Cell-penetrating peptides

Abstract

The present invention relates to peptides, particularly cell-penetrating peptides, and conjugates of such cell-penetrating peptides with therapeutic molecules. The present invention further relates to the use of such peptides or conjugates in methods of treatment or as medicaments, especially in the treatment of genetic disorders, particularly muscular dystrophies, such as Duchenne muscular dystrophy.

Description

[Technical field]

[0001] The present invention relates to peptides, in particular cell-penetrating peptides, and to conjugates of such cell-penetrating peptides with therapeutic molecules.The present invention further relates to the use of such peptides or conjugates in a method of treatment or as a medicament, in particular in the treatment of genetic disorders, in particular muscular dystrophies, such as Duchenne muscular dystrophy. [Background technology]

[0002] Nucleic acid drugs are genomic medicines that have the potential to transform human healthcare. Research suggests that such therapeutics could be applied across a broad range of disease areas, including neuromuscular diseases. Antisense oligonucleotide-based methods modulating pre-mRNA splicing have been applied to the neuromuscular disease Duchenne muscular dystrophy (DMD), placing this monogenic disorder at the forefront of precision medicine.

[0003] However, the therapeutic development of these promising antisense therapeutics has been hindered by poor cell penetration and distribution properties, challenges that are exacerbated in DMD by the large amount of muscle tissue matrix and its distribution properties.

[0004] DMD affects 1 in 3500 newborn boys. This severe X-linked recessive disease is caused by mutations in the DMD gene, which encodes the dystrophin protein. The disorder is characterized by progressive muscle degeneration and atrophy accompanied by the emergence of respiratory failure and cardiac complications, ultimately leading to premature death. The majority of mutations underlying DMD are genomic out-of-frame deletions that induce premature truncations in the open reading frame, which results in a deficiency of the dystrophin protein.

[0005] Exon skipping therapy utilizes splice-switching antisense oligonucleotides (SSOs) to target specific regions of the DMD transcript, inducing the elimination of individual exons and restoring the abnormal reading frame, resulting in the production of an internally deleted but partially functional dystrophin protein. Despite the undoubted potential of antisense oligonucleotide exon skipping therapy for DMD, the successful application of this approach is currently limited by the relative inefficiency of targeting skeletal muscle, as well as the poor targeting of single-stranded oligonucleotides to other affected tissues, such as the heart.

[0006] In September 2016, the Food and Drug Administration (FDA) granted accelerated approval to eteplirsen, a single-stranded oligonucleotide for modulating exon 51 splicing. This was the first approved oligonucleotide for modulating splicing in the United States, but the recovery of dystrophin was disappointing, being only about 1% of normal dystrophin levels. Comparison with the allelic disorder Becker muscular dystrophy and experiments in mdx mice suggest that at least about 15% of wild-type homogeneous sarcolemmal dystrophin expression is required to protect muscles from exercise-induced damage.

[0007] Therefore, there is an urgent need to improve the delivery of antisense oligonucleotides to provide more effective treatments for devastating genetic diseases such as DMD.

[0008] The use of viruses as delivery vehicles has been suggested, however, their use is limited by the immunotoxic and carcinogenic effects of viral coat proteins. As an alternative, various non-viral delivery vectors have been developed, of which peptides have emerged as the most promising due to their small size, target specificity and ability of transcapillary delivery of large biocargoes. Several peptides have been reported for their ability to penetrate cells alone or loaded with biocargoes.

[0009] For several years, cell-penetrating peptides (CPPs) have been conjugated to SSOs (especially charge-neutral phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs)) to enhance the cellular delivery of such oligonucleotide analogs by effectively carrying them through cell membranes to reach pre-mRNA target sites in the cell nucleus.It has been shown that PMO therapeutics conjugated to certain arginine-rich CPPs (also known as P-PMOs or peptide-PMOs) can enhance dystrophin production in skeletal muscle after systemic administration in the mdx mouse model of DMD.

[0010] In particular, PNA / PMO internalization peptides (Pips) have already been developed, which are arginine-rich CPPs composed of two arginine-rich sequences separated by a short central hydrophobic sequence. These "Pip" peptides were initially designed to improve serum stability while maintaining high levels of exon skipping by conjugating them to a PNA cargo. Further derivatives of these peptides were designed as PMO conjugates, which were shown to result in systemic skeletal muscle dystrophin production throughout the body, including the heart, after systemic administration in mice. However, despite the efficacy of these peptides, their therapeutic application has been hindered by their associated toxicity.

[0011] Alternative cell-penetrating peptides with a single arginine-rich domain, such as R6Gly, have also been produced. These CPPs have been used to generate peptide conjugates with reduced toxicity, but these conjugates have shown reduced efficacy compared to the Pip peptide.

[0012] Thus, currently available CPPs have yet to be shown to be suitable for use in the human treatment of diseases such as DMD. Summary of the Invention [Problem to be solved by the invention]

[0013] A challenge in the field of cell-penetrating peptide technology has been to decouple efficacy from toxicity. The inventors have now identified, synthesized, and tested several improved CPPs having specific structures described in the present invention that address at least this problem.

[0014] These peptides maintain a good level of efficacy in skeletal muscle when tested in vitro and in vivo with cargo therapeutic molecules. Moreover, these peptides demonstrate improved efficacy when used in the same conjugates compared to already available CPPs. At the same time, these peptides act effectively in vivo after systemic injection, with reduced clinical signs and reduced toxicity as observed through the measurement of biochemical markers. Importantly, the peptides demonstrate a surprising reduction in toxicity after similar systemic injections in mice compared to previous CPPs. Thus, the peptides of the present invention present improved suitability for use as therapeutic agents for humans over already available peptides and can be used in therapeutic conjugates for safe and effective treatment in human subjects. [Means for solving the problem]

[0015] According to a first aspect of the present invention, two or more cationic domains each containing at least four amino acid residues; One or more hydrophobic domains each containing at least three amino acid residues A peptide having a total length of 40 amino acid residues or less, comprising: Peptides are provided that do not contain artificial amino acid residues.

[0016] According to a second aspect of the invention there is provided a conjugate comprising a peptide of the first aspect covalently attached to a therapeutic molecule.

[0017] According to a third aspect of the invention there is provided a conjugate comprising a peptide of the first aspect covalently attached to an imaging molecule.

[0018] According to a fourth aspect of the invention there is provided a pharmaceutical composition comprising a conjugate of the second aspect.

[0019] According to a fifth aspect of the invention there is provided a conjugate according to the second aspect for use as a medicament.

[0020] In one embodiment of the fifth aspect, there is provided a pharmaceutical composition according to the fourth aspect for use as a medicament.

[0021] According to a sixth aspect of the invention there is provided a method of treating a disease in a subject comprising administering to the subject a therapeutically effective amount of a conjugate of the second aspect.

[0022] In one embodiment of the sixth aspect, there is provided a method of treating a disease in a subject comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition according to the fourth aspect.

[0023] According to a seventh aspect of the invention there is provided an isolated nucleic acid encoding the peptide of the first aspect or the conjugate of the second aspect or the conjugate of the third aspect.

[0024] According to an eighth aspect of the present invention there is provided an expression vector comprising a nucleic acid sequence according to the seventh aspect.

[0025] According to a ninth aspect of the present invention there is provided a host cell comprising an expression vector of the eighth aspect. [Brief description of the drawings]

