Tumor immunotherapy using sindbis virus vectors and agonistic monoclonal antibodies

Abstract

The present disclosure provides compositions and methods for treating cancer. More specifically, the present disclosure provides compositions and methods that utilize a combination of an oncolytic virus (such as Sindbis virus) and an antibody against a costimulatory molecule or an immune system agonist molecule (such as an anti-OX40 antibody and an anti-4-1BB antibody).

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 62 / 871,675, filed July 8, 2019, the contents of which are incorporated herein by reference in their entirety.

[0002] Inclusion by reference of an array list This application contains a Sequence Listing that was submitted via EFS-Web in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on July 3, 2020, is named "27522-0225PCT Sequence Listing_ST25.txt" and is 34 kilobytes in size. [Technical field]

[0003] The present disclosure describes compositions and methods for treating cancer, which utilize an oncolytic virus, such as Sindbis virus, and antibodies against costimulatory or immune system agonist molecules, such as OX-40 and 4-1BB (CD137). [Background technology]

[0004] Immune checkpoint modulation has shown remarkable promise in the treatment of cancer. Patients with highly immunogenic tumors have demonstrated high response rates with immune checkpoint blockade, but the proportion of patients who respond to treatment is often low. The main challenges to overcome are the lack of T cell infiltration into the tumor microenvironment, as well as the immunosuppressive nature of tumors, which inhibits intratumoral immune responses. Furthermore, tumors tend to quickly escape immune responses by mutating or losing expression of drug targets or tumor antigens targeted by immune responses. Thus, there is a need in the art for compositions and methods that overcome these limitations. The present disclosure addresses these needs. Summary of the Invention

[0005] The present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of (a) an oncolytic viral vector, and (b) an antibody to a costimulatory molecule or a nucleic acid encoding the same; or an antibody to an immune system agonist molecule or a nucleic acid encoding the same to a subject.

[0006] The oncolytic viral vector may be a Sindbis viral vector. The Sindbis viral vector may be replication-deficient. The Sindbis viral vector may comprise at least one nucleic acid encoding a therapeutic protein. The Sindbis viral vector may comprise at least one nucleic acid encoding an immunostimulatory or immunomodulatory protein. The immunostimulatory or immunomodulatory protein may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, or any combination thereof. In a preferred embodiment, the immunostimulatory or immunomodulatory protein is IL-12. The Sindbis viral vector may include at least one nucleic acid encoding LacZ, Flue, or GFP.

[0007] The antibody may be an anti-OX40 antibody, an anti-4-1BB antibody, an anti-CD28 antibody, an anti-GITR antibody, an anti-CD137 antibody, an anti-CD37 antibody, an anti-HVEM antibody, or a combination thereof.

[0008] The Sindbis viral vectors and antibodies can induce an immune response in a tumor-associated antigen (TAA) non-specific manner. The induced non-specific immune response can be a primary immune response. The primary immune response can be followed by a secondary immune response. The secondary immune response can be the result of one or more TAAs released from dead tumor cells. The secondary immune response can include memory T cells against one or more TAAs released from dead tumor cells.

[0009] The present disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of (a) a Sindbis virus vector comprising a nucleic acid encoding interleukin-12, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding the same; to the subject, thereby treating the cancer in the subject.

[0010] The Sindbis viral vector may be replication-defective. The Sindbis viral vector may include a nucleic acid encoding interleukin-12 and may further include a nucleic acid encoding an anti-OX40 monoclonal antibody. The method may include administering a Sindbis viral vector including a nucleic acid encoding interleukin-12 and administering a Sindbis viral vector including a nucleic acid encoding an anti-OX40 monoclonal antibody. The Sindbis viral vector may include a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector may include a nucleic acid encoding an interleukin-12 alpha subunit of GenBank Accession No. M86672 and an interleukin-12 beta subunit of GenBank Accession No. M86671 (IL-12beta, IL-12, p40 subunit). The nucleic acid encoding the interleukin-12 α subunit comprises the nucleic acid sequence of SEQ ID NO:1, and the nucleic acid encoding the interleukin-12 β subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0011] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1, and can include a nucleic acid encoding an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO:3, and the amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO:4.

[0012] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0013] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0014] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0015] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0016] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0017] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0018] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0019] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0020] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0021] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 31. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 34.

[0022] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 31. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:34.

[0023] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 35. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 38.

[0024] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 35. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:38.

[0025] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 39. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 42.

[0026] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 39. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:42.

[0027] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 43. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 46.

[0028] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 43. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:46.

[0029] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 47. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 50.

[0030] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 47. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:50.

[0031] The Sindbis viral vector and the anti-OX40 monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-OX40 monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-OX40 monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-OX40 monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0032] The antibodies or fragments thereof of the present disclosure may be derived from any species, including, but not limited to, human, mouse, rat, hamster, dog, rabbit, frog, sheep, goat, cow, horse, pig, bird, donkey, chicken, camel, llama, dromedary, alpaca, shark, cow, and turtle. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from human. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from camel, llama, or alpaca. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from shark. In some embodiments, the antibodies or fragments thereof of the present disclosure are chimeric antibodies derived from two or more of the aforementioned species. In a non-limiting example, the antibodies or fragments thereof of the present disclosure may be chimeric antibodies derived from human and mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure can be derived from any species other than human and can be further humanized using standard methods known in the art to reduce the immunogenicity of the antibodies.

[0033] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and diabody fragments.

[0034] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0035] The present disclosure further provides a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a nucleic acid encoding an anti-OX40 monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding interleukin-12, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding same. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding interleukin-12, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody.

[0036] The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit having GenBank Accession No. M86672 and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit) having GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0037] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1, and can include a nucleic acid encoding an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0038] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0039] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0040] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO: 10.

[0041] The Sindbis viral vector can include a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO: 12.

[0042] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0043] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0044] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0045] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0046] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0047] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 31. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 34.

[0048] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 31. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:34.

[0049] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 35. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 38.

[0050] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 35. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38.

[0051] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 39. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 42.

[0052] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 39. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:42.

[0053] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 43. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 46.

[0054] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 43. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:46.

[0055] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 47. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 50.

[0056] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 47. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:50.

[0057] The antibodies or fragments thereof of the present disclosure may be derived from any species, including, but not limited to, human, mouse, rat, hamster, dog, rabbit, frog, sheep, goat, cow, horse, pig, bird, donkey, chicken, camel, llama, dromedary, alpaca, shark, cow, and turtle. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from human. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from camel, llama, or alpaca. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from shark. In some embodiments, the antibodies or fragments thereof of the present disclosure are chimeric antibodies derived from two or more of the aforementioned species. In a non-limiting example, the antibodies or fragments thereof of the present disclosure may be chimeric antibodies derived from human and mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure can be derived from any species other than human and can be further humanized using standard methods known in the art to reduce the immunogenicity of the antibodies.

[0058] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0059] The disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1, thereby treating the cancer in the subject.The disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a nucleic acid encoding NY-ESO-1, thereby treating the cancer in the subject.

[0060] The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit having GenBank Accession No. M86672 and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit) having GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0061] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1, and can include a nucleic acid encoding an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0062] The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0063] The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and the Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered sequentially or simultaneously. The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 can be administered systemically. The Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered systemically. Both the Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and the Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered systemically. The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 can be administered parenterally. The Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered parenterally. Both the Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and the Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered parenterally. The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 can be administered intraperitoneally. The Sindbis viral vector containing a nucleic acid encoding NY-ESO-1 can be administered intraperitoneally. Both the Sindbis viral vector containing a nucleic acid encoding interleukin-12 and the Sindbis viral vector containing a nucleic acid encoding NY-ESO-1 can be administered intraperitoneally.

[0064] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0065] The present disclosure further provides a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a nucleic acid encoding NY-ESO-1. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding interleukin-12, and (b) a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1.

[0066] The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit of GenBank Accession No. M86672 and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit) of GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0067] The Sindbis viral vector comprises a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and comprises a nucleic acid encoding an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0068] The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0069] The present disclosure provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) a Sindbis virus vector comprising a nucleic acid encoding NY-ESO-1 and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding same, thereby treating the cancer in the subject.

[0070] The Sindbis viral vector may be replication-defective. The Sindbis viral vector may comprise a nucleic acid encoding NY-ESO-1 and may further comprise a nucleic acid encoding an anti-OX40 monoclonal antibody. The method may comprise administering a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 and administering a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody. The Sindbis viral vector may comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector may comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0071] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0072] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80, 85%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0073] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0074] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0075] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO: 9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO: 11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO: 10 and an anti-OX40 antibody light chain of SEQ ID NO: 12.

[0076] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0077] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0078] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0079] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0080] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 31. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 34.

[0081] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 31. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:34.

[0082] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 35. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 38.

[0083] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 35. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38.

[0084] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 39. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 42.

[0085] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 39. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:42.

[0086] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 43. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 46.

[0087] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 43. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:46.

[0088] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 47. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 50.

[0089] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 47. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:50.

[0090] The Sindbis viral vector and the anti-OX40 monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-OX40 monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-OX40 monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-OX40 monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0091] The antibodies or fragments thereof of the present disclosure may be derived from any species, including, but not limited to, human, mouse, rat, hamster, dog, rabbit, frog, sheep, goat, cow, horse, pig, bird, donkey, chicken, camel, llama, dromedary, alpaca, shark, cow, and turtle. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from human. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from camel, llama, or alpaca. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from shark. In some embodiments, the antibodies or fragments thereof of the present disclosure are chimeric antibodies derived from two or more of the aforementioned species. In a non-limiting example, the antibodies or fragments thereof of the present disclosure may be chimeric antibodies derived from human and mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure can be derived from any species other than human and can be further humanized using standard methods known in the art to reduce the immunogenicity of the antibodies.

[0092] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0093] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0094] The present disclosure further provides a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 and a nucleic acid encoding an anti-OX40 monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding the same. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0095] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0096] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0097] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0098] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0099] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0100] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0101] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0102] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0103] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0104] The antibodies or fragments thereof of the present disclosure may be derived from any species, including, but not limited to, human, mouse, rat, hamster, dog, rabbit, frog, sheep, goat, cow, horse, pig, bird, donkey, chicken, camel, llama, dromedary, alpaca, shark, cow, and turtle. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from human. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from camel, llama, or alpaca. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from shark. In some embodiments, the antibodies or fragments thereof of the present disclosure are chimeric antibodies derived from two or more of the aforementioned species. In a non-limiting example, the antibodies or fragments thereof of the present disclosure may be chimeric antibodies derived from human and mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure can be derived from any species other than human and can be further humanized using standard methods known in the art to reduce the immunogenicity of the antibodies.

[0105] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0106] The present disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) a Sindbis viral vector and (b) an anti-4-1BB (CD137) monoclonal antibody or a nucleic acid encoding same, thereby treating the cancer in the subject. The present disclosure further provides an in vitro or ex vivo method for treating cancer or evaluating the treatment of cancer in a subject, the method comprising contacting a biological sample from the subject with (a) a Sindbis viral vector and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding same. The Sindbis viral vector does not contain endogenous nucleic acid encoding a protein.

[0107] The Sindbis viral vector is replication-deficient. The Sindbis viral vector may comprise a nucleic acid sequence encoding a therapeutic protein, an immunostimulating protein, or an immunomodulating protein. The Sindbis viral vector may comprise a nucleic acid encoding a therapeutic protein, an immunostimulating protein, or an immunomodulating protein, and may further comprise a nucleic acid encoding an anti-4-1BB monoclonal antibody. The Sindbis viral vector may comprise a nucleic acid sequence encoding LacZ (lac operon structural gene LacZ encoding β-galactosidase), Flue (firefly luciferase), or GFP (green fluorescent protein). The Sindbis viral vector may comprise a nucleic acid encoding LacZ, Flue, or GFP, and may further comprise a nucleic acid encoding an anti-4-1BB monoclonal antibody.

[0108] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the heavy chain complementarity determining region 1 (HCDR1), HCDR2 and HCDR3 amino acid sequences of SEQ ID NO: 16, 17 and 18, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 19. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the light chain complementarity determining region 1 (LCDR1), LCDR2 and LCDR3 amino acid sequences of SEQ ID NO: 20, 21 and 22, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the amino acid sequence of SEQ ID NO: 23.

[0109] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24.

[0110] The immune stimulating or immune modulating protein may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, or any combination thereof. In a preferred embodiment, the immune stimulating or immune modulating protein is IL-12. The anti-4-1BB antibody may be urelumab, utomirumab, or a combination thereof. The anti-4-1BB antibody may be InVivoMAb anti-mouse 4-1BB (BioXCell, Clone:LOB12.3, Cat. No. BE0169).

[0111] The Sindbis viral vector and the anti-4-1BB monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-4-1BB monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-4-1BB monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-4-1BB monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-4-1BB monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-4-1BB monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-4-1BB monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0112] The antibodies or fragments thereof of the present disclosure may be derived from any species, including, but not limited to, human, mouse, rat, hamster, dog, rabbit, frog, sheep, goat, cow, horse, pig, bird, donkey, chicken, camel, llama, dromedary, alpaca, shark, cow, and turtle. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from human. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from camel, llama, or alpaca. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from shark. In some embodiments, the antibodies or fragments thereof of the present disclosure are chimeric antibodies derived from two or more of the aforementioned species. In a non-limiting example, the antibodies or fragments thereof of the present disclosure may be chimeric antibodies derived from human and mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure can be derived from any species other than human and can be further humanized using standard methods known in the art to reduce the immunogenicity of the antibodies.

[0113] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against 4-1BB or the anti-4-1BB monoclonal antibody described herein may be a full-length antibody against the 4-1BB antibody or an antigen-binding fragment thereof, and the fragment retains the binding to the 4-1BB receptor on the cell surface. The "antigen-binding fragment" of the anti-4-1BB antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0114] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be a carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In a preferred embodiment, the cancer is a lymphoma. In a preferred embodiment, the cancer is a B-cell lymphoma.

[0115] The present disclosure provides a Sindbis viral vector comprising a nucleic acid encoding a therapeutic protein, an immunostimulatory protein, or an immunomodulatory protein, and a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure provides a Sindbis viral vector comprising a nucleic acid encoding LacZ, Flue, or GFP, and a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding a therapeutic protein, an immunostimulatory protein, or an immunomodulatory protein, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding LacZ, Flue, or GFP, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure further provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding a therapeutic protein, an immunostimulatory protein, or an immunomodulatory protein, and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding the same. The present disclosure provides a composition comprising: (a) a Sindbis virus vector comprising a nucleic acid encoding LacZ, Flue, or GFP; and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding same.

[0116] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the heavy chain complementarity determining region 1 (HCDR1), HCDR2 and HCDR3 amino acid sequences of SEQ ID NO: 16, 17 and 18, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 19. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the light chain complementarity determining region 1 (LCDR1), LCDR2 and LCDR3 amino acid sequences of SEQ ID NO: 20, 21 and 22, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the amino acid sequence of SEQ ID NO: 23.

[0117] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24.

[0118] The immune stimulatory or immune modulating protein may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, or any combination thereof. In a preferred embodiment, the immune stimulatory or immune modulating protein is IL-12.

[0119] The antibodies or fragments thereof of the present disclosure may be derived from any species, including, but not limited to, human, mouse, rat, hamster, dog, rabbit, frog, sheep, goat, cow, horse, pig, bird, donkey, chicken, camel, llama, dromedary, alpaca, shark, cow, and turtle. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from human. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from camel, llama, or alpaca. In some embodiments, the antibodies or fragments thereof of the present disclosure are derived from shark. In some embodiments, the antibodies or fragments thereof of the present disclosure are chimeric antibodies derived from two or more of the aforementioned species. In a non-limiting example, the antibodies or fragments thereof of the present disclosure may be chimeric antibodies derived from human and mouse. In some embodiments, the antibodies or fragments thereof of the present disclosure can be derived from any species other than human and can be further humanized using standard methods known in the art to reduce the immunogenicity of the antibodies.

[0120] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against 4-1BB or the anti-4-1BB monoclonal antibody described herein may be a full-length antibody against the 4-1BB antibody or an antigen-binding fragment thereof, and the fragment retains the binding to the 4-1BB receptor on the cell surface. The "antigen-binding fragment" of the anti-4-1BB antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0121] Any of the above aspects can be combined with any other aspect.

[0122] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. As used herein, the singular includes the plural unless the context clearly dictates otherwise, and by way of example, the terms "a", "an" and "the" are understood to be singular or plural, and the term "or" is understood to be inclusive. As an example, "element" means "one or more elements." Throughout this specification, the word "comprise" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a referenced element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the referenced value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about."

[0123] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references described herein are incorporated herein by reference in their entirety. References cited herein are not admitted to be prior art to the claimed invention. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting. Other features and advantages of the present disclosure will become apparent from the following detailed description and claims. [Brief description of the drawings]

[0124] Figures 1A-1D: SV.IL12 induces a modest therapeutic effect and increases OX40 expression on CD4 T cells. Figure 1 shows an outline of the treatment. BALB / c mice were administered 7 × 10 4After injection of 100 mg of CT.26.Fluc, intraperitoneal (ip) injections of SV, IL-12 (50 ng), or SV.IL12 were performed at various time points. Figure 1B shows survival plots of control and treated mice bearing CT26.Fluc tumors. The x-axis shows days of treatment, and the y-axis shows survival percentage. Statistical significance between SV.IL12 and all other groups was determined with the Mantel-Cox test. Results are representative of at least two independent experiments. Figure 1C-D show the effect on OX40 expression of CT26 tumor-bearing mice treated with SV, IL-12 (50 ng), or SV.IL12 for 4 consecutive days (days 1, 2, 3, and 4). Spleens were excised on day 7, and single-cell suspensions were stained and analyzed by flow cytometry. Naïve and untreated (control) tumor-bearing mice were used as controls. Figure 1C shows the percentage of OX40 expression by CD4 T cells (left), regulatory T cells (TREG; middle), and CD8 T cells (right). The x-axis shows the different treatment groups, and the y-axis shows the percentage of OX40+ cells. Figure 1D shows representative flow cytometry plots showing OX40 staining in different T cell subsets. Bars represent the mean, and each symbol represents an individual mouse. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test or Mann-Whitney test. Results are representative of at least two independent experiments.

[0125] Figure 2A-2C: SV infects monocytes / macrophages in mediastinal lymph nodes and rapidly activates T cells Figure 2A shows that tumor-free mice were treated ip with SV expressing firefly luciferase (Flue) protein. After 4 h, bioluminescence images were taken to monitor Flue expression derived from SV. To determine the signal source, mediastinal lymph nodes (LNs) and adipose tissues were extracted and imaged separately. Figure 2B shows the percentage of GFP expression by Ly6G-CD11b+F4 / 80+ cells. Figure 2C shows the percentage of CD69 expression by CD4 (left graph) and CD8 (right graph) T cells. Tumor-free mice were treated ip with SV expressing GFP for 4 consecutive days. On the fifth day, mediastinal and inguinal LNs were extracted, and single-cell suspensions were stained and analyzed by flow cytometry. Naive mice were used as controls. Statistical significance was determined using the Mann-Whitney test. Results are representative of at least two independent experiments.

[0126] Figures 3A-3D: IL-12 and IFN-γ production from SV.IL12 infection Figure 3A shows IL-12 levels in the supernatants of infected cells as measured by ELISA. 5MyC-CaP cells were infected with SV.IL12 at various MOIs (10; 1; 0.1) for 2 h. As controls, MyC-CaP cells were infected with SV or left uninfected (sham). SV was washed out and replaced with fresh medium. After 24 h of incubation, supernatants were collected and IL-12 was measured by ELISA. Figure 3B shows IL-12 levels in plasma measured by ELISA. Figure 3C shows the percentage of Tbet expression by CD4 T cells in cell suspensions from mediastinal LNs stained and analyzed by flow cytometry. Figure 3D shows IFN-γ enzyme-linked immunospot analysis of splenocytes from control and mice treated as indicated (n = 3–10 mice / group). Tumor-bearing mice were treated with SV.IL12 for 4 consecutive days (days 1; 2; 3; 4). Naïve, untreated (control), IL-12 (50 ng), and SV-treated mice served as controls. Plasma, spleen, and mediastinal LNs were harvested from each mouse on day 7. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test or Mann-Whitney test. Results are representative of at least two independent experiments.

[0127] Figure 4A-4B: SV infectivity of MyC-CaP.Fluc tumors MyC-CaP.Fluc and CT.26.Fluc cells were incubated with serially diluted single-round replicating SV.GFP (10 -1 ~10 -4 ) and incubated overnight. Sixteen hours after infection, the percentage of GFP-positive cells for each dilution was analyzed by flow cytometry. Figure 4A shows representative flow cytometry plots of GFP-positive MyC-CaP.Fluc and CT.26.Fluc cells for each dilution and for the uninfected control. Figure 4B shows the plotted infectivity curves of GFP-positive cells.

[0128] Figures 5A-5E: SV.IL12 in combination with anti-OX40 antibodies cures established tumors in vivo. FIG. 5A shows the experimental protocol for the prostate and colon cancer models. FVB / NJ or BALB / c mice were injected with 10 5MyC-CaP.Fluc or 7 x 10 4 CT26.Fluc cells were injected into the mice, followed by ip injection of SV.IL12 and / or anti-OX40 at various time points. FIG. 5B shows CT26.Fluc tumor growth curves shown as fold change relative to day 0 luminescence in the same mice. Each line represents an individual mouse. Left graph: control (n=14) (top), and SV.IL12 (n=20) (bottom). Right graph: anti-OX40 (n=10) (top), and SV.IL12+anti-OX40 (n=11) (bottom). FIG. 5C shows representative bioluminescence images of control and treated CT26.Fluc-bearing mice. FIG. 5D shows survival plots of control and treated mice with peritoneally seeded CT26.Fluc tumors. FIG. 5E shows survival plots of control and treated mice with peritoneally seeded MyC-CaP.Fluc tumors. The Mantel-Cox test determined statistical significance between SV.IL12+anti-OX40 and anti-OX40 or SV.IL12. Results are representative of at least two independent experiments.

