Anti-varicella zoster virus antibodies and uses thereof

Abstract

The present invention relates to antibodies against Varicella-Zoster virus, nucleic acid molecules encoding said antibodies, expression vectors comprising said nucleic acid molecules, host cells comprising said nucleic acid molecules or vectors, methods for producing and purifying said antibodies, and uses of said antibodies.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to Chinese Patent Application No. 202110259834.4, filed on March 10, 2021, the entire contents of which are incorporated herein by reference in their entirety. [Technical field]

[0002] The present invention relates generally to the field of genetic engineering and antibody pharmaceuticals, and specifically to the field of anti-varicella zoster virus antibodies and their uses. The present invention develops novel anti-varicella zoster virus antibodies and provides the use of the antibodies in the prevention or treatment of chickenpox and shingles. [Background technology]

[0003] Varicella zoster virus (VZV) is an enveloped DNA virus belonging to the alpha subfamily of the Herpesvirus genus. VZV is the smallest human herpesvirus, with a genome length of approximately 125,000 bp and more than 70 open reading frames encoding various proteins (Davison, AJ, and JE Scott. 1986). VZV has at least six surface glycoproteins, such as gB (gp II), gC (gp IV), gE (gp I), gH (gp III), gI, and gL. Glycoproteins gE, gB, and gH are highly abundant on the membrane of infected cells, and the antibodies they induce can neutralize the virus (Davison, AJ, CM Edson. 1986). Glycoprotein gE is the most abundantly expressed protein in VZV-infected cells, and binds non-covalently to gI protein and the Fc fragment of immunoglobulin IgG. The gB protein, which is the target of neutralizing antibodies, functions in the process of virus entry into host cells, and the amino acid sequence of gB is highly conserved between VZV and herpes simplex virus-1 (HSV-1) (Kapsenberk, JG 1964). The gH protein mediates fusion of the viral envelope with the cell membrane and between the cell membrane, facilitating cell-to-cell spread, and co-expression of gH and gL results in glycosylation and transport to the cell surface (Forghani, B., L. Ni, and C. Grose. 1994).

[0004] VZV infects human diploid cells and melanoma cells, and can replicate in VERO cells and primary African green monkey kidney cells. VZV binds to heparin sulfate proteoglycans on the cell surface and then enters the cell by binding to a second low-affinity receptor, expressing viral proteins in the infected cells and forming multinucleated giant cells (Zhu, Z., MD Gershon. 1995). Many virus particles are retained in cytoplasmic vacuoles, and they rarely release free virus outside the cell.

[0005] VZV has only one serotype and limited genetic diversity, which does not affect its infectivity and virulence. VZV infection is highly species specific, has no animal reservoir, and does not cause disease in some non-human primates and small animals such as guinea pigs (Chen, J. 2003) and rats (Sadzot-Delvaux. 1990), although it can infect these animals. Humans are the only known natural host, and the skin is the primary target organ for the virus. VZV can be transmitted through droplets or contact, and primary infection in children mainly causes chickenpox. Chickenpox is endemic in temperate regions and often occurs in winter and spring. Chickenpox infection confers lifelong immunity, and secondary infection is rare (Gershon, AA1984). VZV remaining in the infected body can travel retrograde along the sensory axons, or migrate to the spinal dorsal root ganglion or cranial ganglion through the fusion of infected T cells and neuronal cells to lie dormant. When the body's immune system weakens, the immunity of VZV-specific cells weakens, and the latent virus is activated and replicates in large quantities, migrates to the skin via the sensory axons, and causes shingles. Since shingles is caused by the reactivation of latent viruses, only patients who have had their first infection develop the disease, and there is no seasonality in its onset. Shingles mainly occurs in people over 45 years of age, and the incidence rate increases with age. The incidence rate of shingles in ordinary people is (3-5) people / 1000 people / year, and increases by 2.5%-5.0% every year. In people over 75 years of age, it reaches 10 people / 1000 people / year, and the incidence rate of shingles in children is extremely low (Guess, HA 1985). Shingles is common in patients receiving immunosuppressive therapy and in those infected with HIV. In addition to skin damage, shingles causes severe pain and a common complication is post-herpetic neuralgia (PHN), which can last for months to years.

[0006] VZV infection produces IgG, IgM and IgA antibodies that bind to viral proteins, including glycoproteins, regulatory proteins, structural proteins and enzymes (Bogger-Goren. 1984), and neutralizing antibodies mediate the lysis of infected cells. Neutralizing antibodies that bind to gE and gI proteins require complement to exert their neutralizing effect, whereas antibodies that bind to gB and gH / gL proteins do not. After primary chickenpox infection, IgG antibodies, especially glycoprotein antibodies, persist in the body for a long time and protect the body from secondary infections. Injection of VZV immune globulin within 72 hours after exposure to VZV in newborns, naive pregnant women and immunocompromised individuals inhibits infection and viral replication in the body (Zaia, JA, 1983), reduces the severity of chickenpox and reduces the risk of chickenpox pneumonia, but immunoglobulin injections in children with acute chickenpox do not improve the clinical course of the disease. Antiviral drugs can effectively reduce the severity of chickenpox and shingles, shorten the course of the disease, and reduce the incidence of neuralgia caused by shingles. Currently, the treatment of shingles is mainly non-specific antiviral therapy, and there are no specific antiviral drugs.

[0007] Therefore, based on clinical needs, the discovery, research and development of antibodies against varicella-zoster is of great biological and medical significance. Summary of the Invention

[0008] According to a first aspect, the present invention provides an antibody against varicella-zoster virus, comprising a heavy chain variable region comprising HCDR1, HCDR2 and HCDR3 amino acid sequences, and a light chain variable region comprising LCDR1, LCDR2 and LCDR3 amino acid sequences, The HCDR1 amino acid sequence is SGNYWN (SEQ ID NO:29) and the HCDR2 amino acid sequence is YISYDGSTYYNPSLKN (SEQ ID NO:30) and the HCDR3 amino acid sequence is GYYGYWFAY (SEQ ID NO:31) and the LCDR1 amino acid sequence is RASSSVSYMH (SEQ ID NO:32) and the LCDR2 amino acid sequence is ATSNLAS (SEQ ID NO:33)and the LCDR3 amino acid sequence is QQWSSNPFT (SEQ ID NO:34) or The HCDR1 amino acid sequence is SGYYWN (SEQ ID NO:35) and the HCDR2 amino acid sequence is YISYDGSNNYNTSLKN (SEQ ID NO:36) and the HCDR3 amino acid sequence is EDVNYPPYALDY (SEQ ID NO:37) and the LCDR1 amino acid sequence is RSSQSLVHSNGNTYLH (SEQ ID NO:38) and the LCDR2 amino acid sequence is KVSNRFS (SEQ ID NO:39) and the LCDR3 amino acid sequence is SQSTHVPWT (SEQ ID NO:40) or The HCDR1 amino acid sequence is SYTMS (SEQ ID NO:41) and the HCDR2 amino acid sequence is FISNGGDNNYYADTVKG (SEQ ID NO:42) and the HCDR3 amino acid sequence is HNGNWGFAY (SEQ ID NO:43) and the LCDR1 amino acid sequence is SASSSISSNYLH (SEQ ID NO:44) and the LCDR2 amino acid sequence is RTSNLAS (SEQ ID NO:45) and the LCDR3 amino acid sequence is QQGSSIPLT (SEQ ID NO:46) or The HCDR1 amino acid sequence is TYAMH (SEQ ID NO:47) and the HCDR2 amino acid sequence is VISYGGGNRYYAASVKG (SEQ ID NO:48) and the HCDR3 amino acid sequence is ARDNHYFFGMDV (SEQ ID NO:49) and the LCDR1 amino acid sequence is RASQGISSWLA (SEQ ID NO:50) and the LCDR2 amino acid sequence is AASSLQS (SEQ ID NO:51) and the LCDR3 amino acid sequence is QQANSFPLT (SEQ ID NO:52) , QEGFYFPIN (SEQ ID NO:53) , QQATYFPIN (SEQ ID NO:54) Or QQSSYFPIA (SEQ ID NO:55) and Here, the HCDR and LCDR amino acid sequences are defined according to Kabat: An antibody is provided.

