Genetic marker compositions and uses thereof

Abstract

The present invention discloses a tumor gene marker composition, a methylation detection reagent, a kit, and their use. Lung cancer samples can be distinguished by detecting the methylation level of the HOXB4 and SRCIN1 gene combination. The reagent of the present invention has been demonstrated to be capable of detecting and diagnosing lung cancer, and has clinical application value.

Description

[Technical field]

[0001] The present invention is in the biomedical field, and in particular relates to genetic marker compositions and uses thereof. [Background technology]

[0002] Lung cancer is a malignant tumor of the lung originating from the bronchial mucosa, gland, or alveolar epithelium. According to the pathological type, it can be classified as follows: 1) small cell lung cancer (SCLC): a special pathological type of lung cancer, with an obvious tendency to distant metastasis, poor prognosis, and most patients are sensitive to radiation therapy and chemotherapy. 2) non-small cell lung cancer (NSCLC): other pathological types of lung cancer other than small cell lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are some differences in biological behavior and clinical course. According to the location of origin, it can be classified as follows: 1) central lung cancer: lung cancer that grows in and above the segmental bronchial opening. 2) peripheral lung cancer: lung cancer that grows at a location far from the segmental bronchial opening.

[0003] In recent years, affected by factors such as population aging, air pollution, and smoking, the incidence and mortality of lung cancer in China has been increasing year by year. According to the "2017 China Cancer Registry Annual Report" published by the National Cancer Center, about 7 people are diagnosed with cancer every minute in China, ranking first in the incidence and mortality of lung cancer. China has become the country with the most lung cancer patients in the world, and experts predict that the number of lung cancer patients in China will reach 1 million by 2025. According to epidemiological studies, smoking is an important factor in causing lung cancer. Worldwide, about 80%-90% of lung cancer cases are caused by smoking. Compared with non-smokers, the relative risks of lung cancer incidence for those aged 45-64 who smoke 1-19 cigarettes and 20 or more cigarettes daily were 4.27 and 8.61, respectively, and compared with non-smokers, the relative risks of death from lung cancer for long-term smokers of 1-19 cigarettes and 20 or more cigarettes daily were 6.14 and 10.73, respectively. Although lung cancer treatment techniques have improved day by day, the 5-year survival rate has only improved from 4% to only about 12%. Existing anti-cancer drugs can only alleviate the disease, and the average progression-free survival of patients is only extended by 3 to 5 months, but for stage I lung cancer patients, the 5-year survival rate after surgery is high at 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer are one of the most effective ways to improve the 5-year survival rate of lung cancer and reduce the mortality rate.

[0004] Current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but none of them can completely achieve early detection and early diagnosis. (1) Blood biochemistry test There are currently no specific blood biochemistry tests for primary lung cancer. In lung cancer patients, elevated blood alkaline phosphatase or blood calcium should be considered as indications of bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, or bilirubin should be considered as indications of liver metastasis. (2) Tumor marker testing 1) CEA: 30%-70% of lung cancer patients have abnormally high serum CEA levels, but this is mainly seen in patients with advanced lung cancer. Currently, serum CEA testing is mainly used to estimate the prognosis of lung cancer and monitor the course of treatment. 2) NSE: It is the first-choice marker for small cell lung cancer, and is used to diagnose small cell lung cancer and monitor treatment response, with different reference values ​​depending on the detection method and reagent used. 3) CYFRA21-1: It is the first-choice marker for non-small cell lung cancer, and its diagnostic sensitivity for squamous cell carcinoma of the lung can reach 60%, with different reference values ​​depending on the detection method and reagent used. (3) Imaging tests 1) Chest X-ray examination: should include frontal and lateral chest X-rays. In primary hospitals, frontal and lateral chest X-rays remain the most basic and preferred imaging diagnostic method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT examination is performed. 2) CT examination: Chest CT is the most common and important lung cancer examination method used for the diagnosis and differential diagnosis of lung cancer, staging, and follow-up after treatment. CT-guided lung biopsy is an important diagnostic technique for lung cancer, and hospitals that can provide it can apply it to the diagnosis of intrapulmonary lesions that are difficult to qualify, cases where clinical diagnosis of lung cancer needs to be verified by cytology or histology, and materials are difficult to obtain by other methods. In recent years, multislice helical CT and low-dose CT (LDCT) are effective screening tools for early detection of lung cancer and reducing mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT can reduce lung cancer mortality by 20% compared with chest X-ray screening. Low-dose helical CT is recommended as an important method for early screening of lung cancer, but there are many human factors involved and the false positive rate is very high. 3) Ultrasound examination: It is mainly used to check for the presence or absence of metastasis to important abdominal organs, abdominal cavity, and retroperitoneal lymph nodes, and is also used to examine cervical lymph nodes. For intrapulmonary lesions or chest wall lesions adjacent to the chest wall, cystic nature can be identified and ultrasound-guided biopsy can be performed. Ultrasound is also often used to determine the location of pleural drainage. 4) Bone scan: It has a high sensitivity for detecting bone metastasis of lung cancer, but has a certain degree of false positive rate. It can be applied to preoperative examination of lung cancer and patients with local symptoms. (4) Other tests 1) Sputum cytology test: Currently, it is a simple non-invasive diagnostic method for lung cancer, and the positive rate can reach about 60% in serial smear tests, making it a common diagnostic method for suspected cases of lung cancer. 2) Fiberoptic bronchoscopy: It is one of the most important methods in lung cancer diagnosis, and plays an important role in the qualitative and localization diagnosis of lung cancer and the selection of surgical schemes, and is a necessary general examination item for patients undergoing surgical treatment. Although bronchial needle aspiration biopsy (TBNA) is advantageous for staging before treatment, it is technically difficult and has a high risk, so patients who require this test should be transferred to a higher-level hospital for further examination. 3) Others: Percutaneous lung biopsy, thoracoscopic biopsy, mediastinoscopic biopsy, pleural fluid cytology test, etc. can be used to assist in diagnosis when indicated, depending on the existing conditions.

[0005] Multislice helical CT and low-dose CT (LDCT) in imaging examinations are effective screening tools for early detection of lung cancer and reducing mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT can reduce lung cancer mortality by 20% compared with chest X-ray screening. It has been proven in clinical practice that the success or failure of lung cancer screening depends on the identification of high-risk groups. Risk prediction models integrating multiple high-risk factors have been recognized worldwide as one of the methods to identify high-risk groups for lung cancer. Risk models can further improve the therapeutic effect for lung cancer patients by assisting clinicians in improving interventions and treatment. Although it is recognized worldwide that screening of high-risk groups can reduce the current high lung cancer mortality rate, identifying high-risk groups remains a difficult problem to solve. To maximize the benefit-risk ratio of lung cancer screening, the key issues are, first, how to identify high-risk groups. Second, how to screen the population. The methods include identification of high-risk factors, quantification summary of the overall risk, and selection of screening benefit threshold.