[0129] Figure 6A-6B: Tumor growth in MyC-CaP.Fluc tumor-bearing mice during treatment FVB / NJ mice were cultured for 10 days on day 0. 5 MyC-CaP.Fluc cells were injected into the mouse, followed by intraperitoneal (ip) injection of SV.IL12 and / or anti-OX40 at various time points. Figure 6A shows tumor growth curves shown as fold change relative to day 0 luminescence in the same mouse. Each line represents an individual mouse. Left graph: control (n=10) (top), and SV.IL12 (n=10) (bottom). Right graph: αOX40 (n=10) (top) and SV.IL12+αOX40 (n=10) (bottom). Figure 6B shows representative bioluminescence images of control and treated CT.26.Fluc-bearing mice. Results are representative of at least two independent experiments.

[0130] Figures 7A-7D: The therapeutic effect of SV.IL12 + anti-OX40 is maintained in CT26.Fluc-bearing mice upon reduced treatment regimen Figure 7A shows a treatment summary. BALB / c mice were injected ip with SV.IL12 (days 1 and 8) and / or anti-OX40 (days 2 and 9) (7x10 4Figure 7B shows representative bioluminescence images of control and treated CT26.Fluc-bearing mice. Figure 7C shows tumor growth curves shown as fold change relative to day 0 luminescence of the same mice. Each line represents an individual mouse. Left graph: control (n=14) (top) and SV.IL12 (n=15) (bottom). Right graph: αOX40 (n=17) (top), SV.IL12+αOX40 (n=15) (bottom). Figure 7D shows survival plots of control and treated mice bearing CT26.Fluc tumors. Statistical significance between SV.IL12+αOX40 and SV.IL12 was determined by Mantel-Cox test. Results are representative of at least two independent experiments.

[0131] Figures 8A-8B: The therapeutic effect of SV.IL12 + anti-OX40 is dependent on CD4 and CD8 T cells Figure 8A shows mice injected with anti-CD4 (0.4 mg) or anti-CD8 (0.1 mg) depleting antibodies. As a control, a rat IgG2b (0.4 mg) isotype control was used. The frequency of CD4 and CD8 T cells was assessed by flow cytometry in splenocytes after 24, 48, 72 and 96 hours. Figure 8B shows mice injected with 7 x 10 4 BALB / c mice inoculated with CT.26.Fluc were shown. Depleting antibodies anti-CD4 or anti-CD8 were injected ip on days -3, 1, 5, 9, 13, 17. Mice were left untreated (control) or treated with SV.IL12 and anti-OX40 on days 4 and 11. Tumor growth curves are shown as fold change relative to day 0 luminescence of the same mice. Each line represents an individual mouse.

[0132] Figures 9A-9I: Combination therapy significantly alters the transcriptomic signature of T cells, favoring effector T cells with a Th1 phenotype. Figures 9A-9I show RNA sequencing of T cells isolated from the spleens of untreated tumor-bearing mice (control) compared to mice treated with SV.IL12 and / or anti-OX40 on day 7. Figure 9A shows the principal component analysis (PCA) of normalized read counts obtained from the CT26.Fluc tumor model. Figure 9B shows the PCA of normalized read counts obtained from the MyC-CaP.Fluc tumor model. Figure 9C shows MA plots of differentially expressed genes (DEGs; >2-fold) in T cells from anti-OX40 (top graph), SV.IL12 (middle graph) or SV.IL12 + anti-OX40 (bottom graph) treated mice versus control in the CT.26 model. Significantly (p<0.05), upregulated, and downregulated DEGs are shown in red or blue, respectively. Figure 9D shows pathway and network analysis based on DEGs in T cells isolated from CT26.Fluc-bearing mice treated with combination therapy. Downregulated (blue) and upregulated (red) pathways are shown, respectively. Figure 9E shows heatmap analysis of selected genes based on normalized read counts linked to T cell differentiation and activation and T cell lineage transcription factors. Figures 9F-I show data from tumor-bearing mice treated with SV.IL12 and / or anti-OX40. Naïve and untreated (control) tumor-bearing mice were used as controls. Spleens were removed on day 7 and single cell suspensions were stained and analyzed by flow cytometry. Figure 9F shows the percentage of CD44 or Ki-67 expression by T cells from the CT26.Fluc tumor model. Figure 9G shows the percentage of CD44 or Ki-67 expression by T cells from the MyC-CaP.Fluc tumor model. Figure 9H shows the percentage of ICOS and T-bet expression by CD4 T cells. Figure 91 shows representative flow cytometry plots of ICOS and T-bet expression by CD4 T cells. Bars represent the mean and each symbol represents an individual mouse. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test. Results are representative of at least two independent experiments.

[0133] Figures 10A-10B: Combination therapy induces systemic CD4 and CD8 T cell activation Tumor-bearing mice were left untreated or treated with SV.IL12 and / or anti-OX40. Spleens were excised on day 7 and single cell suspensions were stained and analyzed by flow cytometry. Naïve and untreated (control) tumor-bearing mice were used as controls. Figures 10A and 10B show representative flow cytometry plots of CD44 and Ki-67 expression on CD4 and CD8 T cells in CT.26.Fluc and MyC-CaP.Fluc tumor models, respectively.

[0134] Figures 11A-11G: SV.IL12 + anti-OX40 promotes metabolic reprogramming of T cells Tumor-bearing mice were left untreated or treated with SV.IL12 and / or anti-OX40. T cells were isolated from spleens at day 7 or as described elsewhere. Figure 11A shows selected gene set enrichment analysis (GSEA) of oxidative phosphorylation and glycolysis pathways based on DEGs in control vs SV+anti-OX40. Figure 11B shows mitochondrial respiration assessed by measuring median oxygen consumption rate (OCR) in T cells of the indicated groups using an extracellular flux analyzer. To confirm energetic mitochondrial phenotype, oligomycin, FCCP, antimycin and rotenone were injected as indicated. Figure 11C shows Mitotracker Green FM staining of T cells from the indicated groups using flow cytometry. Figure 11D shows Mitotracker Deep Red FM staining of T cells from the indicated groups using flow cytometry. FIG. 11E shows Western blots of c-Myc protein expression in T cells from control mice or mice treated with anti-OX40, SV.IL12 or SV.IL12+anti-OX40. GAPDH (bottom) is a loading control. FIG. 11F shows basal extracellular acidification rates (ECAR) in T cells from the indicated groups obtained from CT26.Fluc and MyC-CaP.Fluc tumor models. FIG. 11G shows the energy profiles (OCR vs ECAR) of T cells from naive or CT26.Fluc-bearing mice treated with SV.IL12+anti-OX40 on days 7, 14 and 40. Error bars show SEM. Results are representative of at least two independent experiments in FIG. 11B-G.

[0135] Figures 12A-12D: Combination therapy metabolically reconstitutes T cells Figures 12A and 12B show metabolic activity of T cells isolated from the spleens of mice bearing CT.26.Fluc or MyC-CaP.Fluc, respectively (day 7). Basal OCR (left) and respiratory capacity (right) were measured in T cells from the indicated groups using an extracellular flux analyzer. Figure 12C shows representative flow cytometry plots of Mitotracker Green FM and Mitotracker Deep Red staining in CD4 and CD8 T cells isolated from the spleens of CT26.Fluc tumor-bearing mice. Figure 12D shows the energy profile (OCR vs ECAR) of T cells from CT26.Fluc-bearing mice naïve (lower graph) or treated with SV.IL12 + anti-OX40 (upper graph) on days 7, 14 and 30. Data represent the mean of three different experiments. Bars represent the mean ± SEM (A, B, D). Results are representative of at least two independent experiments.

[0136] Figures 13A-13G: Reprogrammed T cells in SV+anti-OX40 treated mice show enhanced CD4-mediated cytokine production and anti-tumor activity. Tumor-bearing mice were left untreated or treated with SV.IL12 and / or anti-OX40. Spleens were excised on day 7 and further analyzed. Figure 13A shows heatmap analysis of selected genes based on normalized read counts that were linked to cytokine expression and enhanced antitumor activity. Figure 13B shows RNA sequencing performed on T cells isolated from CT26.Fluc tumor-bearing mice. Figure 13C shows interferon-gamma (IFN-γ) enzyme-linked immunospot analysis of splenocytes from control and mice treated as indicated (n=5-10 mice / group). IFN-γ enzyme-linked immunospot analysis was also performed on splenocytes depleted of CD4 or CD8 T cells in the CT26.Fluc (top) and MyC-CaP.Fluc (bottom) tumor models. Figure 13D shows representative flow cytometry plots of T-bet and granzyme B (GrB) expression by CD4 T cells from the indicated groups using flow cytometry. Figure 13E shows the percentage of T-bet and granzyme B (GrB) expression by CD4 T cells from the indicated groups using flow cytometry in Figure 13D. Figure 13F shows the cytotoxic activity of T cells from control and treated mice (n=5-10 mice per group) (co-cultured with either CT26.FLUC at an effector-to-target cell ratio of 10:1). Figure 13G shows the MyC-CaP.Fluc tumor cell line on day 2. Additionally, T cells were depleted of CD4 or CD8 T cells and co-cultured as previously described. Cytotoxic activity was assessed based on tumor cell viability determined by measuring luciferase activity and is shown relative to naive T cells. In Figures 13B, 13F, 13G, bars represent the mean ± SEM and each symbol represents an individual mouse in Figure 13E. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test. Results are representative of at least two independent experiments.

[0137] Figures 14A-14F: CD8 T cells exhibit enhanced cytotoxic potential in mice treated with SV.IL12 and anti-OX40. Tumor-bearing mice were left untreated or treated with SV.IL12 with or without anti-OX40. Mice were sacrificed on day 7 and T cell immune responses in the spleen were analyzed. Figures 14A-B show the percentage of granzyme B and T-bet expression by CD8 T cells from CT26.Fluc tumor-bearing mice. Figures 14C-D show the percentage of granzyme B and T-bet expression by CD8 T cells from MyC-CaP.Fluc tumor-bearing mice, respectively. Figures 14B and 14D show representative flow cytometry plots. Figures 14E and 14F show the percentage of NKG2D (left graph) or T-bet (right graph) expression by CD8 T cells in CT26.Fluc and MyC-CaP.Fluc tumor-bearing mice, respectively. Bars represent the mean and each symbol represents an individual mouse. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test. Results are representative of at least two independent experiments.

[0138] Figures 15A-15F: Mice treated with SV.IL12 + anti-OX40 show enhanced T cell migration and intratumoral T cell activity. CT26.Fluc-bearing mice were left untreated or treated with SV.IL12 and / or anti-OX40. Spleens were removed on day 7 and single cell suspensions were stained and analyzed by flow cytometry. Figure 15A shows the percentage of CXCR3 expression by CD4 (left graph) and CD8 (right graph) T cells. Figure 15B shows representative flow cytometry plots. Tumors were harvested from control and treated mice 2 weeks after treatment. Figure 15C shows intratumoral gene expression of CXCL9 (top) and CXCL10 (bottom) analyzed by real-time PCR. Data are normalized to GAPDH. Figure 15D shows intratumoral T cell immune responses from the indicated groups assessed by flow cytometry. Percentage of CD4 expression by T cells (left graph), Ki-67 expression by CD4 T cells (middle graph), and Granzyme B expression (right graph). Figure 15E shows multiple immunofluorescence staining of tumors isolated from CT26.Fluc tumor-bearing mice. Figure 15F shows multiple immunofluorescence staining of tumors isolated from MyC-CaP.Fluc tumor-bearing mice. Representative images of T cell infiltration are shown for control, as well as anti-OX40, SV.IL12 and SV.IL12 + anti-OX40. Proteins of interest were stained and indicated by color in each image: K-i67 (red), CD3 (green), CD8 (magenta), and DAPI nuclear staining appear in blue. In Figure 15C, bars represent the mean ± SEM, and in 15A and 15D, each symbol represents an individual mouse. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test. Results are representative of at least two independent experiments.

[0139] Figures 16A-16D: In mice treated with SV.IL12 + anti-OX40, T cells show increased migration to tumors and exert anti-tumor activity. Tumor-bearing mice were left untreated or treated with SV.IL12 with or without anti-OX40. Mice were sacrificed on days 7 and 14 to analyze T cell immune responses in the spleen. Figures 16A-C show the percentage of CXCR3 expression by CD4 (left graph) and CD8 (right graph) T cells measured by flow cytometry in the CT26.Fluc tumor model on day 14, in the MyC-CaP.Fluc tumor model on day 7 (B), and in the MyC-CaP.Fluc tumor model on day 14 (C), respectively. Figure 16D shows the percentage of CD8 expression by T cells (left graph), Ki-67 expression (middle graph), and Granzyme B expression (right graph) by CD8 T cells. Tumors were harvested from control and treated mice 2 weeks after treatment. T cell immune responses from the indicated groups were assessed by flow cytometry. Bars represent the mean and each symbol represents an individual mouse. Statistical significance was determined using the Kruskal-Wallis test followed by Dunns' test. Results are representative of at least two independent experiments.

[0140] Figure 17: Combination therapy stimulates Granzyme B expression in MyC-CaP.Fluc tumors. Figure 17 shows tumors stained by multiplex immunofluorescence. MyC-CaP.Fluc tumors were harvested from control and treated mice 2 weeks after treatment. Representative images are shown for untreated (control), anti-OX40, SV.IL12, and SV.IL12 + anti-OX40 treated mice. Proteins of interest were stained and are indicated by color in each image: F4 / 80 (red) and Gramzyme B (green). DAPI nuclear stain appears in blue.

[0141] Figures 18A-18B: SV.IL12 triggers an innate immune response and induces iNOS expression in MyC-CaP.Fluc tumors. MyC-CaP.Fluc tumors in FIG. 18A and CT26.Fluc tumors in FIG. 18B were harvested from control and treated mice 2 weeks after treatment. Tumors were stained by multiplex immunofluorescence. Representative images are shown for untreated (control), anti-OX40, SV.IL12 and SV.IL12+anti-OX40 treated mice. Proteins of interest were stained and indicated by color in each image: iNOS (cyan), arginase 1 (green), and CD11b (magenta). DAPI nuclear staining appears in blue.

[0142] Figure 19: Treatment overview of C57 / Bl6 (female) mice re-injected with Alm5-2Fluc-17 tumors. Alm5-2Fluc-17 tumor reinjection was performed on day 0 (from 9 C57 / B16 mice in 80 mice (16 cages)). Treatment began on day 9 after cell implantation. Antibody (250 μg / dose) treatment (blue dots) was started on day 10 after cell reinjection, 3 times / week for 3 weeks. Sindbis vector was administered 4 days / week for 4 weeks starting on day 9 after cell reinjection (red dots) (morning). IVIS imaging was performed on the indicated days after tumor implantation.

[0143] Figure 20: The combination of IL-12 and anti-OX40 expressed by Sindbis viral vectors synergistically enhances survival of subjects with established tumors. Figure 20 shows the survival rate of C57 / Bl6 (female) mice reinjected with Alm5-2Fluc-17 tumors and treated as follows: SV.IL12 vector; SV.IL-12 vector + anti-OX40 IgG; RepOX4OIgG_Rep-IL12 (fragment SV expressing OX40 IgG and fragment SV expressing IL-12, 50% mixture of both vectors); or RepOX4OIgG_SV-IL12 (fragment SV expressing OX-40 IgG and full-length SV expressing IL-12, 50% mixture of both vectors). n=5 mice in each treatment group. Untreated mice were used as control. Mice were reinjected with tumor cells and treated according to the scheme in figure 19.

[0144] Figures 21A-21C: A20 lymphoma cells were resistant to SV infection. Figure 21A: A20 cells and BHK cells were infected with GFP-carrying SV overnight and GFP expression was observed under a fluorescent microscope. Figure 21B shows that SV-GFP infectivity to BHK cells was confirmed by flow cytometry. Figure 21C shows SV-GFP infectivity to A20 cells in vivo measured by flow cytometry. 7 A20 cells (CD45.2 expression) were inoculated into CByJ.SJL (B6)-Ptprca / J (CD45.1 BALB / C) mice. Recipient mice were treated with SV-GFP 4 days later. GFP expression was measured the following day.

[0145] Figures 22A-22C: The combination of Sindbis virus (SV) and α4-1BB completely cures A20 lymphoma in BALB / c mice. Figure 22A shows representative bioluminescence images of the indicated groups. Intensity scale, days 0, 7, 21, min:400, max:7000; day 14, min:100, max:1000; day 28, min:3000, max:50000. Figure 22B shows tumor growth measured by relative firefly luciferase (fLuc) activity (normalized to Fluc activity on day 0). Untreated, n=16; SV, n=18; α4-1BB Ab, n=13; SV+α4-1BB Ab, n=13. Figure 22C shows survival curves of all groups (ratios shown as surviving / total).

[0146] Figures 23A-23E: SV alone and SV+α4-1BB mAb stimulated cell cycle progression, cytokine production and activation Figure 23A shows the number of significantly differentially (SD) expressed genes (up- and down-regulated) for SV vs untreated. SD expressed genes were selected based on Deseq2 analysis (q<0.05), |Log2FC|≧1. Figure 23B shows enrichment scores of cell cycle gene clusters for SV vs untreated, SV+α4-1BB vs untreated, and SV+α4-1BB vs SV ("cell cycle" is the gene cluster with the highest enrichment score for these three comparisons). Figure 23C shows heatmaps representing SD expressed cytokine and chemokine genes (left, SV vs untreated; right, SV+α4-1BB vs α4-lBB, Log2FC≧1). Expression values ​​are shown as Z-scores. Genes are hierarchically clustered by negative Pearson correlation. Red arrows, Ccl8, IL4, IL13, and IL21 expression. Figure 23D shows the percentage of CD69+ T cells from all groups on day 2 after the start of treatment as measured by flow cytometry. Figure 23E shows the GSEA enrichment plot of the KEGG (SV+α4-1BB vs. untreated) TCR receptor signaling pathway. *, p<0.05; **, p<0.01, ***, p<0.001

[0147] Figures 24A-24C: SV infection enhanced cell cycle progression and migration. Figure 24A shows the DAVID KEGG analysis. Figure 24B shows the GSEA enrichment plot of KEGG (SV vs untreated) cell cycle pathways (SV vs untreated). Figure 24C shows that IPA significantly enhanced cell migration pathways (SV vs untreated).

[0148] Figures 25A-25B: Significantly differentially (SD) upregulated genes are clustered by DAVID analysis. Figure 25A shows gene cluster enrichment scores for SV+α4-1BB vs. untreated. Figure 25B shows gene cluster enrichment scores for SV+α4-1BB vs. SV.

[0149] Figures 26A-26D: The untreated group had a low proportion of T cells and a high proportion of regulatory T cells on day 28. Figures 26A-26C show the frequencies of CD4, CD8, and Treg, respectively, measured by flow cytometry, and Figure 26D shows the Treg / CD8 ratios as indicated.

[0150] Figures 27A-27D: The combination of Sindbis virus + α4-1BB induced higher cytotoxicity Figure 27A shows splenocytes mixed with fLuc-A20 lymphoma cells in the indicated ratios (spleen cells:lymphoma cells). Cytotoxicity corresponds to the decrease in normalized Luc activity (fLuc activity of A20 lymphoma cells alone is normalized to 1). SV+ tumor, α4-1BB+ tumor, SV+α4-1BB+ tumor: tumor-inoculated mice. SV, α4-1BB, SV+α4-1BB: non-tumor-inoculated mice. Figure 27B shows splenocytes harvested from all groups 7 days after treatment. The percentage of NKG2D+ cells was measured by flow cytometry (CD8 T cell gate). Figure 27C shows the percentage of granzyme B+ cells and perforin+ cells measured by flow cytometry (CD8 T cell gate). Figure 27D shows cytotoxicity-related genes upregulated in the SV+α4-1BB treatment group. Heatmap shows relative expression levels of cytotoxicity-related genes. Expression values ​​are shown as Z-scores. Genes are hierarchically clustered by negative Pearson correlation (day 7). Red squares, granzyme B and perforin expression. Red arrows, Ifng and Stat4 expression. **, p<0.01; ****, p<0.0001

[0151] Figures 28A-28F: The combination of Sindbis virus + α4-1BB induced Th1 differentiation and IFNγ production. Figure 28A shows IFNγ ELISpot analysis of splenocytes harvested on days 2, 7, 14, and 28 from all groups as indicated. Top panel shows IFNγ ELISpot images at day 7 post-treatment. 1, 2, 3 are from 3 individual mice. Bottom panel shows IFNγ spot counts from the indicated groups over the treatment period (2x10 per well). 5splenocytes). No stimuli were added. FIG. 28B shows IFN-γ production from CD4 / CD8 T cell populations in splenocytes and purified CD4 / CD8 T cells. All groups were cultured in medium in the presence of brefeldin A for 5 hours. FIG. 28C shows IFN-γ production from purified CD4 T cells under different stimulation conditions. FIG. 28D shows upregulated Th1 pathway gene sets under SV, α4-1BB, SV+α4-1BB stimulation. Expression values ​​are shown as Z-scores. Genes are hierarchically clustered by negative Pearson correlation (day 7). FIG. 28E shows T-bet expression for all groups shown. FIG. 28F shows EOMES expression for all groups shown. CD8 T cell gate. FIG. 28E and 28F, day 7 post-treatment. *, p<0.05; **, p<0.01, ****, p<0.0001

[0152] FIG. 29 shows IFN-γ production from splenocytes in all groups with or without tumor inoculation as measured by ELISPOT (day 7 post-treatment). Tumor present: tumor was inoculated on day 0: Tumor absent: tumor was not inoculated. In the ELISPOT assay, no stimulants were added.

[0153] FIG. 30A-B: Measurement of IFN-γ production Figure 30A: IFN-γ production by all indicated groups (day 7) was measured by ELISPOT. Figure 30B: IFN-γ production by purified T cells (CD8 T cells) 7 days after treatment was measured by flow cytometry.