[0009] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:1, 3, 5 or 7.

[0010] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:2, 4, 6, 8, 9, 10 or 28.

[0011] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:1 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:2; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:3 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:4; or The amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:5, and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:6; the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:8; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:9; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:10; or The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO:7, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO:28.

[0012] According to a second aspect, the present invention provides an antibody against Varicella-Zoster virus, wherein the amino acid sequence of the heavy chain variable region of the antibody has at least 90% identity with any one of SEQ ID NOs:1, 3, 5 and 7, and the amino acid sequence of the light chain variable region of the antibody has at least 90% identity with any one of SEQ ID NOs:2, 4, 6, 8, 9, 10 and 28. In some embodiments of the first and second aspects, the antibody is a complete antibody, a Fab fragment, a F(ab') 2 It is a fragment or a single chain Fv fragment (scFv). In some embodiments of the first and second aspects, the antibody is a monoclonal antibody. In some embodiments of the first and second aspects, the antibody further comprises a heavy chain constant region selected from an IgG1, IgG2, or IgG4 subtype. In some embodiments of the first and second aspects, the antibody further comprises a light chain constant region selected from the kappa or lambda subtype. In some embodiments of the first and second aspects, the antibody binds to Varicella-Zoster virus gH / gL proteins and / or the antibody mediates antibody-dependent cell-mediated cytotoxicity (ADCC).

[0013] According to a third aspect, the present invention provides a nucleic acid molecule encoding an antibody according to the first or second aspect.

[0014] According to a fourth aspect, the present invention provides a pharmaceutical composition comprising an antibody according to the first or second aspect and a pharma- ceutically acceptable excipient, diluent or carrier.

[0015] According to a fifth aspect, the present invention provides the use of an antibody according to the first or second aspect, a nucleic acid molecule according to the third aspect, or a pharmaceutical composition according to the fourth aspect, in the manufacture of a medicament for the prevention or treatment of chickenpox and shingles.

[0016] According to a sixth aspect, the present invention provides a method for the prevention or treatment of chickenpox and shingles comprising administering to an individual in need thereof an antibody according to the first or second aspect, or a pharmaceutical composition according to the fourth aspect. [Brief description of the drawings]

[0017] [Figure 1] 1 shows ELISA analysis of the blocking ability of anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies to the binding of purified anti-recombinant protein gH / gL phage to recombinant protein gH / gL, in which Figures A to C show the blocking results of anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies S8E1, S8B8, and S7A10, respectively. [Diagram 2] FIG. 1 shows ELISA analysis of the ability of anti-Varicella-zoster virus recombinant protein gH / gL monoclonal antibody H4H8-L1B7 to block the binding of purified anti-recombinant protein gH / gL phage to recombinant protein gH / gL. [Diagram 3] FIG. 1 shows the evaluation of ADCC activity of anti-varicella-zoster virus monoclonal antibodies based on Jurkat-Dual-CD16a reporter gene cells.

[0018] Array Description SEQ ID NO:1 shows the amino acid sequence of the heavy chain variable region of monoclonal antibody S7A10. SEQ ID NO:2 shows the amino acid sequence of the light chain variable region of monoclonal antibody S7A10. SEQ ID NO:3 shows the amino acid sequence of the heavy chain variable region of monoclonal antibody S8E1. SEQ ID NO:4 shows the amino acid sequence of the light chain variable region of monoclonal antibody S8E1. SEQ ID NO:5 shows the amino acid sequence of the heavy chain variable region of monoclonal antibody S8B8. SEQ ID NO:6 shows the amino acid sequence of the light chain variable region of monoclonal antibody S8B8. SEQ ID NO:7 shows the amino acid sequence of the heavy chain variable region of monoclonal antibodies H4H8-L1B7, H4H8-L14H8, H4H8-L13C1, and H4H8-L13C7. SEQ ID NO:8 shows the amino acid sequence of the light chain variable region of monoclonal antibody H4H8-L13C1. SEQ ID NO:9 shows the amino acid sequence of the light chain variable region of monoclonal antibody H4H8-L13C7. SEQ ID NO:10 shows the amino acid sequence of the light chain variable region of monoclonal antibody H4H8-L14H8. SEQ ID NO:11 shows the amino acid sequence of the gH glycoprotein of Varicella zoster virus. SEQ ID NO:12 shows the amino acid sequence of the gL glycoprotein of Varicella zoster virus. SEQ ID NO:13 shows the amino acid sequence of the His tag. SEQ ID NO:14 shows the amino acid sequence of the heavy chain constant region of homo sapiens IgG1 subtype. SEQ ID NO:15 shows the amino acid sequence of the heavy chain constant region of homo sapiens IgG2 subtype. SEQ ID NO:16 shows the amino acid sequence of the heavy chain constant region of homo sapiens IgG4 subtype. SEQ ID NO:17 shows the amino acid sequence of the heavy chain constant region of mouse (mus musculus) IgG1 subtype. SEQ ID NO:18 shows the amino acid sequence of the heavy chain constant region of mouse (mus musculus) IgG2a subtype. SEQ ID NO:19 shows the amino acid sequence of the light chain constant region of the human (homo sapiens) kappa subtype. SEQ ID NO:20 shows the amino acid sequence of the light chain constant region of homo sapiens λ subtype. SEQ ID NO:21 shows the amino acid sequence of the light chain constant region of the mouse (mus musculus) kappa subtype. SEQ ID NO:22 shows the amino acid sequence of the light chain constant region of the mouse (mus musculus) lambda subtype. SEQ ID NO:23 shows the nucleotide sequence of primer PmCGR. SEQ ID NO:24 shows the nucleotide sequence of primer PmCKR. SEQ ID NO:25 shows the amino acid sequence of single chain antibody S7A10. SEQ ID NO:26 shows the amino acid sequence of single chain antibody S8E1. SEQ ID NO:27 shows the amino acid sequence of the single chain antibody S8B8. SEQ ID NO:28 shows the amino acid sequence of the light chain variable region of monoclonal antibody H4H8-L1B7. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] The inventors of the present invention have developed a novel antibody against Varicella-Zoster virus by antibody engineering techniques. In various aspects of the present invention, there are provided a novel antibody against Varicella-Zoster virus, a nucleic acid molecule encoding said antibody or an antigen-binding fragment thereof, a vector comprising said nucleic acid molecule, a host cell comprising said nucleic acid molecule or said vector, a method for producing and purifying said antibody, and medical and biological uses of said antibody. According to the amino acid sequence of the variable region of the antibody according to the present invention, a full-length antibody molecule can be constructed as a medicine for preventing or treating chickenpox and varicella-zoster.