[0006] With the rapid development of technology, tumor marker detection has become a new field of tumor diagnosis and treatment following image diagnosis and pathological diagnosis, which can have a great impact on tumor diagnosis, detection and treatment. Tumor markers can be detected in body fluids or tissues and can reflect the presence of tumors, the degree of differentiation, prognosis estimation, personalized medicine and treatment effects, etc. Early lung cancer patients have no obvious symptoms, which makes it difficult for doctors and patients to notice, and there are no obvious specific markers in blood and biochemical items, making early detection and early diagnosis difficult with traditional diagnostic methods. Therefore, early diagnosis of lung cancer, especially its application to large-scale mass screening, is relatively difficult.

[0007] More and more studies have revealed that two types of mechanisms are involved in the process of tumorigenesis. One is the genetic mechanism, i.e., mutations due to changes in DNA nucleotide sequences. Tumors have been demonstrated in the field of molecular biology as genetic diseases. The other is the epigenetic mechanism, i.e., changes in gene expression levels independent of changes in DNA sequences, and its role in the process of tumorigenesis has attracted more and more attention. The two mechanisms of genetics and epigenetics alternate and jointly promote tumor formation. Abnormal methylation of genes appears in the early stages of tumor formation, and the degree of abnormal methylation of genes increases during tumor progression. By analyzing the genomes of 98 common types of primary human tumors, we found that each tumor had at least 600 abnormally methylated CpG islands.

[0008] Many studies have shown that promoter abnormal methylation is a frequent early event in the development of many tumors, so the methylation status of tumor-associated genes is an early and highly sensitive indicator of tumor formation and is considered a promising tumor molecular biomarker. More importantly, cancer cells can release DNA into peripheral blood. Nanogram levels of free DNA are present in the peripheral blood of normal individuals. Research has found that promoter abnormal methylation of tumor-associated genes in tumor tissues can also be detected in peripheral blood plasma / serum and body fluids associated with tumor-associated organs (saliva, sputum, etc.). These biological samples are relatively easy to obtain, and the DNA in those samples can be detected with high sensitivity after amplified in large quantities by PCR technology. Therefore, detecting the methylation status of the promoter region of a specific tumor-associated gene can provide very valuable information for the early diagnosis of tumors. Compared with other types of tumor molecular markers, the detection of promoter abnormal methylation has more advantages. A specific gene has the same promoter abnormal methylation region in different types of tumors, so its detection is relatively convenient. Also, compared to markers such as allelic deletion, aberrant methylation is a positive signal and can be easily distinguished from the negative background of normal tissues. Esteller et al. detected aberrant methylation status in the promoter regions of genes such as p16, DAPK, GSTP1, and MGM T in tumor tissues and serum from 22 cases of non-small cell lung cancer (NSCLC), and found that promoter methylation of at least one gene was present in 68% (15 / 22) of tumor tissues, and in 11 of the 15 tissue-positive cases, promoter aberrant methylation was also detected in serum. Many researchers have also detected promoter methylation of certain tumor-related genes in tumor tissues and serum from patients with liver cancer, head and neck cancer, esophageal cancer, and colon cancer.

[0009] Conventional lung cancer detection technologies have problems such as low sensitivity, many false positives, and high invasiveness. In addition, current general detection technologies have difficulty detecting early-stage lung cancer.

[0010] Non-invasive detection of lung cancer, such as sputum detection, is more difficult. Tumor markers in the sputum of lung cancer patients have also been studied, but compared with the detection and evaluation of tumor markers in blood samples of other tumor patients, the success rate of sputum samples is very low. This is mainly due to the following reasons: (1) The composition of sputum is relatively complex, and different populations have large differences in sputum composition and viscosity under different diseases and environments. (2) Sputum contains many non-lung cancer cell components such as tracheal epithelial cells, bacteria, and oral mucosal cells, and general sample processing methods cannot effectively enrich a sufficient number of lung cancer-derived DNA. (3) Many smokers do not produce sputum. AJ Hubers et al., in "Molecular sputum analysis for the diagnosis of lung cancer," studied 10 previous papers and found that the median methylation level of markers in lung cancer tissue was 48%, while the median methylation level in sputum was 38%, indicating that the detection rate of methylation markers in tissues was significantly higher than that in sputum. In addition, Rosalia Cirincione's "Methylation profile in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case-contro" disclosed that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues were 65.5%, 41.4%, and 51.7%, respectively, while the detection rates in sputum were only 44.4%, 5%, and 5%. Summary of the Invention

[0011] One object of the present invention is to provide a genetic marker composition, a detection / diagnostic reagent for detecting the genetic marker composition, and uses thereof.

[0012] Meanwhile, the present invention provides a genetic marker composition, the genetic markers including HOXB4 and SCRIN1.

[0013] The genetic marker composition of the present invention also includes fragments of any length for each genetic marker, i.e., any combination of fragments (of any length) derived from HOXB4 and SCRIN1 is within the scope of protection of the present invention.

[0014] The HOXB4 gene is a member of the Antp homeobox gene family and belongs to the homeobox B cluster genes on chromosome 17. The HOXB4 gene encodes a nuclear protein with a homeobox DNA-binding domain, and the encoded protein functions as a sequence-specific transcription factor involved in development. Intracellular or ectopic expression of this protein expands hematopoietic stem and progenitor cells in vivo and in vitro, making it a potential candidate for therapeutic stem cell expansion.

[0015] SRCIN1 (SRC kinase signaling inhibitor 1) is a gene and protein that functions as a negative regulator of SRC and inhibits SRC activity and downstream signaling by activating CSK, impairing cell spreading and migration, regulating dendritic spine morphology, and participating in calcium-dependent exocytosis.

[0016] The present invention further provides a use of a multi-gene methylation combination detection reagent in the manufacture of a lung cancer detection reagent or kit, wherein the genes include HOXB4 and SCRIN1.

[0017] At present, the oversight rate of lung cancer is relatively high. In particular, in the case of adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is very low. This is because most adenocarcinomas are peripheral-type lung cancers that arise from small bronchi, and the exfoliated cells deep in the lungs are more difficult to be exhaled through sputum. Therefore, at present, the means of sputum detection of adenocarcinoma is almost zero.

[0018] In early tumor screening, it is very important to reduce the missed rate. If early tumor screening products cannot screen all or most patients, the missed patients will not be able to receive sufficient risk warnings, which will delay the timing of treatment and cause great losses to patients.