[0026] [Figure 1] Figure 1 shows the in vitro exon 23 skipping efficacy of some peptides from the DPEP1 series conjugated to antisense therapeutic PMOs at 0.25 μM, 0.5 μM and 1 μM as measured by densitometric analysis of nested RT-PCR in H2K-mdx cells (error bars: standard deviation, n≧3). [Diagram 2] Figure 1 shows the in vitro exon 23 skipping efficacy of some peptides from the DPEP3 series conjugated to antisense therapeutic PMOs at 0.25 μM, 0.5 μM and 1 μM as measured by densitometric analysis of nested RT-PCR in H2K-mdx cells (error bars: standard deviation, n≧3). [Diagram 3] In vivo efficacy of selected peptides from the DPEP1 series conjugated to antisense therapeutic PMOs is shown in (A) tibialis anterior muscle, (B) diaphragm, and (C) cardiac muscle after a single 10 mg / kg intravenous dose in mdx mice as measured by Western blot and qRT-PCR (error bars: standard deviation, n=3). [Figure 4] In vivo efficacy of selected peptides from the DPEP3 series conjugated to antisense therapeutic PMOs is shown in (A) tibialis anterior muscle, (B) diaphragm, and (C) cardiac muscle after a single 10 mg / kg intravenous dose in mdx mice as measured by Western blot and qRT-PCR (error bars: standard deviation, n=3). [Diagram 5]Relative KIM-1 levels measured in the urine of C57BL / 6 mice 2 and 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 6] Relative NGAL levels measured in the urine of C57BL / 6 mice 2 and 7 days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 7] Serum BUN levels measured in C57BL / 6 mice 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 8] Serum creatinine levels measured in C57BL / 6 mice 7 days after administration of a single dose of 30 mg / kg of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 9] (A) Alanine transferase, (B) alkaline phosphatase and (C) aspartate aminotransferase serum levels measured in C57BL / 6 mice 7 days after administration of a single 30 mg / kg dose of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline (error bars: standard deviation, n=6). [Figure 10]Figure 1 shows the in vivo efficacy of exon 23 skipping as assessed by qRT-PCR in (A) tibialis anterior muscle, (B) diaphragm, and (C) heart of C57BL / 6 mice following a single 30 mg / kg intravenous administration of various DPEP peptides conjugated to antisense therapeutic PMOs compared to currently available peptide carriers conjugated to the same antisense therapeutic PMOs and saline. [Figure 11] Assessment of urinary KIM-1 levels on days 2 and 7 following single dose administration of different amounts of peptide-PMO between 2.5 and 50 mg / kg to 8-10 week old C57BL6 mice (n=4-6) in comparison to currently available peptide carriers conjugated to the same antisense therapeutic PMO. KIM-1 levels were determined by ELISA and normalized to urinary creatinine levels. Data are presented as fold change relative to control KIM-1 levels in saline injected mice (n=10). [Figure 12] Comparative dose-response study of the in vivo exon skipping efficacy of peptide-PMO following single dose administration of increasing amounts between 2.5 and 50 mg / kg to 8-10 week old C57BL6 mice (n=3-6) compared to currently available peptide carriers conjugated to the same antisense therapeutic PMO. qPCR analysis of exon 23 exclusion was assessed in (A) tibialis anterior muscle, (B) diaphragm, and (C) heart at 7 days post-administration. [Figure 13] Figure 1 shows that different DPEP1 / 3-[CAG]7PMO conjugates correct the splicing defect of Mbnl1 transcript in vitro in DM1 patient myoblasts (n=1-3) derived from DM1 patients carrying 2600 repeats in the DMPK gene at various concentrations. [Figure 14] Figure 1 shows different DPEP1 / 3-[CAG]7PMO conjugates correcting splicing defects of DMD transcripts in vitro in DM1 patient myoblasts derived from a DM1 patient carrying 2600 repeats in the DMPK gene at various concentrations (error bars: mean ± SEM, n = 1–3). [Figure 15]Relative KIM-1 levels assessed in urine of female C57BL6 mice at days 2 and 7 post-injection for different DPEP1 / 3-[CAG]7PMO conjugates, measured by ELISA using samples diluted to fall within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentration. KIM-1 levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n=4-10). [Figure 16] Relative NGAL levels measured in urine of female C57BL6 mice at days 2 and 7 post-injection for different DPEP1 / 3-[CAG]7PMO conjugates, measured by ELISA using samples diluted to fall within the standard curve. Values ​​were normalized to urinary creatinine levels to account for urinary protein concentration. NGAL levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n=4-10). [Figure 17] Figure 1 shows BUN levels assessed in serum of female C57BL6 mice 7 days after injection for different DPEP1 / 3-[CAG]7PMO conjugates compared to saline. BUN levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n = 4-10). [Figure 18] Creatinine levels assessed in serum of female C57BL6 mice 7 days after injection for different DPEP1 / 3-[CAG]7PMO conjugates compared to saline. Creatinine levels were similar to saline control injections compared to the fold increase induced by previous Pip-based peptide carriers (error bars: mean ± SEM, n = 4-10). [Figure 19]Figure 1 shows (A) Alanine aminotransferase (ALT), (B) alkaline phosphatase (ALP) and (C) aspartate aminotransferase (AST) levels assessed in serum from female C57BL6 mice treated with a bolus IV (tail vein) injection of different DPEP1 / 3-[CAG]7PMO conjugates compared to saline at collection on day 7 post-injection. ALP, ALT and AST levels were similar to saline control injections compared to the fold increase induced by the previous Pip-based peptide carrier. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] Detailed Description The present inventors have generated a series of peptides suitable for use as cell penetrating peptides for delivering therapeutic molecules into cells.

[0028] Surprisingly, the inventors have found a group of peptides with at least two cationic domains and at least one hydrophobic domain of defined length that do not contain any artificial amino acids and that have enhanced cell permeability to muscle compared to currently available cell-penetrating peptides, an effect observed when delivered to cells as conjugates with antisense oligonucleotide therapeutics or when administered in vivo.

[0029] In the context of the disease DMD, enhanced cell permeability by the peptides of the invention linked to appropriate therapeutic molecules can be demonstrated by specific exon exclusion within the transcript: directing antisense oligonucleotides to the appropriate sequences results in forced exon skipping, correction of the open reading frame, and restoration of the internally deleted but partially functional dystrophin isoform.

[0030] The peptides of the invention are shown herein to have high levels of exon exclusion and dystrophin protein restoration when used as conjugates with antisense oligonucleotide therapeutics designed to target the dystrophin gene.

[0031] In particular, conjugates comprising the peptides of the invention exhibit significantly increased cell penetration when compared to currently available peptides conjugated to the same antisense oligonucleotide therapeutics, as demonstrated in the present invention by increased exon skipping in the dystrophin gene in a variety of different muscle groups.

[0032] In vivo, the results described herein demonstrate that the levels of exon skipping and functional dystrophin expression using the peptide conjugates of the invention are nearly double the levels obtained from the use of the same antisense oligonucleotide therapeutics conjugated to already available cell-permeable peptides.

[0033] This is a significant improvement in the efficacy of such peptide carriers to penetrate muscle cells and has benefits in neuromuscular diseases.

[0034] Without wishing to be bound by theory, the inventors believe that removing artificial amino acids, such as 6-aminohexanoic acid residues, which are typically used in cell-penetrating peptides, and replacing them with, for example, naturally occurring beta-alanine residues, has a beneficial effect on reducing overall toxicity and increasing cell permeability of the peptide.

[0035] However, it was completely unexpected that such peptide structures without artificial amino acid residues would improve the delivery properties of previously reported cell-penetrating peptides to transport therapeutic molecular cargos, such as oligonucleotides, into muscle. The efficacy of a peptide is highly dependent on its ability to be serum stable for the length of time it takes for the peptide to enter cells. It was expected that peptides formed without artificial amino acids would be unstable in vivo, prone to protease degradation, and unable to penetrate muscle cells and tissues in sufficient quantities to enhance therapeutic efficacy. Contrary to this expectation, the inventors have found that peptides with the specific claimed structures are stable enough to enter cells and maintain good and improved efficacy, and yet have the advantage of a reduced toxicity profile due to the lack of artificial amino acids.

[0036] It was unexpected that such enhanced transport would result in therapeutic molecules such as antisense oligonucleotides successfully enhancing exon skipping and functional dystrophin protein production in a variety of different muscles, as demonstrated herein.

[0037] Moreover, it was not expected that such peptide structures would significantly reduce the toxicity of cell-penetrating peptides when delivering therapeutic cargo in vivo to the extent that human treatment with such conjugates would be feasible. In vivo, the results described herein show reduced nephrotoxicity as determined by biochemical markers.

[0038] For the avoidance of doubt and to provide clarity as to the direction in which this disclosure is to be interpreted, certain terms used in accordance with the present invention are further defined herein.

[0039] The present invention includes any combination of the described aspects and features unless such combination is expressly not permitted or is expressly avoided.

[0040] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0041] References throughout to "X" refer to any form of aminohexanoic acid, a man-made, synthetically produced amino acid.

[0042] References to "B" throughout refer to the naturally occurring, but non-genetically encoded amino acid beta-alanine.

[0043] References to "Ac" throughout indicate acetylation of the relevant peptide.

[0044] References throughout to "Hyp" refer to the naturally occurring, but non-genetically encoded amino acid hydroxyproline.

[0045] References throughout to other capital letters indicate the relevant genetically encoded amino acid residue according to the accepted alphabetical amino acid code.

[0046] Artificial Amino Acids The present invention relates to short cell-penetrating peptides having a specific structure that is free of artificial amino acid residues.

[0047] Reference herein to an "artificial" amino acid or residue means any amino acid that does not occur in nature, and includes synthetic amino acids, modified amino acids (e.g., sugar modified), non-natural amino acids, manmade amino acids, spacers, and non-peptide bond spacers.

[0048] Synthetic amino acids can be those chemically synthesized by humans.

[0049] For the avoidance of doubt, aminohexanoic acid (X) is an artificial amino acid in the context of the present invention. For the avoidance of doubt, beta-alanine (B) and hydroxyproline (Hyp) occur in nature and are therefore natural amino acids, rather than artificial amino acids, in the context of the present invention.

[0050] Artificial amino acids can include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azetidine-carboxylic acid (Az), 11-aminoundecanoic acid.

[0051] Suitably the peptide does not contain aminohexanoic acid residues.Suitably the peptide does not contain any form of aminohexanoic acid residue.Suitably the peptide does not contain 6-aminohexanoic acid residues.

[0052] Suitably the peptide comprises only naturally occurring amino acid residues and therefore consists of naturally occurring amino acid residues.

[0053] Suitably, the artificial amino acid typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, is replaced with a natural amino acid.Suitably, the artificial amino acid typically used in cell-penetrating peptides, such as 6-aminohexanoic acid, is replaced with an amino acid selected from beta-alanine, serine, proline, arginine, and histidine or hydroxyproline.

[0054] In one embodiment, aminohexanoic acid is replaced with beta-alanine. Suitably, 6-aminohexanoic acid is replaced with beta-alanine.

[0055] In one embodiment, aminohexanoic acid is replaced with histidine. Suitably, 6-aminohexanoic acid is replaced with histidine.

[0056] In one embodiment, aminohexanoic acid is replaced with hydroxyproline. Suitably, 6-aminohexanoic acid is replaced with hydroxyproline.

[0057] Suitably, artificial amino acids typically used in cell penetrating peptides, such as 6-aminohexanoic acid, may be replaced with any combination of beta-alanine, serine, proline, arginine and histidine or hydroxyproline, suitably any combination of beta-alanine, histidine and hydroxyproline.

[0058] In one embodiment, two or more cationic domains each containing at least four amino acid residues; One or more hydrophobic domains each containing at least three amino acid residues A peptide having a total length of 40 amino acid residues or less, comprising: Peptides are provided in which at least one cationic domain comprises a histidine residue.

[0059] Suitably, at least one cationic domain is histidine-rich.

[0060] Suitably, what is meant by histidine-rich is defined herein with respect to the cationic domain.

[0061] Cationic Domain The present invention relates to short cell penetrating peptides with a specific structure in which there are at least two cationic domains with a specific length.

[0062] References herein to "cationic" refer to an amino acid or domain of amino acids that carry an overall positive charge at physiological pH.

[0063] Suitably the peptide comprises a maximum of four cationic domains, a maximum of three cationic domains.

[0064] Suitably, the peptide comprises two cationic domains.

[0065] As defined above, a peptide comprises two or more cationic domains, each having a length of at least four amino acid residues.

[0066] Suitably, each cationic domain has a length of between 4 and 12 amino acid residues, suitably a length of between 4 and 7 amino acid residues.