[0020] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry and immunology within the skill of the art. Unless otherwise specified, the terms used herein have the meanings that are commonly understood by those of ordinary skill in the art.

[0021] [Definition] The term "antibody" as used herein refers to an immunoglobulin molecule capable of specifically binding to a target through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. Targets include, but are not limited to, carbohydrates, polynucleotides, lipids, polypeptides, and the like. As used herein, "antibody" refers to not only complete antibodies (i.e., full-length antibodies) but also antigen-binding fragments thereof (e.g., Fab, Fab', F(ab')). 2 , Fv), variants thereof, fusion proteins containing antibody portions, humanized antibodies, chimeric antibodies, diabodies, linear antibodies, single chain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other engineered configuration of an immunoglobulin molecule that contains an antigen recognition site of desired specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

[0022] Typically, a complete or full-length antibody comprises two heavy chains and two light chains. Each heavy chain comprises a heavy chain variable region (VH) and a first, second and third constant region (CH1, CH2 and CH3). Each light chain comprises a light chain variable region (VL) and a constant region (CL). A full-length antibody may be any type of antibody, such as IgD, IgE, IgG, IgA or IgM (or a subclass of the above), but the antibody need not belong to any particular class. Immunoglobulins can be assigned to different classes based on the antibody amino acid sequence of the constant domain of the heavy chain. There are usually five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and some of these classes can be further divided into subclasses (homotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. The heavy chain constant domains corresponding to the different immunoglobulin classes are called α, δ, ε, γ and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are known.

[0023] The term "antigen-binding fragment or portion" as used herein refers to the portion or region of a complete antibody molecule responsible for antigen binding. The antigen-binding domain may comprise a heavy chain variable region (VH), a light chain variable region (VL), or both of the above. Each of the VH and VL typically comprises three complementarity determining regions CDR1, CDR2, and CDR3.

[0024] Those skilled in the art know that complementarity determining regions (CDRs, usually CDR1, CDR2 and CDR3) are the regions of the variable region that have the greatest influence on the affinity and specificity of an antibody. There are two common definition methods for the CDR amino acid sequence of VH or VL: Chothia definition and Kabat definition (e.g., Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991); A1-Lazikani et al., J. Mol. Biol. 273:927-948 (1997); and Martin et al., Proc. Natl. Acad. Sci.USA86:9268-9272 (1989)). For a given antibody variable region amino acid sequence, the CDR amino acid sequences of the VH and VL amino acid sequences may be determined according to the Chothia definition or the Kabat definition. In an embodiment of the present invention, the CDR amino acid sequence is defined using Kabat.

[0025] For a given antibody variable region amino acid sequence, the CDR amino acid sequences within the variable region amino acid sequence may be analyzed in a variety of ways, for example, may be determined using the online software Abysis (http: / / www.abysis.org / ).

[0026] Examples of antigen-binding fragments include (1) a Fab fragment, which may be a monovalent fragment having a VL-CL chain and a VH-CH1 chain; (2) an F(ab') fragment, which may be a bivalent fragment having two Fab' fragments linked via a disulfide bridge in the hinge region (i.e., a Fab' dimer). 2(3) Fv fragments having the VL and VH domains of a single arm of an antibody; (4) single-chain Fvs (scFvs), which may be a single polypeptide chain consisting of a VH domain and a VL domain via a peptide linker; and (5) two VL domains linked via a peptide linker and two VH domains combined with two VL domains via disulfide bridges (scFvs). 2 These include, but are not limited to:

[0027] As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an antigen epitope.

[0028] The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous antibody population, i.e., the individual antibodies constituting the population are identical, except for possible naturally occurring mutations in a few individuals. The monoclonal antibodies described herein include, in particular, "chimeric" antibodies, in which a portion of the heavy and / or light chain is identical or homologous to the corresponding amino acid sequence in an antibody derived from a particular species or belonging to a particular antibody class or subclass, and the remaining portion of the heavy and / or light chain is identical or homologous to the corresponding amino acid sequence in an antibody derived from another species or belonging to another antibody class or subclass, and also include fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567, and Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 (1984)).

[0029] According to a first aspect, the present invention provides an antibody against varicella-zoster virus, comprising a heavy chain variable region comprising HCDR1, HCDR2 and HCDR3 amino acid sequences, and a light chain variable region comprising LCDR1, LCDR2 and LCDR3 amino acid sequences, The HCDR1 amino acid sequence is SGNYWN (SEQ ID NO:29)and the HCDR2 amino acid sequence is YISYDGSTYYNPSLKN (SEQ ID NO:30) and the HCDR3 amino acid sequence is GYYGYWFAY (SEQ ID NO:31) and the LCDR1 amino acid sequence is RASSSVSYMH (SEQ ID NO:32) and the LCDR2 amino acid sequence is ATSNLAS (SEQ ID NO:33) and the LCDR3 amino acid sequence is QQWSSNPFT (SEQ ID NO:34) or The HCDR1 amino acid sequence is SGYYWN (SEQ ID NO:35) and the HCDR2 amino acid sequence is YISYDGSNNYNTSLKN (SEQ ID NO:36) and the HCDR3 amino acid sequence is EDVNYPPYALDY (SEQ ID NO:37) and the LCDR1 amino acid sequence is RSSQSLVHSNGNTYLH (SEQ ID NO:38) and the LCDR2 amino acid sequence is KVSNRFS (SEQ ID NO:39) and the LCDR3 amino acid sequence is SQSTHVPWT (SEQ ID NO:40) or The HCDR1 amino acid sequence is SYTMS (SEQ ID NO:41) and the HCDR2 amino acid sequence is FISNGGDNNYYADTVKG (SEQ ID NO:42) and the HCDR3 amino acid sequence is HNGNWGFAY (SEQ ID NO:43) and the LCDR1 amino acid sequence is SASSSISSNYLH (SEQ ID NO:44) and the LCDR2 amino acid sequence is RTSNLAS (SEQ ID NO:45) and the LCDR3 amino acid sequence is QQGSSIPLT (SEQ ID NO:46) or The HCDR1 amino acid sequence is TYAMH (SEQ ID NO:47) and the HCDR2 amino acid sequence is VISYGGGNRYYAASVKG (SEQ ID NO:48) and the HCDR3 amino acid sequence is ARDNHYFFGMDV (SEQ ID NO:49) and the LCDR1 amino acid sequence is RASQGISSWLA (SEQ ID NO:50) and the LCDR2 amino acid sequence is AASSLQS (SEQ ID NO:51) and the LCDR3 amino acid sequence is QQANSFPLT (SEQ ID NO:52), QEGFYFPIN (SEQ ID NO:53) , QQATYFPIN (SEQ ID NO:54) Or QQSSYFPIA (SEQ ID NO:55) and The HCDR and LCDR amino acid sequences are defined according to Kabat: An antibody is provided.