[0019] Although some tumor markers related to lung cancer have been found in the prior art, due to the limitations of the detection reagents or detection methods of these tumor markers, the sensitivity and specificity of these tumor markers cannot meet the requirements. Therefore, at present, the art needs to further research screening means that can be reliably applied to lung cancer. However, although non-invasive screening has unique advantages in sampling, it has some limitations in other aspects. For example, for adenocarcinoma of lung cancer, the cells that fall off deep in the lungs are difficult to be exhaled by sputum, so those skilled in the art generally believe that this type of lung cancer is not suitable for non-invasive screening. Meanwhile, for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements for clinical use. Although related research has been conducted for many years, there is still no non-invasive lung cancer screening method that can be applied to clinical practice.

[0020] The present invention further provides a multi-gene methylation combination detection reagent or kit, comprising a methylation detection reagent for HOXB4 and SRCIN1 genes.

[0021] "Methylation detection reagent" includes reagents that detect any smaller / short sequence of the gene or gene content, i.e., any detection and detection reagents for any site (e.g., smaller fragment) in the gene are all within the scope of protection of the present invention.

[0022] The genetic markers of the present invention, HOXB4 and SCRIN1, are detected in combination, ie several genetic markers of the present invention are detected simultaneously.

[0023] In this specification, "detection" and "diagnosis" are the same and include early diagnosis of lung cancer, as well as mid- and late diagnosis of lung cancer, and also lung cancer screening, risk assessment, prognosis, disease differentiation, diagnosis of disease stage, and selection of therapeutic targets.

[0024] The combination of lung cancer markers HOXB4 and SCRIN1 allows for early diagnosis of lung cancer. When it is confirmed that the methylated genes in cancer cells are methylated in clinically or morphologically normal cells, it indicates that the normally expressed cells have progressed to cancer. Therefore, lung cancer can be diagnosed early by the methylation of the lung cancer-specific HOXB4 and SCRIN1 gene combination in normally expressed cells.

[0025] Early diagnosis involves detecting the likelihood of cancer before metastasis, preferably before morphological changes in tissues or cells occur.

[0026] In addition to early diagnosis of lung cancer, the reagent / kit of the present invention can also be applied to lung cancer screening, risk assessment, prognosis, disease identification, stage diagnosis, and therapeutic target selection.

[0027] In an optional embodiment of the disease stage, the methylation degree of the HOXB4 and SCRIN1 gene combination obtained from the sample can be measured according to the progression of lung cancer at different stages or times. The specific stage of lung cancer in the sample can be determined by comparing the methylation degree of the HOXB4 and SCRIN1 gene combination of the nucleic acid isolated from the sample of each stage of lung cancer with the methylation degree of the HOXB4 and SCRIN1 gene combination of one or more nucleic acids isolated from the sample of tissue without abnormal cell proliferation.

[0028] Generally, a CpG island refers to a region containing a large amount of CpG dinucleotides, and is usually located in a promoter and its neighboring region. The detection site of methylation of the present invention includes not only a promoter and its neighboring region containing a large amount of CpG dinucleotides, but also a heteromethylated CpG site or an independent CpG site.

[0029] The methylation combination detection reagent of the HOXB4 and SCRIN1 gene combination may be a methylation detection reagent in the prior art. In the prior art, there are many methods that can detect the methylation of target genes, such as methylation-specific PCR (MSP), methylation-specific quantitative PCR (qMSP), PCR of methylated DNA specific binding protein, quantitative PCR and DNA chip, methylation-sensitive restriction endonuclease, bisulfite sequencing or pyrosequencing. Other methylation detection methods include the method described in patent US62007687. Each detection method has a corresponding reagent, and all of these reagents can be applied to the methylation detection of the HOXB4 and SCRIN1 gene combination of the present invention.

[0030] The present invention further provides a combination methylation detection reagent for the HOXB4 and SCRIN1 gene combination, comprising primers and / or probes for each gene in the HOXB4 and SCRIN1 gene combination.

[0031] Some specific embodiments of the invention include primers and / or probes directed against the CpG islands of each gene in the HOXB4 and SCRIN1 gene combination.

[0032] In some specific embodiments of the invention, the primers and / or probes detect methylation of each gene in the HOXB4 and SCRIN1 gene combination by quantitative methylation specific PCR (qMSP).

[0033] In some specific embodiments of the present invention, the methylation detection reagent provided by the present invention detects the methylation levels of the gene body, intergenic region, or promoter region and the neighboring region of the promoter region of each gene in the HOXB4 and SCRIN1 gene combination.

[0034] In some embodiments, the methylation detection reagent provided by the present invention comprises primers and / or probes directed against CpG islands in the promoter regions of each gene in the HOXB4 and SCRIN1 gene combination or in the regions adjacent to said promoter regions.

[0035] In some embodiments, in the methylation detection reagent provided by the present invention, the upstream primer in the methylation detection primer for the HOXB4 gene is I: a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleotide sequences set forth in SEQ ID NO:1, SEQ ID NO:16 and SEQ ID NO:19; and II: complementary sequence of the sequence shown in I; any one of the nucleotide sequences And / or, the downstream primer in the methylation detection primer for the HOXB4 gene is III: A nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleotide sequences set forth in SEQ ID NO:2, SEQ ID NO:17 and SEQ ID NO:20; and IV: the complement of the sequence shown in III; any one of the nucleotide sequences And / or, the upstream primer in the methylation detection primer for the SRCIN1 gene is V: a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleotide sequences set forth in SEQ ID NO:4 and SEQ ID NO:22; and VI: Complement of the sequence shown in V; any one of the nucleotide sequences And / or, the downstream primer in the methylation detection primer for the SRCIN1 gene is VII: a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleotide sequence set forth in SEQ ID NO:5; and VIII: the complement of the sequence shown in VII; The present invention includes any one of the nucleotide sequences.

[0036] In some embodiments, the methylation detection primer pair for the HOXB4 gene is shown in SEQ ID NO:1 and SEQ ID NO:2.

[0037] In some embodiments, the methylation detection primer pair for the HOXB4 gene is shown in SEQ ID NO:16 and SEQ ID NO:17.

[0038] The methylation detection primer pair for the HOXB4 gene is shown in SEQ ID NO:19 and SEQ ID NO:20.

[0039] In some embodiments, the methylation detection primer pair for the SRCIN1 gene is shown in SEQ ID NO:4 and SEQ ID NO:5.

[0040] In some embodiments, the methylation detection primer pair for the SRCIN1 gene is shown in SEQ ID NO:22 and SEQ ID NO:5.