[0154] Figures 31A-31I: SV and α4-1BB mAb stimulated chemotaxis, adhesion, and enhanced T cell infiltration and activation in tumors. Figure 31A shows a heat map of the expression pattern of chemokine and chemokine receptor genes upregulated in SV+α4-1BB (expression values ​​are shown as Z scores). Genes are hierarchically clustered by negative Pearson correlation (day 7). Figure 31B shows the percentage of CCR5+ cells measured by flow cytometry (day 7). Figures 31C and 31D show the percentage of CD11a+ cells and ICAM-1+ cells, respectively, measured by flow cytometry. Figure 31E shows the relative expression of CD11a(ltgal) and ICAM-1 measured by RNA-Seq and shown by a heat map. Expression values ​​are shown as Z scores. Figure 31F shows the percentage of OX40+ cells and ICOS+ T cells measured by flow cytometry. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 Figure 31G shows the frequency of CD3 and CD8 T cells relative to total cells recovered from tumors as measured by flow cytometry. Figure 31H shows the CD8 / Treg ratio of tumor-infiltrating T cells. Figure 31I shows the percentage of Granzyme B+CD8 T cells. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001

[0155] Figure 32A-32E: Phenotype of tumor-infiltrating T cells Figures 32A-32E show the percentages of Ki67+, Foxp3+, T-bet+, EOMES+, and NKG2D+ T cells, respectively, as measured by flow cytometry.

[0156] Figures 33A-33C: Sindbis virus + α4-1BB synergistically enhanced T cell glycolysis and oxidative phosphorylation Figure 33A shows GSEA enrichment plot of KEGG (SV+α4-1BB vs. untreated) glycolysis pathway. Figure 33B shows the canonical pathway of SV+α4-1BB Ab stimulation clustered by IPA. Red squares: oxidative phosphorylation. Figure 33C shows both oxygen consumption rate (oxidative phosphorylation) and extracellular acidification rate (glycolysis) measured by Seahorse XFe24. All groups are as indicated (n=4).

[0157] Figure 34A-34B: SV + low dose α4-1BB mAb cured A20 tumor-bearing mice Figure 34A shows mouse bioluminescence images (indicating tumor burden) in A20 tumor-bearing mice treated with SV + low dose α4-1BB mAb compared to control (untreated) and SV alone. Figure 34B shows tumor growth (relative luciferase activity) in the indicated treatment groups. Each line is a single mouse.

[0158] Figures 35A-35D: Cured mice are completely protected from rechallenge with A20 lymphoma. Figure 35A shows bioluminescence images of groups pre-treated as indicated and re-challenged with A20 lymphoma cells. Figure 35B shows bioluminescence images of groups pre-treated as indicated and re-challenged with A20 tumor cells (5×10 4 Figure 35 shows IFN-γ production from purified T cells of all groups (SV+α4-1BB; 4 months after the end of treatment) in the absence or presence of IFN-γ (measured by ELISPOT analysis) in the presence or absence of IFN-γ (SV+α4-1BB; 4 months after the end of treatment) (per well). Figure 35C shows a cytotoxicity test performed as in Figure 27A. In the two left panels, total splenocytes were used. In the right, purified T cells were used. In the top left, A20 Fluc cells and in the bottom left, CT26 Fluc cells were used for co-culture. In Figure 35D, the gene sets significantly differently (SD) upregulated by DAVID-kegg analysis are clustered by DAVID KEGG analysis. *, p<0.05; **, p<0.01; ****, p<0.0001

[0159] Figure 36: The combination of NY-ESO-1 and IL-12 expressed by separate Sindbis viral vectors synergistically enhances survival of subjects with established tumors. Figure 36 shows the survival rate of C57 / Bl6 (albino-female) mice re-injected with Alm5-2Fluc-17 tumor cells and treated with SV-IL-12, SV-NY-ESO-1, or a 50% mixture (one injection) of both vectors (SV-IL-12 and SV-NY-ESO-1), as indicated. Untreated mice were used as controls. A total of n=5 mice in each group were examined for the percentage of survival days after tumor implantation.

[0160] Figure 37: Combination of NY-ESO-1 and IL-12 expressed by the same Sindbis viral vector synergistically enhances survival of subjects with established tumors. Figure 37 shows the survival rate of C57 / Bl6 (albino-female) mice re-injected with Alm5-2Fluc-17 tumor cells and treated with SV-IL-12, SV-NY-ESO-1, or a Sindbis virus vector expressing both IL-12 and NY-ESO-1 (SV-NYESO-SGP2-IL12) as indicated. Untreated mice were used as controls. A total of n=5 mice in each group were examined for the percentage of survival days after tumor implantation.

[0161] Figure 38: pSP6-R_IL12 Sindbis replicon vector expressing IL12a and b subunits FIG. 38 shows a plasmid map with the following: SP6, a promoter for in vitro transcription; replicase, SV RNA polymerase; Psg, a subgenomic promoter for IL12 expression; linker, linking the IL12a and b subunits; AmpR, ampicillin resistance gene. Numbers indicate the nucleotide positions of the genes in the replicon plasmid.

[0162] Figure 39: Sindbis replicon vector expressing full-length antibody IgG2a against OX40 FIG. 39 shows a plasmid map with the following: T7, a promoter for in vitro transcription; replicase, SV RNA polymerase; Psg, a subgenomic promoter for expression of anti-OX40 heavy chain IgG 2a; 2Psg, a second subgenomic promoter for light chain anti-OX40 expression; AmpR, ampicillin resistance gene; ColE1, plasmid origin of replication. Numbers indicate the nucleotide positions of the genes in the replicon plasmid.

[0163] Figure 40: Sindbis replicon vector expressing a single chain antibody against OX40 FIG. 40 shows a plasmid map with the following: T7, promoter for in vitro transcription; replicase, SV RNA polymerase; Psg, subgenomic SV promoter; IL12 signal peptide, signal peptide fused to sequence encoding anti-OX40 single chain antibody; AmpR, ampicillin resistance gene; ColE1, origin of replication of the plasmid. Numbers indicate the nucleotide positions of the genes in the replicon plasmid.

[0164] Figure 41: Sindbis replicon vector expressing NY-ESO-1 Figure 41 shows a plasmid map with the following: T7, promoter for in vitro transcription; replicase, SV RNA polymerase; Psg, subgenomic promoter for transcription; Hu NY-ESO-1, coding sequence for human NY-ESO-1 tumor associated antigen; Poly A, polyA tail transcribed onto NY-ESO mRNA; AmpR, ampicillin resistance gene; ColE, plasmid origin of replication. Numbers indicate the nucleotide positions of the genes in the replicon plasmid.

[0165] Fig. 42 :pT7StuIR1-FcOX40L_T2A_NY-ESO1 Sindbis replicon vector expressing OX40 ligand and NY-ESO-1 fused with Fc receptor sequences Figure 42 shows a plasmid map with the following: T7, promoter for in vitro transcription; replicase, SV RNA polymerase; Psg, subgenomic SV promoter; FcOX40L, coding sequence; T2A, termination peptide sequence; NY-ESO-1, coding sequence; AmpR, ampicillin resistance; ColE1, plasmid origin of replication. Numbers indicate the nucleotide positions of the genes in the replicon plasmid. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0166] Oncolytic virus (OV) therapy has become a novel immunotherapeutic approach to treat cancer. The principle of oncolytic viruses is that they can infect and lyse tumor cells. They have been manufactured to selectively replicate in tumor cells by tumor-specific promoter tropism or by direct intratumoral administration. Most OVs encounter numerous barriers that prevent systemic administration. Upon lysis by OVs, tumor cells release tumor-associated antigens (TAA) that can stimulate cytotoxic T cells. OV infection also induces an inflammatory response that helps to trigger an immune antitumor response. Several OV clinical trials are ongoing and have shown promising results. However, whether OV therapy can effectively treat tumors that OVs cannot infect remains an unresolved limitation.

[0167] Sindbis virus (SV) belongs to the alphavirus genus and is a type of OV. It does not lyse infected tumor cells, but can induce apoptotic death. This offers several important advantages. SV is known as one of the smallest pathogenic alphaviruses and usually does not cause clinical signs and symptoms. It has been estimated to be 17 times more asymptomatic than symptomatic SV infections. When symptoms occur in humans, they generally consist of a self-limited, mild febrile illness with blisters and joint pain, with most patients recovering within 14 days. The disease is somewhat self-limited because SV is an RNA virus that does not integrate into the host genome and therefore its presence is transient. The lack of an integration step in the replication cycle also avoids the risk of insertional mutagenesis. Additionally, the SV vectors of the present disclosure were generated from the laboratory strain AR339, which is not known to cause disease in humans. These vectors were further attenuated by making them replication-deficient.

[0168] SV vectors can target tumors systemically and reach metastatic tumor cells throughout the body. They can target tumors without infecting normal tissues. However, susceptibility to infection by SV vectors depends on many factors, including the expression and distribution of laminin receptors and defects in IFN signaling in tumors. This disclosure demonstrates that SV vectors can effectively help heal tumors that they cannot infect, and further demonstrates that the combination of antibodies and SV vectors provides a surprising synergistic therapeutic effect against cancer.

[0169] The present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of (a) an oncolytic viral vector, and (b) an antibody to a costimulatory molecule or a nucleic acid encoding the same; or an antibody to an immune system agonist molecule or a nucleic acid encoding the same to a subject.

[0170] The oncolytic viral vector may be a Sindbis viral vector. The Sindbis viral vector may be replication-deficient. The Sindbis viral vector was produced as described in U.S. Patent No. 8,093,021, which is incorporated herein by reference in its entirety. The Sindbis viral vector may comprise at least one nucleic acid encoding a therapeutic protein. The Sindbis viral vector may comprise at least one nucleic acid encoding an immunostimulatory or immunomodulatory protein. The immunostimulatory or immunomodulatory protein may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, or any combination thereof. In a preferred embodiment, the immunostimulatory or immunomodulatory protein is IL-12. The Sindbis viral vector may include at least one nucleic acid encoding LacZ, Flue, or GFP.

[0171] The antibody may be an anti-OX40 antibody, an anti-4-1BB antibody, an anti-CD28 antibody, an anti-GITR antibody, an anti-CD137 antibody, an anti-cd37 antibody, an anti-HVEM antibody, or a combination thereof.

[0172] The Sindbis viral vectors and antibodies can induce an immune response in a tumor-associated antigen (TAA) non-specific manner. The non-specific immune response induced can be a primary immune response. The primary immune response can be followed by a secondary immune response. The secondary immune response can be the result of one or more TAAs released from dead tumor cells. The secondary immune response can include memory T cells against one or more TAAs released from dead tumor cells.

[0173] The present disclosure also provides a method for treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of (a) a Sindbis virus vector comprising a nucleic acid encoding interleukin-12, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding the same; to a subject.

[0174] The Sindbis viral vector may be replication-deficient. The Sindbis viral vector may include a nucleic acid encoding interleukin-12 and may further include a nucleic acid encoding an anti-OX40 monoclonal antibody. The method may include administering a Sindbis viral vector including a nucleic acid encoding interleukin-12 and administering a Sindbis viral vector including a nucleic acid encoding an anti-OX40 monoclonal antibody.

[0175] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit of GenBank Accession No. M86672 and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit) of GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0176] The nucleic acid encoding the interleukin-12 alpha subunit (IL-12α, IL-12, p35 subunit) comprises the nucleic acid sequence of SEQ ID NO:1 shown in the table below. [Table 1]

[0177] A nucleic acid encoding the interleukin-12 beta subunit (IL-12β, IL-12, p40 subunit) comprises the nucleic acid sequence of SEQ ID NO:2 shown in the table below. [Table 2]

[0178] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0179] The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and a nucleic acid encoding an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1 The amino acid sequence of the interleukin-12 alpha subunit comprises the amino acid sequence of SEQ ID NO:3 shown in the table below. [Table 3]

[0180] The amino acid sequence of the interleukin-12 β subunit comprises the amino acid sequence of SEQ ID NO:4 shown in the table below. [Table 4]

[0181] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:3, and a nucleic acid encoding an interleukin-12 beta subunit that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:4.

[0182] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0183] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO:5, as shown in the table below. [Table 5]

[0184] The nucleic acid sequence encoding the anti-OX40 variable heavy chain comprises the nucleic acid sequence of SEQ ID NO:6 shown in the table below. [Table 6]

[0185] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO:7, as shown in the table below. [Table 7]

[0186] The nucleic acid sequence encoding the anti-OX40 variable light chain comprises the nucleic acid sequence of SEQ ID NO:8 shown in the table below. [Table 8]

[0187] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 variable heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding an anti-OX40 variable light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 variable heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding an anti-OX40 variable light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0188] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO:9 as shown in the table below. [Table 9]

[0189] The nucleic acid sequence encoding the anti-OX40 antibody heavy chain comprises the nucleic acid sequence of SEQ ID NO: 10 shown in the table below. [Table 10]

[0190] In SEQ ID NOs:9 and 10, the underlined residues represent the IL-2 signal peptide; the bolded residues represent the variable antigen binding region; the non-underlined residues represent the mouse heavy chain IgG2a constant region, GB Accession No. BC080671; the bolded and underlined residues represent the hinge and disulfide bond regions. The double underlined residue in SEQ ID NO:10 represents a C to T change, removing an ApaI site. The dotted underlined residue in SEQ ID NO:10 represents the Kozak sequence.

[0191] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO:11, as shown in the table below. [Table 11]

[0192] The nucleic acid sequence encoding the mouse anti-OX40 antibody light chain comprises the nucleic acid sequence of SEQ ID NO:12 shown in the table below. [Table 12]

[0193] In SEQ ID NOs: 11 and 12, the underlined residues represent the IL-2 signal peptide; the bolded residues represent the variable antigen binding region; the non-underlined residues represent the light chain constant region, GB Accession No. BC091750.1, and the dotted underlined residues in SEQ ID NO: 12 represent the Kozak sequence.

[0194] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0195] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0196] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13 shown in the table below. [Table 13]

[0197] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable heavy chain comprising the amino acid sequence of SEQ ID NO:31, as shown in the table below. [Table 14]

[0198] The nucleic acid sequence encoding the human anti-OX40 antibody heavy chain variable region comprises the nucleic acid sequence of SEQ ID NO:32 shown in the table below. [Table 15]

[0199] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable light chain comprising the amino acid sequence of SEQ ID NO:33, as shown in the table below. [Table 16]

[0200] The nucleic acid sequence encoding the human anti-OX40 antibody light chain variable region comprises the nucleic acid sequence of SEQ ID NO:34 shown in the table below. [Table 17]

[0201] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable heavy chain comprising the amino acid sequence of SEQ ID NO:35, as shown in the table below. [Table 18]

[0202] The nucleic acid sequence encoding the human anti-OX40 antibody heavy chain variable region comprises the nucleic acid sequence of SEQ ID NO:36 shown in the table below. [Table 19]

[0203] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable light chain comprising the amino acid sequence of SEQ ID NO:37, as shown in the table below. [Table 20]

[0204] The nucleic acid sequence encoding the human anti-OX40 antibody light chain variable region comprises the nucleic acid sequence of SEQ ID NO:38 shown in the table below. [Table 21]

[0205] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable heavy chain comprising the amino acid sequence of SEQ ID NO:39, as shown in the table below. [Table 22]

[0206] The nucleic acid sequence encoding the human anti-OX40 antibody heavy chain variable region comprises the nucleic acid sequence of SEQ ID NO: 40 shown in the table below. [Table 23]

[0207] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable light chain comprising the amino acid sequence of SEQ ID NO:41, as shown in the table below. [Table 24]

[0208] The nucleic acid sequence encoding the human anti-OX40 antibody light chain variable region comprises the nucleic acid sequence of SEQ ID NO:42 shown in the table below. [Table 25]

[0209] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable heavy chain comprising the amino acid sequence of SEQ ID NO:43, as shown in the table below. [Table 26]

[0210] The nucleic acid sequence encoding the human anti-OX40 antibody heavy chain variable region comprises the nucleic acid sequence of SEQ ID NO:44 shown in the table below. [Table 27]

[0211] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable light chain comprising the amino acid sequence of SEQ ID NO:45, as shown in the table below. [Table 28]

[0212] The nucleic acid sequence encoding the human anti-OX40 antibody light chain variable region comprises the nucleic acid sequence of SEQ ID NO:46 shown in the table below. [Table 29]

[0213] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable heavy chain comprising the amino acid sequence of SEQ ID NO:47 shown in the table below. [Table 30]

[0214] The nucleic acid sequence encoding the human anti-OX40 antibody heavy chain variable region comprises the nucleic acid sequence of SEQ ID NO:48 shown in the table below. [Table 31]

[0215] The Sindbis viral vector can comprise a nucleic acid encoding a human anti-OX40 antibody variable light chain comprising the amino acid sequence of SEQ ID NO:49, as shown in the table below. [Table 32]

[0216] The nucleic acid sequence encoding the human anti-OX40 antibody light chain variable region comprises the nucleic acid sequence of SEQ ID NO:50 shown in the table below. [Table 33]

[0217] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 IgG2a antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 IgG2a antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0218] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and a murine anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0219] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0220] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80, 85%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0221] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0222] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0223] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0224] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0225] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 31. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 34.

[0226] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 31. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 32. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 33. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:34.

[0227] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 35. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 37. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 38.

[0228] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 35. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 36. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 37. The nucleic acid encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:38.

[0229] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 39. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 42.

[0230] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 39. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 40. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 41. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:42.

[0231] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 43. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 46.

[0232] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 43. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 44. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 45. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:46.

[0233] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 47. The nucleic acid sequence encoding the human anti-OX40 variable heavy chain is SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is SEQ ID NO: 50.

[0234] The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable heavy chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 47. The nucleic acid sequence encoding a human anti-OX40 variable heavy chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 48. The Sindbis viral vector can include a nucleic acid encoding a human anti-OX40 variable light chain comprising an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 49. The nucleic acid sequence encoding the human anti-OX40 variable light chain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:50.

[0235] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0236] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0237] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0238] The Sindbis viral vector and the anti-OX40 monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-OX40 monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-OX40 monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-OX40 monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0239] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0240] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0241] Sindbis virus vector and anti-0X40 monoclonal antibody

[0242] The present disclosure further provides a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a nucleic acid encoding an anti-OX40 monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding interleukin-12, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding same. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding interleukin-12, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody.

[0243] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit of GenBank Accession No. M86672 and an interleukin-12 beta subunit of GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0244] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0245] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0246] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0247] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0248] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0249] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0250] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0251] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0252] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0253] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0254] The disclosure also provides a method for treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of (a) a Sindbis virus vector comprising a nucleic acid encoding interleukin-12, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding same, thereby treating cancer in the subject.

[0255] The Sindbis viral vector may be replication-deficient. The Sindbis viral vector may comprise a nucleic acid encoding interleukin-12 and may further comprise a nucleic acid encoding an anti-OX40 monoclonal antibody. The method may comprise administering a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and administering a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody.

[0256] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit of GenBank Accession No. M86672 and an interleukin-12 beta subunit of GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0257] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0258] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0259] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80, 85%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0260] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0261] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0262] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0263] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0264] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0265] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0266] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0267] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0268] The Sindbis viral vector and the anti-OX40 monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-OX40 monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-OX40 monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-OX40 monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0269] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0270] The Sindbis virus may be administered at least once, at least twice, at least three times, at least four times, or at least five times per week. The Sindbis virus may be administered for at least one week, at least two weeks, at least three weeks, or at least four weeks. 6 ~10 9 Preferably, the Sindbis virus is administered at a dose of 10 6 ~10 9 Can be administered in TU / mL.

[0271] The anti-OX40 monoclonal antibody can be administered at least once, at least twice, at least three times, at least four times, or at least five times per week. The anti-OX40 monoclonal antibody can be administered for at least one week, at least two weeks, at least three weeks, or at least four weeks. The anti-OX40 monoclonal antibody can be administered at 25 μg to 500 μg, 25 μg to 450 μg, 50 μg to 400 μg, 50 μg to 350 μg, 50 μg to 300 μg, 50 μg to 250 μg, 50 μg to 200 μg, 50 μg to 150 μg, or 50 μg to 100 μg. The anti-OX40 monoclonal antibody can be administered at 250 μg. The anti-OX40 monoclonal antibody can be administered at 250 μg once a week for one week. Anti-OX40 monoclonal antibodies can be administered at 250 μg once per week for two weeks. Anti-OX40 monoclonal antibodies can be administered at 250 μg once per week for three weeks. Anti-OX40 monoclonal antibodies can be administered at 250 μg three times per week for one week. Anti-OX40 monoclonal antibodies can be administered at 250 μg three times per week for two weeks. Anti-OX40 monoclonal antibodies can be administered at 250 μg three times per week for three weeks.

[0272] The results provided in this disclosure demonstrate that administration of Sindbis virus expressing IL-12 (SV.IL12) significantly increases the expression of OX40 on CD4 T cells, and demonstrate that combined administration of SV.IL12 and anti-OX40 monoclonal antibodies results in complete tumor regression in in vivo models of colon, prostate and ovarian cancer, resulting in survival rates of over 60% (and in some cases over 90%). This combined therapeutic effect was dramatically more effective than monotherapy with SV.IL12 or anti-OX40 monoclonal antibodies. These results also confirm that the oncolytic activity of Sindbis virus is not required to induce a robust and effective anti-tumor response.

[0273] The results provided in this disclosure demonstrate that the combination of SV.IL12 and anti-OX40 monoclonal antibody treatment significantly alters the transcriptomic signature of T cells, favoring the differentiation of terminal effector T cells (e.g., effector T cells with a Th1-type phenotype). Notably, pathways upregulated by the combination treatment are dominated by DNA replication, chromosome organization, and cell cycle regulation, but also include various metabolic and immunological processes such as mitochondrial respiration, nucleotide metabolism, and adaptive immune response. Specifically, only T cells from the combination treatment expressed the gene signature of terminally differentiated effector T cells, characterized by high expression of killer lectin-like receptor (KLRG1) and low expression of interleukin-7 receptor (IL-7R). Furthermore, gene-encoded products associated with effector cell differentiation and function, such as Batf, Id2, Tbet, Gzmb, Ifng, were also highly expressed in T cells following the combination treatment. Furthermore, CD4+ T cells expressed a pronounced anti-tumor effector phenotype (ICOS), which was on average 2-3-fold higher during combination therapy compared to SV.IL12 or anti-OX40 treatment. + Tbet + ) was also expressed.