[0030] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:1, 3, 5 or 7. In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:2, 4, 6, 8, 9, 10 or 28.

[0031] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:1 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:2; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:3 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:4; or The amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:5, and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:6; the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:8; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:9; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:10; or The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO:7, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO:28.

[0032] According to a second aspect, the present invention provides an antibody against Varicella-Zoster virus, wherein the amino acid sequence of the heavy chain variable region of the antibody has at least 90% identity with any one of SEQ ID NOs:1, 3, 5 and 7, and the amino acid sequence of the light chain variable region of the antibody has at least 90% identity with any one of SEQ ID NOs:2, 4, 6, 8, 9, 10 and 28. In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to any one of SEQ ID NOs:1, 3, 5 and 7.

[0033] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to any one of SEQ ID NOs:2, 4, 6, 8, 9, 10, and 28. In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the antibody differs from the amino acid sequence set forth in any one of SEQ ID NOs:1, 3, 5, and 7 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions.

[0034] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the antibody differs from the amino acid sequence set forth in any one of SEQ ID NOs:2, 4, 6, 8, 9, 10, and 28 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions. In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence set forth in any one of SEQ ID NOs:1, 3, 5 and 7 may be further truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while maintaining a similar function of the heavy chain variable region of the antibody.

[0035] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence set forth in any one of SEQ ID NOs:1, 3, 5 and 7, and the resulting amino acid sequence maintains similar function of the heavy chain variable region of the antibody. In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted from a region other than the C-terminus or N-terminus of the amino acid sequence shown in any one of SEQ ID NOs:1, 3, 5 and 7, as long as the altered amino acid sequence maintains a similar function of the heavy chain variable region of the antibody.

[0036] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence set forth in any one of SEQ ID NOs:2, 4, 6, 8, 9, 10, and 28 may be further truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while maintaining similar functions of the light chain variable region of the antibody. In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence set forth in any one of SEQ ID NOs:2, 4, 6, 8, 9, 10, and 28, and the resulting amino acid sequence maintains similar function of the light chain variable region of the antibody.

[0037] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted from a region other than the C-terminus or N-terminus of the amino acid sequence shown in any one of SEQ ID NOs:2, 4, 6, 8, 9, 10, and 28, as long as the altered amino acid sequence maintains a similar function to the light chain variable region of the antibody.

[0038] In some embodiments of the first and second aspects, the antibody is a complete antibody, a Fab fragment, a F(ab') 2 It is a fragment or a single chain Fv fragment (scFv). In some embodiments of the first and second aspects, the antibody is a fully human antibody. In some embodiments of the first and second aspects, the antibody is a monoclonal antibody. In some embodiments of the first and second aspects, the antibody further comprises a heavy chain constant region selected from an IgG1, IgG2, or IgG4 subtype.

[0039] In some particular embodiments of the first and second aspects, the heavy chain constant region is of the IgG1 subtype. In some embodiments of the first and second aspects, the antibody further comprises a light chain constant region selected from the kappa or lambda subtype. In some particular embodiments of the first and second aspects, the light chain constant region is of the kappa subtype. In some embodiments of the first and second aspects, the antibody binds to Varicella-Zoster virus gH / gL proteins and / or the antibody mediates antibody-dependent cell-mediated cytotoxicity (ADCC).

[0040] According to a third aspect, the present invention provides a nucleic acid molecule encoding an antibody according to the first or second aspect. In some embodiments, the nucleic acid molecule comprises a regulatory sequence that can be recognized by a host cell transformed with the vector. nucleotide is operably linked to the sequence.

[0041] According to a fourth aspect, the present invention provides a pharmaceutical composition comprising an antibody according to the first or second aspect and a pharma- ceutically acceptable excipient, diluent or carrier.

[0042] In some embodiments, the pharmaceutical composition is used to prevent or treat chickenpox and shingles. In some embodiments, the pharmaceutical compositions may further comprise one or more of a lubricating agent (such as talc, magnesium stearate, or mineral oil), a wetting agent, an emulsifying agent, a suspending agent, a benzoic acid, a preservative (such as sorbic acid or calcium propionate), a sweetener enhancer, and / or a flavoring agent. In some embodiments, the pharmaceutical compositions of the present invention may be prepared in the form of tablets, pills, powders, tablets, elixirs, suspensions, emulsions, solutions, syrups, suppositories, or capsules.

[0043] In some embodiments, the pharmaceutical compositions of the present invention may be delivered using any physiologically acceptable method of administration, including, but not limited to, oral administration, parenteral administration, nasal administration, rectal administration, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, and the like. In some embodiments, therapeutic pharmaceutical compositions may be prepared for storage in the form of a lyophilized formulation or aqueous solution by mixing reagents having the desired purity and, optionally, pharma- ceutically acceptable carriers, excipients, etc.

[0044] According to a fifth aspect, the present invention provides the use of an antibody according to the first or second aspect, a nucleic acid molecule according to the third aspect, or a targeted pharmaceutical composition according to the fourth aspect in the manufacture of a medicament for the prevention or treatment of chickenpox and shingles. According to a sixth aspect, the present invention provides a method for the prevention or treatment of chickenpox and shingles comprising administering to an individual in need thereof an antibody according to the first or second aspect, or a pharmaceutical composition according to the fourth aspect.

[0045] According to other aspects, the invention also provides isolated nucleic acid molecules encoding the antibodies of the invention or their light or heavy chains, vectors comprising said nucleic acid molecules, host cells comprising said vectors, and methods of producing said antibodies. In some embodiments, said nucleic acid molecules comprise a regulatory domain that can be recognized by a host cell transformed with said vector. nucleotide The nucleic acid is operably linked to the sequence. In some embodiments, the method of producing the antibody comprises culturing a host cell to express the nucleic acid. In some embodiments, the method of producing the antibody comprises recovering the antibody from the host cell culture medium.