[0041] In some embodiments, the HOXB4 gene methylation detection probe comprises: IX: a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleotide sequences set forth in SEQ ID NO:3, SEQ ID NO:18 and SEQ ID NO:21; and X: the complement of the sequence shown in IX; any one of the nucleotide sequences And / or, the methylation detection probe for the SRCIN1 gene is XI: a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleotide sequence set forth in SEQ ID NO:6; and XII: Complement of the sequence shown in XI; The present invention includes any one of the nucleotide sequences.

[0042] In some embodiments, the lung cancer is selected from small cell lung cancer and non-small cell lung cancer.

[0043] In some embodiments, the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.

[0044] The present invention further provides a kit for detecting lung cancer, comprising the above-mentioned combination methylation detection reagent.

[0045] In some embodiments, the kit provided by the present invention further includes a reagent commonly used in kits. For example, a conversion agent commonly used in qMSP converts unmethylated cytosine bases to uracil, but does not change methylated cytosine bases. The conversion agent is not particularly limited, and may be any reagent disclosed in the prior art that can achieve the conversion of cytosine to uracil, such as one or more of hydrazine salts, bisulfite salts, and hydrogen sulfite salts (e.g., sodium pyrosulfite, potassium hydrogen sulfite, cesium hydrogen sulfite, ammonium hydrogen sulfite, etc.). In addition, a DNA polymerase, dNTPs, Mg, etc., which are commonly used in gene amplification, may be used. 2+ These include ions and buffer solutions.

[0046] In some embodiments, the reagent or kit further comprises a detection reagent for an internal standard gene.

[0047] In some embodiments, the internal control gene is β-actin.

[0048] In some embodiments, the detection reagent for the internal standard gene is a primer and a probe for the internal standard gene.

[0049] In some embodiments, the detection reagent for the internal standard gene is the primer pair shown in SEQ ID NO:13 and SEQ ID NO:14 and the probe shown in SEQ ID NO:15.

[0050] The present invention provides the use of a combined HOXB4 and SCRIN1 gene methylation detection reagent in the manufacture of a lung cancer detection reagent or kit.

[0051] The present invention provides a primer, which is at least one selected from the following nucleotide sequences having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:22, or a complementary sequence thereof.

[0052] The present invention provides a primer, which is at least one selected from a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:5, or a complementary sequence thereof.

[0053] In some embodiments, the primers are selected from at least one primer pair set forth in SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5. In some embodiments, the primers are selected from the primer pairs set forth in SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5.

[0054] The primers are used to amplify the nucleic acid fragment. In the art, successful design of primers is crucial for PCR. In contrast to general PCR, the impact of primer design is more important in methylation detection. This is because methylthiolation converts "C" in the DNA strand to "U", reducing the GC content, and forming long and continuous "T" in the sequence after PCR reaction, which is likely to cause DNA strand breakage, making it difficult to select a primer with an appropriate Tm value and stability. Meanwhile, in order to distinguish between thiolated DNA, non-thiolated DNA, and incompletely treated DNA, the primer must have a sufficient number of "C". This also makes it more difficult to select a stable primer. Therefore, in DNA methylation detection, the selection of the amplified fragment for the primer (e.g., the length and position of the amplified fragment) and the selection of the primer all affect the sensitivity and specificity of detection. The present inventors have found through experiments that there are differences in the detection effects of different amplified fragments and primers. In many cases, the expression of certain genes or nucleic acid fragments has been found to be different between tumors and non-tumors, but there is still a long way to go before they can be used as tumor markers in clinical practice. The main reason is that the detection reagents are limited, so the detection sensitivity and specificity of these potential tumor markers are difficult to meet the detection requirements, or the detection methods are complicated and expensive, making large-scale clinical application difficult.

[0055] In another aspect, the present invention further provides a nucleic acid probe, which is at least one selected from the following nucleotide sequences having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the sequences shown in SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:18, and SEQ ID NO:21, or their complementary sequences.

[0056] In a preferred embodiment of the invention, the nucleic acid probe is selected from the sequences shown in SEQ ID NO:3 and SEQ ID NO:6.

[0057] In some embodiments, the kits provided herein include a first container that contains a primer pair for amplification and a second container that contains a probe.

[0058] In some embodiments, the kit further comprises instructions.

[0059] In some embodiments, the kit further comprises a nucleic acid extraction reagent.

[0060] In some embodiments, the kit further comprises a sampling device.

[0061] The present invention provides use of a methylation detection reagent, kit, primer, or probe in the manufacture of a methylation detection reagent or kit, or a lung cancer detection reagent or kit.

[0062] The present invention further provides use of said methylation detection reagent, kit, primers and probe in methylation detection or lung cancer detection.

[0063] The present invention further provides a lung cancer detection system, comprising: (1) a methylation combination detection section for the HOXB4 and SRCIN1 genes; (2) a data processing unit; (3) a result output unit; Includes.

[0064] In some embodiments, the methylation detection component comprises a methylation detection instrument.

[0065] In some embodiments, the methylation detection unit further comprises the methylation combination detection reagent, kit, primer, or probe.

[0066] In some embodiments, the methylation detection instrument comprises one or more of a fluorescent quantitative PCR instrument, a PCR instrument, and a sequencer.

[0067] In some embodiments, the data processing unit comprises a data processing device.

[0068] The data processing device includes any facility, equipment or device capable of processing data available to those skilled in the art.

[0069] In some embodiments, the data processing device comprises one or more of the following: a calculator, a computer.

[0070] The computer is equipped with any software or program capable of processing or statistically analyzing data that can be used by one of ordinary skill in the art.

[0071] In some embodiments, the computer comprises a computer equipped with one or more of the following software: SPSS, SAS, Excel.

[0072] In some embodiments, the result output section includes a result output device.

[0073] The output device includes any facility, equipment or device capable of displaying a data processing result as readable content.

[0074] In some embodiments, the methylation detection unit further comprises a multigenic methylation combination detection reagent.

[0075] In some embodiments, the results output device includes one or more of the following: a screen, a paper report.

[0076] In some embodiments, the data processing device is configured to: a. receive test data of a detection sample and a normal control sample; b. store the test data of the detection sample and the normal control sample; c. compare the test data of the detection sample and the normal control sample of the same type; and d. determine the probability or likelihood that the subject is affected by lung cancer based on the comparison result.

[0077] In some embodiments, the result output unit outputs the probability or likelihood of the subject having lung cancer.

[0078] In some embodiments, the criterion of the data processor is to judge the lung cancer samples and the normal samples based on a threshold value.

[0079] In some embodiments, the combined detection of HOXB4 and SRCIN1 of the present invention can be achieved by multiplex PCR.