[0274] The tumor microenvironment can be a very challenging environment for effector T cells, as it is characterized by hypoxia, acidosis, and low levels of nutrients (such as glucose and glutamine). Even if T cell activation and initiation of effector function are possible, T cells may not be able to generate the bioenergetic intermediates necessary to execute effector functions in the tumor microenvironment. Thus, providing metabolic support for T cells is important for successful cancer therapy. The results provided in this disclosure demonstrate that the combination of SV.IL12 and anti-OX40 monoclonal antibody promotes metabolic reprogramming of T cells. Specifically, the basal rate of oxygen consumption (OCR) was increased and spare respiratory capacity was dramatically improved in T cells after combination therapy. The combination also induced elevated protein expression of c-MYC, as well as extracellular acidification rate (ECAR). Taken together, these results indicate that SV.IL12 induces enhanced oxidative phosphorylation in CD8 T cells and that combination therapy is necessary to drive CD4 T cells towards glycolysis by increasing the protein expression of c-MYC. Thus, the combination of SV.IL12 and anti-OX40 monoclonal antibody metabolically reconfigures T cells to an energy state using both metabolic pathways, oxidative phosphorylation and glycolysis.

[0275] The results provided in this disclosure demonstrate that metabolically reprogrammed T cells exhibit improved CD4-mediated cytokine production and antitumor activity after treatment with a combination of SV.IL12 and anti-OX40 monoclonal antibody. Specifically, after combination therapy, genes encoding the inflammatory cytokines ifng and il2 were upregulated in T cells, and secretion of interferon-y (IFN-y) by splenocytes was increased. Also, levels of cytotoxic proteases, granzymes A and B, were upregulated after combination therapy. Furthermore, granzyme B-positive cells were detected in CD8 and CD4 T cells (indicating the presence of cytotoxic CD4 T cells after combination therapy). Also, co-culture with splenocytes from mice that received combination therapy significantly reduced tumor growth. Surprisingly, tumor growth inhibition was mediated by CD4 T cells. Taken together, these results clearly demonstrate that T cells from the combination therapy elicit improved antitumor and functional activities, such as granzyme B and IFNy production induced by CD4 T cells.

[0276] The results provided in this disclosure demonstrate that treatment with a combination of SV.IL12 and anti-OX40 monoclonal antibody results in enhanced T cell migration and intratumoral T cell immunity. Specifically, after combination therapy, CXCR3 levels were significantly upregulated on CD4 T cells. In contrast, CXCR3 expression on CD8 T cells appeared only late in the treatment, indicating that CD4 T cells were recruited to the inflammatory site first, followed by CD8 T cells. The combination therapy also enhanced the production of CXCL9 and CXCL10 in the tumor microenvironment, indicating that CXCR3-positive T cells migrate to the tumor site. These results clearly demonstrate that the combination of SV.IL12 and anti-OX40 monoclonal antibody alters the tumor microenvironment by promoting T cell infiltration through the regulation of the CXCR3 / CXCL9-11 system. Combination therapy not only increased T cell infiltration, but also CD4 and CD8 T cells showed enhanced functional activity in tumors (as determined by Ki-67 and granzyme B expression). These results indicate that the presence of activated T cells in the tumor microenvironment exerts antitumor activity that inhibits tumor growth. Enhanced iNOS production was also demonstrated in tumors treated with combination therapy. Interestingly, the amount of iNOS was inversely correlated with arginase 1 production, indicating a repolarization of tumor-associated macrophages from an M2-like (tumor-promoting) to an M1-like (antitumor) phenotype during combination therapy.

[0277] Thus, the data provided herein clearly show that even in the absence of direct Sindbis virus infectivity, SV.IL12 combined with anti-OX40 monoclonal antibody alters the tumor microenvironment by enhancing T cell infiltration and intratumoral T cell immunity (especially against poorly immunogenic tumors). The synergistic therapeutic effect of systemic administration of this combination is induced by T cell regulation and reprogramming of its metabolic state (to enhance antitumor responses in the periphery and tumor microenvironment). Furthermore, the use of Sindbis virus allows these metabolically reprogrammed T cells to better penetrate the tumor microenvironment, which is important for proper immunotherapy.

[0278] Sindbis virus vector and anti-4-1BB monoclonal antibody

[0279] The present disclosure also provides a method for treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of (a) a Sindbis viral vector and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding the same, thereby treating the cancer in the subject. The present disclosure further provides an in vitro or ex vivo method for treating cancer in a subject or evaluating a treatment for cancer, comprising contacting a biological sample from the subject with (a) a Sindbis viral vector and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding the same. Preferably, the Sindbis viral vector does not contain endogenous nucleic acid encoding a protein. The Sindbis viral vector was produced as described in U.S. Pat. No. 8,093,021, which is incorporated herein by reference in its entirety.

[0280] The Sindbis viral vector is replication-deficient. The Sindbis viral vector may comprise a nucleic acid sequence encoding a therapeutic protein, an immunostimulating protein, or an immunomodulating protein. The Sindbis viral vector may comprise a nucleic acid encoding a therapeutic protein, an immunostimulating protein, or an immunomodulating protein, and may further comprise a nucleic acid encoding an anti-4-1BB monoclonal antibody. The Sindbis viral vector may comprise a nucleic acid sequence encoding LacZ (lac operon structural gene LacZ encoding β-galactosidase), Flue (firefly luciferase), or GFP (green fluorescent protein). The Sindbis viral vector may comprise a nucleic acid encoding LacZ, Flue, or GFP, and may further comprise a nucleic acid encoding an anti-4-1BB monoclonal antibody.

[0281] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the heavy chain complementarity determining region 1 (HCDR1), HCDR2 and HCDR3 amino acid sequences shown below; HCDR1: GFIFSYFDMA (SEQ ID NO: 16), HCDR2: SISPDGSIPYYRDSVK (SEQ ID NO: 17), and HCDR3: RSYGGYSELDY (SEQ ID NO: 18).

[0282] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB heavy chain comprising the amino acid sequence of SEQ ID NO:19, as shown in the table below. [Table 34]

[0283] The Sindbis viral vector can contain a nucleic acid encoding an anti-4-1BB antibody light chain comprising the light chain complementarity determining region 1 (LCDR1), LCDR2 and LCDR3 amino acid sequences shown below; LCDR1: QASQDIGNWLA (SEQ ID NO: 20), LCDR2: GSTSLAD (SEQ ID NO: 21), and LCDR3: LQAYGAPW (SEQ ID NO: 22).

[0284] The Sindbis viral vector may comprise a nucleic acid encoding an anti-4-1BB light chain comprising the amino acid sequence of SEQ ID NO:23, as shown in the table below. [Table 35]

[0285] The Sindbis virus vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen comprising the amino acid sequence of SEQ ID NO:24 shown in the table below. [Table 36]

[0286] The Sindbis viral vector can comprise a nucleic acid encoding a 4-1BB heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:19, and a nucleic acid encoding a 4-1BB light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:23.

[0287] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen (4-1BB antigen) of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain amino acid sequence that binds to a target antigen (4-1BB antigen) of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain amino acid sequence that binds to a target antigen (4-1BB antigen) of the amino acid sequence of SEQ ID NO: 24.

[0288] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the heavy chain complementarity determining region 1 (HCDR1), HCDR2 and HCDR3 amino acid sequences of SEQ ID NO: 16, 17 and 18, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 19. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the light chain complementarity determining region 1 (LCDR1), LCDR2 and LCDR3 amino acid sequences of SEQ ID NO: 20, 21 and 22, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the amino acid sequence of SEQ ID NO: 23.

[0289] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24.

[0290] The immune stimulating or immune modulating protein may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, or any combination thereof. In a preferred embodiment, the immune stimulating or immune modulating protein is IL-12. The anti-4-1BB antibody may be urelumab, utomirumab, or a combination thereof. The anti-4-1BB antibody may be InVivoMAb anti-mouse 4-1BB (BioXCell, Clone: ​​LOB12.3, Cat. No. BE0169).

[0291] The Sindbis viral vector and the anti-4-1BB monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-4-1BB monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-4-1BB monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-4-1BB monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-4-1BB monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-4-1BB monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-4-1BB monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0292] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against 4-1BB or the anti-4-1BB monoclonal antibody described herein may be a full-length antibody against the 4-1BB antibody or an antigen-binding fragment thereof, and the fragment retains the binding to the 4-1BB receptor on the cell surface. The "antigen-binding fragment" of the anti-4-1BB antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0293] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be a carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In a preferred embodiment, the cancer is a lymphoma. In a preferred embodiment, the cancer is a B-cell lymphoma.

[0294] The present disclosure provides a Sindbis viral vector comprising a nucleic acid encoding a therapeutic protein, an immunostimulatory protein, or an immunomodulatory protein, and a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure provides a Sindbis viral vector comprising a nucleic acid encoding LacZ, Flue, or GFP, and a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding a therapeutic protein, an immunostimulatory protein, or an immunomodulatory protein, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding LacZ, Flue, or GFP, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-4-1BB monoclonal antibody. The present disclosure further provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding a therapeutic protein, an immunostimulatory protein, or an immunomodulatory protein, and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding the same. The present disclosure provides a composition comprising: (a) a Sindbis virus vector comprising a nucleic acid encoding LacZ, Flue, or GFP; and (b) an anti-4-1BB monoclonal antibody or a nucleic acid encoding same.

[0295] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the heavy chain complementarity determining region 1 (HCDR1), HCDR2 and HCDR3 amino acid sequences of SEQ ID NO: 16, 17 and 18, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 19. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the light chain complementarity determining region 1 (LCDR1), LCDR2 and LCDR3 amino acid sequences of SEQ ID NO: 20, 21 and 22, respectively. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain comprising the amino acid sequence of SEQ ID NO: 23.

[0296] The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain CDR1, CDR2 and CDR3 amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody heavy chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24. The Sindbis viral vector can comprise a nucleic acid encoding an anti-4-1BB antibody light chain amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 24.

[0297] The immune stimulating or immune modulating protein may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, or any combination thereof. In a preferred embodiment, the immune stimulating or immune modulating protein is IL-12. Additional cytokines include IL-18 to IL-36. In addition to CCL17, other chemokines can be used, including but not limited to CCL1-CCL27 and other CC chemokines, CXCL1-CXCL13 and other CXC chemokines, C chemokines, and CX3C chemokines. Cytokines or chemokine receptors and soluble receptors can also be used. Additional immune modulators that can be used include TGF-β and TNFα. Different combinations of the above (or alternative) cytokines can also be used.

[0298] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against 4-1BB or the anti-4-1BB monoclonal antibody described herein may be a full-length antibody against the 4-1BB antibody or an antigen-binding fragment thereof, and the fragment retains the binding to the 4-1BB receptor on the cell surface. The "antigen-binding fragment" of the anti-4-1BB antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0299] The Sindbis virus may be administered at least once, at least twice, at least three times, at least four times, or at least five times per week. The Sindbis virus may be administered for at least one week, at least two weeks, at least three weeks, or at least four weeks. 6 ~10 9 Preferably, the Sindbis virus is administered at a dose of 10 6 ~10 9 Can be administered in TU / mL.

[0300] The anti-4-1BB monoclonal antibody can be administered at least once, at least twice, at least three times, at least four times, or at least five times per week. The anti-4-1BB monoclonal antibody can be administered for at least one week, at least two weeks, at least three weeks, or at least four weeks. The anti-4-1BB monoclonal antibody can be administered at 25 μg to 500 μg, 25 μg to 450 μg, 50 μg to 400 μg, 50 μg to 350 μg, 50 μg to 300 μg, 50 μg to 250 μg, 50 μg to 200 μg, 50 μg to 150 μg, or 50 μg to 100 μg. The anti-4-1BB monoclonal antibody can be administered at 50 μg. The anti-4-1BB monoclonal antibody can be administered at 50 μg once a week for three weeks. The anti-4-1BB monoclonal antibody can be administered at 250 μg. The anti-4-1BB monoclonal antibody can be administered at 250 μg three times a week for two weeks. The anti-4-1BB monoclonal antibody can be administered at 350 μg. The anti-4-1BB monoclonal antibody can be administered at 350 μg three times a week for two weeks.

[0301] The results provided in this disclosure demonstrate that combined administration of Sindbis virus and anti-4-1BB monoclonal antibody resulted in complete tumor regression of lymphoma in an in vivo model, and that this therapeutic effect was dramatically more effective than single treatment with Sindbis virus or anti-4-1BB monoclonal antibody. Tumor elimination requires the synergistic effect of the combination, which significantly enhances T cell cytotoxicity, IFNy production, T cell proliferation, migration, and glycolysis. As described in more detail below, the data identify molecular pathways, including upregulated cytokines, chemokines, and metabolic pathways, in T cells triggered by the combination therapy, helping to achieve highly effective anti-tumor responses.

[0302] The results provided in this disclosure demonstrate that combined administration of Sindbis virus and anti-4-1BB monoclonal antibody increased cell cycle progression, cytokine production and activation of T cells. T cell proliferation is important for an effective anti-tumor response.

[0303] The results provided in this disclosure demonstrate that the combined administration of Sindbis virus and anti-4-1BB monoclonal antibody increased cytotoxicity (e.g., increased cytotoxic T cell function). Specifically, after administration of Sindbis virus and anti-4-1BB monoclonal antibody, genes such as Gzmb (granzyme B), Prfl (perforin), and Klrkl (NKG2D) were significantly upregulated in T cells (especially CD8 T cells).

[0304] The results provided in this disclosure demonstrate that combined administration of Sindbis virus and anti-4-1BB monoclonal antibody increased IFNy production from T cells and Th1 differentiation. The combination of Sindbis virus and anti-4-1BB monoclonal antibody upregulated the expression of STAT4, Ccr5, Cxcr3, Havcr2 (Tim3), IL12rbl, and Klrcl in T cells, which are required for the development of Th1 cells from naive CD4+ T cells and IFNy production. This increase was independent of the presence or absence of TAA. The combination of Sindbis virus and anti-4-1BB monoclonal antibody increased IFNy production from both CD4 and CD8 T cells (more CD4 T cells producing IFNy), demonstrating that antigen-presenting cells (APCs) are essential to support T cell-produced IFNy. The combination of Sindbis virus and anti-4-1BB monoclonal antibody also increased T-bet in T cells. T-bet is a key transcription factor essential for type I immune responses (IFNy production, T cell toxicity) and differentiation of memory T cells. Therefore, this indicates that the combination of Sindbis virus and anti-4-1BB monoclonal antibody promotes type I immune responses that are important for controlling tumor growth. The combination of Sindbis virus and anti-4-1BB monoclonal antibody also increased Eomesodermin (EOMES) in T cells. EOMES is another important transcription factor that is upregulated in activated T cells and is essential for the development of memory CD8 T cells.

[0305] The results provided in this disclosure demonstrate that combined administration of Sindbis virus and anti-4-1BB monoclonal antibody resulted in increased chemotaxis, adhesion, and enhanced T cell infiltration and activation in tumors. Specifically, the combination significantly upregulated CD11a and ICAM-1 (CD54) in both CD4 and CD8 T cells (CD11a and ICAM-1 are two adhesion molecules expressed on activated T cells that are essential for the formation of immune synapses between T cells and APCs, and are also required for T cell / T cell homotypic aggregation and activation). In addition, the combination of Sindbis virus and anti-4-1BB monoclonal antibody significantly upregulated OX40 and ICOS in T cells. OX40 engagement promotes effector T cell function and survival, and ICOS is another important CD4 T cell co-stimulatory molecule. Tumor-infiltrating lymphocytes play an important role in anti-tumor and are important markers for prognosis. The proportion of CD3 and CD8 T cells increased approximately two-fold after combination therapy. Thus, these results demonstrate that combination therapy enhanced T cell infiltration, division, activation, and cytotoxicity, and downregulated the suppressive Treg population.

[0306] The results provided in this disclosure demonstrate that combined administration of Sindbis virus and anti-4-1BB monoclonal antibody enhanced T cell glycolysis and oxidative phosphorylation. T cell activation requires rapid expenditure of energy through both enhanced glycolysis and oxidative phosphorylation. Metabolic switching is a key feature of T cell activation and memory T cell development. Upregulation of glycolytic genes rapidly generates ATP and supports T cell migration and cytotoxicity in hypoxic or acidic microenvironments (e.g., in and around tumors). The results demonstrate that combined therapy significantly increased both oxygen consumption rate (OCR; representing oxidative phosphorylation) and extracellular acidification rate (ECAR; representing glycolysis), indicating that both glycolysis and oxidative phosphorylation are activated in combined treated T cells.

[0307] The results provided in this disclosure demonstrate that mice cured by combined administration of Sindbis virus and anti-4-1BB monoclonal antibody were completely protected from rechallenge with cancer, demonstrating that these mice acquired long-lasting anti-tumor immunity.

[0308] According to the conventional view of oncolytic virus therapy for tumors, it requires selective infection of cancer cells and induces their lysis and apoptosis. Tumor-specific antigens (TAA) are released from dead tumor cells and induce and stimulate anti-tumor immune responses. The data presented herein demonstrate that it is not essential to encode a TAA for the combination of Sindbis virus and anti-4-1BB monoclonal antibody to completely eradicate growing tumors.

[0309] Because tumor cells divide exponentially and rapidly, rapid inhibition of tumor growth is important for cancer therapy. However, induction of adaptive immunity and establishment of tumor-specific immunity require a long time. An ideal treatment requires early rapid reduction of tumor burden and late induction of anti-tumor specificity, which prevents recurrence. The data presented herein demonstrate that the combination of Sindbis virus and anti-4-1BB monoclonal antibody treatment induced massive T cell activation by virus-induced immune response. This massive activation helps to control tumors in a TAA-nonspecific manner.

[0310] Herein, it was shown that both NKG2D (KLRKI) and granzyme B were highly expressed under combination therapy. This extensive nonspecific activation is important for controlling tumor growth at early time points (7 days). This step is also important for inducing antitumor specificity mediated by TAAs released from dead tumor cells by nonspecific killing. After tumor regression, T cells from treated animals were able to maintain the ability to produce IFNy and acquired immune memory, and quickly rejected tumor rechallenge. IFNy production from purified T cells of cured mice was significantly enhanced after encountering tumor cells. This demonstrates that antitumor specificity is well established in cured mice.

[0311] The data also indicate that Sindbis virus infection of tumor cells, dendritic cell encapsulation and lymphodepletion are not essential for successful cancer therapy. Omission of these additional features would reduce costs and decrease the risks associated with toxicity and infection.

[0312] Thus, the data provided herein demonstrate that the combination of Sindbis virus and anti-4-1BB monoclonal antibody completely eradicated B cell lymphoma in a preclinical mouse model, an outcome that could not be achieved with either monotherapy. Tumor elimination required the synergistic effect of the combination, which significantly enhanced T cell cytotoxicity, IFN-y production, migration, tumor invasion, and oxidative phosphorylation. Furthermore, all mice that survived treatment developed long-lasting antitumor immunity.

[0313] Sindbis virus vector and Sindbis virus vector NY-ESO-1

[0314] The disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1, thereby treating the cancer in the subject.The disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a nucleic acid encoding NY-ESO-1, thereby treating the cancer in the subject.

[0315] The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can comprise a nucleic acid encoding an interleukin-12 alpha subunit having GenBank Accession No. M86672 and an interleukin-12 beta subunit having GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0316] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0317] The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1, NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14, as shown in the table below. [Table 37]

[0318] The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15 shown in the table below. [Table 38]

[0319] The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0320] The replication-deficient Sindbis viral vectors described herein may be any replication-deficient Sindbis viral vector, including, for example, those described in U.S. Patent Nos. 7,303,898, 7,306,792, and 8,093,021. Replication-deficient vectors are preferred for use in the present invention to prevent infection of healthy tissue.

[0321] The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and the Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered sequentially or simultaneously. The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 can be administered systemically. The Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered systemically. Both the Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and the Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered systemically. The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 can be administered parenterally. The Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered parenterally. Both the Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and the Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 can be administered parenterally. The Sindbis viral vector comprising a nucleic acid encoding interleukin-12 can be administered intraperitoneally. The Sindbis viral vector containing a nucleic acid encoding NY-ESO-1 can be administered intraperitoneally. Both the Sindbis viral vector containing a nucleic acid encoding interleukin-12 and the Sindbis viral vector containing a nucleic acid encoding NY-ESO-1 can be administered intraperitoneally.

[0322] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0323] The present disclosure further provides a Sindbis viral vector comprising a nucleic acid encoding interleukin-12 and a nucleic acid encoding NY-ESO-1. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding interleukin-12, and (b) a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1.

[0324] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit (IL-12alpha, IL-12, p35 subunit) and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit). The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit of GenBank Accession No. M86672 and an interleukin-12 beta subunit (IL-12beta, IL-12, p40 subunit) of GenBank Accession No. M86671. The nucleic acid encoding the interleukin-12 alpha subunit comprises the nucleic acid sequence of SEQ ID NO:1. The nucleic acid encoding the interleukin-12 beta subunit comprises the nucleic acid sequence of SEQ ID NO:2.

[0325] The Sindbis viral vector can include a nucleic acid encoding an interleukin-12 alpha subunit having the amino acid sequence of GenBank Accession No. AAA39292.1 and an interleukin-12 beta subunit having the amino acid sequence of GenBank Accession No. AAA39296.1. The amino acid sequence of the interleukin-12 alpha subunit is the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of the interleukin-12 beta subunit is the amino acid sequence of SEQ ID NO: 4.

[0326] The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0327] The present disclosure provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) a Sindbis virus vector comprising a nucleic acid encoding NY-ESO-1, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding same, thereby treating the cancer in the subject.