[0067] Suitably, each cationic domain has a length of 4, 5, 6 or 7 amino acid residues.

[0068] Suitably each cationic domain is of similar length, suitably each cationic domain is of the same length.

[0069] Suitably, each cationic domain comprises cationic amino acids and may also comprise polar and / or non-polar amino acids.

[0070] The non-polar amino acids may be selected from alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. Suitably, the non-polar amino acids are uncharged.

[0071] The polar amino acids may be selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine. Suitably, the selected polar amino acids do not carry a negative charge.

[0072] The cationic amino acid may be selected from arginine, histidine, lysine. Suitably, the cationic amino acid carries a positive charge at physiological pH.

[0073] Suitably, each cationic domain does not include any anionic or negatively charged amino acid residues.

[0074] Suitably, each cationic domain comprises arginine, histidine, beta-alanine, hydroxyproline and / or serine residues.

[0075] Suitably, each cationic domain consists of arginine, histidine, beta-alanine, hydroxyproline and / or serine residues.

[0076] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50% cationic amino acids.

[0077] Suitably, each cationic domain comprises a majority of cationic amino acids. Suitably, each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

[0078] Suitably, each cationic domain comprises an isoelectric point (pI) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0079] Suitably, each cationic domain comprises an isoelectric point (pI) of at least 10.0.

[0080] Suitably, each cationic domain comprises an isoelectric point (pI) between 10.0 and 13.0.

[0081] In one embodiment, each cationic domain comprises an isoelectric point (pI) between 10.4 and 12.5.

[0082] Suitably, the isoelectric point of the cationic domain is calculated at physiological pH by any suitable means available in the art, suitably by using the web-based algorithm developed by Lukasz Kozlowski, Biol Direct. 2016;11:55. DOI:10.1186 / s13062-016-0159-9 at IPC (www.isoelectric.org).

[0083] Suitably, each cationic domain comprises at least one cationic amino acid, suitably between 1 and 5 cationic amino acids. Suitably, each cationic domain comprises at least two cationic amino acids, suitably between 2 and 5 cationic amino acids.

[0084] Suitably, each cationic domain is arginine-rich and / or histidine-rich. Suitably, a cationic domain may contain both histidine and arginine.

[0085] By "arginine-rich" or "histidine-rich" is meant that at least 40% of the cationic domain is formed by said residues.

[0086] Suitably, each cationic domain comprises a majority of arginine and / or histidine residues.

[0087] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

[0088] Suitably, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine residues.

[0089] Suitably, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% histidine residues.

[0090] Suitably, the cationic domain may comprise a total of between 1 and 5 histidine residues and between 1 and 5 arginine residues. Suitably, the cationic domain may comprise a total of between 1 and 5 arginine residues. Suitably, the cationic domain may comprise a total of between 1 and 5 arginine residues. Suitably, the cationic domain may comprise a total of between 2 and 5 histidine residues and between 3 and 5 arginine residues. Suitably, the cationic domain may comprise a total of between 3 and 5 arginine residues. Suitably, the cationic domain may comprise a total of between 2 and 5 histidine residues and between 3 and 5 arginine residues. Suitably, the cationic domain may comprise a total of between 2 and 5 histidine residues. Suitably, the cationic domain may comprise a total of between 2 and 5 histidine residues.

[0091] Suitably, each cationic domain comprises one or more beta-alanine residues. Suitably, each cationic domain may comprise between 2 and 5 beta-alanine residues in total, suitably 2 or 3 beta-alanine residues in total.

[0092] Suitably, the cationic domain may comprise one or more hydroxyproline or serine residues.

[0093] Suitably, the cationic domain may comprise between 1 and 2 hydroxyproline residues. Suitably, the cationic domain may comprise between 1 and 2 serine residues.

[0094] Suitably, all of the cationic amino acids within a given cationic domain may be histidines, or, suitably, all of the cationic amino acids within a given cationic domain may be arginines.

[0095] Suitably, the peptide may comprise at least one histidine-rich cationic domain.Suitably, the peptide may comprise at least one arginine-rich cationic domain.

[0096] Suitably, the peptide may comprise at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.

[0097] In one embodiment, the peptide comprises two arginine-rich cationic domains.

[0098] In one embodiment, the peptide comprises two histidine-rich cationic domains.

[0099] In one embodiment, the peptide comprises two arginine- and histidine-rich cationic domains.

[0100] In one embodiment, the peptide comprises one arginine-rich cationic domain and one histidine-rich cationic domain.

[0101] Suitably, each cationic domain contains no more than 3 consecutive arginine residues, suitably no more than 2 consecutive arginine residues.

[0102] Suitably, each cationic domain does not comprise consecutive histidine residues.

[0103] Suitably, each cationic domain comprises arginine, histidine, and / or beta-alanine residues. Suitably, each cationic domain comprises a majority of arginine, histidine, and / or beta-alanine residues. Suitably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues in each cationic domain are arginine, histidine, and / or beta-alanine residues. Suitably, each cationic domain consists of arginine, histidine, and / or beta-alanine residues.

[0104] In one embodiment, the peptide comprises a first cationic domain comprising an arginine residue and a beta-alanine residue and a second cationic domain comprising an arginine residue and a beta-alanine residue.

[0105] In one embodiment, the peptide comprises a first cationic domain comprising an arginine residue and a beta-alanine residue, and a second cationic domain comprising a histidine residue, a beta-alanine residue, and optionally an arginine residue.

[0106] In one embodiment, the peptide comprises a first cationic domain comprising an arginine residue and a beta-alanine residue and a second cationic domain comprising a histidine residue and a beta-alanine residue.

[0107] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and beta-alanine residues and a second cationic domain consisting of arginine and beta-alanine residues.

[0108] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and beta-alanine residues and a second cationic domain consisting of arginine, histidine and beta-alanine residues.

[0109] Suitably, the peptide comprises at least two cationic domains, suitably these cationic domains form the arms of the peptide. Suitably, the cationic domains are located at the N-terminus and C-terminus of the peptide. Suitably, therefore, the cationic domains may be known as cationic arm domains.

[0110] In one embodiment, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and the other at the C-terminus of the peptide. Suitably located at either end of the peptide. Suitably no further amino acids or domains are present at the N-terminus and C-terminus of the peptide, except for other groups such as terminal modifications, linkers and / or therapeutic molecules. For the avoidance of doubt, such other groups may be present in addition to the "peptide" described and claimed herein. Suitably, each cationic domain thus forms an end of the peptide. Suitably, this does not exclude the presence of further linker groups as described herein.

[0111] Suitably, the peptide may comprise up to four cationic domains. Suitably, the peptide comprises two cationic domains.

[0112] In one embodiment, the peptide comprises two cationic domains that are both arginine-rich.

[0113] In one embodiment, the peptide comprises one cationic domain that is arginine-rich.

[0114] In one embodiment, the peptide comprises two cationic domains, both of which are arginine-rich and histidine-rich.

[0115] In one embodiment, the peptide comprises one cationic domain that is arginine-rich and one cationic domain that is histidine-rich.

[0116] Suitably, the cationic domain comprises amino acid units selected from the following: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0117] Suitably, the cationic domain may also comprise serine, proline and / or hydroxyproline residues. Suitably, the cationic domain may further comprise an amino acid unit selected from the following: RP, PR, RPR, RRP, PRR, PRP, Hyp;R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the amino acid units listed above.

[0118] Suitably, each cationic domain comprises any one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.

[0119] Suitably, each cationic domain consists of any of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.

[0120] Suitably, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9).

[0121] Suitably, the cationic domains of each of the peptides may be the same or different. Suitably, the cationic domains of each of the peptides are different.

[0122] Hydrophobic domain The present invention relates to short cell-penetrating peptides having a specific structure in which there is at least one hydrophobic domain having a specific length.

[0123] References herein to "hydrophobic" refer to an amino acid or domain of amino acids that has the ability to repel or immiscible with water.

[0124] Suitably the peptide comprises a maximum of three hydrophobic domains, a maximum of two hydrophobic domains.

[0125] Suitably the peptide comprises one hydrophobic domain.

[0126] As defined above, a peptide comprises one or more hydrophobic domains, each having a length of at least three amino acid residues.

[0127] Suitably, each hydrophobic domain has a length of between 3 and 6 amino acids. Suitably, each hydrophobic domain has a length of 5 amino acids.

[0128] Suitably, each hydrophobic domain may comprise non-polar amino acid residues, polar amino acid residues and hydrophobic amino acid residues.

[0129] The hydrophobic amino acid residues may be selected from alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0130] The non-polar amino acid residue may be selected from proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine.

[0131] The polar amino acid residue may be selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine.

[0132] Suitably the hydrophobic domain does not include any hydrophilic amino acid residues.

[0133] Suitably, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. Suitably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. Suitably, each hydrophobic domain consists of hydrophobic amino acid residues.

[0134] Suitably, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.

[0135] Suitably, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.

[0136] Suitably, each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.

[0137] Suitably, each hydrophobic domain comprises a hydrophobicity of between 0.4 and 1.4.

[0138] In one embodiment, each hydrophobic domain comprises a hydrophobicity between 0.45 and 0.48.

[0139] In one embodiment, each hydrophobic domain comprises a hydrophobicity between 1.27 and 1.39.

[0140] Suitably, hydrophobicity is as measured by White and Wimley: WC Wimley and SH White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces", Nature Struct Biol 3:842 (1996).

[0141] Suitably, each hydrophobic domain comprises at least 3 hydrophobic amino acid residues, at least 4 hydrophobic amino acid residues.

[0142] Suitably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and glutamine residues. Suitably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and / or glutamine residues.

[0143] In one embodiment, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine residues.

[0144] In one embodiment, each hydrophobic domain consists of tryptophan and / or proline residues.

[0145] Suitably, the peptide comprises one hydrophobic domain. Suitably, the or each hydrophobic domain is located in the middle of the peptide. Suitably, the hydrophobic domain may therefore be known as core hydrophobic domain. Suitably, the or each hydrophobic core domain is flanked on both sides by arm domains. Suitably, the arm domain may comprise one or more cationic domains and one or more further hydrophobic domains. Suitably, each arm domain comprises a cationic domain.

