD34-positive HSPCs.

12. The method according to any one of claims 1 to 10, wherein the erythrocyte progenitor cells are erythroblasts such as erythroblasts derived from CD34-positive HSPCs.

13. The method according to any one of claims 1 to 12, wherein the agent is administered in vitro to the erythrocyte progenitor cells.

14. The method according to any one of claims 1 to 13, wherein the agent is administered in vivo to erythrocyte progenitor cells in a subject requiring it.

15. The method according to claim 14, wherein the subject requires treatment for a disease associated with erythrocyte differentiation disorder.

16. The method according to claim 15, wherein the disease associated with erythrocyte differentiation disorder is myelodysplastic syndrome such as refractory anemia or refractory cytopenia, erythrocyte dysplasia, bone marrow failure, or megaloblastic anemia.

17. A method for identifying agents that promote erythrocyte differentiation, a. To provide a composition comprising the MED26 polypeptide or an active fragment thereof, b. Contacting the composition with the test agent, c. To evaluate whether the test agent increases the ability of MED26 to mediate the arrest of RNA polymerase II. Methods that include...

18. The method according to claim 17, wherein the evaluation step includes evaluating whether the test agent promotes the ability to form aggregates of MED26, the ability to interact with transcriptional pause factors, and / or the ability to occupy super-enhancer sites.

19. A composition comprising an agent that increases the arrest of RNA polymerase II mediated by the MED26 polypeptide.

20. A method for delivering reagents to cells, a. Prepare a condensate containing the MED26 polypeptide or its active fragment and the reagent, and b. Including bringing the cells into contact with the condensate, A method wherein the MED26 polypeptide or its active fragment delivers the reagent to the cells.

21. The method according to claim 20, wherein the reagent is one or more nucleic acids such as RNA or DNA molecules.

22. The method according to claim 20 or claim 21, wherein the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

16.

23. The method according to claim 22, wherein the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75% sequence identity with SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

24. The method according to claim 22, wherein the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.

25. The method according to claim 22, wherein the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO:

12.

26. The method according to claim 22, wherein the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO:

2.

27. The method according to any one of claims 21 to 26, wherein the nucleic acid encodes one or more components for gene editing.

28. The method according to claim 27, wherein the gene editing comprises CRISPR gene editing, the nucleic acid encodes one or more of CRISPR RNA (crRNA), tracrRNA hybridizing with the crRNA, and Cas endonucleases (e.g., Cas9, Cas12, Cas13), preferably the nucleic acid encodes a single guide RNA and / or the Cas endonuclease comprising the crRNA and the tracrRNA, and more preferably the nucleic acid encodes the single guide RNA and the Cas9 endonuclease.

29. The method according to claim 27 or claim 28, wherein the nucleic acid is a DNA molecule such as plasmid DNA.

30. The method according to claim 27 or claim 28, wherein the nucleic acid is RNA, for example, mRNA.

31. The method according to any one of claims 21 to 26, wherein the reagent is a DNA molecule such as circular DNA (e.g., plasmid DNA) or linear DNA (e.g., antisense DNA).

32. The method according to any one of claims 21 to 26, wherein the reagent is RNA, such as mRNA, siRNA, antisense RNA, linear RNA, circular RNA, or tRNA.

33. The method according to any one of claims 20 to 32, wherein the step of preparing the condensate comprises mixing the reagent with the MED26 polypeptide or its active fragment in a buffer containing water.

34. The method according to claim 33, wherein the buffer solution further comprises polyethylene glycol (PEG).

35. The method according to claim 34, wherein the buffer solution contains 1 to 30% (w / v) PEG, for example 2 to 20% (w / v) PEG, for example 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% (w / v) PEG, preferably 10% (w / v).

36. The method according to any one of claims 20 to 35, wherein the step of preparing the condensate comprises mixing the reagent with 1 to 200 μM, preferably 5 to 150 μM, for example 5, 10, 25, 50, 75, 100, 125 or 150 μM, more preferably 10 μM of the MED26 polypeptide or its active fragment.