[0328] The Sindbis viral vector may be replication-defective. The Sindbis viral vector may comprise a nucleic acid encoding NY-ESO-1 and may further comprise a nucleic acid encoding an anti-OX40 monoclonal antibody. The method may comprise administering a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 and administering a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody. The Sindbis viral vector may comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector may comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0329] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0330] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80, 85%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0331] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0332] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0333] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0334] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0335] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0336] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0337] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0338] The Sindbis viral vector and the anti-OX40 monoclonal antibody can be administered sequentially or simultaneously. The Sindbis viral vector can be administered systemically. The anti-OX40 monoclonal antibody can be administered systemically. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered systemically. The Sindbis viral vector can be administered parenterally. The anti-OX40 monoclonal antibody can be administered parenterally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered parenterally. The Sindbis viral vector can be administered intraperitoneally. The anti-OX40 monoclonal antibody can be administered intraperitoneally. Both the Sindbis viral vector and the anti-OX40 monoclonal antibody, or the nucleic acid encoding the same, can be administered intraperitoneally.

[0339] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0340] The cancer may be a solid cancer or a liquid / blood cancer. The cancer may include metastatic cancer. The cancer may include a solid tumor. The cancer may be carcinoma, lymphoma, blastoma, sarcoma, leukemia, brain cancer, breast cancer, blood cancer, bone cancer, lung cancer, skin cancer, liver cancer, ovarian cancer, bladder cancer, kidney cancer, stomach cancer, thyroid cancer, pancreatic cancer, esophageal cancer, prostate cancer, cervical cancer or colorectal cancer. In one preferred embodiment, the cancer is colon cancer. In one preferred embodiment, the cancer is prostate cancer. In one preferred embodiment, the cancer is ovarian cancer.

[0341] The present disclosure further provides a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1 and a nucleic acid encoding an anti-OX40 monoclonal antibody. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1, and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding the same. The present disclosure also provides a composition comprising (a) a Sindbis viral vector comprising a nucleic acid encoding NY-ESO-1, and (b) a Sindbis viral vector comprising a nucleic acid encoding an anti-OX40 monoclonal antibody. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of NCBI reference accession number NM_001327.1. The nucleic acid encoding NY-ESO-1 comprises the nucleic acid sequence of SEQ ID NO: 14. The Sindbis viral vector can comprise a nucleic acid encoding NY-ESO-1 of the amino acid sequence of NCBI reference accession number NP_001318.1. The amino acid sequence of NY-ESO-1 comprises the amino acid sequence of SEQ ID NO: 15.

[0342] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable heavy chain comprising the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding the anti-OX40 variable heavy chain is SEQ ID NO: 6. The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 variable light chain comprising the amino acid sequence of SEQ ID NO: 7. The nucleic acid sequence encoding the anti-OX40 variable light chain is SEQ ID NO: 8.

[0343] The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain of the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain of the amino acid sequence of SEQ ID NO: 7. The Sindbis viral vector can include a nucleic acid encoding a mouse anti-OX40 heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 5 and a nucleic acid encoding a mouse anti-OX40 light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 7.

[0344] The Sindbis viral vector can comprise a nucleic acid encoding an anti-OX40 antibody heavy chain comprising the amino acid sequence of SEQ ID NO: 9. The nucleic acid sequence encoding the anti-OX40 antibody heavy chain is SEQ ID NO:10.

[0345] The Sindbis viral vector can comprise a nucleic acid encoding a murine anti-OX40 antibody light chain comprising the amino acid sequence of SEQ ID NO: 11. The nucleic acid sequence encoding the anti-OX40 antibody light chain is SEQ ID NO:12.

[0346] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having the amino acid sequence of SEQ ID NO:9 and an anti-OX40 antibody light chain having the amino acid sequence of SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain of SEQ ID NO:10 and an anti-OX40 antibody light chain of SEQ ID NO:12.

[0347] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, and an anti-OX40 antibody light chain having an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10 and an anti-OX40 antibody light chain that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12.

[0348] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO:13.

[0349] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody light chain having an amino acid sequence that binds to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0350] The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody variable heavy chain amino acid sequence and an anti-OX40 antibody variable light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13. The Sindbis viral vector can include a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence and an anti-OX40 antibody light chain amino acid sequence that bind to a target antigen of the amino acid sequence of SEQ ID NO: 13.

[0351] The "monoclonal antibody" disclosed herein may be a full-length antibody or an antigen-binding fragment thereof, and the "antigen-binding fragment" is a fragment of the full-length antibody that retains the binding of the monoclonal antibody to the target antigen. For example, the monoclonal antibody against OX-40 or the anti-OX40 monoclonal antibody described herein may be a full-length antibody against OX40 or an antigen-binding fragment thereof, where the fragment retains the binding to the OX40 receptor on the cell surface. The "antigen-binding fragment" of the anti-OX40 antibody described herein may include any fragment selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, scFv-CH3, scFv-Fc, and bispecific antibody fragments.

[0352] The results provided in this disclosure demonstrate that combined administration of IL-12 and NY-ESO-1 expressed by separate Sindbis viral vectors synergistically improves the survival rate of subjects with established tumors. The results described herein reveal that mice implanted with Alm5-2Fluc-17 ovarian cancer cells by reinjection to establish tumors, as shown in FIG. 19, did not show improved survival when treated with a SV vector expressing NY-ESO-1 (SVNYESO) after tumor establishment, and showed similar survival rates to untreated tumor-bearing mice, indicating that some tumors are resistant to treatment with SV expressing a TAA such as NY-ESO-1. The results described herein reveal that treatment of tumor-bearing mice with SV expressing NYESO (SV-NYESO_SV-IL12) showed improved survival rates. Surprisingly, the results show that treatment with a 50% mixture of SV expressing IL-12 (SV-IL-12) and SV expressing NYESO (SV-NYESO_SV-IL 12) in one injection synergistically enhanced survival rates compared to mice treated with SV-IL-12 or SV-NYESO. The results described herein clearly demonstrate the potential of using a combination of SV vectors expressing IL-12 and SV vectors expressing NY-ESO-1 to treat cancers that may be resistant to treatment with SV expressing tumor-associated antigens.

[0353] The results provided in this disclosure demonstrate that administration of a combination of IL-12 and NY-ESO-1 expressed in the same Sindbis viral vector synergistically improves survival in subjects with established tumors. The results show that mice bearing established tumors of Alm5-2Fluc-17 ovarian cancer cells demonstrated synergistically enhanced survival when treated with a Sindbis viral vector expressing both IL-12 and NYESO (SV-NYESO_SGP2_IL12) compared to mice treated with SV-IL-12 or SV-NYESO. The results described herein clearly demonstrate the potential of using a single SV vector expressing both IL-12 and NY-ESO-1 to treat cancers that may be resistant to treatment with SV expressing tumor-associated antigens.

[0354] Treating cancer means treating at least one symptom of cancer, which may include inhibiting tumor growth, reducing tumor size, reducing tumor number, reducing tumor burden, preventing cancer recurrence, and preventing metastasis of a primary tumor, or any combination thereof.

[0355] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Included in this definition are benign and malignant cancers. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, leukemia, and germ cell tumors. More specific examples of such cancers include adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast cancer, cervical squamous cell carcinoma, cervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphatic tumors, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, papillary renal cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelioma, serous ovarian cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma, paraganglioma, prostate adenocarcinoma, rectal adenocarcinoma, sarcoma, cutaneous melanoma, gastric adenocarcinoma, testicular germ cell tumor, thyroid cancer, thymoma, uterine carcinosarcoma, and uveal melanoma. Other examples include breast cancer, lung cancer, lymphoma, melanoma, liver cancer, colorectal cancer, ovarian cancer, bladder cancer, renal cancer or gastric cancer.Further examples of cancer include neuroendocrine cancer, non-small cell lung cancer (NSCLC), small cell lung cancer, thyroid cancer, endometrial cancer, biliary tract cancer, esophageal cancer, anal cancer, salivary gland cancer, vulvar cancer, cervical cancer, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenal tumors, anal cancer, bile duct cancer, bladder cancer, bone cancer, intestinal cancer, brain cancer, breast cancer, cancer of unknown primary (CUP), bone metastasis cancer, brain metastasis cancer, liver metastasis cancer, Lung metastasis, carcinoid, cervical cancer, childhood cancer, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), colorectal cancer, ear cancer, endometrial cancer, eye cancer, follicular dendritic cell sarcoma, gallbladder cancer, gastric cancer, gastroesophageal junction cancer, germ cell tumors, gestational trophoblastic disease (GIT), hairy cell leukemia, head and neck cancer, Hodgkin's lymphoma, Kaposi's sarcoma, kidney cancer, laryngeal cancer, leukemia, linitis These include plastica type gastric cancer, liver cancer, lung cancer, lymphoma, malignant Schwannoma, mediastinal germ cell tumor, melanoma skin cancer, male cancer, Merkel cell skin cancer, mesothelioma, molar pregnancy, oropharyngeal cancer, myeloma, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, neuroendocrine tumors, non-Hodgkin's lymphoma (NHL), esophageal cancer, ovarian cancer, pancreatic cancer, penile cancer, persistent trophoblastosis and choriocarcinoma, pheochromocytoma, prostate cancer, pseudomyxoma peritonei, rectal cancer, retinoblastoma, salivary gland cancer, secondary cancers, signet ring cell carcinoma, skin cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, T-cell childhood non-Hodgkin's lymphoma (NHL), testicular cancer, thymic cancer, thyroid cancer, tongue cancer, tonsillar cancer, adrenal tumors, uterine cancer, vaginal cancer, vulvar cancer, Wilms' tumor, uterine cancer and gynecological cancer. Examples of cancer include, but are not limited to, hematological malignancies, lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, multiple myeloma, chronic lymphocytic leukemia, chronic myeloid leukemia, acute myeloid leukemia, myelodysplastic syndrome, myelofibrosis, biliary tract cancer, hepatocellular carcinoma, colorectal cancer, breast cancer, lung cancer, non-small cell lung cancer, ovarian cancer, thyroid cancer, renal cell carcinoma, pancreatic cancer, bladder cancer, skin cancer, malignant melanoma, Merkel cell carcinoma, uveal melanoma, or glioblastoma multiforme.

[0356] Nucleotide sequences encoding the TAAs expressed in the Sindbis viral vectors described herein are well known in the art and can be readily obtained from the literature. For example, the sequence of NY-ES0-1, a testis antigen aberrantly expressed in human cancers, was published in 1997 (http: / / www.pnas.org / content / 94 / 5 / 1914.full , Yao-Tseng Chen, Matthew J. Scanlant, Ugur Sahin, Ozlem Tiireci, Ali 0. Guret, Solam Tsangt, Barbara Williamsont, Elisabeth Stockertt, Michael Pfreundschuh, and Lloyd J. Old, PNAS 1997.), and the sequence of carcinoembryonic antigen was published in 1987 (http: / / mcb.asm.org / content / 7 / 9 / 3221.short Isolation and characterization of full-length functional cDNA clones for human carcinoembryonic antigen. N Beauchemin, .S. Benchimol, D Cournoyer, A Fuks and CP Stanners, Molecular and Cellular Biology.).

[0357] In mice, a single ip injection of the SV / TAA described herein is sufficient to induce a detectable CD8+-mediated immune response against the tumor, although other treatment regimens may be necessary to achieve a maximal response. For example, one to about eight ip injections over a period of one to many weeks may be preferred for maximal efficacy (with the possibility of one or more booster injections after one or more years). EXAMPLES

[0358] Example 1: Sindbis with anti-OX40 enables immune response against immune refractory tumors (cold tumors)

[0359] This study investigates the therapeutic efficacy of a replication-deficient oncolytic viral vector called Sindbis virus. Since Sindbis virus (SV) is a blood-borne pathogen, vectors derived from this virus can be administered into the bloodstream via intravenous (iv) and intraperitoneal (ip) routes, making their delivery very easy [Tseng, JC, et al., Nature Biotech., 2004]. Furthermore, SV was genetically modified to be replication-deficient by splitting its genome and deleting packaging signals to block viral assembly after viral replication [Bredenbeek PJ, et al., J. Virol. 1993]. This study shows that SV expressing the inflammatory cytokine IL-12 (SV.IL12) activates T cells and enhances the expression of OX40 on CD4 T effector cells, thus enhancing the efficacy of agonistic anti-OX40 antibody therapy. The data show that the combination of SV.IL12 and anti-OX40 activates tumor immunity against poorly immunogenic tumors through metabolic reorganization of T cells into highly activated effector cells. Moreover, SV.IL12 combined with anti-OX40 induces significant immune cell infiltration into the tumor microenvironment. Considering that tumors tend to quickly escape immune responses by mutating or losing expression of drug targets or tumor antigens targeted by immune responses, the therapeutic approach disclosed herein reduces the risk of developing tumor resistance and provides an attractive and safe strategy to change the immunogenic phenotype of various cancers without prior knowledge of tumor antigens.

[0360] The work presented herein describes several non-limiting examples of anti-OX40 antibodies, Sindbis viral vectors (SV), Sindbis viral vectors expressing IL-12 (SV.IL-12), Sindbis viral vectors expressing anti-OX40 antibodies, and Sindbis viral vectors expressing both IL-12 and anti-OX40 antibodies. These examples are provided below to further illustrate various features of the invention. The examples also illustrate useful methodologies for carrying out the invention. These examples do not limit, nor are they intended to limit, the invention.

[0361] Materials and Methods

[0362] cell line

[0363] Baby hamster kidney (BHK), BALB / c colon cancer [CT26.WT (ATCC [登録商標] CRL-2638 TM )] and FVB prostate cancer [MyC-CaP(ATCC [登録商標] CRL-3255 TM )] cell lines were obtained from the American Type Culture Collection (ATCC). CT26 and MyC-CaP cells expressing firefly luciferase (Fluc) (CT26.Fluc and MyC-CaP.Fluc) were generated by stable transfection of pGL4.20_Fluc plasmid.

[0364] BHK cells were maintained in minimal essential alpha-modified medium (α-MEM) (Corning CellGro) containing 5% fetal calf serum (FCS, Gibco) and 100 mg / ml penicillin-streptomycin (Corning CellGro). CT26.Fluc and MyC-CaP.Fluc cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Corning CellGro) containing 4.5 g / l glucose, supplemented with 10% FCS, 100 mg / ml penicillin-streptomycin, 7.5 μg / ml puromycin or 400 μg / ml gentamicin. All cell lines were cultured at 37°C and 5% CO2.

[0365] SV production

[0366] SV-LacZ production and titration were performed as previously described [Scherwitzl I, Mal Ther Oncolytics. 2018]. SV.IL12 and SY.Lacz vectors were produced as previously described [Subramanian A et al., Proc Natl Acad Sci US A. 2005; Leonard WJ et al., F1000Res. 2016; Rowell JF et al., J. Immunol. 1999; Metcalf TU et al., J. Virol. 2013]. All SV viral vectors used in these studies are replication-deficient. Vectors were generated as previously described. The SV.IL12 plasmid used in this study was published in 2002 [Tseng JC et al., J Natl Cancer Inst. 2002]. To construct a Sindbis virus vector containing the gene for interleukin 12 (IL-12), a Sindbis virus vector SinRep / 2PSG was first constructed, which contains a second subgenomic promoter responsive to Sindbis replicase. Two DNA oligonucleotide primers containing the subgenomic promoter sequence (sequence 5' CGCGTAAAGCATCTCTACGGTGGTCCTAATAGTGCATG-3'; SEQ ID NO:29) and its complementary strand (5' CACTATTAGGACCACCGTCGAGATGCTTTA-3'; SEQ ID NO:30) were annealed and ligated into the MluI and SphI sites of the SinRep plasmid. The mouse IL-12 α subunit gene (mp35; ATCC87596) and IL-12 β subunit gene (mp40; ATCC87595) were subcloned into the MluI and StuI sites of SinRep / 2PSG, respectively, to generate the Sin-Rep / IL12 plasmid.

[0367] SV empty is an identical plasmid without additional genes of interest (e.g., IL12). SV.Luc was generated as described in [Tseng, JC et al., Nature Biotech., 2004]. SV.GFP was generated as published in 2012 [Suzme R et al., Cancer Gene Ther., 2012]. In brief, replicon-carrying plasmids (e.g., SinRep-IL12 or SinRep-IL-12) or DHBB helper RNA were linearized with XhoI. In vitro transcription was performed using the mMessage mMachine RNA transcription kit (Ambion). Helper and replicon RNA were then electroporated into BHK cells and incubated at 37°C in αMEM supplemented with 10% FCS. After 12 hours, the medium was replaced with OPTI-MEM (GIBCO-BRL) supplemented with CaCl2 (100 mg / l) and the cells were incubated at 37°C. After 24 hours, the supernatant was collected, centrifuged to remove cell debris, and frozen at -80°C. The vector was titrated as previously described [Tseng JC et al., J. Natl. Can. Inst., 2002].

[0368] In vivo experiments and tumor models

[0369] All experiments were performed in accordance with the Animal Care and Use Committee of New York University. Female BALB / c mice, 6–12 weeks of age, were purchased from Taconic (Germantown, NY), and age-matched male FVB / NJ mice were purchased from Jackson Laboratory.

[0370] Tumor inoculation and animal studies

[0371] 7×10 4 CT26.Fluc cells or 10 5 Treatment was initiated on day 4 after ip inoculation of MyC-CaP.Fluc cells (in 500 μl OPTI-MEM). For treatment, mice were randomized and administered SV (107 Animals were injected i.p. into the left flank with 100 μg of 10 ... Survival was monitored and recorded daily.

[0372] Flow cytometry

[0373] For flow cytometry analysis, spleens and tumors were harvested from mice and treated as previously described [Scherwitzl I, et al., Mol. Ther. Oncol, 2018]. Extracted tumors were minced into small pieces and incubated with RPMI and a digestion mixture containing Collogenase IV (50 μg / ml) and DNAse I (20 U / ml) for 1 h at 37°C. Tumor samples contained additional Hyaluronidase V (50 μg / ml) in the digestion mixture.

[0374] Spleens and digested tumors were ground through a 70 μm filter before lysis of red blood cells with ammonium chloride-potassium (ACK) lysis agent (Gibco). Cells were washed with PBS containing 1% FCS and surface receptors were stained with various antibodies. Fluorochrome-conjugated antibodies against mouse CD3, CD4, CD44, ICOS, OX40, CD69, Foxp3, Granzyme B, and Tbet were purchased from Biolegend. Fluorochrome-conjugated antibodies against mouse CD8a were purchased from BD Biosciences. Fluorochrome-conjugated antibodies against Mitotracker Deep Red FM, Mitotracker Gree, and CXCR3 and Ki67 were purchased from Thermofisher. Stained cells were fixed with PBS containing 4% formaldehyde. For intracellular staining, a forkhead box P3 (FOXP3) staining buffer set was used (eBioscience). Flow cytometry analysis was performed on an LSR II machine (BD Bioscience) and data analysis was performed using FlowJo (Tree Star).

[0375] Isolation of T cells

[0376] Total T cells were freshly isolated using the EasySep™ Mouse T Cell Isolation Kit. Freshly isolated lymphocytes were depleted of either CD4 or CD8 specific T cells using the EasySep™ Mouse CD4 and CD8 Positive Selection Kit II. T cell isolation and depletion were performed according to the manufacturer's protocol (Stemcell Technologies).

[0377] Enzyme-linked immunospot (ELISPOT)

[0378] Enzyme-linked immunospot was performed as previously described [Scherwitzl I, et al., Mol. Ther. Oncol, 2018]. Splenocytes and T cells were prepared as described for flow cytometry. Mouse IFNγ ELISpot was performed according to the manufacturer's protocol (BD Bioscience). Lymphocytes (4 × 10 5cells) and isolated (8 × 10 4 ) T cells were plated per well (overnight in RPMI supplemented with 10% FCS). No additional stimuli were used in ELISPOT. As a positive control, cells were stimulated with 5ng / ml PMA+1μg / ml ionomycin.

[0379] Ex vivo cytotoxicity assay

[0380] During treatment, T cells were isolated on days 7 and 14. 5 T cells were cultured at 100 / ml in RPMI supplemented with 10% FCS (1 ml) for 2 days in 24-well plates with CT26.Fluc cells (2 × 10 4 / ml) or MyC-CaP.Fluc cells (2 × 10 4 Cells were co-cultured with 100 μl of M-PER Mammalian Protein Extraction Reagent (Promega) per well. Cytotoxicity was assessed based on the viability of CT26 cells, which was determined by measuring luciferase activity in each well. Luciferase activity was measured by adding 100 μl of Steady-Glo reagent (Promega) to each cell lysate and measuring luminescence using a GLOMAX portable luminometer (Promega).

[0381] In vivo depletion of CD8+ and CD4+ T cells

[0382] CD8+ T cells were depleted using anti-CD8 antibody (clone 2.43) (Bio X cell, Lebanon, NH). Each mouse was injected with 0.1 mg antibody in 0.2 g PBS (starting 1 day before the first SV treatment, then every 4 days for 2 weeks). CD4+ T cells were depleted using anti-CD4 antibody (clone GK1.5) (Bio X cell, Lebanon, NH). Each mouse was injected with 0.4 mg (starting 1 day before the first treatment). Control mice were injected with PBS and isotype control.

[0383] Quantitative real-time PCR

[0384] RNA was extracted from tumor samples using the RNeasy Kit (Qiagen), followed by cDNA synthesis with the iScript II Kit (Bio-Rad). qRT-PCR was performed using iQTM SYBR Green Supermix (Biorad) and the StepOneTM Real-Time PCR Detection System (Applied Biosystems). PCR conditions were as follows: 95°C for 10 min, followed by 40 cycles of amplification (94°C for 30 s, 58°C for 30 s). For quantification, CT values ​​were normalized to GAPDH, and expression was analyzed using the 2-ΔΔCT method. Primers for CXCL9, CXCL10, and GAPDH were used. CXCL9 (forward: GAAGTCCGCTGTTCTTTTCC; SEQ ID NO: 25 reverse: TTGACTTCCGTTCTTCAGTG; SEQ ID NO: 26), CXCL10 (forward: GCTGCACTGCATCCATATC; SEQ ID NO: 27; reverse: AGGAGCCCTTTTAGACCTTT; SEQ ID NO: 28)

[0385] Transcriptome analysis of T cells

[0386] Total RNA was extracted from freshly isolated T cells from spleens on day 7 of treatment using the RNeasy Kit (Qiagen). For each group, three BALB / C or three FVB / J mice were used for biological repeats. RNA next-generation sequencing was performed by the NYUMC Genomics Center. RNA quality and quantity were analyzed. RNAseq libraries were prepared and loaded onto an automated HiSeq 4000 Sequencing System (Illumina) and run with single 50-nucleotide reads.