[0046] Additionally, the antibodies specific for Varicella Zoster virus described herein can be used to detect the presence of Varicella Zoster virus in biological samples. Antibody-based detection methods are known in the art and include, for example, ELISA, Western blot, radioimmunoassay, immunofluorescence, immunoprecipitation and other related techniques. It should be noted that the above detailed description is intended only to allow those skilled in the art to more clearly understand the contents of the present invention, and is not intended to limit the present invention in any manner. Those skilled in the art may make various modifications and changes to the above embodiments. EXAMPLES

[0047] The following examples are used for illustration only, without the purpose of limiting the scope of the present invention. Example 1: Production of recombinant proteins The gH glycoprotein (SEQ ID NO:11) and gL glycoprotein (SEQ ID NO:12) are used to produce and identify antibodies specific to Varicella-Zoster Virus. gH and gL are synthesized separately in cells and must be folded together to form a gH / gL dimer before effective secretory expression can occur. Moreover, since the gH / gL dimer has a large amount of post-translational modifications (e.g., glycosylation and disulfide bonds), it is more advantageous to use a mammalian cell expression system to maintain the structure and function of the recombinant protein. Furthermore, the addition of a His tag (SEQ ID NO:13) to the C-terminus of the gH glycoprotein makes it easier to purify the recombinant protein and identify the function of the monoclonal antibody. Based on the amino acid sequences of the gH glycoprotein and gL glycoprotein of Varicella-Zoster Virus Oka strain in the Uniprot database, genes encoding the gH (including His tag) and gL recombinant proteins were designed and synthesized. The synthesized recombinant protein genes encoding gH-His and gL were cloned into appropriate eukaryotic expression vectors (e.g., pcDNA3.1, Invitrogen, etc.) using conventional molecular biology techniques, and then the produced recombinant protein expression plasmids were transfected into HEK293 cells (e.g., HEK293F, Invitrogen, etc.) using liposomes (e.g., 293fectin, Invitrogen, etc.) or other transfection reagents (e.g., PEI, etc.) and cultured under serum-free suspension culture conditions for 3 to 5 days. Then, the culture supernatant was obtained by centrifugation or the like. The recombinant protein in the supernatant was further purified using a metal chelate affinity chromatography column (e.g., HisTrap FF, GE, etc.). Then, the recombinant protein storage buffer was replaced with PBS (pH 7.0) or other appropriate buffer using a desalting column (e.g., Hitrap desaulting, GE, etc.). If necessary, the samples were sterilized by filtration, individually packaged, and stored at -20°C.

[0048] When producing a recombinant antibody, the heavy chain constant region of the antibody can be human IgG1 subtype (SEQ ID NO:14), human IgG2 subtype (SEQ ID NO:15), human IgG4 subtype (SEQ ID NO:16), or mouse IgG1 subtype (SEQ ID NO:17), mouse IgG2a subtype (SEQ ID NO:18), and the light chain constant region can be human kappa subtype (SEQ ID NO:19), human lambda subtype (SEQ ID NO:20), mouse kappa subtype (SEQ ID NO:21), mouse lambda subtype (SEQ ID NO:22). Using conventional molecular biology techniques, the nucleotide sequences encoding the heavy and light chain variable regions of the antibody are cloned and combined into a eukaryotic expression vector (e.g., pcDNA3.1 from Invitrogen) in which the nucleotide sequences encoding the heavy and light chain constant regions are fused, to express the complete antibody. The recombinant antibody expression plasmid produced was transfected into HEK293 cells (e.g., HEK293F, Invitrogen) using liposomes (e.g., 293fectin, Invitrogen) or other transfection reagents (e.g., PEI, etc.) and cultured under serum-free suspension culture conditions for 3 to 5 days. The culture supernatant was then obtained by centrifugation or other methods, and further purified using a ProteinA / G affinity column (e.g., Mabselect SURE, GE). The recombinant protein storage buffer was then replaced with PBS (pH 7.0) or other appropriate buffer using a desalting column (e.g., Hitrap desaulting, GE). If necessary, the antibody sample was sterilized by filtration, individually packaged, and stored at -20°C.

[0049] Example 2: Screening of mouse anti-Varicella zoster virus recombinant protein gH / gL monoclonal antibodies 2.1 Mouse immunization and generation of immune antibody library BALB / c mice aged 6 to 8 weeks were immunized with the recombinant protein gH-His / gL produced in Example 1 as an antigen at an immunization dose of 50 μg / mouse, and booster immunization was performed once every 14 days. The mice were killed 8 weeks after the first immunization, and spleen cells were collected. Mouse spleen lymphocytes were isolated using a mouse lymphocyte isolation solution (Dakowi Biotechnology Co., Ltd., CAT#DKW33-R0100). Total RNA of the isolated lymphocytes was extracted using a cell total RNA extraction kit (Tiangen Biological Chemical Technology (Beijing) Co., Ltd., CAT#DP430). Using the extracted total RNA as a template, cDNAs of the heavy chain variable region and light chain variable region of the antibody were synthesized using a first strand cDNA synthesis kit (Thermo scientific, CAT#K1621), and gene-specific primers were used as reverse transcription primers. The primer pairing regions are located in the heavy chain constant region of the antibody and the light chain constant region of the antibody, respectively, and the specific sequences are PmCGR: TGCATTTGAACTCCTTGCC (SEQ ID NO: 23) and PmCKR: CCATCAATCTTCCACTTGAC (SEQ ID NO: 24), respectively. The synthesized cDNA was immediately stored at -70°C. Then, using the cDNA obtained by reverse transcription as a template, primers were synthesized with reference to the literature (Krebber A, Bornhauser S, Burmester J, et al. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J Immunol Methods. 1997;201(1):35-55, the entire contents of which are incorporated herein by reference), and the nucleotide sequences encoding the mouse antibody VH and VK were amplified by PCR, and then a single-chain antibody (scFv) gene was constructed using overlap extension PCR technology.Finally, the prepared mouse single chain antibody nucleotide sequence was cloned into vector pADSCFV-S (the experimental technique flow can be referred to Example 1 of Chinese Patent Application No. 201510097117.0, the entire contents of which are incorporated herein by reference) to construct an scFv library. The capacity of the antibody library reached 2.13E+08, and the accuracy rate was 50%.

[0050] 2.2 Screening of anti-Varicella-Zoster virus recombinant protein gH / gL mouse single-chain antibodies Referring to the literature (the experimental technique flow can be referred to China Patent Application No. 201510097117.0, the entire contents of which are incorporated herein by reference), the recombinant protein gH-His / gL prepared in Example 1 was used as an antigen to screen the phage library displaying the mouse single chain antibody constructed above using a solid-phase screening strategy (the experimental scheme can be referred to Phage Display: General Experimental Guidelines / Clackson, T. (USA), edited by Lowman, HB (USA), translated by Ma Lan et al., Chemical Industry Press, May 2008, the entire contents of which are incorporated herein by reference), and three rounds of screening were carried out by binding, elution, neutralization, infection and amplification, and finally S7A10 (amino acid sequence shown in SEQ ID NO: 25), S8E1 (amino acid sequence shown in SEQ ID NO: 26), and S8B8 (amino acid sequence shown in SEQ ID NO: 27) were selected. We obtained several single-chain antibodies with different sequences that could specifically bind to the recombinant protein gH-His / gL, including the clone shown in NO:27.