[0146] In one embodiment, the peptide comprises two arm domains flanking a hydrophobic core domain, each arm domain comprising a cationic domain.

[0147] In one embodiment, the peptide consists of two cationic arm domains flanking a hydrophobic core domain.

[0148] Suitably, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0149] Suitably, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26), or any combination thereof.

[0150] Suitably the or each hydrophobic domain consists of one of the following sequences FQILY (SEQ ID NO: 21), YQFLI (SEQ ID NO: 20), ILFQY (SEQ ID NO: 22).

[0151] Suitably the or each hydrophobic domain consists of FQILY (SEQ ID NO:21).

[0152] Suitably, each hydrophobic domain within a peptide may have the same sequence or a different sequence.

[0153] peptide The present invention relates to short cell-penetrating peptides for use in the delivery of therapeutic cargo molecules in the treatment of disease conditions.

[0154] Peptide has a sequence that is a continuous single molecule, and therefore the domain of peptide is continuous.Compatibly, peptide comprises several domains that are linearly arranged between N-terminus and C-terminus.Compatibly, the domain is selected from cationic domain and hydrophobic domain as described above.Compatibly, peptide consists of cationic domain and hydrophobic domain, and the domain is as defined above.

[0155] Each domain has common sequence characteristics as described in the relevant section above, but the exact sequence of each domain is subject to variation and modification. Thus, a variety of sequences are possible for each domain. Combinations of each possible domain sequence result in a variety of peptide structures, each of which forms part of the present invention. The characteristics of the peptide structures are described below.

[0156] Suitably, a hydrophobic domain separates any two cationic domains. Suitably, each hydrophobic domain is flanked on either side by a cationic domain.

[0157] Suitably, a cationic domain is not contiguous with another cationic domain.

[0158] In one embodiment, the peptide comprises one hydrophobic domain flanked by two cationic domains in the following arrangement: [cationic domain]-[hydrophobic domain]-[cationic domain].

[0159] Thus, suitably, the hydrophobic domain may be known as a core domain and each cationic domain may be known as an arm domain. Suitably, the hydrophobic arm domains flank the cationic core domain on either side.

[0160] In one embodiment, the peptide consists of two cationic domains and one hydrophobic domain.

[0161] In one embodiment, the peptide consists of one hydrophobic core domain flanked by two cationic arm domains.

[0162] In one embodiment, the peptide is RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), ), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), and R[Hyp]RR[Hyp]R (SEQ ID NO: 19), respectively, and are flanked by two cationic arm domains each containing a sequence selected from YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), and WWPW (SEQ ID NO: 26).

[0163] In one embodiment, the peptide consists of one hydrophobic core domain comprising a sequence selected from FQILY (SEQ ID NO:21), YQFLI (SEQ ID NO:20), and ILFQY (SEQ ID NO:22), flanked by two cationic arm domains comprising a sequence selected from RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9).

[0164] In one embodiment, the peptide consists of one hydrophobic core domain comprising the sequence: FQILY (SEQ ID NO:21) flanked by two cationic arm domains comprising a sequence selected from RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8).

[0165] In any such embodiment, additional groups may be present, such as linkers, terminal modifications and / or therapeutic molecules.

[0166] Suitably the peptide is N-terminally modified.

[0167] Suitably the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated or N-methylsulfonylated. Suitably the peptide is N-acetylated.

[0168] Optionally, the N-terminus of the peptide may be unmodified.

[0169] In one embodiment, the peptide is N-acetylated.

[0170] Suitably the peptide is C-terminally modified.

[0171] Suitably the peptide comprises a C-terminal modification selected from a carboxy group, a thioacid group, an aminooxy group, a hydrazino group, a thioester group, an azide group, a strained alkyne, a strained alkene, an aldehyde group, a thiol group or a haloacetyl group.

[0172] Advantageously, the C-terminal modification provides a means for linking the peptide to a therapeutic molecule.

[0173] Thus, the C-terminal modification may include a linker or vice versa. Suitably, the C-terminal modification may consist of a linker or vice versa. Suitable linkers are described elsewhere herein.

[0174] Suitably the peptide comprises a C-terminal carboxyl group.

[0175] Suitably the C-terminal carboxyl group is provided by a glycine or beta-alanine residue.

[0176] In one embodiment, the C-terminal carboxyl group is provided by a beta-alanine residue.

[0177] Suitably the C-terminal beta alanine residue is a linker.

[0178] Suitably, therefore, each cationic domain can further comprise N-terminal modification or C-terminal modification.Suitably, the C-terminal cationic domain comprises C-terminal modification.Suitably, the N-terminal cationic domain comprises N-terminal modification.Suitably, the C-terminal cationic domain comprises a linker group, and suitably, the C-terminal cationic domain comprises C-terminal beta-alanine.Suitably, the N-terminal cationic domain is N-acetylated.

[0179] The peptides of the present invention are defined as having an overall length of 40 amino acid residues or less. A peptide can therefore be considered an oligopeptide.

[0180] Suitably the peptide has an overall length of between 3 and 30 amino acid residues, suitably between 5 and 25 amino acid residues, between 10 and 25 amino acid residues, between 13 and 23 amino acid residues, between 15 and 20 amino acid residues.

[0181] Suitably the peptides have an overall length of at least 12 amino acid residues, at least 13 amino acid residues, at least 14 amino acid residues, at least 15 amino acid residues, at least 16 amino acid residues, at least 17 amino acid residues.

[0182] Suitably the peptide is capable of penetrating cells and the peptide may therefore be regarded as a cell penetrating peptide.

[0183] Suitably, the peptide is for attaching to a therapeutic molecule. Suitably, the peptide is for transporting a therapeutic molecule to a target cell. Suitably, the peptide is for delivering a therapeutic molecule to a target cell. The peptide may therefore be considered as a carrier peptide.

[0184] Suitably the peptide is capable of penetrating cells and tissues, suitably into the nucleus of cells, suitably into muscle tissue.

[0185] Suitably, the peptide may be selected from any of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRFQILYRBRR (SEQ ID NO:28) RBRRBRFQILYRRBRBR (SEQ ID NO: 29) RBRBRFQILYRBRRBRR (SEQ ID NO: 30) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRILFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYRBRBR (SEQ ID NO: 33) RBRRBFQILYRBRRBR (SEQ ID NO: 34) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBFQILYRBRBR (SEQ ID NO: 36) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRRFQILYHBRBH (SEQ ID NO: 39) RBRRBRRYQFLIRBHBH (SEQ ID NO: 40) RBRRBRRILFQYRBHBH (SEQ ID NO: 41) RBRHBHRFQILYRBRBR (SEQ ID NO: 42) RBRBBHRFQILYRBHBH (SEQ ID NO: 43) RBRRBRFQILYRBHBH (SEQ ID NO: 44) RBRRBRFQILYHBHBH (SEQ ID NO: 45) RBRRBHFQILYRBHBH (SEQ ID NO: 46) HBRRBRFQILYRBHBH (SEQ ID NO: 47) RBRRBFQILYRBHBH (SEQ ID NO: 48) RBRRBRFQILYBHBH (SEQ ID NO: 49) RBRRBRYQFLIHBHBH (SEQ ID NO:50) RBRRBRILFQYHBHBH (SEQ ID NO:51) RBRRBRRFQILYHBHBH (SEQ ID NO:52)

[0186] Suitably, the peptide may be selected from any of the following additional sequences: RBRRBRFQILYBRBS (SEQ ID NO:53) RBRRBRFQILYBRB [Hyp] (SEQ ID NO: 54) RBRRBRFQILYBR[Hyp]R (SEQ ID NO: 55) RRBRRBRFQILYBRBR (SEQ ID NO:56) BRRBRRFQILYBRBR (SEQ ID NO:57) RBRRBRWWWBRBR (SEQ ID NO:58) RBRRBRWWPWWBRBR (SEQ ID NO:59) RBRRBRWPWWBRBR (SEQ ID NO: 60) RBRRBRWWPWBRBR (SEQ ID NO:61) RBRRBRRWWWRBRBR (SEQ ID NO:62) RBRRBRRWWPWWRBRBR (SEQ ID NO: 63) RBRRBRRWPWWRBRBR (SEQ ID NO: 64) RBRRBRRWWPWRBRBR (SEQ ID NO: 65) RBRRBRRFQILYBRBR (SEQ ID NO: 66) RBRRBRRFQILYRBR (SEQ ID NO:67) BRBRBWWPWWRBRRBR (SEQ ID NO: 68) RBRRBRRFQILYBHBH (SEQ ID NO: 69) RBRRBRRFQIYRBHBH (SEQ ID NO: 70) RBRRBRFQILYBRBH (SEQ ID NO:71) RBRRBRFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 72) R[Hyp]RR[Hyp]RFQILYRBHBH (SEQ ID NO: 73) R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 74) RBRRBRWWWRBHBH (SEQ ID NO: 75) RBRRBRWWPRBHBH (SEQ ID NO:76) RBRRBRPWWRBHBH (SEQ ID NO:77) RBRRBRWWPWWRBHBH (SEQ ID NO: 78) RBRRBRWWPWRBHBH (SEQ ID NO:79) RBRRBRWPWWRBHBH (SEQ ID NO: 80) RBRRBRRWWWRBHBH (SEQ ID NO: 81) RBRRBRRWWPWWRBHBH (SEQ ID NO: 82) RBRRBRRWPWWRBHBH (SEQ ID NO: 83) RBRRBRRWWPWRBHBH (SEQ ID NO: 84) RRBRRBRFQILYRBHBH (SEQ ID NO: 85) BRRBRRFQILYRBHBH (SEQ ID NO: 86) RRBRRBRFQILYBHBH (SEQ ID NO: 87) BRRBRRFQILYBHBH (SEQ ID NO: 88) RBRRBHRFQILYRBHBH (SEQ ID NO: 89) RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO: 101) R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO: 102) R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R (SEQ ID NO: 103) RBRRBRWWWBRBR (SEQ ID NO: 104) RBRRBRWWPWWBRBR (SEQ ID NO: 105)

[0187] Suitably the peptide consists of one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRILFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRFQILYRBHBH (SEQ ID NO: 44)

[0188] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO:35).