[0080] In some embodiments, the Cp value and / or ΔCp value (ΔCp value=Cp 標的遺伝子 -Cp 内部標準遺伝子 ) to determine the methylation level of the sample.

[0081] In some embodiments, if the ΔCp value of one of the genes in the tissue sample is lower than the limit value of the ΔCp value, it is determined to be a lung cancer sample, and if the ΔCp values ​​of both of the genes in the tissue sample are equal to or greater than the limit value of the ΔCp value, it is determined to be a normal sample.

[0082] In some embodiments, the limit range of Cp values ​​in the samples is 35-39, and the limit range of ΔCp values ​​is 4-12.

[0083] In some embodiments, for combined detection of HOXB4 and SRCIN1, the threshold ΔCp value for HOXB4 is 5.4 and the threshold ΔCp value for SRCIN1 is 6.5 in tissue samples.

[0084] In some embodiments, for the combined detection of HOXB4 and SRCIN1, the threshold line Cp values ​​of HOXB4 and SRCIN1 in sputum samples are 36.9 and 37.0, respectively. If one of the single gene detection results is lower than the threshold, it can be judged as positive (i.e., lung cancer sample), and if the results of two of the detection results are both equal to or higher than the corresponding threshold, it can be judged as negative (i.e., normal sample).

[0085] In some embodiments, for multiplex PCR detection of HOXB4 and SRCIN1, the cutoff Cp value in sputum samples is 36.7, the cutoff Cp value in lavage samples is 37.2, and the cutoff ΔCp value is 9.

[0086] In some embodiments, in the multiplex PCR detection of HOXB4 and SRCIN1, if the Cp value in the sputum sample is lower than the limit Cp value, it is determined as a lung cancer sample, and if the Cp value in the sputum sample is equal to or greater than the limit Cp value, it is determined as a normal sample.

[0087] In some embodiments, in multiplex PCR detection of HOXB4 and SRCIN1, if either the Cp value or the ΔCp value in the lavage fluid sample is lower than the Cp value and ΔCp limit value, the sample is determined to be a lung cancer sample, and if both the Cp value and the ΔCp value in the lavage fluid sample are equal to or greater than the Cp value and ΔCp limit value, the sample is determined to be a normal sample.

[0088] In some embodiments, the tumor is a lung cancer.

[0089] In some embodiments, the tumor is small cell lung cancer or non-small cell lung cancer.

[0090] In some embodiments, the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.

[0091] In some embodiments, the detection sample or sample type is at least one selected from bronchoalveolar lavage fluid, tissue, pleural fluid, sputum, blood, serum, plasma, urinary fluid, prostatic fluid, or feces.

[0092] In some embodiments, the sample according to the present invention is at least one selected from bronchoalveolar lavage fluid, tissue, and sputum.

[0093] In some embodiments, the sample according to the present invention is at least one selected from bronchoalveolar lavage fluid or sputum.

[0094] The present invention further provides a method for diagnosing lung cancer, comprising the steps of: Step (1): Detecting the methylation levels of the HOXB4 and SRCIN1 genes in a detection sample derived from a subject; Step (2): Comparing the methylation levels of the HOXB4 and SRCIN1 genes between the detection sample and the normal control sample; Step (3): Diagnose lung cancer based on the deviation in methylation levels between the detection sample and the normal control sample.

[0095] In some embodiments, the present invention provides a method for diagnosing lung cancer, the method comprising the following steps (1) to (3): step (1): detecting the methylation levels of HOXB4 and SRCIN1 genes in a detection sample derived from a subject, the detection being performed by contacting the detection sample with a detection reagent for detecting the methylation levels of HOXB4 and SRCIN1 genes, step (2): comparing the methylation levels of HOXB4 and SRCIN1 genes in the detection sample and a normal control sample, and step (3): diagnosing lung cancer based on a difference in the methylation levels between the detection sample and the normal control sample.

[0096] In some embodiments, the present invention provides a method for diagnosing lung cancer, which includes the steps of: adding a gene methylation detection reagent to a detection sample derived from a subject, detecting the methylation levels of HOXB4 and SRCIN1 genes in the detection sample, comparing the methylation levels of HOXB4 and SRCIN1 genes in the detection sample with those in a normal control sample, and diagnosing lung cancer based on the difference in the methylation levels between the detection sample and the normal control sample.

[0097] In some embodiments, the deviation in step (3) refers to a deviation in the methylation level of any one of two genes, HOXB4 and SRCIN1.

[0098] In some embodiments, in step (1), the detecting comprises contacting a detection sample of the subject with a detection reagent for detecting methylation levels of the HOXB4 and SRCIN1 genes.

[0099] In some embodiments, the methylation levels of the HOXB4 and SRCIN1 genes are detected by methylation-specific quantitative PCR (qMSP).

[0100] In some embodiments, the methylation results of the detection sample and the normal sample are compared based on the results, and if there is a significant or very significant difference in methylation between the detection sample and the normal sample, the detection sample is determined to have a high risk of disease.

[0101] The diagnostic methods of the invention can be used before, after or in conjunction with lung cancer treatment, such as to assess the success of treatment or to monitor remission, recurrence and / or progression (including metastasis) of lung cancer after treatment.

[0102] Also provided is a method for treating lung cancer, comprising the steps of: (1) administering to a patient a therapeutically effective amount of a compound selected from the group consisting of 1) a pulmonary sarcoma; Step (1): Detecting the methylation levels of the HOXB4 and SRCIN1 genes in a detection sample derived from a subject; Step (2): Comparing the methylation levels of the HOXB4 and SRCIN1 genes between the detection sample and the normal control sample; Step (3): Diagnosing lung cancer based on the difference in methylation levels between the detection sample and the normal control sample; Step (4): Administer a lung cancer therapeutic drug to the subject diagnosed with lung cancer.

[0103] In another aspect of the present invention, a method for treating lung cancer is provided, comprising administering to a patient diagnosed with lung cancer by the diagnostic method, surgery, chemotherapy, radiation therapy, radiochemotherapy, immunotherapy, oncolytic virus therapy, other types of lung cancer treatment methods used in the art, or a combination of these treatment methods.

[0104] In the present invention, through research, it has been found that in some specific embodiments, by detecting the combination of HOXB4 and SRCIN1 genes, lung cancer samples can be well distinguished from samples, and the detection sensitivity and specificity for lung cancer are very high. [Brief description of the drawings]

[0105] [Figure 1] 1 shows ROC curves obtained detecting different marker compositions in tissue samples. [Diagram 2] 1 shows ROC curves obtained detecting different marker compositions in sputum samples. [Diagram 3] 1 shows the amplification curves obtained by detecting the combination of HOXB4 and SRCIN1 in the lavage fluid samples. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0106] The technical means of the present invention will be further described below by way of specific examples. The specific examples do not limit the scope of protection of the present invention. Non-essential modifications and adjustments made by those skilled in the art based on the concept of the present invention are also included in the scope of protection of the present invention.