[0051] Example 3: Affinity analysis of mouse anti-Varicella zoster virus recombinant protein gH / gL monoclonal antibodies Using conventional molecular biology techniques, nucleotide sequences encoding the light and heavy chains of a single-chain antibody that specifically binds to gH / gL were cloned into a eukaryotic expression vector to produce a mouse-human chimeric antibody in the form of a recombinant human IgG1-κ.

[0052] The affinity of anti-gH / gL antibodies was measured by surface plasmon resonance using Biacore X100. All related reagents and consumables, including amino binding kit (BR-1000-50), human antibody capture kit (BR-1008-39), CM5 chip (BR100012), and 10× HBS-EP at pH 7.4 (BR100669), were purchased from GE Healthcare. According to the kit's instruction manual, the surface of the carboxylated CM5 chip was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC: 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) and N-hydroxysuccinimide (NHS: N-Hydroxysuccinimide), and anti-human IgG (Fc) antibody (capture antibody) was diluted to 25 μg / mL with 10 mM sodium acetate pH 5.0 and then injected at a flow rate of 10 μL / min to achieve a binding amount of approximately 10,000 response units (RU). After injection of the capture antibody, 1 M ethanolamine was injected to block unreacted groups. In the kinetic measurement, anti-gH / gL antibody was diluted to 0.5-1 μg / mL and injected at 10 μL / min to ensure that approximately 50 RU of antibody was captured by the anti-human Fc antibody. Then, recombinant protein gH / gL was injected at 30 μL / min from low to high concentration at 25 °C in a series of concentration gradients (e.g., 1.23 nM, 3.7 nM, 11.1 nM, 33.3 nM, and 100 nM) with an association time of 120 s and a dissociation time of 3600 s in 3 M MgCl. 2 The binding kinetics (K) were calculated by fitting the binding and dissociation sensing maps with a 1:1 binding model using the Biacore X100 evaluation software version 2.0.1. a ) and dissociation rate (K d ) was calculated. d / K a The dissociation equilibrium constant (K D The fitting results are shown in Table 1.

[0053] [Table 1]

[0054] Example 4: Epitope analysis of mouse anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies Varicella-zoster virus recombinant protein gH / gL was coated onto a 96-well ELISA plate (3 μg / mL, 100 μL / well) and left in a refrigerator at 4 °C overnight. Blocking solution PBS-0.1% Twain + 20-3% milk was used for blocking at 37 °C for 1 h. A fixed concentration (5 × 10 10 ~1×10 11 cfu / mL) of purified anti-recombinant protein gH / gL phage (S7A10, S8B8, and S8E1) were used to perform gradient dilution against recombinant protein gH / gL antibodies (S7A10, S8B8, and S8E1), with a starting concentration of 10 μg / mL, and 3-fold gradient dilution with 8-10 concentration gradients, 100 μL / well was placed in a blocked 96-well ELISA plate and incubated at 37 °C for 1 h. The ELISA plate was washed with PBS-0.1% Twain 20, and then HRP anti-M13 secondary antibody (Beijing Yiqiao Shenzhou Technology Co., Ltd., 11973-MM05T-H) was added and incubated at 37 °C for 1 h. The ELISA plate was washed with PBS-0.1% Twain 20, and OPD substrate color development solution was added, and after 5-10 min, 1M H 2 SO 4 The color development was stopped using a 500 mM NaCl solution, and the dual wavelength optical density values ​​at 492 nm / 630 nm were measured using a microplate reader. As a result of ELISA analysis, as shown in Figure 1, the S8E1-IgG1 monoclonal antibody cannot block the binding of the S8B8 phage and the S7A10 phage to the recombinant protein gH / gL (Figure 1A). The S8B8-IgG1 monoclonal antibody can partially block the binding signal of the S8E1 phage to the recombinant protein gH / gL, but does not affect the binding of the S7A10 phage to the recombinant protein gH / gL (Figure 1B). The S7A10-IgG1 monoclonal antibody cannot block the binding of the S8B8 phage and the S7A10 phage to the recombinant protein gH / gL (Figure 1C).

[0055] Example 5: Neutralizing activity of mouse anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies The neutralizing activity of the antibodies (S7A10, S8B8, and S8E1) was determined by the reduction in plaques formed by mixing the antibodies with VZV virus and then infecting MRC-5 cells. 5 The cells were inoculated into a 6-well cell culture plate at 100 μg / well and cultured for 72 hours to form a monolayer. When 90% of the cells were spread, the culture supernatant was removed and 400 μL of virus maintenance solution (2% serum-containing MEM medium) was added per well. VZV (Oka) was diluted to 2000 pfu / mL with the virus maintenance solution, i.e., diluted to contain 100 pfu of VZV per 100 μL after mixing with the antibody in an equal volume. The antibody was diluted 2-fold with the virus dilution solution to a starting concentration of 20 μg / mL, resulting in 8 concentration gradients, i.e., the antibody concentrations after mixing with the VZV in an equal volume were 10 μg / mL, 5 μg / mL, 2.5 μg / mL, 1.25 μg / mL, 0.62 μg / mL, 0.31 μg / mL, 0.16 μg / mL, and 0.08 μg / mL. VZV was mixed with the antibody in an equal volume, left at 25°C for 1 hour, and 100μL per well of MRC5 cells in a 6-well plate was infected. The cells were adsorbed at 37°C for 1 hour, the supernatant was aspirated and discarded, washed twice with PBS, 3mL of maintenance solution was added per well, and maintained at 37°C for 8 days, the supernatant was removed, washed once with PBS, 1mL of Coomassie Brilliant Blue staining solution was added per well, and after 10 minutes of action, the cells were washed once with PBS, placed in a bright place, and the plaques were counted. The antibody concentration at which the plaques were reduced by 50% (PRNT50) was calculated using the Reed and Muench method. The experimental results are shown in Table 2.