[0189] In one embodiment, the peptide consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO:37).

[0190] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO:44).

[0191] Conjugates The peptides of the invention can be covalently attached to a therapeutic molecule to provide a conjugate.

[0192] The therapeutic molecule can be any molecule for treating disease.The therapeutic molecule can be selected from nucleic acid, peptide nucleic acid, antisense oligonucleotide (e.g. PNA, PMO), mRNA and gRNA (e.g. using CRISPR / Cas9 technology), short interfering RNA, microRNA, antagomiRNA, peptide, cyclic peptide, protein, pharmaceutical, drug, or nanoparticle.

[0193] In one embodiment, the therapeutic molecule is an antisense oligonucleotide.

[0194] Suitably, the antisense oligonucleotides are composed of phosphorodiamidate morpholino oligonucleotides (PMOs).

[0195] Alternatively, the oligonucleotide may be a modified PMO, or any other charge-neutral oligonucleotide, such as a peptide nucleic acid (PNA), a chemically modified PNA, such as gamma PNA (Bahal, Nat. Comm., 2016), an oligonucleotide phosphoramidate (where the non-bridging oxygen of the phosphate is replaced with an amine or alkylamine, e.g., as described in WO2016028187A1) or any other partially or fully charge-neutralized oligonucleotide.

[0196] Therapeutic antisense oligonucleotide sequences can be selected from any available, for example, antisense oligonucleotides for exon skipping in DMD disclosed at https: / / research-repository.uwa.edu.au / en / publications / antisense-oligonucleotide-induced-exon-skipping-across-the-human-, or therapeutic antisense oligonucleotides complementary to ISSN1 or IN7 sequences for treating SMA disclosed in Zhou, HGT, 2013; and Hammond et al., 2016; and Osman et al., HMG, 2014.

[0197] Suitably the antisense oligonucleotide sequence is for inducing exon skipping for use in the treatment of DMD.

[0198] Suitably, the antisense oligonucleotide sequence is for inducing exon skipping in the dystrophin gene for use in treating DMD.Suitably, the antisense oligonucleotide sequence can induce exon skipping of one or more exons.

[0199] In one embodiment, the antisense oligonucleotide sequence is for inducing exon skipping of single exon of dystrophin gene for use in treating DMD.Suitably, the single exon is selected from any exon related to DMD, and it can be any exon in dystrophin gene, such as exon 45, 51 or 53.The PMO oligonucleotide of any sequence can be purchased (e.g., from Gene Tools Inc, USA).

[0200] In one embodiment, the therapeutic molecule of the conjugate is an oligonucleotide complementary to the pre-mRNA of the gene target.

[0201] Suitably, the oligonucleotide complementary to the pre-mRNA of gene target changes pre-mRNA, resulting in altered mRNA, thereby causing steric blocking event, resulting in altered sequence of protein.Suitably, gene target is dystrophin gene.Suitably, steric blocking event can be exon inclusion or exon skipping.In one embodiment, steric blocking event is exon skipping, suitably exon skipping of a single exon of dystrophin gene.

[0202] If necessary, lysine residues can be added to one or both ends of the therapeutic molecule (eg, PMO or PNA) prior to conjugation to the peptide to improve water solubility.

[0203] Suitably the therapeutic molecule has a molecular weight of less than 5,000 Da, suitably less than 3,000 Da, suitably less than 1,000 Da.

[0204] Suitably, the peptide is covalently attached to the therapeutic molecule at the C-terminus.

[0205] Suitably, the peptide is optionally covalently attached to the therapeutic molecule via a linker, which may act as a spacer to separate the peptide sequence from the therapeutic molecule.

[0206] The linker can be selected from any suitable sequence.

[0207] Suitably, a linker is present between the peptide and the therapeutic molecule. Suitably, the linker is a separate group from the peptide and the therapeutic molecule. Thus, the linker may include an artificial amino acid.

[0208] In one embodiment, the conjugate comprises a peptide covalently attached to a therapeutic molecule via a linker. In one embodiment, the conjugate comprises the following structure: [Peptide]-[Linker]-[Therapeutic molecule].

[0209] In one embodiment, the conjugate comprises the following structure: [Peptide]-[Linker]-[Therapeutic molecule].

[0210] Suitably, any of the peptides listed herein can be used in the conjugate according to the present invention. In one embodiment, the conjugate comprises a peptide selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0211] Suitably, in either case, the peptide may further comprise an N-terminal modification as described above.

[0212] Suitable linkers include, for example, a C-terminal cysteine ​​residue capable of forming a disulfide, thioether or thiol-maleimide bond, a C-terminal aldehyde for forming an oxime, click reaction or morpholino bond formation with a basic amino acid on the peptide, or a carboxylic acid moiety on the peptide that covalently conjugates to an amino group to form a carboxamide bond.

[0213] Suitably, the linker is between 1 and 5 amino acids in length. Suitably, the linker may comprise any linker known in the art.

[0214] Suitably the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX and XB. Suitably, where X is 6-aminohexanoic acid.

[0215] Suitably the linker may be a polymer, such as PEG.

[0216] In one embodiment, the linker is beta-alanine.

[0217] In one embodiment, the peptide is conjugated to the therapeutic molecule via a carboxamide bond.

[0218] The linker of the conjugate may form part of the therapeutic molecule to which the peptide is attached. Alternatively, the therapeutic molecule may be attached directly to the C-terminus of the peptide. Suitably, in such an embodiment, a linker is not required.

[0219] Alternatively, the peptides can be chemically conjugated to the therapeutic molecule. Chemical bonds can be, for example, via disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bonds.

[0220] If desired, a cysteine ​​can be added to the N-terminus of the therapeutic molecule to allow for disulfide bond formation to the peptide, or the N-terminus can be bromoacetylated to allow for thioether conjugation to the peptide.

[0221] The peptides of the invention can likewise be covalently attached to imaging molecules to provide conjugates.

[0222] Suitably, the imaging molecule can be any molecule that allows visualization of the conjugate. Suitably, the imaging molecule can indicate the location of the conjugate. Suitably, the location of the conjugate in vitro or in vivo. Suitably, a method is provided for monitoring the location of the conjugate comprising the imaging molecule, comprising administering the conjugate to a subject and imaging the subject to confirm the location of the conjugate.

[0223] Examples of imaging molecules include detection molecules, contrast molecules, or enhancement molecules.Suitable imaging molecules can be selected from radionuclides; fluorophores; nanoparticles (e.g., nanoshells); nanocages; colorants (e.g., enzymes), radioisotopes, dyes, radio-opacifying agents, fluorescent compounds, and combinations thereof.

[0224] Suitably, imaging molecules can be visualized using imaging techniques, which may be cellular imaging techniques or medical imaging techniques.Suitable cellular imaging techniques include, for example, image cytometry, fluorescence microscopy, phase contrast microscopy, SEM, TEM.Suitable medical imaging techniques include, for example, X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI.

[0225] In some cases, the imaging molecule may be considered as a diagnostic molecule. Suitably, the diagnostic molecule allows for the diagnosis of a disease using the conjugate. Suitably, the diagnosis of the disease can be achieved by determining the location of the conjugate using the imaging molecule. Suitably, a method of diagnosing a disease is provided, comprising administering to a subject an effective amount of a conjugate comprising an imaging molecule and monitoring the location of the conjugate.

[0226] Suitably further details such as attachment of the conjugate comprising the imaging molecule are the same as those described above for the conjugate comprising the therapeutic molecule.

[0227] Suitably, the peptides of the invention may be covalently linked to therapeutic and imaging molecules to provide conjugates.

[0228] Suitably the conjugate is capable of penetrating cells and tissues, suitably into the nucleus of cells, suitably into muscle tissue.

[0229] Pharmaceutical Compositions The conjugates of the invention can be formulated into pharmaceutical compositions.

[0230] Suitably the pharmaceutical composition comprises a conjugate of the invention.

[0231] Suitably, the pharmaceutical composition may further comprise a pharma- ceutically acceptable diluent, adjuvant or carrier.

[0232] Suitable pharma- ceutically acceptable diluents, adjuvants and carriers are well known in the art.

[0233] As used herein, the phrase "pharmacologically acceptable" means a ligand, material, formulation, and / or dosage form that is suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio.

[0234] The phrase "pharmaceutical acceptable carrier" as used herein means a pharmaceutical acceptable material, formulation or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the conjugate from one organ or part of the body to another organ or part of the body. Each cell penetrating peptide must be "acceptable" in the sense of being compatible with other components of the composition, such as the peptide and therapeutic molecule, and not harmful to the individual. Lyophilized compositions that can be reconstituted and administered are also within the scope of the present compositions.

[0235] Pharmaceutically acceptable carriers can be, for example, excipients, vehicles, diluents, and combinations thereof.For example, when compositions are administered orally, they can be formulated as tablets, capsules, granules, powders, or syrups, or when administered parenterally, they can be formulated as injections, infusions, or suppositories.These compositions can be prepared by conventional means, and if necessary, active compound (i.e., conjugate) can be mixed with any conventional additive, for example, excipients, binders, disintegrants, lubricants, flavorings, solubilizers, suspension aids, emulsifiers, coatings, or combinations thereof.

[0236] It is to be understood that the pharmaceutical compositions of the present disclosure may further comprise additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like, for medical use to alleviate, ameliorate, prevent, and treat the diseases, disorders, and conditions described herein.

[0237] Suitably, the pharmaceutical composition is for use as a medicament. Suitably, the pharmaceutical composition is for use as a medicament in the same manner as described herein for the conjugate. All features described herein for the medical treatment using the conjugate apply to this pharmaceutical composition.

[0238] Thus, in a further aspect of the invention there is provided a pharmaceutical composition according to the fourth aspect for use as a medicament. In a further aspect there is provided a method of treating a subject for a disease condition comprising administering to the subject an effective amount of a pharmaceutical composition according to the fourth aspect.