[0107] In the present invention, a "primer" or a "probe" refers to an oligonucleotide that comprises a region complementary to a sequence of at least 6 consecutive nucleotides of a target molecule (e.g., a target nucleic acid fragment). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the sequence to be amplified. In some embodiments, the primer or probe comprises a region complementary to a sequence of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the target molecule. When a primer or probe comprises a region "complementary to at least x consecutive nucleotides of the target molecule," the primer or probe is complementary to at least 95% of at least x consecutive or non-consecutive blocked nucleotides of the target molecule. In some embodiments, the primer or probe is complementary to at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the target molecule.

[0108] In the present invention, a "normal" sample refers to a sample of the same type isolated from an individual known to be free of said cancer or tumor.

[0109] Methylation detection samples of the present invention include, but are not limited to, DNA, RNA, mRNA-containing DNA and RNA samples, or DNA-RNA hybrids. DNA or RNA may be single-stranded or double-stranded.

[0110] In the present invention, the "subject" is a mammal, for example a human.

[0111] In the present invention, "methylation level" is synonymous with "degree of methylation" and can usually be expressed as a percentage of methylated cytosines, which is the number of methylated cytosines divided by the sum of the number of methylated cytosines and the number of unmethylated cytosines. Currently, the methylation level is generally expressed by dividing the number of methylated target genes by the number of internal reference genes. Other methods of expressing the methylation level in the prior art may also be used.

[0112] In the present invention, the term "sample" is synonymous with the term "specimen."

[0113] The term "and / or" as used herein refers to any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and / or" indicates that any one of the listed items can be used alone, or any combination of the two or more listed items can be used. For example, if a composition, combination, structure, etc. is described as including (or containing) components A, B, C, and / or D, the composition can include and be used with A alone, B alone, C alone, D alone, a combination of A and B, a combination of A and C, a combination of A and D, a combination of B and C, a combination of B and D, a combination of C and D, a combination of A, B and C, a combination of A, B and D, a combination of A, C and D, a combination of B, C and D, or a combination of A, B, C and D.

[0114] Example 1 The present inventors screened hundreds of genes in tissue samples and compared the detection results of two combinations of HOXB4, SRCIN1, PCDHGA12, and HOXD8 genes using the β-actin gene as an internal standard gene. The detection primers and probes for each gene are as follows.

[0115] Primers and probes for HOXB4 detection: SEQ ID NO: 1 HOXB4-F1 Primer F: TTCGTTTTCGTTATCATTC SEQ ID NO: 2 HOXB4-R1 Primer R: TACTAACCGCCTCGCTAC SEQ ID NO: 3 HOXB4-P1 Probe P: FAM-CGGGTTTTTGCGTCGTTATTCGTC-BQ1

[0116] Primers and probes for detecting SRCIN1: SEQ ID NO: 4 SRCIN1 Primer F: TCGTGTGTCGTCGTTCAGAC SEQ ID NO: 5 SRCIN1 primer R: GAAATATCCGCGAAAATACTG SEQ ID NO: 6 SRCIN1 Probe P: FAM-AGTTTTACGTTGGAGAAGCGTCGG-BQ1

[0117] Detection primers and probes for PCDHGA12: SEQ ID NO: 7 PCDHGA12 Primer F: TTGGTTTTTACGGTTTTCGAC SEQ ID NO: 8 PCDHGA12 Primer R: AAATTCTCCGAAACGCTCG SEQ ID NO: 9 PCDHGA12 Probe P: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

[0118] Primers and probes for HOXD8 detection: SEQ ID NO: 10 HOXD8 Primer F: TTAGTTTCGGCGCGTAGC SEQ ID NO: 11 HOXD8 primer R: CCTAAAACCGACGCGATCTA SEQ ID NO: 12 HOXD8 Probe P: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

[0119] Primers and probes for detection of β-actin: SEQ ID NO: 13 β-actin Primer F: GGAGGTTTAGTAAGTTTTTGGATT SEQ ID NO: 14 β-actin Primer R: CAATAAAACCTACTCCTCCCTTA SEQ ID NO: 15 β-actin Probe P: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

[0120] Experimental process 1. DNA extraction Samples from patients diagnosed with lung cancer and non-lung cancer patients (including paraffin tissue samples, sputum samples, and lavage fluid samples, respectively) were collected. After pretreatment of the samples and cell isolation, DNA was extracted according to the instructions of the kit (HiPure FFPE DNA Kit (D3126-03)) manufactured by Mikal Biosciences.

[0121] 2, DNA modification ZYMO RESEARCH biological company's EZ DNA Methylation Kit TM Bisulfite modification was performed according to the instructions of the KIT (D5002).

[0122] 3. Amplification and detection [Table 1]

[0123] Amplification systems: Amplification systems for detecting genes are shown in Tables 2 and 3.

[0124] [Table 2]

[0125] [Table 3]

[0126] 4. Detection results Sample information There were a total of 169 lung tissue samples, including 91 normal tissue samples and 78 cancer tissue samples. Of the 78 cancer group samples, there were 27 squamous cell carcinomas, 38 adenocarcinomas, 3 small cell carcinomas, 4 large cell carcinomas, 1 composite cancer, and 5 cases of unclassified lung cancer, of which there were 77 pairs of tumor and peritumoral control samples.

[0127] ACTB was used as an internal standard gene, and the △Cp value of the target genes HOXB4 and SRCIN1 (△Cp value = Cp 標的遺伝子 -Cp ACTB ) to determine the methylation level of the samples. The threshold lines for HOXB4 and SRCIN1 were ΔCp value = 5.4 and ΔCp value = 6.5, respectively. If one of the detection results is lower than the above threshold, it can be judged as positive, and if both of the detection results are equal to or higher than the corresponding threshold, it can be judged as negative.

[0128] The threshold line for PCDHGA12 was Cp value = 25.9, and the threshold line for HOXD8 was Cp value = 27.4. When the detection result of each marker is equal to or higher than the corresponding threshold line, it can be determined as negative, and when the detection result of the marker is lower than the corresponding threshold line, it can be determined as positive.

[0129] The ROC curves obtained by detecting the combinations of HOXB4 and SRCIN1, HOXB4 and PCDHGA12, and HOXB4 and HOXD8 in all tissue samples are shown in Figure 1. The detection statistics for each gene in each tissue are shown in Table 3.