[0056] [Table 2]

[0057] Example 6: Inhibitory activity of anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies against cell-to-cell spread of the virus Antibodies (S7A10, S8B8, and S8E1) were added 24 hours after VZV virus infection of MRC5 cells, and the inhibitory activity of the antibodies against cell-to-cell spread of the virus was determined by the reduction in plaque formation. MRC-5 cells were infected with 1.5 × 10 5 The cells were inoculated into a 6-well cell culture plate at 100 cells / well and cultured for 72 hours to form a monolayer. When 90% of the cells were spread, the culture supernatant was removed and 400 μL of virus maintenance solution (2% serum-containing MEM medium) was added per well. VZV was diluted to 1000 pfu / mL with the virus maintenance solution and infected into MRC5 cells in a 6-well plate at 100 μL per well, i.e., 100 pfu of VZV was infected per well. The cells were adsorbed at 37°C for 1 hour, the supernatant was aspirated and discarded, washed twice with PBS, 3 mL of maintenance solution was added per well, and cultured at 37°C for 24 hours. The antibody was diluted 2-fold in the virus dilution solution, with a starting concentration of 400 μg / mL, to give eight concentration gradients, and 30 μL per well was added to a 6-well plate of MRC5 cells infected with VZV, i.e., the antibody concentrations in the culture medium were 4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, and 0.125 μg / mL. The cells were maintained in culture at 37°C for 7 days, the supernatant was removed, washed once with PBS, 1 mL of Coomassie Brilliant Blue staining solution was added per well, and the cells were allowed to react for 10 minutes, washed once with PBS, placed in a bright place, and the plaques were counted. The antibody concentration at which the plaques were reduced by 50% was calculated. The experimental results are shown in Table 3.

[0058] [Table 3]

[0059] Example 7: Screening of fully human monoclonal antibodies against varicella-zoster virus recombinant protein gH / gL Using the recombinant protein gH-His / gL prepared in Example 1 as an antigen, a solid-phase screening strategy (for the experimental scheme, refer to phage display: General experimental guidelines / edited by Clackson, T. and Lowman, HB, translated by Ma Lan et al., Chemical Industry Press, May 2008, the entire contents of which are incorporated herein by reference) was used to screen the natural human phage antibody library (for the experimental technical procedure, refer to Example 1 of China Patent Application No. 201510097117.0, the entire contents of which are incorporated herein by reference), and finally, a strain of fully human single-chain antibody H4H8-L1B7 that specifically binds to the recombinant protein gH-His / gL was obtained.

[0060] Example 8: Epitope analysis of fully human monoclonal antibodies against varicella-zoster virus recombinant protein gH / gL Using standard molecular biology techniques, the light and heavy chain encoding H4H8-L1B7 was cloned into a eukaryotic expression vector to produce a fully human monoclonal antibody in the recombinant human IgG1-κ format.

[0061] Referring to Example 4, a certain concentration (5×10 10 ~1×10 11 The anti-recombinant protein gH / gL antibody (H4H8-L1B7-IgG1) was gradient-diluted using each of the purified anti-recombinant protein gH / gL phages (S7A10, S8E1, S8B8 and H4H8-L1B7) at 100 cfu / mL, and the blocking of the binding of the recombinant protein gH / gL phages to the recombinant protein gH / gL by the human anti-recombinant protein gH / gL monoclonal antibody H4H8-L1B7-IgG1 was measured. The ELISA analysis results shown in Figure 2 showed that the H4H8-L1B7-IgG1 monoclonal antibody could completely block the binding signals of the H4H8-L1B7 phages and S8E1 phages to the recombinant protein gH / gL, and had no effect on the binding signals of the other two phages (S7A10 and S8B8) to the recombinant protein gH / gL.

[0062] Example 9: Construction and screening of a fully human monoclonal antibody H4H8-L1B7 light chain mutant library of anti-varicella zoster virus recombinant protein gH / gL 9.1 Construction and Screening of the H4H8-L1B7 Light Chain Mutant Library Based on the dual vector phage display system, the strategy of light chain CDR mutation (specific operations can be referred to Example 5 of the Chinese Patent No. 201510097117.0 previously filed by the applicant, the entire contents of which are incorporated herein by reference) was used to measure the in vitro affinity of the H4H8-L1B7 monoclonal antibody. A LCDR3 mutation library with a capacity of more than 5.5E+07 was constructed using classical overlap extension PCR method, and the design scheme of the mutation library is shown in Table 4.

[0063] [Table 4]

[0064] Using recombinant gH-His / gL protein as an antigen, the LCDR3 mutation library of L1B7 (SEQ ID NO:28) was screened twice based on the H4H8-L1B7 heavy chain using a solid-phase screening strategy, and finally three light chain variants L13C1 (SEQ ID NO:8), L13C7 (SEQ ID NO:9), and L14H8 (SEQ ID NO:10) were obtained.

[0065] 9.2 Affinity analysis of H4H8-L1B7 light chain mutants Using standard molecular biology techniques, the light and heavy chains encoding H4H8-L14H8, H4H8-L13C1, and H4H8-L13C7 were cloned into eukaryotic expression vectors to produce fully human monoclonal antibodies in the recombinant human IgG1-κ format. See Example 3, the affinities of the H4H8-L1B7 light chain mutants were analyzed using Biacore X100 evaluation software version 2.0.1, and the results are shown in Table 5.

[0066] [Table 5]

[0067] Example 10: Neutralizing activity of anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies The neutralizing activity of monoclonal antibodies H4H8-L14H8, H4H8-L13C1 and H4H8-L13C7 was measured with reference to Example 5. The experimental results are shown in Table 6.

[0068] [Table 6]

[0069] Example 11: Inhibitory activity of anti-varicella zoster virus recombinant protein gH / gL monoclonal antibodies against cell-to-cell spread of the virus Referring to Example 6, the inhibitory activity of monoclonal antibodies H4H8-L14H8, H4H8-L13C1 and H4H8-L13C7 against cell-to-cell spread of the virus was measured. The experimental results are shown in Table 7.

[0070] [Table 7]

[0071] Example 12: Mediation of ADCC effect on infected cells by anti-varicella zoster virus monoclonal antibodies The inventors of the present invention constructed a Jurkat-dual-CD16a reporter gene cell line by introducing CD16a plasmid into Jurkat-dual cells from Invivogen. When antibody-dependent cell-mediated cytotoxicity (ADCC) occurs, the activation signal is transferred to the downstream NF-κB pathway via CD16a molecules, and finally, ADCC activity is detected via luciferase. MRC5 cells spread 90% in a T75 cell culture flask were infected with varicella zoster virus (VZV) at MOI=0.01, and observed under a microscope. 50-60% of the cells in the culture flask developed lesions (96 hours after infection), and the cells were digested with pancreatic enzymes and then harvested. Jurkat-Dual-CD16a cells and target cells (MRC-5 cells) infected with VZV were mixed at an effector cell to target cell ratio of 15:1. The test molecules H4H8-L14H8-IgG1, H4H8-L13C1-IgG1, H4H8-L1B7-IgG1 and homotype control IgG1 antibody were each started at a final concentration of 60 μg / mL, diluted 3-fold to a total of 10 concentration points, and co-cultured with the above mixed cells. After 20 h incubation, they were centrifuged to take 50 μL of the supernatant, and an automatic sample program was set up on the microplate reader, 50 μL of luciferase detection solution quanti-luc (Invivogen, product number rep-qlc2) was added to each well, and fluorescence intensity was measured by full wavelength detection. The results of ADCC activity based on the Jurkat-Dual-CD16a reporter gene system (Figure 3) showed that H4H8-L14H8-IgG1 and H4H8-L13C1-IgG1 had better ADCC activity than H4H8-L1B7-IgG1.