[0239] Medical Use A conjugate comprising the peptide of the present invention can be used as a medicament for treating a disease.

[0240] The medicament may be in the form of a pharmaceutical composition as defined above.

[0241] Also provided is a method of treating a patient or subject in need of treatment for a disease condition, comprising administering to the patient or subject a therapeutically effective amount of the conjugate.

[0242] Suitably the medical treatment requires the delivery of a therapeutic molecule to a cell, suitably to the nucleus of the cell.

[0243] The disease to be treated may include any disease in which improved penetration of the cell and / or nuclear membrane by a therapeutic molecule may result in improved therapeutic efficacy.

[0244] Suitably the conjugate is for use in the treatment of a disease of the neuromuscular system.

[0245] The conjugate comprising the peptide of the present invention is suitable for treating genetic diseases of the muscular nervous system. The conjugate comprising the peptide of the present invention is suitable for treating genetic diseases of the muscular nervous system. In a suitable embodiment, the conjugate according to the second aspect is provided for use in treating genetic diseases of the muscular nervous system. Suitably, the conjugate is for use in treating genetic diseases of the muscular nervous system. Suitably, the conjugate is for use in treating genetic genetic diseases of the muscular nervous system. Suitably, the conjugate is for use in treating genetic genetic diseases of the muscular nervous system. Suitably, the conjugate is for use in treating genetic X-linked genetic diseases of the muscular nervous system. Suitably, the conjugate is for use in treating genetic X-linked diseases of the muscular nervous system.

[0246] Suitably, the conjugate is for use in the treatment of diseases caused by splicing defects.In such embodiments, the therapeutic molecule can comprise an oligonucleotide capable of preventing or correcting the splicing defect and / or increasing the production of correctly spliced ​​mRNA molecules.

[0247] Suitably, the conjugate is for use in the treatment of any of the following diseases: Duchenne muscular dystrophy (DMD), Butcher muscular dystrophy (BMD), Menkes disease, beta thalassemia, dementia, Parkinson's disease, spinal muscular atrophy (SMA), myotonic dystrophy (DM), Huntington's disease, Hutchinson-Gilford progeria syndrome, ataxia-telangiectasia, or cancer.

[0248] In one embodiment, the conjugate is for use in the treatment of DMD.

[0249] In one embodiment, the conjugate according to the second aspect is provided for use in treating DMD.Compatibly, in such an embodiment, the therapeutic molecule of the conjugate is operable to increase the expression of dystrophin protein.Compatibly, in such an embodiment, the therapeutic molecule of the conjugate is operable to increase the expression of functional dystrophin protein.

[0250] Suitably, the conjugate increases dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. Suitably, the conjugate increases dystrophin expression by up to 50%.

[0251] Suitably, the conjugate restores 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% expression of the dystrophin protein. Suitably, the conjugate restores up to 50% expression of the dystrophin protein.

[0252] Suitably, the conjugate restores 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% of the function of the dystrophin protein. Suitably, the conjugate restores up to 50% of the function of the dystrophin protein.

[0253] Suitably, the therapeutic molecule of the conjugate is operable to do so by causing the skipping of one or more exons during dystrophin transcription.

[0254] Suitably, the conjugated therapeutic molecule causes skipping of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% of one or more exons of the dystrophin gene. Suitably, the conjugated therapeutic molecule causes skipping of up to 50% of one or more exons of the dystrophin gene.

[0255] Suitably, the patient or subject to be treated may be any animal or human. Suitably, the patient or subject may be a non-human mammal. Suitably, the patient or subject may be male or female. In one embodiment, the subject is male.

[0256] Suitably, the patient or subject to be treated can be of any age. Suitably, the patient or subject to be treated is between 0 and 40 years old, suitably between 0 and 30 years old, suitably between 0 and 25 years old, suitably between 0 and 20 years old.

[0257] Suitably, the conjugate is administered systemically to the subject, for example, by intramedullary, intrathecal, intracerebroventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, intrabuccal, or intranasal routes.

[0258] In one embodiment, the conjugate is for intravenous administration to a subject.

[0259] In one embodiment, the conjugate is for intravenous administration by injection to a subject.

[0260] Suitably, the conjugate is to be administered to a subject in a "therapeutically effective amount", by which is meant that the amount is sufficient to show benefit to the individual. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the disease to be treated. Decisions about dosage are within the responsibility of general practitioners and other physicians. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.

[0261] Exemplary doses can be between 0.01 mg / kg and 50 mg / kg, between 0.05 mg / kg and 40 mg / kg, between 0.1 mg / kg and 30 mg / kg, between 0.5 mg / kg and 18 mg / kg, between 1 mg / kg and 16 mg / kg, between 2 mg / kg and 15 mg / kg, between 5 mg / kg and 10 mg / kg, between 10 mg / kg and 20 mg / kg, between 12 mg / kg and 18 mg / kg, between 13 mg / kg and 17 mg / kg.

[0262] Advantageously, the dosage of the conjugates of the invention is an order of magnitude or order of magnitude lower than the dosage required to see any effect from the therapeutic molecule alone.

[0263] Suitably, after administration of a conjugate of the invention, one or more markers of toxicity are significantly reduced compared to previous conjugates using currently available peptide carriers.

[0264] A suitable marker of toxicity may be a marker of nephrotoxicity.

[0265] Suitable markers of toxicity include KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase.

[0266] Suitably, the levels of at least one of KIM-1, NGAL and BUN are reduced following administration of a conjugate of the invention when compared to previous conjugates using currently available peptide carriers.

[0267] Suitably, the levels of each of KIM-1, NGAL and BUN are reduced following administration of the conjugates of the invention when compared to previous conjugates that use currently available peptide carriers.

[0268] Suitably the level of the or each marker is significantly reduced when compared to previous conjugates using currently available peptide carriers.

[0269] Suitably, the levels of the or each marker are reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% following administration of the conjugate of the invention when compared to previous conjugates using currently available peptide carriers.

[0270] Advantageously, the toxicity of the peptides and resulting conjugates is significantly reduced compared to previous cell-penetrating peptides and conjugates, in particular KIM-1 and NGAL-1, which are markers of toxicity, are significantly reduced by up to 120-fold compared to previous conjugates using currently available peptide carriers.

[0271] Nucleic Acids and Hosts The peptides of the invention can be produced by any standard protein synthesis method, for example, chemical synthesis, semi-chemical synthesis, or through the use of an expression system.

[0272] The present invention therefore also relates to nucleotide sequences comprising or consisting of DNA encoding the peptide, expression systems, for example vectors comprising said sequences together with sequences necessary for the expression and control of expression, and host cells and host organisms transformed with said expression systems.

[0273] Thus, nucleic acids encoding the peptides according to the invention are also provided.

[0274] Suitably the nucleic acid may be provided in isolated or purified form.

[0275] Also provided is an expression vector comprising a nucleic acid encoding a peptide according to the invention.

[0276] Suitably the vector is a plasmid.

[0277] Suitably, the vector comprises a control sequence, such as a promoter, operably linked to the nucleic acid encoding the peptide according to the invention. Suitably, the expression vector is capable of expressing the peptide when transfected into a suitable cell, such as a mammalian, bacterial or fungal cell.

[0278] Also provided is a host cell comprising an expression vector of the invention.

[0279] The expression vector can be selected according to the host cell into which the nucleic acid of the present invention can be inserted. Such transformation of the host cell includes conventional techniques, such as those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of a suitable vector is within the skill of a person skilled in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0280] The produced peptide can be isolated and purified from the host cells by any suitable method, such as precipitation or chromatographic separation, for example affinity chromatography.

[0281] Suitable vectors, hosts and recombinant techniques are well known in the art.

[0282] As used herein, the term "operably linked" can include the situation where a selected nucleotide sequence and a control nucleotide sequence are covalently linked to place expression of the nucleotide coding sequence under the control of the control sequence, such that the control sequence is capable of effecting transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence. If appropriate, the resulting transcript can then be translated into the desired peptide.

[0283] Certain embodiments of the present invention will now be described with reference to the following figures and tables.

[0284] Throughout the description and claims of this specification, the words "comprise" and "contain" and their variants mean "including but not limited to" and are not intended to (and do not) exclude other moieties, additives, ingredients, integers or steps. Throughout the description and claims of this specification, the singular includes the plural unless the context requires otherwise. In particular, when the indefinite article is used, it should be understood that the specification contemplates the plural as well as the singular, unless the context requires otherwise.

[0285] It is to be understood that any feature, integer, property, compound, chemical moiety or chemical group described in connection with a particular aspect, embodiment or example of the invention is applicable to any other aspect, embodiment or example described herein, to the extent not inconsistent therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive.

[0286] The present invention is not limited to the details of any of the above embodiments. The present invention extends to any one or any combination of novel features disclosed in this specification (including any accompanying claims, abstracts and drawings), or any one or any combination of novel steps of any method or process so disclosed. The reader's attention is directed to all articles and documents filed contemporaneously with or prior to this specification in connection with this application, and published herewith, the contents of which are incorporated herein by reference. EXAMPLES

[0287] 1. Materials and Methods 1.1 P-PMO synthesis and preparation Wang resin (0.19 or 0.46 mmol g ) preloaded with 9-fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH was used. -1) were obtained from Merck (Hohenbrunn, Germany). HPLC grade acetonitrile, methanol and synthesis grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). Chicken embryo extract and horse serum were obtained from Sera Laboratories International Ltd (West Sussex, UK). Interferon was obtained from Roche Applied Science (Penzberg, Germany). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. 10 mg mL in 50% acetonitrile in water. -1 Stock solutions of α-cyano-4-hydroxycinnamic acid or sinapic acid were used as templates. Error bars are ±0.1%.