[0130] [Table 4]

[0131] As can be seen from the above results, the combined detection of HOXB4 and SRCIN1 in tissue samples had a specificity of 97.8% and a sensitivity of 89.7% when comparing the normal group and the total cancer group. Compared with the combined detection of the other two groups, the combined detection of HOXB4 and SRCIN1 had a higher sensitivity when the specificity was consistent. In addition, the combined detection of HOXB4 and SRCIN1 unexpectedly significantly improved the sensitivity compared with the single detection of HOXB4 and SRCIN1.

[0132] As can be seen from the above results, HOXB4 and SRCIN1 had high specificity and relatively high sensitivity in tissue samples. In particular, the combined detection greatly improved the sensitivity without affecting the specificity. Sputum is an important non-invasive detection sample in the diagnosis of lung cancer. Therefore, the inventors detected two markers, HOXB4 and SRCIN1, in sputum.

[0133] Example 2: Detection of HOXB4 and SRCIN1 genes in sputum Sample information: There were a total of 107 test sputum samples, including 51 normal control samples and 56 cancer group samples. The 56 cancer group samples included 20 cases of squamous cell carcinoma, 8 cases of small cell carcinoma, 20 cases of adenocarcinoma, 1 case of large cell carcinoma, 1 case of giant cell carcinoma, and 6 cases of lung cancer not clearly classified.

[0134] Testing process Sputum samples were collected from patients diagnosed with lung cancer and non-lung cancer patients, thinned with NaOH, centrifuged to remove precipitated cells, washed twice with PBS, and then DNA was extracted using Magen's DNA extraction kit (HiPure FFPE DNA Kit, D3126-03). b. Bisulfite modification of DNA was performed using a DNA conversion kit from ZYMO RESEARCH biological company (EZ DNA Methylation Kit, D5002). c. The primer and probe sequences for each gene marker, the reaction mixture composition, and the amplification system were the same as those in Example 1. d. The methylation level of the sample was determined based on the Cp values ​​of the target genes HOXB4 and SRCIN1, and the threshold line Cp values ​​of HOXB4 and SRCIN1 were 36.9 and 37.0, respectively. If one of the single gene detection results is lower than the threshold, it can be determined as positive, and if both of the detection results are equal to or higher than the corresponding threshold, it can be determined as negative. PCDHGA12, HOXD8: The threshold line of PCDHGA12 was Cp value = 23.48, and the threshold line of HOXD8 was Cp value = 26.4. When the detection result of each marker is equal to or higher than the corresponding threshold line, it can be judged as negative, and when the detection result of the marker is lower than the corresponding threshold line, it can be judged as positive. e. The detection results are shown below.

[0135] [Table 5]

[0136] The ROC curves obtained by detecting HOXB4 and SRCIN1 in sputum samples are shown in Figure 2, and the statistical results are shown in Table 4. As can be seen from the above results, in sputum samples, the combined detection of HOXB4 and SRCIN1 had a sensitivity of 76.8% for lung cancer when compared with the normal group and the total cancer group, and a sensitivity of 100% when compared with the normal group and the total small cell carcinoma group. For single gene markers, the detection rate of HOXB4 was 64.3%, and the detection rate of SRCIN1 was 48.2%, and the combined detection of the two improved the sensitivity to lung cancer to 76.8%, and the two played a synergistic effect.

[0137] Example 3: Optimization of the multiplex PCR system for HOXB4 and SRCIN1 genes The above results show that the combined detection of HOXB4 and SRCIN1 genes can significantly improve the detection rate of lung cancer. The present inventors simplified the detection process by optimizing the PCR system using multiplex PCR method, and verified it based on the sample of Example 2. The detection primers and probes for each gene are as follows:

[0138] The detection primer and probe sequences for HOXB4, SRCIN1 and β-actin were the same as in Example 1. a. Sputum sample processing was the same as in Example 2. b. The reaction mixture composition is shown in the table below.

[0139] [Table 6]

[0140] c. The amplification system was similar to that shown in Table 2 of Example 1. d. The methylation level of the sample was determined based on the Cp value of multiplex PCR of the target genes HOXB4 and SRCIN1. The threshold line Cp value detected by multiplex PCR of HOXB4 and SRCIN1 was 36.7. If one of the single gene detection results is lower than the threshold, it can be judged as positive, and if the detection result is equal to or higher than the threshold, it can be judged as negative. e. The detection results are shown in Table 6 below.

[0141] [Table 7]

[0142] As can be seen from the results, the detection results of the HOXB4 and SRCIN1 multiplex PCR system were almost identical to those of Example 2. This multiplex PCR system detection result indicates that the combination of HOXB4 and SRCIN1 genes can be used to determine the lung cancer detection result.

[0143] Example 4: Detection of HOXB4 and SRCIN1 genes in lavage fluid Sample information A total of 387 bronchoalveolar lavage fluid samples were tested, including 303 normal control samples and 84 cancer control samples. The 84 cancer control samples included 21 squamous cell carcinomas, 40 adenocarcinomas, 10 small cell carcinomas, and 13 unknown lung cancer types.

[0144] The detection primer and probe sequences for HOXB4, SRCIN1, and β-actin were the same as those in Example 1.

[0145] Testing process a. Bronchoalveolar lavage fluid samples were collected from patients diagnosed with lung cancer and non-lung cancer patients, the cells were centrifuged, and then DNA was extracted using a DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) manufactured by Mikal Biological Products Co., Ltd. b. Bisulfite modification of DNA was performed using a DNA conversion kit from ZYMO RESEARCH biological company (EZ DNA Methylation Kit, D5002). c. The reaction mixture and amplification system were the same as in Example 3. d. The detection results are shown below. ACTB was used as an internal standard gene to measure the Cp and △Cp values ​​of the target genes HOXB4 and SRCIN1 (△Cp value = Cp 標的遺伝子 -Cp ACTB ) to determine the methylation level of the samples. The threshold lines for HOXB4 and SRCIN1 were Cp value = 37.2 and △Cp value = 9. If one of the detection results was lower than the above threshold, it was judged as positive, and if the results of two of the detection results were both above the threshold, it was judged as negative. The detection results of 387 lavage fluid samples are shown in the table below.

[0146] [Table 8]

[0147] The amplification curves of the combination of HOXB4 and SRCIN1 detected in all lavage samples are shown in Figure 3, and the statistical results are shown in Table 7. As can be seen from the above results, the combination of HOXB4 and SRCIN1 detection reached a sensitivity of 77.4% with a high specificity of 96.0%. Comparative analysis according to lung cancer subtypes showed that the detection rate of the combination of HOXB4 and SRCIN1 was 71.4% in the squamous cell carcinoma group. In particular, in terms of the detection effect on adenocarcinoma, the sensitivity of the combination of HOXB4 and SRCIN1 was as high as 75.0%, which has significant significance for the detection of adenocarcinoma. Adenocarcinoma is generally of the peripheral type, and due to the physiological structure of the bronchial tree, the alveolar lavage fluid is unlikely to come into contact with the alveoli or cancer tissue deep in the lungs.