[0387] Alignment and differential expression analysis

[0388] Sequence Bowtie software: version 1.0.0 87HTSeq was used to align the reads to the mm10 mouse genome [Langmead R et al., Genome Biol. 2009] (allowing two mismatches). Uniquely mapped reads were further processed by removing PCR duplicates using Picard ("Picard Tools." Broad Institute, GitHub repository. http: / / broadinstitute.github.io / picard / ). 88 MarkDuplicate and transcript counts were performed using DESeq and differential gene expression was performed between all groups [Anders S et al., Genome Biol. 2010]. Differences in gene expression were considered significant when padj<0.05.

[0389] GSEA and enrichment map analysis

[0390] A network-based method, Enrichment Map 90, was used for gene set enrichment visualization and data interpretation. It is a follow-up analysis of Gene-Set Enrichment Analysis 2 (GSEA) [Mootha VK et al., Nat. Genet., 2003], which reduces redundancy, aids in the interpretation of large gene sets, and helps to quickly identify major enriched functional themes in gene expression data. To perform this analysis, we first assigned a unique row identifier for each transcript and obtained differentially expressed genes through DESeq [Anders S et al., Genome Biol. 2010]. These genes were then ranked and subjected to GSEA on the Gene Pattern 92 server using the GSEA Prerank module. Next, the Bioconductor package 'org.Mm.eg.db' was used to obtain gene identifiers corresponding to gene names, and the obtained positively and negatively adjusted gene identifiers were used to generate an enrichment map in Cytoscape [Shannon P et al., Genome Res. 2003]. Expression heatmaps were drawn by Morpheus (https: / / software.broadinstitute.org / morpheus / ). Maximum and minimum expression (row min. and row max.) for each gene were displayed in red and blue, respectively.

[0391] Measurement of T cell oxygen consumption and extracellular acidification rate

[0392] T cell metabolic output was measured by Seahorse technology as previously described [Scharping NE et al., Cancer Immunol. Res., 2017]. Purified T cells were cultured at 6 × 10 5Cells / well were seeded into Seahorse XF24 cell culture microplates. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an Agilent Seahorse XF24 metabolic analyzer following the manufacturer's recommended procedures (Agilent). For mitochondrial stress testing, 1) oligomycin (1 μM), 2) FCCP (1.5 μM), 3) rotenone (100 nM) and antimycin A (1 μM) were injected sequentially through ports A, B, and C.

[0393] Immunoblot analysis

[0394] Cells were cultured in M-PER according to the manufacturer's protocol. (登録商標) Lysates were lysed in Mammalian Protein Extraction Reagent. Lysates were separated by SDS-PAGE on 4-12% Bio-Rad gels, transferred to polyvinylidene difluoride (PVDF) membranes, and blocked with 5% Milk in TBS buffer containing 0.1% Tween-20 (TBST). Primary antibodies against c-Myc (Santa Cruz Biotechnology) and GAPDH (Thermofisher) were added at room temperature or overnight at 4°C. Secondary fluorescent antibodies (IRDye (登録商標) , LI-COR) was added to 5% Milk in TBST for 1 hour at room temperature. Odyssey (登録商標) An Infrared imaging system was used for visualization.

[0395] Histochemistry and Multiple Immunofluorescence (MIF)

[0396] Mouse tumors were harvested, fixed in 4% PFA for 2 days, embedded in paraffin, sectioned, and stained with H&E. For multiplex immunofluorescence staining and imaging, 5-micron paraffin sections were stained with a Leica BondRX according to the manufacturer's instructions. (登録商標) Akoya Biosciences automated stainer (登録商標) Opal TMStaining was performed with a multiplex automated kit. Sections were heat-fixed and blocked with Bond Epitope Retrieval Buffer 2 (Leica ER2, AR9640) before incubation with the first primary antibody. Primary antibodies in panel 1 were against CD3 (1:200, Biorad, MCA1477T), CD8 (1:2000, Cell Signaling, 98941S), and Ki67 (1:200, Abcam, AB16667). Primary antibodies in panel 2 recognized iNos (1:1000, Genetex, GTX130246), Arg1 (1:750, Genetex, GTX109242), granzyme B (1:1000, Abcam, AB4059), CD11b (1:10,000, Abcam, AB133357), and F480 (1:250, Cell Signaling, 70076S). Each primary antibody was followed by a cocktail of horseradish peroxidase-conjugated secondary antibodies against mouse and rabbit IgG (RTU, Akoya / Perkin Elmer, Cat# ARH1001), followed by tyramide-mediated signal amplification (TSA) with individual Opal fluorophores covalently linked to tumor antigens (1:250, Opal 520 (FP1496001KT), 540 (FP1487001KT), 570 (FP1494001KT), 620 (FP1488001KT), 650 (FP1495001KT), or 690 (FP1497001KT), Akoya / Perkin Elmer Cat#'s, respectively). Antibodies were then removed using either ER1 (Leica, AR9961) or ER2 (Leica, AR9640) heat retrieval buffer, and the next round of immunostaining was started. After completion of sequential incubations and stripping, slides were counterstained with spectral DAPI (Akoya / PerkinElmer, FP1490). Monoplex controls were used to confirm proper staining of the antibodies incorporated in the multiplex panel. Multispectral imaging was performed (20x) on a Vectra3 imaging system (Akoya / PerkinElmer).Fluorophore emission signatures were captured with a multispectral camera and then de-overlapped with InForm software (Akoya / PerkinElmer). Autofluorescence from unstained slides was removed from the composite, and pseudocolored images were exported as tif files.

[0397] statistical analysis

[0398] Statistical analysis was performed using GraphPad Prism 7.0 as described in the figure legends. All data are presented as mean ± SEM. Figures were generated using GraphPad Prism 7, Adobe Photoshop and ImageJ software. Naïve mice were compared with treated groups using one-way analysis using Prism 7 (GraphPad Software). Differences in p-values ​​<0.05 were considered significant: *P<0.05; **P<0.005; ***P<0.0001.

[0399] IL-12-expressing SV enhances OX40 expression in CD4 T cells

[0400] The study described herein investigated the therapeutic effect of SV.IL12 in immune-competent tumor-bearing mice (colon cancer; CT26). To develop SV.IL12 for cancer therapy, tumor cells were implanted ip and, after tumor establishment (day 4 after tumor cell injection [designated day 0]), SV, SV.IL12, and IL-12 were injected ip for 4 consecutive days (days 1, 2, 3, and 4) for a total of 4 weeks (Figure 1A and B). Untreated (control) and SV and IL-12-treated mice succumbed to cancer after 3 weeks, whereas treatment with SV.IL12 slightly extended survival time (overall long-term survival rate 7.1%). These data suggest that IL-12-expressing SV is required to induce the observed therapeutic effect. Shortly after ip injection, SV infects macrophages in mediastinal lymph nodes and T cells are subsequently activated (Figure 2). Even though SV.IL12-infected cells secreted significant amounts of IL-12 as observed in in vitro experiments (Figure 3A), ip injection of SV.IL12 did not significantly change plasma IL-12 levels in mice (Figure 3B). This suggests that IL-12 produced by SV acts locally to stimulate transduced macrophages that present tumor antigens to corresponding T cells and further activate them (Figure 2). It shapes the subsequent antitumor immune response, such as promoting differentiation into Th1 cells and increasing IFN-γ production (Figures 3C and 3D). 27, 28, 29, 30 One week after treatment, T cell responses were analyzed for the expression of inhibitory and activation markers. OX40 was significantly upregulated on CD4 T cells during SV.IL12 treatment, mostly in effector CD4 T cells and less in regulatory T cells (Figures 1C and 1D). Interestingly, SV treatment also induced OX40 upregulation on CD4 T cells, but to a lesser extent (Figures 1C and 1D). Based on the above results and previous studies reporting the beneficial effects of anti-OX40 in cancer treatment [Aspeslagh S et al., Eur. J Cancer, 2016], it was hypothesized that agonistic anti-OX40 antibodies could enhance the therapeutic effect of SV.IL12 and help induce anti-tumor immune responses without the need for knowledge of tumor antigens.

[0401] Intraperitoneal delivery of SV.IL12 and anti-OX40 antibodies cures established cancer

[0402] To investigate whether the oncolytic activity of SV.IL12 combined with anti-OX40 is necessary for successful anticancer therapy, SV-insensitive (colon cancer; CT26) and SV-sensitive (prostate cancer; MyC-CaP) tumor cell lines were used in this study (Figure 4) [Granot T et al., Mol. Ther., 2014; Huang PY et al., Mol. Ther., 2012]. Immunocompetent female BALB / c and male FVB / NJ mice were implanted with either the CT26 or MyC-CaP tumor cell lines expressing the firefly luciferase (Flue) protein, respectively. This allows tumor growth to be monitored in vivo using non-invasive bioluminescence imaging. After tumors were established (day 0), mice were treated with SV.IL12 in combination with anti-OX40. SV.IL12 was injected ip for four consecutive days (days 1, 2, 3, 4) for a total of four weeks (Figure 5A). Anti-OX40 was injected three times a week (days 0, 2, 4) for a total of two weeks. In both tumor models, all untreated animals experienced progressive tumor growth and succumbed to cancer at week 3 (Figures 5, 6). CT26.Fluc or MyC-CaP.Fluc tumor-bearing mice showed some improvement in tumor growth when treated with ip injection of SV.IL12 or anti-OX40 alone. Although SV.IL12 showed a delay in tumor progression, it only showed a moderate effect on long-term survival (Figures 5 and 6). In contrast, the combination of SV.IL12 and anti-OX40 led to complete tumor regression in both tumor models (Figures 5 and 6). After the treatment was terminated, the mice treated with the combination therapy occasionally experienced tumor recurrence, resulting in long-term survival rates of 91.6% and 50% in the CT26 and MyC-CaP tumor models, respectively. In conclusion, the combination of SV.IL12 and anti-OX40 induces a strong therapeutic effect against two separate solid tumors. Furthermore, these findings confirm that the oncolytic activity of SV is not necessary to induce a robust and effective anti-tumor response. Due to the fact that anti-OX40 monotherapy already led to a survival rate of 20-50%, we investigated whether the addition of SV.IL12 would allow a reduction in the frequency of treatment while maintaining the strong therapeutic effect of the combination therapy.This is particularly important because it reduces the risk of adverse events and is more convenient for outpatients. Interestingly, the therapeutic effect in the CT26.Fluc tumor model was maintained with only one injection per week of SV.IL12 and anti-OX40 (Figure 7). This is in contrast to MyC-CaP.Fluc tumor-bearing mice, which required a full therapeutic regimen (data not shown). Therefore, in the following experiments, CT26 tumor-bearing mice were treated with a weekly injection, whereas MyC-CaP tumor-bearing mice received the full therapeutic regimen.

[0403] Combination therapy significantly alters the transcriptomic signature of T cells

[0404] The requirement for T cells during SV.IL12+anti-OX40 treatment was evaluated. The presence of both CD4 and CD8 T cells was necessary to induce the observed therapeutic effect, as mice treated with the corresponding depleting antibodies were unable to control tumor growth (Figure 8). To better understand the impact of the combination therapy on T cells, RNA sequencing was performed on T cells isolated on day 7 from the spleens of naive, control, anti-OX40, and SV-treated mice with or without anti-OX40. Principal component analysis (PCA) of the normalized read data showed clear differences between the combination therapy and all other groups in both tumor models (Figures 9A and 9B). These data suggest that the combination therapy induces a clear T cell response in the periphery, independent of the tumor model and mouse strain, suggesting an indirect and immune-driving role of the SV vector, with negligible direct effects of the vector within the tumor (Figure 9C). Indeed, gene expression profiles of control vs. anti-OX40, SV, or SV + anti-OX40 were clearly different, with the latter having the most differentially expressed genes (DEGs) (503, 49, and 2100 DEGs, respectively) (Figure 9C). Of the 2100 DEGs in control vs. combination therapy, more genes were downregulated (more than two-fold more than upregulated) (1637 vs. 463). Similarly, downregulated DEGs outnumbered upregulated DEGs in control vs. anti-OX40 and control vs. SV (393 vs. 110, and 30 vs. 19, respectively).

[0405] To determine the biological processes in T cells affected by this treatment, unbiased pathway enrichment and network analysis was performed on DEGs from control vs combination therapy (Figure 9D). Although both up- and down-regulated DEGs were included in the analysis, the overwhelming majority of pathways were up-regulated in T cells treated with combination therapy (four clusters; with the exception of TGFβ signaling, ribosome biogenesis, translation, and chromatin modification). The up-regulated pathways were dominated by DNA replication, chromosome organization, and cell cycle regulation, but also included various metabolic and immunological processes such as mitochondrial respiration, nucleotide metabolism, and adaptive immune response.

[0406] Combination therapy enhances systemic T cell responses and favors Th1-like ICOS CD4 T cells

[0407] As T cells from combination therapy expressed marked changes in transcriptome signatures compared to all other groups, markers for T cell differentiation and activation (e.g., PD-1, ICOS, OX40, TIM3, KLRGl, IL7R) and T cell lineage transcription factors (e.g., EOMES, TBET, GATA3, BCL6, RORC, FOXP3) were analyzed (Figure 9E). Only T cells from combination therapy expressed the gene signature of terminally differentiated effector T cells, characterized by high expression of killer lectin-like receptor (KLRGl) and low expression of receptor for interleukin 7 (IL-7R) [Joshi NS et al., Immunity, 2007]. Furthermore, genes encoding products related to effector cell differentiation and function, such as Batf, Id2, Tbet, Gzmb, and Ifng, were also highly expressed in T cells isolated from mice treated with combination therapy compared to all other groups. Enhancement of effector T cells in combination therapy was confirmed in both tumor models (by flow cytometry) as judged by increased expression of CD44 and Ki-67, activation and proliferation markers, respectively (Figures 9F, 9G, 10). Interestingly, CD4+ T cells expressed a striking anti-tumor effector phenotype (ICOS), which was on average 2-3-fold higher in combination therapy compared to SV.IL12 or anti-OX40 treatment. + Tbet + ) were also expressed (Figures 9H and 9I). Previous studies have shown that ICOS was upregulated in cancer patients receiving anti-CTLA4 therapy. + Tbet + reported a correlation between CD4 T cell expansion and clinical benefit [Wei SC et al., Cell, 2017; Ng Tang G et al., Cancer. Immunol. Res. 2003; Carthon BC et al., Clin. Cancer Res., 2010]. In summary, SV.IL12 in combination with anti-OX40 induces a prominent systemic T cell response and favors the differentiation of terminal effector T cells. Furthermore, the combination therapy was associated with a significant increase in ICOS, which was reported to be elevated during successful anti-CTLA4 cancer treatment. + Tbet+ Induces a sustained increase in the frequency of CD4 T cells.

[0408] CD4 and CD8 T cells are metabolically reprogrammed in mice treated with SV.IL12 and anti-OX40

[0409] The tumor microenvironment can be a very challenging environment for effector T cells, as it is characterized by hypoxia, acidosis, and low levels of nutrients (e.g., glucose and glutamine) [Delgoffe, GM et al, Cancer Immunol. Res., 2016; Scharping, NE, Vaccines, 2016; Chang, CH et al., Cell, 2015]. Even if T cells are capable of activation and initiating effector functions, they may not be able to generate the bioenergetic intermediates required to carry out effector functions in the tumor microenvironment. Thus, providing metabolic support for T cells is important for successful cancer therapy, as previously reported [Scharping, NE et al., Immunity, 2016; Ho, PC et al., Cell, 2015; Siska PJ., et al, Trends immunol., 2015; Zhao et al., Nat. Immunol., 2016]. To test whether SV.IL12 in combination with anti-OX40 affects the metabolic state of T cells, gene set enrichment analysis (GSEA) of RNA-seq data was performed between T cells from combination therapy and controls. GSEA analysis showed that expression of genes involved in oxidative phosphorylation and glycolysis pathways was significantly higher during combination therapy (Figure 11). To confirm the GSEA analysis, peripheral T cells from both tumor models were metabolically profiled using Seahorse analysis at day 7 (Figures 11B, 12A, 12B). Oxidative phosphorylation and glycolysis profiles were determined in T cells from naive mice, control mice, and mice treated with SV.IL12 and / or anti-OX40 by measuring oxygen consumption rate (OCR) and extracellular acidification rate (ECAR), respectively. Although basal OCR was enhanced in T cells derived from combination therapy and SV.IL12 treatment, only the former had a dramatic increase in spare respiratory capacity in the CT26 model (FIGS. 11B and 12A).This was in contrast to T cells from the combination therapy in the MyC-CaP.Fluc tumor model, which expressed 3.75-fold higher basal OCR without spare respiratory capacity (Figure 12B). The discrepancy between the two models may be due to differences in the number of treatments, as MyC-CaP.Fluc-bearing mice received 3- and 4-fold more anti-OX40 and SV.IL12 injections, respectively.

[0410] Analysis of mitochondrial mass (Figures 11C and 12C) and activity (Figures 11D and 12C) by flow cytometry using the mitochondrial stains Mitotracker Green and DeepRed, respectively, revealed that SV.IL12 with or without anti-OX40 induced higher mitochondrial mass and activity in CD8 T cells, but not in CD4 T cells. These data suggest that the observed increase in basal OCR was mainly driven by CD8 T cells. Interestingly, a slight decrease in active mitochondria occurred in CD4 T cells from mice treated with the combination therapy, which may explain the increased spare respiratory capacity in this group. To test whether the decrease in active mitochondria in CD4 T cells is related to the switch to glycolysis, key regulators for glycolysis c-MYC and basal ECAR were measured for T cells from all groups. Indeed, the addition of anti-OX40 to SV.IL12 induced an increase in c-MYC protein expression and basal ECAR (Figures 11E and 11F). T cells from naive and control mice, as well as from mice treated with SV.IL12 or anti-OX40, showed no signs of elevation. Collectively, these findings demonstrate that SV.IL12 induces enhanced oxidative phosphorylation in CD8 T cells, whereas anti-OX40 is required in addition to SV.IL12 to drive CD4 T cells toward glycolysis by increasing the protein expression of c-MYC.

[0411] To determine the kinetics of peripheral T cell metabolism during the course of treatment with SV.IL12 and anti-OX40, OCR and ECAR were measured at days 7, 14 and 40 in CT26.Fluc-bearing mice (Figure 11G). As described above, T cells at day 7 were shifted towards a glycolytic state associated with the early effector phase. As reported for highly activated T cells [Buck MD et al., J. Exp. Med., 2015], after 2 weeks of treatment, T cells were switched to a high-energy state utilizing both metabolic pathways (oxidative phosphorylation and glycolysis). When tumors were completely rejected and mice were tumor-free for 1 month, T cells reverted to a more resting state like naive cells. Interestingly, T cells from MyC-CaP.Fluc-bearing mice were switched to a high-energy state early during treatment (day 7) and remained in this metabolic phenotype 2 weeks after treatment cessation (Figure 12D). The reason for this discrepancy may be due to the difference in the number of treatments applied in both tumor models, since MyC-CaP.Fluc-bearing mice received 3-fold and 4-fold more anti-OX40 and SV.IL12, respectively. T cells from control and anti-OX40 or SV.IL12-treated mice in both tumor models remained in a quiescent state over the course of treatment (Figure 12E). In summary, the combination of SV.IL12 and anti-OX40 metabolically reconfigures T cells to an energy state using both metabolic pathways (oxidative phosphorylation and glycolysis). This phenotype does not occur in SV.IL12 or anti-OX40-treated mice that succumb to cancer. Thus, the altered metabolic state of T cells correlates with an efficient anti-tumor response and better survival.

[0412] Metabolically reprogrammed T cells in SV.IL12+anti-OX40 treated mice exhibit enhanced CD4-mediated cytokine production and antitumor activity

[0413] To test whether metabolically reprogrammed T cells in the combination therapy have enhanced effector function, we analyzed cytokine production and cytotoxicity in T cells isolated from spleens on day 7. Genes encoding the proinflammatory cytokines ifng and il2 were upregulated in T cells from mice treated with SV+anti-OX40 (Figure 13A). ELISPOT analysis of interferon-γ (IFN-γ) by splenocytes confirmed the RNA sequencing data showing strongest IFN-γ secretion in mice treated with the combination therapy in both tumor models (Figures 13B and 13C). Splenocytes from mice treated with SV.IL12 also produced IFN-γ, but to a lesser extent. Interestingly, it was CD4 T cells that primarily produced IFN-γ, as depletion of CD4 T cells abolished IFN-γ secretion in splenocytes from mice treated with the combination therapy, whereas depletion of CD8 T cells did not abolish IFN-γ secretion.

[0414] Furthermore, RNA levels of cytotoxic proteases granzyme A and B were upregulated in mice treated with the combination therapy compared to all other groups (Figure 13A). Granzyme B protein expression correlated with RNA levels measured by flow cytometry in both tumor models (Figures 13D, 13E, and 14A-14D). Furthermore, granzyme B positive cells were detected in CD8 and CD4 T cells, suggesting the presence of cytotoxic CD4 T cells in mice treated with the combination therapy [Brown DM et al., Cell Immunol, 2010; Mucida D. et al., Nat Immunol, 2013; Reis BS et al., Nat Immunol 2013]. Upregulation of granzyme B was associated with downregulation of the transcription factor Foxo1, known to control granzyme transcription by suppressing the transcription factor T-bet (Figure 13A) [Rao RR et al., Immunity, 2012]. Finally, the enhanced cytotoxic potential of T cells from the combination therapy was also supported by elevated expression of the NKG2D receptor, which has been shown to trigger TCR-independent cytotoxicity in activated T cells (Figures 13A, 14E, 14F) [Verneris MR et al., Blood 2004].