[0288] 1.2 Synthesis of P-PMO peptides for screening in H2k mdx cells a) Preparation of a library of peptide variants Peptides were purified using Wang resin preloaded with Fmoc-β-Ala-OH (0.19 or 0.46 mmol g -1Peptides were prepared on a 10 μmol scale using an Intavis Parallel Peptide Synthesizer or a 100 μmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK) by applying standard Fmoc chemistry and following the manufacturer's recommended procedures. When synthesizing using the Intavis Parallel Peptide Synthesizer, a double coupling step with a PyBOP / NMM coupling mixture was used, followed by capping with acetic anhydride after each step. When using the CEM Liberty Blue Peptide Synthesizer, single chain couplings were performed for all amino acids except for arginine, which was performed by double coupling. Couplings were performed once at 75° C. for 5 minutes at 60 watts of microwave power, except for the arginine residue, which was coupled twice each. Each deprotection reaction was performed twice at 75° C., once for 30 seconds and then for 3 minutes at 35 watts of microwave power. Upon completion of the synthesis, the resin was washed with DMF (3 × 50 mL) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):HO:triisopropylsilane (TIPS) (95%:2.5%:2.5%:3–10 mL) for 3 h at room temperature. After peptide release, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by addition of cold diethyl ether (15–40 mL depending on the synthesis scale) and centrifugation at 3200 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. A linear gradient of CH3CN in 0.1% TFA / HO was used for 15 mL min-1 The peptide was purified by semi-preparative HPLC using a RP-C18 column (10×250 mm, Phenomenex Jupiter) at a flow rate of 1000 s. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to give the peptide as a white solid. [Table 1] Table 1: Peptides synthesized for testing in the examples with N-terminal acetylation and C-terminal beta-alanine linker. Pip9b2 and R6Gly are comparative peptides. R6Gly uses a C-terminal glycine as the linker.

[0289] b) Synthesis of a Library of PMO-Peptide Conjugates A 25-mer PMO antisense sequence of mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90)) was used. The peptide was conjugated to the 3' end of the PMO by its C-terminal carboxyl group. This was achieved using 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.3 equivalents of DIPEA relative to peptide, and a 2.5-fold excess of peptide relative to PMO dissolved in DMSO. In a few cases, 2.3 equivalents of HBTU was used instead of PyBOP for activation of the C-terminal carboxyl group of the peptide. In general, to a solution of peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 μL) was added PyBOP (19.2 μL of 0.3 M in NMP), HOAt (16.7 μL of 0.3 M NMP), DIPEA (1.0 μL), and PMO (100 μL of 10 mM in DMSO). The mixture was left at 40 °C for 2.5 h and the reaction was stopped by the addition of 0.1% TFA in HO (300 μL). The solution was purified by ion exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified using an ion exchange column (Resource S 4 mL, GE Healthcare) at a flow rate of 4 mL min-1 using a linear gradient of sodium chloride (0–1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. Fractions containing the desired peptide were combined and lyophilized to obtain the peptide-PMO derivative as a white solid. Excess salt was removed from the peptide-PMO conjugate by filtering the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugate was lyophilized and analyzed by MALDI-TOF. Before use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of peptide-PMO was determined by the molar absorbance at 265 nm of the conjugate in 0.1 N HCl solution. (See Table 2 for yields). [Table 2] Table 2. Yields of P-PMO conjugates for cell culture analysis (Yields are based on the dry weight of lyophilized purified ppmo. The purity of P-PMO is greater than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm. (a) P-PMO was synthesized using HBTU activation instead of PyBOP).

[0290] 1.3 Cell culture Mouse H2k mdx myoblasts were cultured in gelatin (0.01%)-coated flasks in Dulbecco's Modified Eagle Medium (DMEM PPA Laboratories) supplemented with 20% heat-inactivated fetal bovine serum (FBS Gold, PAA Laboratories), 2% chicken embryo extract (Seralab), 1% penicillin-streptomycin-neomycin antibiotic mixture (PSN, Gibco), and 3 pg / μL gamma-interferon (Roche) at 33°C under 10% CO2. Cells were plated at 2 × 10 5 Cells were seeded at a density of 10 ...

[0291] 1.4 Cell transfection Cells were incubated with peptide-PMO conjugates prepared as above made in serum-free Opti-MEM, 350 μL was added in duplicate to each well and incubated for 4 hours at 37° C. The transfection medium was then replaced with DMEM supplemented with 5% horse serum and 1% PSN, and cells were incubated for an additional 20 hours at 37° C. Cells were washed with PBS and 0.5 mL of TRI RNA (Sigma) isolation reagent was added to each well. Cells were frozen at −80° C. for 1 hour.

[0292] 1.5 RNA extraction and nested RT-PCR analysis Total cellular RNA was extracted using TRI reagent with an additional precipitation with ethanol. Purified RNA was quantified using Nanodrop® ND-1000 (Thermo Scientific). RNA (400 ng) was used as template for RT-PCR using OneStep RT-PCR Kit (Roche, Indianapolis, USA). For primer sequences, see Table 4. The cycling conditions for the first reverse transcription were 1 cycle of 50°C for 30 min and 94°C for 7 min, followed by 30 cycles of 94°C for 20 s, 55°C for 40 s, and 68°C for 80 s. One microliter of RT-PCR product was used as template for the second PCR step. Amplification was performed with 0.5 U of SuperTAQ for 25 cycles at 94°C for 30 s, 55°C for 1 min, and 72°C for 1 min. Products were separated by electrophoresis using a 1.5% agarose gel. Agarose gel images were taken using the Molecular Imager ChemiDoc™ XRS + Images were captured with an imaging system (BioRad, UK) and analyzed using Image Lab (V4.1). Exon skipping assay data were analyzed and plotted using Microsoft Excel and expressed as the percentage of exon 23 skipping from at least three independent experiments.

[0293] 1.6 Synthesis of PMO-peptide conjugates for testing in H2k mdx mice a) Synthesis of peptide variants Peptides were synthesized on a 100 μmol scale using a CEM Liberty Blue™ microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry according to the manufacturer's recommended procedures. The side chain protecting groups used were labile to trifluoroacetic acid treatment and peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mmol) activated using PyBOP (5-fold excess) in the presence of DIPEA. N-Fmoc protecting groups were removed using piperidine (20% v / v in DMF). Couplings were performed once at 75° C. for 5 min at 60 watts of microwave power, except for the arginine residues which were each coupled twice. Each deprotection reaction was performed twice at 75° C., once for 30 s and then once for 3 min at 35 watts of microwave power. Upon completion of the synthesis, the resin was washed with DMF (3×50 mL) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3×20 mL) and DCM (3×20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%, 10 mL) for 3 h at room temperature. Excess TFA was removed by sparging with nitrogen. The cleaved peptide was precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3×40 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector. Use a linear gradient of CH3CN in 0.1% TFA / HO for 15 mL min -1 Peptides were purified by semi-preparative HPLC using a RP-C18 column (10 × 250 mm, Phenomenex Jupiter) at a flow rate of 100 s. Detection was performed at 220 nm and 260 nm.

[0294] b) Synthesis of PMO-peptide conjugates A 25-mer PMO antisense sequence of mouse dystrophin exon 23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 90)) was used. The peptide was conjugated to the 3' end of the PMO by its C-terminal carboxyl group. This was achieved using 2.3 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.3 equivalents of DIPEA relative to peptide, and a 2.5-fold excess of peptide relative to PMO dissolved in DMSO. In a few cases, HBTU (2.3 equivalents) was used instead of PyBOP for activation of the C-terminal carboxyl group of the peptide. In general, to a solution of peptide (10 μmol) in N-methylpyrrolidone (NMP, 100 μL) was added PyBOP (76.6 μL of 0.3 M in NMP), HOAt (66.7 μL of 0.3 M NMP), DIPEA (4.0 μL), and PMO (400 μL of 10 mM in DMSO). The mixture was left at 40 °C for 2 h and the reaction was stopped by the addition of 0.1% TFA (1 mL). The reaction was purified using a cation exchange chromatography column (Resource S 6 mL column, GE Healthcare) at a flow rate of 6 mL min-1 using a linear gradient of sodium chloride (0–1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. Excess salt was removed from the peptide-PMO conjugates by filtering the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugates were lyophilized and analyzed by MALDI-TOF. Prior to use, the conjugates were dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of the peptide-PMO was determined by the molar absorbance at 265 nm of the conjugate in 0.1 N HCl solution. The overall yields (Table 3) were 25-36% based on the PMO. [Table 3] Table 3. Yields of P-PMO conjugates synthesized on a larger scale for in vivo analysis (yields are based on the dry weight of lyophilized purified ppmo. Purity of PPMO is greater than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm. (a) PPMO was synthesized using HBTU activation instead of PyBOP).

[0295] 1.7 In vivo assessment of dystrophin restoration by P-PMO Experiments were performed in accordance with institutional review board at the Biomedical Sciences Unit, University of Oxford under Home Office Project Licence authorisation. Mice were housed in a minimal disease facility and the environment was temperature controlled with a 12-h day / night cycle. Animals received commercial rodent chow and water ad libitum.

[0296] Experiments were performed in female 10-12 week old mdx mice. After restraining mdx mice, a single tail vein injection of 10 mg / kg P-PMO was administered. One week after injection, mice were sacrificed and the TA, heart and diaphragm muscles were removed, flash frozen in dry ice-cooled isopentane and stored at -80 °C.

[0297] 1.8 Western blot analysis To assess the duration of dystrophin restoration after a single dose, one-third of the muscle (for TA and diaphragm) or 7 μm thick transverse cryosections (for heart) were dissolved in 300 μl of buffer (50 mM Tris pH 8, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 10% SDS and protease / phosphatase inhibitors) and then centrifuged for 10 min at 13000 rpm (Heraeus, #3325B). Supernatants were collected and heated at 100°C for 3 min. Protein was quantified by the BCA method and 40 μg protein / sample was separated on NuPage 3-8% Tris acetate gels as previously described (19). Proteins were transferred to 0.45 μm pore size PVDF membranes for 1 h at 30 V, then for 1 h at 100 V and probed with monoclonal anti-dystrophin (1:200, NCL-DYS1, Novocastra) and anti-vinculin (loading control, 1:100000, hVIN-1, Sigma) antibodies as previously described ( 37 ). Secondary antibody IRDye 800CW goat anti-mouse was used at a dilution of 1:20000 (LiCOR).