[0148] Example 5: Detection results of different marker combinations in sputum samples We compared the detection status of different marker combinations in sputum samples. The comparison groups were as follows: Combination 1: HOXB4+SRCIN1 Combination 2: HOXB4+PCDHGA12 Combination 3: SRCIN1+PCDHGA12 Combination 4: HOXB4+HOXD8 Combination 5: SRCIN1+HOXD8 Combination 6: SRCIN1+PCDHGA12+HOXD8 Combination 7: SRCIN1+HOXB4+HOXD8

[0149] The specific experimental conditions and procedures were the same as those in Example 2. Different marker combinations were detected in 107 sputum samples, including 51 normal control samples and 56 cancer samples, and the detection results for each combination are shown in Table 8.

[0150] [Table 9]

[0151] As can be seen from the results in Table 8, the combination of different markers had a relatively large effect on the detection rate of lung cancer in sputum samples. Analysis of combination 1, combination 2, combination 3, combination 4 and combination 5 showed that there was a large difference in the detection results between the combinations of different marker pairs. In combination 1, the specificity was 92.2% and the sensitivity was 76.8% by combining HOXB4 and SRCIN1 for detection, and the overall detection performance was much higher than that of the other four combinations. Analysis of combination 3, combination 5, combination 6 or combination 1 and combination 7 showed that adding markers does not necessarily improve the detection rate and may even lead to a decrease in specificity. As can be seen from the results, not all gene marker combinations can achieve the optimal overall effect of the three indicators of sensitivity, specificity and AUC, as in combination 1 of the present invention. Unexpectedly, even if the number of target gene markers is increased for combination detection (e.g., combinations 6 and 7), the specificity and sensitivity were not correspondingly improved.

[0152] Example 6: Selection of primer-probe combinations Primers and probes also have a significant impact on the detection effect of tumor markers. In order to find probes and primers that can improve detection sensitivity and specificity as much as possible so that the detection reagent of the present invention can be practically applied to clinical detection, the present inventors designed multiple pairs of primers and corresponding probes in the course of research. Different primer-probe combinations were detected in 40 sputum samples, including 15 normal control samples and 25 cancer control samples.

[0153] [Table 10]

[0154] The reaction mixtures and the amplification processes were the same as in Example 2. The detection results are shown in Tables 10 and 11.

[0155] [Table 11]

[0156] [Table 12]

[0157] As can be seen from the above results, different primer pairs of the same region affect the detection results. When the specificity is consistent, the primer-probe combinations of HOXB-F1, HOXB-R1, HOXB-P1 and SRCIN1-F1, SRCIN1-R1, SRCIN1-P1 have higher sensitivity.

Claims

1. A multi-gene methylation combination detection kit comprising a HOXB4 gene methylation detection reagent and a SRCIN1 gene methylation detection reagent, The reagent for detecting methylation of the HOXB4 gene comprises a first primer pair and a first probe, the first primer pair is a combination of a first upstream primer having a nucleotide sequence shown in SEQ ID NO: 1 and a first downstream primer having a nucleotide sequence shown in SEQ ID NO: 2; The first probe is a nucleotide sequence shown in SEQ ID NO:3, The reagent for detecting methylation of the SRCIN1 gene comprises a second primer pair and a second probe; the second primer pair is a combination of a second upstream primer having a nucleotide sequence shown in SEQ ID NO: 4 and a second downstream primer having a nucleotide sequence shown in SEQ ID NO: 5; The second probe is a nucleotide sequence shown in SEQ ID NO:

6.

2. The kit according to claim 1 , which is used to detect lung cancer in a subject.

3. The kit of claim 2 , wherein the lung cancer is small cell lung cancer or non-small cell lung cancer.

4. The kit of claim 2, wherein the lung cancer is squamous cell carcinoma or adenocarcinoma.

5. A method for determining a risk of lung cancer in a subject in vitro, comprising: Detecting the methylation levels of HOXB4 and SRCIN1 genes in a sample derived from a subject by the multi-gene methylation combination detection kit according to any one of claims 1 to 4; comparing the methylation levels of HOXB4 and SRCIN1 genes between the sample and a normal control sample; determining the subject's risk of developing lung cancer based on a difference in methylation level between the sample and a normal control sample; The sample is at least one selected from the group consisting of bronchoalveolar lavage fluid, lung cancer tissue, and sputum, The criterion is to judge the lung cancer samples and the normal samples based on the limit value or threshold line Cp value; In a lung cancer tissue sample, if the ΔCp value of one of the genes in the lung cancer tissue sample is lower than the limit value of the ΔCp value, it is determined to be a lung cancer sample; if the ΔCp values ​​of both of the genes in the tissue sample are equal to or higher than the limit value of the ΔCp value, it is determined to be a normal sample; the limit value of the ΔCp value of HOXB4 in the lung cancer tissue sample is 5.4, and the limit value of the ΔCp value of SRCIN1 is 6.5; In sputum samples, the threshold line Cp values ​​of HOXB4 and SRCIN1 are 36.9 and 37.0, respectively. If one of the single gene detection results is lower than the threshold line Cp value, it is determined to be a lung cancer sample; if two of the detection results are both equal to or higher than the corresponding threshold line Cp value, it is determined to be a normal sample; For multiplex PCR detection of HOXB4 and SRCIN1, the limiting Cp value in sputum samples was 36.7, the limiting Cp value in lavage samples was 37.2, and the limiting ΔCp value was 9; If the Cp value in the sputum sample is lower than the Cp value limit, it is determined to be a lung cancer sample, and if the Cp value in the sputum sample is equal to or greater than the Cp value limit, it is determined to be a normal sample; If either the Cp value or the ΔCp value in the washing solution sample is lower than the limit value of the Cp value or the ΔCp value, the washing solution sample is determined to be a lung cancer sample, and if both the Cp value and the ΔCp value in the washing solution sample are equal to or higher than the limit value of the Cp value or the ΔCp value, the washing solution sample is determined to be a normal sample; wherein, when ACTB is used as an internal standard gene and HOXB4 and / or SRCIN1 are used as target genes, ΔCp value=Cp target gene−Cp internal standard gene.

6. The method of claim 5, wherein the methylation levels of the HOXB4 and SRCIN1 genes are detected by methylation-specific quantitative PCR (qMSP).

7. The method of claim 5, wherein the sample is bronchoalveolar lavage fluid or sputum.

Images