[0415] Since upregulation of granzymes and cytotoxicity receptors was observed in the combination therapy, ex vivo tumor growth assays were used to study T cell function. Splenocytes from all groups were co-cultured with either CT26.FLUC (Figure 13F) or MyC-CaP.Fluc (Figure 13G) tumor cell lines at an effector-to-target cell ratio of 10:1. Antitumor activity of splenocytes was measured by measuring the luciferase activity of the cell lines, which correlates with tumor growth. In both tumor models, tumor growth was significantly reduced when co-cultured with splenocytes from mice receiving combination therapy compared to splenocytes from naive, control, and anti-OX40-treated mice. The antitumor activity of splenocytes from mice treated with SV.IL12 alone was weaker than that of the combination therapy. Surprisingly, tumor growth inhibition was mediated by CD4 T cells, since depletion of CD4 T cells (but not CD8 T cells) abolished the inhibitory effect of tumor cells. Taken together, these results clearly demonstrate that T cells from the combination therapy elicit enhanced antitumor and functional activities, such as granzyme B and IFN-γ production driven by CD4 T cells.

[0416] Mice treated with SV.IL12 + anti-OX40 exhibit enhanced T cell migration and intratumoral T cell immunity

[0417] Only a minority of all treated patients respond to current immunotherapies, and the presence of TILs has been shown to be one of the major factors influencing responsiveness to various therapies in multiple cancers [Galon, J et al., Science 2006; Hwang WT et al., Gynecol Oncol 2012]. Due to the fact that the antitumor response induced by SV does not necessarily require direct infection of the tumor or intratumoral injection, we investigated whether SV.IL12 therapy in combination with anti-OX40 could nevertheless alter the local tumor microenvironment and favor intratumoral immunity. To evaluate whether SV.IL12 in combination with anti-OX40 induces T cell infiltration into the tumor, the chemokine receptor CXCR3 on peripheral T cells was analyzed after one week of treatment. In the CT26.Fluc model, CXCR3 levels were significantly upregulated on CD4 T cells during combination therapy compared to all other groups, and CXCR3 levels remained elevated over the course of treatment (Figures 15A, 15B, and 16A). In contrast, CXCR3 expression on CD8 T cells appeared only later in the treatment, suggesting that CD4 T cells were recruited to the inflammatory site first, followed by CD8 T cells (Figure 16A). MyC-CaP.Fluc tumor-bearing mice showed elevated CXCR3 levels on CD4 and CD8 T cells after 1 week of combination therapy (Figures 16B and 16C). Furthermore, SV.IL12 treatment also increased CXCR3 expression on T cells, but to a lesser extent. The reason for this discrepancy between the two models may be due to the difference in the number of treatments, since MyC-CaP.Fluc-bearing mice received 3-fold and 4-fold more injections of anti-OX40 and SV.IL12, respectively. Cells expressing CXCR3 follow the gradient of their ligands CXCL9, CXCL10, and CXCL11 [Groom, JR & Luster, AD Exp. Cell Res. 2011]. Indeed, the combination therapy also enhanced the production of CXCL9 and CXCL10 in the tumor microenvironment, as determined by real-time PCR, suggesting that CXCR3-positive T cells migrate to the tumor site (Figure 15C).SV.IL12 or anti-OX40 treatment alone did not alter the expression of these ligands. Consistent with these observations, an overall increase in T cells was observed in CT26.Fluc and MyC-CaP.Fluc peritoneal disseminated tumors in mice treated with the combination therapy compared to control and anti-OX40-treated mice (Figures 15E and 15F). Mice treated with SV.IL12 also showed increased infiltration of T cells, but to a lesser extent. Furthermore, analysis of CD4 and CD8 T cells by flow cytometry revealed that the combination therapy increased the proportion of CD4 T cells in CT26.Fluc tumors, which is consistent with elevated CXCR3 expression on peripheral CD4 T cells (Figure 15D). These results clearly demonstrate that SV.IL12 + anti-OX40 alters the tumor microenvironment by facilitating T cell infiltration through modulation of the CXCR3 / CXCL9-11 axis. Combination therapy not only increased T cell infiltration in both tumor models, but CD4 and CD8 T cells also demonstrated enhanced functional activity in tumors, as determined by Ki-67 and granzyme B expression (Figures 15D, 16D, and 17). Consistent with these results, reduced proliferation (determined by Ki-67 expression in tumor cells) was observed in CT26.Fluc and MyC-CaP.Fluc tumor cells when treated with combination therapy compared to all other treatments (Figures 15E and 15F). These results suggest that the presence of activated T cells in the tumor microenvironment exerts antitumor activity that inhibits tumor growth. In addition to T cell activation, enhanced iNOS production was observed in MyC-CaP.Fluc tumors treated with combination therapy compared to control or anti-OX40 treatment (Figure 18). SV.IL12 treatment alone also induced iNOS production, but to a lesser extent. Interestingly, the amount of iNOS was inversely correlated with arginase 1 production, suggesting a repolarization of tumor-associated macrophages from an M2-like (tumor-promoting) to an M1-like (antitumor) phenotype upon combination therapy. These trends were observed only in MyC-CaP.Fluc, but not in CT26.Fluc tumors, which may be the result of direct infection of MyC-CaP cells with SV.

[0418] The studies described herein provide a practical strategy for cancer immunotherapy with SV and anti-OX40. This strategy exploits the existing T cell immune repertoire in vivo, eliminating the need to know the tumor antigens present. The studies described herein show that the combination of replication-deficient SV.IL12 and anti-OX40 amplifies these anti-tumor T cells and directs their action throughout the body against two separate solid tumors, effectively reversing local tumor-mediated immune suppression. This effect is specific to the combination therapy and was not observed with SV.IL12 or anti-OX40 treatment alone.

[0419] In the tumor microenvironment, the high metabolic activity of cancer cells, together with a poor vascular blood supply, can induce nutrient deprivation [Delgoffe, GM et al., Cancer Immunol Res. 2016; Scharping, NE & Delgoffe, GM, Vaccines, 2016; Chang, CH et al., Cell, 2015]. These conditions can impair TCR signaling, glycolysis and mitochondrial metabolism, as well as reduce mitochondrial mass, all hallmarks of T effector cells, resulting in impaired antitumor effector function of tumor-specific T cells [39-42 Scharping, NE et al., Immunity 2016; Ho, PC et al., Cell 2015; Siska, PJ & Rathmell, JC, Trends Immunol., 2015; Zhao, E. et al., Nat Immunol, 2016]. Data from two different models of cancer immunotherapy disclosed in the studies described herein show that SV.IL12+OX40 signaling provides the metabolic support required for T cells to generate effective antitumor responses. This metabolic support is most notably characterized by increased mitochondrial function and mass in CD8 T cells and a switch to aerobic glycolysis in CD4 T cells. T cells from mice treated with SV.IL12+anti-OX40 demonstrated enhanced protein expression of c-Myc compared to all other groups. Thus, the studies described herein clearly show that T cells are metabolically reprogrammed in the periphery during combination therapy.

[0420] The studies described herein strongly indicate that the therapeutic effect of SV.IL12 + anti-OX40 is driven by T cell regulation and reprogramming of its metabolic state, enhancing anti-tumor responses in the periphery and in the tumor microenvironment. Furthermore, the use of SV allows these metabolically reprogrammed T cells to better penetrate the tumor microenvironment, which is important for proper immunotherapy. Currently, anti-OX40 antibodies are being investigated in phase I and II clinical trials. SV will be tested as a single agent in its phase I clinical trial in the third quarter of 2020. The results from our current preclinical studies provide a strong rationale for combining SV.IL12 with an agonistic anti-OX40 antibody in a therapeutic modality in patients with solid tumors. In summary, the studies described herein clearly demonstrate that even in the absence of direct SV tumor targeting, SV vectors encoding SV.IL12+anti-OX40, or IL-12 and anti-OX40, can alter the tumor microenvironment in different solid tumors through indirect and immune-driven mechanisms that enhance T cell infiltration and intratumoral T cell immunity.

[0421] Example 2: Combination of IL-12 expressed by a Sindbis viral vector with anti-OX40 synergistically enhances survival of subjects with established tumors

[0422] The study described herein investigates the effect of administering IL-12 and anti-OX40 antibody, both expressed by Sindbis virus vector, to established tumors. This strategy is particularly advantageous for the treatment of cancers such as ovarian cancer (similar efficacy of the combination of SV.IL-12 and anti-OX40 antibody observed in colon and prostate cancer is not found in ovarian cancer). Administration of SV / IL-12 and anti-OX40 antibody enhanced the clearance of established tumors of CT26 and MyC-CaP, colon and prostate cancer cell lines, respectively. C57 / Bl6 albino (female) mice were reinjected with Alm5-2Fluc-17 ovarian cancer cells to establish tumors (Figure 19) and then treated with a) IL-12 expressing SV vector; b) IL-12 expressing SV vector combined with anti-OX40 antibody (aOX40_REP-IL12); c) a 50% mixture of fragmented SV expressing OX-40 IgG and fragmented SV expressing IL-12 (RepOX4OIgG_Rep-IL12); or d) a 50% mixture of fragmented SV expressing OX-40 IgG and full-length SV expressing IL-12 (RepOX4OIgG_SV-IL12). The survival percentages of the RepOX4OIgG_SV-IL12 and aOX40_Rep-IL12 treatment groups were comparable and higher than those of the SV-IL-12 and RepOX4OIgG_Rep-IL12 treatment groups. However, the results showed that the RepOX4OIgG_SV-IL12 treatment group showed the highest improvement in survival (Figure 20).

[0423] The work described herein provides plasmid constructs for expressing IL-12 and anti-OX40 in SV vectors. The work described herein provides plasmid constructs encoding the IL-12a and b subunits (Figure 38), the anti-OX40 IgG2a heavy and light chains (Figure 39), and a plasmid construct encoding a single chain antibody against OX40 (Figure 40).

[0424] The SV.IL12 plasmid used in this study was published in 2002 [Tseng JC et al., J Natl Cancer Inst. 2002]. To construct a Sindbis virus vector containing the gene for interleukin 12 (IL-12), the Sindbis virus vector SinRep / 2PSG was first constructed, which contains a second subgenomic promoter responsive to Sindbis replicase. Two DNA oligonucleotide primers (sequence 5' CGCGTAAAGCATCTCTACGGTGGTCCTAATAGTGCATG-3'; SEQ ID NO:29) and their complementary strands (5' CACTATTAGGACCACCGTCGAGATGCTTTA-3'; SEQ ID NO:30), containing the subgenomic promoter sequence, were annealed and ligated into the MluI and SphI sites of the SinRep plasmid. The mouse IL-12 α subunit gene (mp35; ATCC 87596) and IL-12 β subunit gene (mp40; ATCC 87595) were subcloned into the MluI and SphI sites of SinRep / 2PSG, respectively, to generate the Sin-Rep / IL12 plasmid.

[0425] The heavy and light chains of the OX40 Ab are expressed from a single SV using two subgenomic promoters. The synthesized sequence was designed to encode an IL-12 secretion signal peptide upstream of both the heavy and light polypeptide sequences preceded by a ribosome binding site and a start codon. The variable Ab binding sequence, which functionally binds to activate the OX40 receptor, contains non-unique complementarity determining regions. The variable chains are linked to mouse IgG2a light chain (GenBank accession number BAR42292) and heavy chain (GenBank accession number CAC20702) constant region sequences, respectively: this mouse IgG2a isotype is comparable to BioXcell OX40 Ab used in parallel in in vivo experiments.

[0426] In summary, the results described herein clearly demonstrate the feasibility of using a combination of SV vectors expressing IL-12 and SV vectors expressing anti-OX40 antibodies, or SV vectors expressing both IL-12 and anti-OX40 antibodies, for the treatment of cancers that may be resistant to directly administered anti-OX40 antibody therapy.

[0427] Example 3. Molecular and metabolic pathways mediating curative treatment of non-Hodgkin's B-cell lymphoma with Sindbis viral vectors and anti-4-1BB monoclonal antibodies

[0428] The studies described herein use antibodies against 4-1BB (CD137, TNFRSF9), a T cell costimulatory molecule. 4-1BB agonist stimulation significantly enhances NK and cytotoxic T cell activity. There are preclinical studies showing that α4-1BB effectively treats lymphoma and that depletion of Treg cells enhances the therapeutic effect of α4-1BB [Houot R et al., Blood, 2009]. The A20 tumor cells used in the studies described herein were obtained from spontaneous reticulum cell sarcoma (non-Hodgkin's lymphoma) in BALB / c mice.

[0429] Previously, we have used NYESO-1-bearing SVs encoding NYESO-1, a cancer testicular TAA, to cure CT26 tumors expressing NYESO-1 [Scherwitzl I et al., Mol. Ther. oncoytics, 2018]. The work described herein shows that systemically disseminated A20 lymphoma can be completely cured by SV+α4-1BB mAb combination therapy without the need to generate SVs encoding TAA known to be present in A20 lymphoma cells. In addition, the A20B lymphoma cells used in the current model are resistant to SV infection, so no intratumoral injection of SV vectors or infection of tumors is required.

[0430] One difference in the current study compared to those previously published is the use of SV vector combination therapy, which includes agonistic mAbs for costimulatory receptors versus targeting checkpoint blockade molecules such as CTLA4 and PD-1. The study described herein shows that agonistic mAbs in combination with SV vectors trigger a cascade of events that results in a curative outcome. The findings disclosed herein reveal the potential of SV combination therapy to treat tumors where TAAs are completely unknown.

[0431] Materials and Methods

[0432] Generation of firefly luciferase (Fluc)-expressing A20 cells

[0433] A20 cells were transfected with Nucleofector TM The cells were transfected with pGL4-neo_Fluc plasmid (Promega) by electroporation via Kit V (Lonza). Fluc-A20 cell clones were selected and maintained in RPMI1640 (Cellgro) + 10% FBS (Gibco) + 250 μg / ml G418 (Gibco). The A20 clone stably expressed fLuc and was used for tumor inoculation and subsequent experiments.

[0434] SV production

[0435] SV-LacZ production and titer determination were performed as previously described [Scherwitzl I et al., Mol. Ther. Oncoytics, 2018].

[0436] SV-GFP infection

[0437] A20 cells and control BHK cells were infected with GFP-carrying SV for 1 h, and GFP expression was observed the next day by fluorescence microscopy.

[0438] A20 tumor inoculation and in vivo imaging system (IVIS) imaging

[0439] 3×10 6 fLuc-A20 cells were inoculated into BALB / C mice by ip injection. Tumor growth was monitored as previously described [Scherwitzl I et al., Mol. Ther. oncoytics, 2018].

[0440] SV and α4-lBB Ab treatment

[0441] Treatment was initiated after successful tumor inoculation (day 4 after tumor cell injection, confirmed by IVIS imaging). Tumor growth was measured weekly by non-invasive bioluminescence imaging. SVLacZ was injected four times a week for a total of three weeks. Virus (10 7 ~10 8 For the two groups (4-1BB and SV+4-1BB), 41BB Ab (350 μg / mouse) was injected 3 times a week for 2 weeks. InVivoMAb anti-mouse 4-1BB was ordered from BioXCell (Clone: ​​LOB12.3, Cat.No. BE0169). For the low-dose treatment protocol, SVLacZ was injected 3 times a week for a total of 3 weeks ip. 41BB Ab (50 μg / mouse) was injected once a week for 3 weeks.

[0442] Ellipse Spot

[0443] Mouse IFNγ ELISPOT was performed according to the manufacturer's protocol (BD Biosciences). 2 × 10 cells per well were cultured in RPMI supplemented with 10% FBS. 5 spleen cells or 1 x 10 5 T cells were plated. For positive controls, splenocytes were stimulated with 5ng / ml PMA+1 μg / ml ionomycin.

[0444] Flow cytometry

[0445] Fluorochrome-conjugated antibodies against mouse CD3, CD4, CD8, CD25, CD44, CD62L, ICOS, CD11a, and ICAM-1 were purchased from Biolegend (San Diego, CA). Fluorochrome-conjugated antibodies against mouse Foxp3, EOMES, and CCR5 were purchased from Thermofisher. BUV395-conjugated antibody against mouse CD8a was purchased from BD Biosciences. For surface staining, cells were washed and stained with anti-mouse directly conjugated antibodies. Cells were analyzed using an LSRII flow cytometer (BD Biosciences) and data were analyzed using Flowjo software (Treestar, Ashland, OR). For intracellular cytokine staining, stimulated cells were fixed with cytofix / cytoperm solution (BD Biosciences), permeabilized with perm / wash buffer (BD Biosciences), and stained with anti-mouse IFN-γ antibody. For nuclear antigens, cells were fixed and permeabilized with Foxp3 fixation / permeabilization buffer (eBioscience) and stained with anti-Foxp3, T-bet, Ki67 and EOMES antibodies.

[0446] RNA isolation and transcriptome analysis

[0447] Total RNA was collected by RNAeasy isolation kit (Qiagen, Valencia, CA). For each group, three BALB / C mice were used as biological repeats. RNA sequencing was performed by NYUMC Genome Technology Center (GTC). To confirm significant differences in expression between any pair of groups, differential expression analysis was performed using Deseq2 and an adjusted p-value cutoff of 0.05 was applied [19, Love MI et al, Genome Biol. 2014] (q<0.05). To increase stringency, only genes with Log2 fold change ≥ 1 (upregulated) or ≤ -1 (downregulated) were selected for further analysis. Gene cluster analysis was performed by DAVID analysis using the selected differentially expressed genes [Huang da W et al., Nucleic Acids Res 2009, Huang da W et al., Nat Protoc. 2009]. RNA-seq results (normalized counts) were used as input to perform gene set enrichment analysis (GSEA) [Subramanian A, et al., Proc Natl Acad Sci US A. 2005]. Molecular Signatures Database (MSigDB) v4.0 was used as the screening database. For each gene, gene expression values ​​are normalized by the relative log2 fold change compared to the median value of this gene. Expression heatmaps were drawn by Morpheus (https: / / software. broadinstitute.org / morpheus / ). The list of statistically differentially expressed genes was used to generate canonical pathways and disease as well as biological function analysis by ingenuity pathway analysis (IPA; Ingenuity Systems, Redwood City, CA). To increase the representativeness of the samples, a nominal p<0.05 is selected as the cutoff value for IPA.

[0448] Tumor infiltrating lymphocyte (TIL) harvest

[0449] To investigate the phenotype of TILs, all treatments were initiated 11 days after tumor inoculation, and after 7 days of treatment, tumor masses were harvested and TILs phenotype was analyzed as previously described [18, Scherwitzl I, Mol Ther Oncoytics. 2018].

[0450] T cell Seahorse assay

[0451] T cells were isolated from the spleen using a Pan T cell isolation kit (Stemcells). T cells were plated in 24-well plates at 6 × 10 5 Cells were plated / well. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an Agilent Seahorse XFe24.

[0452] statistical analysis

[0453] For comparisons of two groups, statistical differences were determined by unpaired two-tailed Student's t-test. Multiple sample comparisons were analyzed by one-way ANOVA. For all experiments, P<0.05 was determined to be significant. All values ​​were calculated with Excel (Microsoft) and Prism software (GraphPad).

[0454] The combination of SV and α4-1BB mAb completely cured A20 lymphoma

[0455] To investigate whether SV has a therapeutic effect on tumors that are not targeted or infected by SV vectors, we used the A20 B cell lymphoma, which is highly resistant to SV infection (Figure 21). To monitor tumor growth in vivo, a firefly luciferase (f-Luc) expression vector was transfected into the A20 lymphoma cell line by electroporation. Stable f-Luc-expressing A20 clones were isolated by G418 selection. 3x10 per mouse 6f-Luc A20 tumor cells were injected intraperitoneally (ip). Tumor growth was monitored by IVIS imaging once a week. Tumors were well established 4 days after inoculation (Figure 22A). After tumors were established, SV and α4-1BB mAb treatment was initiated (referred to as day 0). A similar treatment protocol as previously reported was used [Scherwitzl I et al., Mol Ther Oncoyticss. 2018]. The combination of SV+α4-1BB mAb achieved the best therapeutic effect (Figure 22B). All mice in that group showed complete tumor regression at 2 weeks. Both SV or α4-1BB monotherapy achieved obvious therapeutic effects compared to untreated mice, but were not as effective as the combination, and some mice in these two groups eventually succumbed to tumors (Figure 22C).

[0456] SV alone and SV+α4-1BB mAb stimulated cell cycle progression, cytokine production and activation In the study described herein, SV significantly inhibited tumor growth by day 7 (Figure 22A). T cells play a key role in SV-induced antitumor immunity. T cell responses peak at day 7 post-infection [Scherwitzl I et al., Mol Ther Oncoyticss. 2018]. To investigate how SV-induced T cell responses help eradicate A20 lymphoma, RNA-Seq was performed with purified splenic T cells from all groups at day 7. Compared to untreated samples, 271 genes were upregulated (q<0.05 and Log2 fold change ≥ 1) and 28 genes were downregulated (q<0.05 and Log2 fold change ≤ -1) were identified in the SV-infected group by Deseq2 analysis (Figure 23A, Table 1). Table 1: List of genes expressed in SD by RNA-Seq in SV vs. untreated groups (q<0.05, Log2FC≧1 and Log2FC≦-1). [Table 1-1] [Table 1-2] [Table 1-3]

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Table 1-8

[0457] NIH DAVID cluster analysis was performed using the upregulated gene list. Enriched clusters were ranked based on enrichment score. The cell cycle gene cluster achieved the highest enrichment score (Fig. 23B, 24A). This result was confirmed by KEGG gene set enrichment analysis (GSEA) (Fig. 24B). The cell cycle gene set ranks highest (enrichment score = 0.64, FDR q value = 0.1, nominal p value = 0). These results suggest that SV infection enhances T cell cycle progression. SV induced upregulation of a series of cytokines and chemokines / chemokine receptors (Fig. 23C, left). To confirm the cytokines / chemokines upregulated by administration of SV vector, SV + α4-1BB mAb vs. α4-1BB mAb was compared (Fig. 23C, right). CCL8, IL-4, IL-13, and IL-21 are among the RNAs whose expression was upregulated by SV treatment. The IL-21 antitumor effect depends on the activation of T, B, and NK cells [Leonard WJ et al., F1000Res. 2016]. IL-4, IL-10, and IL-21 upregulation is consistent with previous reports [Rowell JF et al., J Immunol. 1999, Metcalf TU et al., J Virol. 2013]. Furthermore, Ingenuity Pathway Analysis (IPA) suggests that SV treatment promotes T cell migration by altering the expression of multiple molecules involved in migration, including multiple chemokines and chemokine receptors (Table 2, Figure 24C).