[0072] Although various exemplary embodiments of the present invention have been described above, those skilled in the art may modify or improve the exemplary embodiments described in the present invention without departing from the spirit and scope of this specification, and the resulting variations or equivalent aspects also belong to the scope of the present invention.

[0073] References Davison, A. J., and J. E. Scott. 1986. The complete DNA sequence of varicella-zoster virus. J. Gen. Virol. 67:1759-1816. Davison, A. J., C. M. Edson, R. W. Ellis, B. Forghani, D. Gilden, C. Grose, P. M. Keller, A. Vafai, Z. Wroblewska, and K. Yamanishi. 1986. A new common nomenclature for the glycoprotein genes of varicella-zoster virus and their glycosylated products. J. Virol. 57:1195-1197. Kapsenberk, J. G. 1964. Possible antigenic relationship between varicellazoster virus and herpes simplex virus. Arch. Ges. Virusforsch. 15:67-73. Forghani, B., L. Ni, and C. Grose. 1994. Neutralization epitope of the varicella-zoster virus gH:gL glycoprotein complex. Virology 199:458-462. Zhu, Z., M. D. Gershon, R. Ambron, C. Gabel, and A. A. Gershon. 1995. Infection of cells by varicella zoster virus: inhibition of viral entry by mannose 6-phosphate and heparin. Proc. Natl. Acad. Sci. USA 92:3546-3550. Sadzot-Delvaux, C., M. P. Merville-Louis, P. Delree, P. Marc, J. Piette, G. Moonen, and B. Rentier. 1990. An in vivo model of varicella-zoster virus latent infection of dorsal root ganglia. J. Neurosci. Res. 26:83-89. Gershon, A. A., S. P. Steinberg, and L. Gelb. 1984. Clinical reinfection with varicella-zoster virus. J. Infect. Dis. 149:137-142. Guess, H. A., D. D. Broughton, L. J. Melton, and L. T. Kurland. 1985. Epidemiology of herpes zoster in children and adolescents: a populationbased study. Pediatrics 76:512-518. Bogger-Goren, S., J. M. Bernstein, A. A. Gershon, and P. L. Ogra. 1984. Mucosal cell-mediated immunity to varicella-zoster virus: role in protection against disease. J. Pediatr. 105:195-199 Zaia, J. A., M. J. Levin, S. R. Preblud, J. Leszczynski, G. G. Wright, R. J. Ellis, A. C. Curtis, M. A. Valerio, and J. LeGore. 1983. Evaluation of varicella-zoster immune globulin: protection of immunosuppressed children after household exposure to varicella. J. Infect. Dis. 147:737-743. Gershon, A.A.; Steinberg, S.; Gelb, L.; NIAID-Collaborative-Varicella-Vaccine-Study-Group. Live attenuated varicella vaccine: Efficacy for children with leukemia in remission. JAMA 1984, 252, 355-362. Chen, J.; Gershon, A.; Silverstein, S.J.; Li, Z.S.; Lungu, O.; Gershon, M.D. Latent and lytic infection of isolated guinea pig enteric and dorsal root ganglia by varicella zoster virus. J. Med. Virol. 2003, 70, S71-S78. Oxman, MN; Levin, MJ; Johnson, GR; Schmader, KE; Straus, SE; Gelb, LD; Arbeit, RD; Simberkoff, M.; Gershon, A.; Davis, LE; et al. A vaccine to prevent herpes zoster and postherpetic neuralgia in older adults. N. Engl. J. Med. 2005, 352, 2271-2284. Cunningham, AL; Lal, H.; Kovac, M.; Chlibek, R.; Hwang, SJ; Diez-Domingo, J.; Godeaux, O.; Levin, M.; McElhaney, JE; Puig-Barbera, J.; et al. Efficacy of the Herpes Zoster Subunit Vaccine in Adults 70 Years of Age or Older. N. Engl. J. Med. 2016, 375, 1019-1032.

Claims

1. An antibody against varicella zoster virus, A heavy chain variable region that binds to varicella-zoster virus gH / gL protein and includes HCDR1, HCDR2, and HCDR3 amino acid sequences, and a light chain variable region that includes LCDR1, LCDR2, and LCDR3 amino acid sequences; The HCDR1 amino acid sequence is TYAMH (SEQ ID NO: 47), the HCDR2 amino acid sequence is VISYGGGNRYYAASVKG (SEQ ID NO: 48), the HCDR3 amino acid sequence is ARDNHYFFGMDV (SEQ ID NO: 49), the LCDR1 amino acid sequence is RASQGISSWLA (SEQ ID NO: 50), the LCDR2 amino acid sequence is AASSLQS (SEQ ID NO: 51), and the LCDR3 amino acid sequence is QQANSSFPLT (SEQ ID NO: 52), QEGFYFPIN (SEQ ID NO: 53), QQATYFPIN (SEQ ID NO: 54), or QQSSYFPIA (SEQ ID NO: 55). No.: 55), The HCDR and LCDR amino acid sequences are defined according to Kabat, antibody.

2. The antibody of claim 1, wherein the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:

7.

3. The antibody of claim 1 , wherein the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO: 8, 9, 10 or 28.

4. The amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:8; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:9; or the amino acid sequence of the heavy chain variable region of the antibody is set forth in SEQ ID NO:7 and the amino acid sequence of the light chain variable region of the antibody is set forth in SEQ ID NO:10; or The antibody of claim 1 , wherein the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 7 and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO:

28.

5. The antibody of any one of claims 1 to 4, wherein the amino acid sequence of the heavy chain variable region of the antibody has at least 90% identity to SEQ ID NO: 7, and the amino acid sequence of the light chain variable region of the antibody has at least 90% identity to any one of SEQ ID NOs: 8, 9, 10, and 28.

6. The antibody may be a complete antibody, a Fab fragment, an F(ab') ２ and / or the antibody is a fully human antibody, and / or the antibody is a monoclonal antibody, and / or the antibody further comprises a heavy chain constant region selected from an IgG1, IgG2 or IgG4 subtype; and / or The antibody of any one of claims 1 to 4, further comprising a light chain constant region selected from the κ or λ subtype.

7. An antibody described in any one of claims 1 to 4, wherein the antibody mediates antibody-dependent cell-mediated cytotoxicity (ADCC).

8. A nucleic acid molecule encoding the antibody according to any one of claims 1 to 7.

9. A pharmaceutical composition comprising the antibody of any one of claims 1 to 7 and a pharma- ceutically acceptable excipient, diluent or carrier.

10. The pharmaceutical composition according to claim 9 for preventing or treating chickenpox and shingles.

Images