[0458] Table 2: Upregulated cell migration pathways in SV vs untreated groups by IPA. SV-induced SD upregulated gene sets are clustered by DAVID analysis (SV vs untreated). Gene clusters are ranked by enrichment score. [Table 2-1] [Table 2-2] [Table 2-3]

[0459] To understand why SV+α4-1BB mAb achieves the best therapeutic effect, Deseq2 analysis was performed on SV+α4-1BB mAb vs. untreated samples. In the SV+α4-1BB mAb group, 1046 upregulated genes (q<0.05 and log2 fold change ≧1) and 877 downregulated genes (q<0.05 and Log2 fold change ≦-1) were identified (Figure 23A, Table 3). T cells from animals treated with SV+α4-1BB mAb were also compared to SV alone, and 316 upregulated genes (p<0.05 and Log2 fold change ≧1) and 439 downregulated genes (p<0.05 and Log2 fold change ≦-1) were found in the SV+α4-1BB mAb treatment group (Figure 23A, Table 4).

[0460] Table 3: List of genes expressed in SD in SV+α4-1BB vs. untreated groups by RNA-Seq (q<0.05, Log2FC≧1 and Log2FC≦-1). [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 3-23

Table 3-24

Table 3-25

Table 3-26

Table 3-27

Table 3-28

Table 3-29

Table 3-30

Table 3-31

Table 3-32

Table 3-33

Table 3-34

Table 3-35

Table 3-36

Table 3-37

Table 3-38

Table 3-39

Table 3-40

Table 3-41

[0461] Table 4: List of SD-expressed genes in the SV+α4-1BB vs. SV group by RNA-Seq (q<0.05, Log2FC≧1 and Log2FC≦-1). [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9]

Table 4-10

Table 4-11

Table 4-12

Table 4-13

Table 4-14

Table 4-15

Table 4-16

Table 4-17

Table 4-18

Table 4-19

[0462] Next, NIH DAVID analysis was performed using the upregulated gene list. In both comparisons, upregulation of cell cycle genes is the highest enrichment cluster (although SV+α4-1BB mAb vs SV has a lower enrichment score compared to SV+α4-1BB mAb vs untreated samples) (Figures 23B and 25). This indicates that SV+α4-1BB mAb induced stronger T cell cycle progression compared to SV alone. T cell proliferation is important for an effective antitumor response against A20 lymphoma. The CD4 / CD8 T cell ratio in untreated mice was significantly decreased by day 28 after tumor inoculation (Figures 26A-26B). In addition, the Treg / CD8 T cell ratio increased by day 28, indicating impaired T cell function (Figures 26C-26D). In the other groups, the T cell ratio remained constant due to proliferation.

[0463] CD69 is the earliest marker of immune system activation. SV+α4-1BB mAb treatment synergistically upregulated CD69 on day 2 (Figure 23D). Furthermore, KEGG GSEA shows that T cell receptor signaling gene sets were enriched when comparing SV+α4-1BB vs. untreated samples (enrichment score=0.35, normalized enrichment score (NES)=1.56, FDR q-value=0.17, nominal p-value=0) (Figure 23E).

[0464] SV+α4-1BB mAb stimulated cytotoxic T cell function

[0465] To investigate the antitumor cytotoxicity of SV / α4-1BB-treated splenocytes, f-Luc A20 lymphoma cells were co-cultured with splenocytes on day 7. The splenocyte to tumor cell ratios were 40:1, 20:1, and 10:1. Splenocytes treated with SV+α4-1BB showed the highest cytotoxicity of all groups, as calculated by the reduction in f-Luc activity (Figure 27A). To understand whether this response was induced by TAA or antiviral immunity, we performed the same experiment with treated mice (but without tumor inoculation). We found that SV+α4-1BB exerted a similar effect as the combination therapy with tumor inoculation. This indicates that the antitumor response on day 7 was not tumor specific. Accordingly, NKG2D, granzyme B, and perforin were highly expressed in CD8 T cells from α4-1BB-treated mice. In addition, the combination of SV+α4-1BB induced the highest expression of NKG2D and granzyme B in CD8 T cells. The upregulation of NKG2D, granzyme B, and perforin was not tumor-dependent, since the same pattern was observed for all treatments even without tumor inoculation (Figures 27B-27C). Correspondingly, IPA shows that a set of genes for cytotoxic T cell development is significantly upregulated in SV+α4-1BB mAb. These genes include Gzmb (granzyme B), Prfl (perforin), and Klrkl (NKG2D) (Figure 27D). These data indicate that SV+α4-1BB mAb significantly enhanced cytotoxic T cell activity.

[0466] SV+α4-1BB mAb induced IFN-γ production from T cells

[0467] Other upregulated genes in SV+α4-1BB mAb combination therapy included STAT4 (Figure 27D) and IL12rb1 (Figure 28D), which are required for Th1 cell development from naive CD4+ T cells and IFN-γ production (Figure 27D) (responding to IL-12) [Jacobson NG et al., J Exp Med. 1995]. Consistent with this observation, splenocytes from SV+α4-1BB mAb treatment produced a significantly higher number of IFNγ spots compared to other groups, with production peaking on day 7 (Figure 28A, top panel). After 7 days, the response weakened but remained at the highest level compared to other groups (Figure 28A, bottom panel). This is consistent with the increased IFN-γ RNA levels. To confirm whether TAA or viral antigens induce IFN-γ production on day 7, the same experiment was performed in tumor cell-naive mice. In both SV or SV+α4-1BB treatment, the presence or absence of tumor did not significantly affect IFNγ levels (Figure 29), confirming that IFNγ production on day 7 was primarily an antiviral response. To determine whether T cells or antigen-presenting cells (APCs) play a major role in IFNγ production, splenic T cells and naive T cells treated with SV were harvested, respectively. T cells from SV-treated mice were cocultured with naive APCs. Conversely, APCs from SV-treated mice were cultured with naive T cells. T cells from SV-treated mice produced IFN-γ when cocultured with naive APCs. Naive T cells produced much fewer IFNγ spots when cultured with SV-infected APCs. However, neither T cells nor APCs alone were able to increase the number of IFNγ spots. These observations indicate that T cells play a major role in IFN-γ production during SV infection (Figure 30A). APCs are essential for helping T cells produce IFNγ.

[0468] Next, to confirm whether CD4 or CD8 T cells produce IFN-γ, flow cytometry analysis was performed to analyze cytokines. Among splenocytes, 2-2.5% of SV+α4-1BB mAb-treated CD4 T cells produced significantly higher IFN-γ than the other groups. In all groups, the percentage of IFN-γ-producing CD8 T cells was very low (Figure 28B). When APC was removed, much fewer T cells produced IFN-γ (Figure 28B). There was also no difference in IFN-γ production among all groups. This suggests that T cell-APC interaction is essential for IFNγ production. To test the antitumor IFNγ-producing activity of purified T cells, they were co-cultured for 5 hours with A20 cells expressing major histocompatibility complex (MHC) I and II molecules [Pizzoferrato E et al., Int J Cancer, 2004]. Only CD4 T cells from the SV+α4-1BB mAb group produced IFN-γ after coculture (Fig. 28C and 30B). This indicates that SV+α4-1BB mAb induces antitumor IFNγ production activity. Besides IFN-γ, several Th1-related genes were also upregulated in T cells from the SV+α4-1BB mAb treatment group. These include Ccr5, Cxcr3, Havcr2 (Tim3), IL12rb1, and Klrc1 (Fig. 4d). T-bet is a key transcription factor essential for type I immune responses (IFN-γ production, T cell cytotoxicity) and memory T cell differentiation. Consistent with the IFNγ expression findings, it was observed that SV+α4-1BB mAb coordinately upregulated T-bet in T cells at day 7 (Fig. 28E). This suggests that SV helps α4-1BB to boost type I immune responses, which are important in controlling tumor growth. SV or α4-1BB mAb alone failed to induce high IFNγ production due to low T-bet upregulation. Another important transcription factor, Eomesodermin (EOMES), is upregulated in activated T cells and is essential for the development of memory CD8 T cells.Both α4-1BB mAb and SV+α4-1BB mAb induced high expression of EOMES at day 7 (Figure 28F). Lack of both T-bet and EOMES leads to reduced expression of CXCR3 in T cells and a dramatic reduction in the number of tumor-infiltrating T cells

[28] . The data disclosed herein are consistent with these observations. Elevated CXCR3 (Figure 28D), T-bet and EOMES (Figures 28E and 28F) were found in T cells from SV+α4-1BB mAb combination-treated animals.

[0469] SV and α4-1BB mAb stimulated chemotaxis, adhesion, and enhanced T cell infiltration and activation in tumors

[0470] RNA-seq confirmed that a series of chemokines and chemokine receptors were upregulated in SV+α4-1BB mAb (Figure 31A). Among these molecules, flow cytometry confirmed CCR5 upregulation (Figure 31B). CCR5 enhances CD4 T helper cell function boosting overall antitumor responses [Gonzalez-Martin A et al., Oncoimmunology, 2012]. SV+α4-1BB was found to significantly upregulate CD11a and ICAM-1 (CD54). These two adhesion molecules are highly expressed on activated T cells. LFA-1 (CD11a / CD18)-ICAM-1 interaction is essential for the formation of immune synapses between T cells and APCs [Walling BL et al., Front Immunol, 2018]. LFA-1 and ICAM-1 are also required for T cell-T cell homotypic aggregation and activation [Sabatos CA, et al., Immunity, 2008; Gerard A, et al., Nat Immunol. 2013]. α4-1BB mAb stimulation induced significant upregulation of CD11a and ICAM-1 in both CD4 and CD8 T cells, whereas SV did not (Fig. 31C-31E). Furthermore, the T cell costimulatory molecule OX40 was also significantly upregulated in T cells from mice treated with α4-1BB (Fig. 31F, left). OX40 association promotes effector T cell function and survival [33 Croft M, et al., Immunol Rev. 2009]. ICOS, another CD4 T cell costimulatory molecule, was upregulated by SV or α4-1BB alone but was most upregulated by the SV+α4-1BB combination therapy, suggesting the presence of a synergistic effect (Figure 31F, right).

[0471] TILs play an important antitumor role and are important markers for prognosis. Compared to untreated, the percentage of CD3 and CD8 T cells increased approximately two-fold after combination therapy (Figure 31G). Ki67 was upregulated in T cells that showed active division (Figure 32A). Untreated TILs had the highest frequency of Foxp3+ Treg cells (Figure 32B) and the lowest CD8 / Treg ratio (Figure 31H). Treatment enhanced T-bet and EOMES expression in T cells (Figures 32C-32D). NKG2D and granzyme B were highly upregulated in tumor-infiltrating CD8 T cells (Figures 31I and 32E). Overall, these data indicate that combination therapy enhanced T cell infiltration, division, activation, and cytotoxicity, and downregulated the suppressive Treg population.

[0472] SV and α4-lBB mAb synergistically enhance oxidative phosphorylation

[0473] T cell activation requires rapid expenditure of energy through both enhanced glycolysis and oxidative phosphorylation [Wahl DR et al., Immunol Rev., 2012]. Metabolic switching is a key feature of T cell activation and memory T cell development [van der Windt GJ et al., Immunol Rev., 2012]. GSEA KEGG analysis identified a glycolysis gene set to be upregulated in SV+α4-1BB vs. untreated samples (Figure 33A). This method rapidly generates ATP and supports T cell migration and cytotoxicity in hypoxic or acidic microenvironments. IPA confirms that SV+α4-1BB mAb synergistically enhanced oxidative phosphorylation (Figure 33B).

[0474] Both oxygen consumption rate (OCR, representing oxidative phosphorylation) and extracellular acidification rate (ECAR, representing glycolysis) of all groups were evaluated (Figure 33C). Compared to other groups, SV+α4-1BB significantly increased both OCR and ECAR, indicating that both glycolysis and oxidative phosphorylation are activated in T cells from animals treated with SV+α4-1BB.

[0475] SV plus low doses of α4-lBB mAb cured A20 tumor-bearing mice

[0476] To reduce the potential risk of cytotoxicity and the cost of treatment with SV vector + α4-1BB, the study disclosed herein investigated whether a lower dose of α4-lBB mAb and fewer injections would be effective in curing tumor-bearing mice as well as the higher dose and frequency used in our initial study. As demonstrated (Figures 34A and 34B), A20 tumor-bearing mice were completely cured with SV (3 times a week for 3 weeks) + low dose of α4-1BB mAb (50 μg / week for 3 weeks). This reduces the dosing requirements of both SV and α4-1BB mAb. The reduced dose of α4-lBB mAb would help prevent α4-1BB mAb-induced hepatotoxicity reported by several researchers [Bartkowiak T, et al., Clin Cancer Res., 2018].

[0477] All tumor-cured mice acquired durable antitumor immunity

[0478] To test the memory response to A20 lymphoma, naïve and tumor-cured mice were inoculated with 3 × 10 6 Each mouse was inoculated with 100 A20 tumor cells. After the first tumor challenge, only mice that survived for more than 4 months were selected. In all tumor-cured mice, the A20 lymphoma was completely rejected, whereas naive mice were susceptible to A20 inoculation (Figure 35A).

[0479] To confirm whether anti-tumor specificity was induced, IFN-γ production of purified T cells with or without tumor cells was measured by ELISPOT analysis. T cells were isolated from naive mice and cured mice under SV+α4-1BB treatment (4 months after the end of treatment). The isolated T cells were co-cultured with A20 and CT26 tumor cells, respectively. Co-culture with A20 cells dramatically enhanced IFN-γ production, whereas co-culture with CT26 cells only slightly enhanced IFN-γ production (Figure 35B).

[0480] Next, cytotoxicity was measured for both naive mice and cured mice under SV+α4-1BB treatment (similar method to Figure 27A). Compared to naive mice, cured mice had enhanced cytotoxicity against A20 lymphoma cells, but not against CT26 tumor cells. To confirm that this was mediated by T cells, the same experiment was performed with purified T cells. Cured mice had enhanced cytotoxicity compared to naive mice (Figure 35C).

[0481] To better understand the difference between this memory T cell response and the initial treatment response observed on day 7, we performed RNA-seq using purified splenic T cells from all rechallenge groups. In T cells from these rechallenged mice, only a small number of differentially expressed genes were found among the three treatment groups (Table 5), indicating that tumor-cured mice express very similar T cell gene expression profiles regardless of treatment method. Compared to untreated, KEGG analysis showed that TCR signaling was the most upregulated pathway in the SV+α4-1BB group (Figure 35D), indicating that persistently enhanced TCR signaling is important for maintaining anti-tumor immunity.

[0482] Table 5: SD expression gene list for all tumor-cured mouse groups [Table 5-1]

[0483] The conventional view of oncolytic virus therapy for tumors is that it requires selective infection of cancer cells, resulting in the induction of cancer cell lysis and apoptosis. TAAs are released from dead tumor cells to induce and stimulate antitumor immune responses. The study described herein found that coding of a TAA is not essential for the complete success of SV vector + α4-1BB mAb therapy. SV vectors lacking the A20 lymphoma TAA were able to treat A20 lymphoma and, in combination with α4-1BB mAb, eradicated the growing tumor. This is particularly important when an effective immunoreactive TAA is unknown. The immunotherapeutic response of SV vector + α4-1BB mAb may be independent of whether the tumor is "cold" (i.e., has few TAAs or mutation-specific neoantigens that can promote robust T cell activity) or "hot".

[0484] The study described herein showed that both NKG2D (KLRK1) and granzyme B were highly expressed under combination therapy. This strong nonspecific activation is important for controlling tumor growth at early time points (day 7). This step is also important for inducing antitumor specificity mediated by TAAs released from dead tumor cells by nonspecific killing. After tumor regression, T cells from treated animals were able to maintain the ability to produce IFN-γ and the acquired immune memory, and rapidly rejected rechallenge of A20 lymphoma. IFN-γ production from purified T cells of cured mice was significantly enhanced after encountering A20 tumor cells. This demonstrates that antitumor specificity is well established in cured mice. In the study described herein, the upregulated molecular pathways of responding T cells induced by SV vector and α4-1BB mAb alone and in combination were identified and compared. The combination of SV and α4-1BB mAb has synergistic effects and shows potent and robust therapeutic efficacy that can cure B lymphoma, providing long-term protection in preclinical models.

[0485] In conclusion, SV vectors in combination with α4-1BB mAb completely eradicated B cell lymphoma in a preclinical mouse model, an outcome that could not be achieved with either monotherapy. Tumor elimination was accompanied by a synergistic effect of the combination that significantly boosted T cell cytotoxicity, IFN-γ production, migration, tumor invasion, and oxidative phosphorylation. Furthermore, all mice that survived after treatment developed long-lasting antitumor immunity. The work disclosed herein provides a novel and alternative method for B cell lymphoma treatment and describes a rational method to aid in the translation of SV vectors + agonistic mAbs into clinical applications.

[0486] Example 4: NY-ESO-1 and IL-12 expressed in Sindbis viral vectors prolong survival of subjects with established tumors

[0487] The study described herein investigates the effect of administering tumor-associated antigens and immune stimulating molecules expressed by Sindbis virus vectors on antitumor responses and survival in subjects with established tumors. Previous studies have demonstrated that vectors encoding TAAs such as NY-ESO-I can cure CT26-NY-ES0-1 tumors [Galon J, et al., Nature reviews Drug discovery 2019; Gupta S, et al., Frontiers in oncology 2017]. However, while this approach was effective in enhancing immune responses and clearance against established tumors of colon and prostate cancer, its efficacy in curing other cancers, such as ovarian cancer, is limited. Therefore, we tested an approach of administering a combination of IL-12, an immune stimulating molecule expressed in SV, and SV-NY-ESO-1 to subjects with established tumors.

[0488] Combination of NY-ESO-1 and IL-12 expressed by separate Sindbis viral vectors improves survival in subjects with established tumors

[0489] The study described herein investigates the effect of administration of IL-12 and NY-ESO-1 expressed by separate Sindbis viral vectors on established tumors. C57 / B16 albino (female) mice were reinjected with Alm5-2Fluc-17 ovarian cancer cells to establish tumors (FIG. 19) and treated with either an SV vector expressing IL-12 (SV-IL-12), an SV vector expressing NY-ESO-1 (SVNYESO), or a 50% mixture of SV-IL-12 and SVNYESO (SV-NYESO_SV-IL12).

[0490] A Sindbis replicon (SV-NYESO1) expressing NYESO-1 cDNA was generated by PCR amplification of the NYESO-1 gene from the pReceiver-M02 plasmid. Expression of the NYESO-1 gene was confirmed by Western blot. NYESO-1 was detected by Western blot according to standard protocols, ...

Claims

1. A composition for treating cancer, comprising: (a) a Sindbis virus vector comprising a nucleic acid encoding interleukin-12; and (b) an anti-OX40 monoclonal antibody or a nucleic acid encoding the same; A composition comprising:

2. A composition for treating cancer, comprising: Sindbis virus vector containing nucleic acid encoding interleukin-12 and nucleic acid encoding anti-OX40 monoclonal antibody A composition comprising:

3. A Sindbis virus vector comprising a nucleic acid encoding interleukin-12, and A Sindbis virus vector containing a nucleic acid encoding an anti-OX40 monoclonal antibody is The composition of claim 1 .

4. The composition of claim 1 or 2, wherein the nucleic acid encoding interleukin-12 comprises a nucleic acid sequence encoding the interleukin-12 alpha subunit of SEQ ID NO: 1 and a nucleic acid sequence encoding the interleukin-12 beta subunit of SEQ ID NO:

2.

5. A nucleic acid encoding an anti-OX40 monoclonal antibody, a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence encoding an anti-OX40 antibody heavy chain, and comprising a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence encoding an anti-OX40 antibody light chain; The nucleic acid sequence encoding the anti-OX40 antibody heavy chain and the nucleic acid sequence encoding the anti-OX40 antibody light chain are the nucleic acid sequences of SEQ ID NOs: 6 and 8, 10 and 12, 32 and 34, 36 and 38, 40 and 42, 44 and 46, or 48 and 50; The composition according to claim 1 or 2.

6. The composition of claim 1 or 2, wherein the nucleic acid encoding the anti-OX40 monoclonal antibody comprises a nucleic acid encoding an anti-OX40 antibody heavy chain amino acid sequence, an anti-OX40 antibody light chain amino acid sequence, or a combination thereof, that binds to a target antigen of the amino acid sequence of SEQ ID NO:

13.

7. The composition according to claim 1, for systemically administering a Sindbis virus vector and an anti-OX40 monoclonal antibody.

8. The composition according to claim 1, for parenterally administering a Sindbis virus vector and an anti-OX40 monoclonal antibody.

9. The composition according to claim 1, for intraperitoneally administering a Sindbis virus vector and an anti-OX40 monoclonal antibody.

10. 3. The composition of claim 1 or 2, wherein the Sindbis viral vector is replication-defective.

11. The composition of claim 1 or 2, wherein the cancer comprises a solid tumor.

12. The composition of claim 1 or 2, wherein the cancer is colon cancer, prostate cancer or ovarian cancer.

13. A nucleic acid encoding interleukin-12, and Nucleic acid encoding an anti-OX40 monoclonal antibody A Sindbis virus vector comprising:

14. The Sindbis virus vector of claim 13, wherein the nucleic acid encoding interleukin-12 comprises a nucleic acid sequence encoding the interleukin-12 alpha subunit of SEQ ID NO:1 and a nucleic acid sequence encoding the interleukin-12 beta subunit of SEQ ID NO:

2.

15. A nucleic acid encoding an anti-OX40 monoclonal antibody, a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence encoding an anti-OX40 antibody heavy chain, and comprising a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence encoding an anti-OX40 antibody light chain; The nucleic acid sequence encoding the anti-OX40 antibody heavy chain and the nucleic acid sequence encoding the anti-OX40 antibody light chain are the nucleic acid sequences of SEQ ID NOs: 6 and 8, 10 and 12, 32 and 34, 36 and 38, 40 and 42, 44 and 46, or 48 and 50; The Sindbis virus vector of claim 13.

Images