[0298] Dystrophin restoration levels in P-PMO-treated mdx mice were expressed as relative levels to those in C57BL / 10 wild-type control mice, which were considered as 100%. For this, a standard curve was generated by including five series of C57BL / 10 protein dilutions in parallel with the P-PMO-treated mdx samples. The dilution series was as follows: 75%, 40%, 15%, 5% or 0% of the 40 μg total protein loaded per lane was from C57BL / 10 protein lysate, and the remainder was from untreated mdx protein lysate. Aliquots of these standards were used in each Western blot in parallel with the treated mdx samples. Quantification of dystrophin intensity was performed for all standards and treated samples using a Fluorescence Odyssey imaging system and normalized by calculating the ratio to vinculin fluorescence intensity in all samples. The standard normalized values ​​were plotted against their known dystrophin concentrations to obtain a best fit equation, which was used to interpolate the normalized values ​​for each sample of P-PMO-treated mdx mice.

[0299] 1.9 RT-qPCR analysis of Dmd exon 23 skipping in vivo Skeletal muscle and heart tissues treated with peptide-PMO were used to quantify the exclusion of exon 23 from mouse Dmd transcripts. Briefly, RNA was extracted from homogenized tissues using a Trizol-based extraction method, and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and designed to amplify a region spanning exons 23-24, representing the non-skipped product (mDMD23-24, see Table 4) or to specifically amplify transcripts lacking exon 23 using a probe spanning the boundary between exons 22 and 24 (mDMD22-24). Each transcript level was calibrated against a standard curve generated using known transcript abundance, and skipping percentages were derived by [skipped] / [skipped+non-skipped]. [Table 4] Table 4: Primer and probe sequences for quantification of exon 23 skipping by nested or quantitative RT-PCR.

[0300] 1.10 Toxicological evaluation of peptide-PMOs Eight to ten week old female C57BL / 6 mice were administered a single dose of 30 mg / kg of peptide-PMO in 0.9% saline by bolus intravenous injection into the tail vein. On days 2 and 7 after administration, urine was collected non-invasively under chilled conditions after 20 h of housing in metabolic cages (Tecniplast, UK). Serum was collected from the jugular vein at necropsy on day 7, and tibialis anterior, diaphragm and heart tissues were also collected.

[0301] The same procedure was followed with different single dosages of peptide-PMO ranging from 2.5 mg / kg to 50 mg / kg in 0.9% saline by intravenous injection into the tail vein.

[0302] Urinary levels of KIM-1 (kidney injury molecule-1) and NGAL (neutrophil gelatinase-associated lipocalin) were quantified by ELISA after appropriate dilution of urine to fit the standard curve (KIM-1 R&D Catalogue No. MKM100, NGAL R&D Catalogue No. MLCN20). Values ​​were normalized to urinary creatinine levels quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK. Serum blood urea nitrogen levels were quantified at the MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK.

[0303] All levels were quantified with an AU680 Clinical Chemistry Analyser, Beckman Coulter.

[0304] Quantitation of the efficiency of exon skipping was determined by quantitative RT-PCR of exon 23-skipped and non-skipped transcripts and expressed as the percentage of skipped transcripts relative to total (skipped and non-skipped) transcripts (see Table 4 for sequences).

[0305] 2.Results The results provided herein demonstrate a clear dose-response effect of the peptide-PMO conjugates generated herein on exon skipping activity in cells (Figures 1, 2 and 12). These figures also highlight that all of the DPEP1 and DPEP3 series, i.e., the peptides of the present invention, have sufficient cell-penetrating efficacy into cells to be considered for therapeutic use.

[0306] The results provided herein further highlight the activity of peptide-PMO conjugates in vivo in relevant mouse models of disease (Figures 3-4). Overall, these results suggest that the activity of such conjugates is greatest in the tibialis anterior muscle, followed by the diaphragm, and then the heart. These figures demonstrate that the DPEP peptide conjugates of the present invention have good exon skipping activity in vivo and lead to increased dystrophin protein expression in vivo. Furthermore, the DPEP conjugates of the present invention compare favorably with previous cell-penetrating peptides such as the "PIP" peptide and R6Gly when the same conjugates were used in both respects.

[0307] It is also demonstrated herein that the levels of KIM-1 and NGAL (which are indicators of renal toxicity) after administration of DPEP peptide conjugate compounds are significantly lower than conjugates with previous cell-penetrating peptides. DPEP 1.9 and 3.8 conjugates showed the lowest levels of such markers (Figures 5, 6 and 11). Serum blood urea nitrogen levels (another marker of renal dysfunction) were also elevated only for conjugates with Pip9b2, but not for conjugates with the DPEP peptide of the present invention (Figure 7). The second major finding is that 7 days after administration, KIM-1 and NGAL levels drop to near saline levels for all DPEP peptide conjugates, suggesting that there is also some reversal and amelioration of kidney-related toxicity. Such an effect was not seen with conjugates using previous cell-penetrating peptides. This reversal effect of toxicity is seen with the DEDP peptide of the present invention even when given at a high dose of 50 mg / kg (Figure 11). Previous cell-penetrating peptides showed no reduction in toxicity after seven days, with toxicity markers remaining much higher throughout.

[0308] Exon skipping activity remains high in TA and diaphragm at higher doses of 30 and 50 mg / kg for all DPEP peptide conjugates (Figures 10 and 12), which is supported by the lower levels of kidney damage markers, suggesting a broader therapeutic index for these compounds since toxicity markers are many times lower. It is also noteworthy that all DPEP peptide conjugates have higher activity than the known R6Gly comparator in the conjugate, while at least maintaining similar toxicity marker levels, and have similar activity to the known PIP peptide comparator in the conjugate, while still having much lower toxicity marker levels. In some cases, the DPEP peptide conjugates of the present invention show not only increased activity but also reduced toxicity markers compared to the known R6Gly conjugates.

[0309] Thus, the DPEP1 and 3 peptides of the present invention provide promising cell-permeable peptides for improving efficacy and reducing toxicity of therapeutic conjugates for the treatment of neuromuscular disorders in humans.

[0310] 3. Further Examples P-PMO synthesis and preparation Wang resin (0.19 or 0.46 mmol g ) preloaded with 9-fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH was used. -1 ) were obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC grade acetonitrile, methanol and synthesis grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). All other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. Stock solutions of α-cyano-4-hydroxycinnamic acid or sinapic acid at 10 mg mL-1 in 50% acetonitrile in water were used as templates. Error bars are ±0.1%.

[0311] Synthesis of P-PMO peptides for screening in cells a) Preparation of a library of peptide variants Peptides were prepared on a 10 μmol scale using an Intavis Parallel Peptide Synthesizer or on a 100 μmol scale using a CEM Liberty Blue™ Peptide Synthesizer (Buckingham, UK) by applying standard Fmoc chemistry using Wang resin preloaded with Fmoc-β-Ala-OH (0.19 or 0.46 mmol g-1, Merck Millipore) and following the manufacturer's recommended procedures. When synthesizing using the Intavis Parallel Peptide Synthesizer, double coupling steps with a PyBOP / NMM coupling mixture were used, followed by capping with acetic anhydride after each step. When using the CEM Liberty Blue Peptide Synthesizer, single chain couplings were performed for all amino acids except for arginine, which was performed by double coupling. Couplings were performed once at 75 °C for 5 min at 60 watts microwave power, except for the arginine residue, which was coupled twice each. Each deprotection reaction was carried out twice at 75 °C, once for 30 s and then for 3 min at 35 watts microwave power. Upon completion of the synthesis, the resin was washed with DMF (3 × 50 mL) and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%:3–10 mL) for 3 h at room temperature. After peptide release, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by addition of cold diethyl ether (15–40 mL depending on the synthesis scale) and centrifugation at 3200 rpm for 5 min.The crude peptide pellet was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System equipped with a 445-LC Scale-up module and a 440-LC fraction collector using a linear gradient of CH3CN in 0.1% TFA / H2O at 15 mL min−1. -1 The peptide was purified by semi-preparative HPLC using a RP-C18 column (10×250 mm, Phenomenex Jupiter) at a flow rate of 1000 s. Detection was performed at 220 nm and 260 nm. The fractions containing the desired peptide were combined and lyophilized to give the peptide as a white solid (see Table 5 for yields). [Table 5] Table 5: Peptides synthesized for testing in the Examples, with N-terminal acetylation (Ac) and C-terminal β-alanine linker (B). * is a glycosylated serine residue. DPEP5.7, Pip9b2, and Pip6a are comparison peptides.

[0312] b) Synthesis of a Library of Peptide-PMO Conjugates A 21-mer PMO antisense sequence of the triplet repeat sequence (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 107)), otherwise known as [CAG]7, was used. The peptide was conjugated to the 3' end of the PMO by its C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, in NMP in the presence of 2.5 equivalents of DIPEA, and a 2.5-fold excess of peptide relative to PMO dissolved in DMSO. In general, to a solution of peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 μL) was added PyBOP (19.2 μL of 0.3 M in NMP), HOAt in (16.7 μL of 0.3 M NMP), DIPEA (1.0 mL), and PMO (180 μL of 10 mM in DMSO). The mixture was left at 40 °C for 2.5 h and the reaction was stopped by the addition of 0.1% TFA in HO (300 μL). The solution was purified by ion exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified using an ion exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. The conjugate was eluted from the column using a sodium chloride solution (1 M) at 4 mL min -1 or 6 mL min -1 The peptide-PMO conjugates were eluted at a flow rate of either 0.1 mL / min or 100 mL / min. Fractions containing the desired compound were combined and immediately desalted. Excess salt was removed from the peptide-PMO conjugates by filtering the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugates were lyophilized and analyzed by MALDI-TOF. Prior to use, the conjugates were dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of the peptide-PMO was determined by the molar absorbance at 265 nm of the conjugate in 0.1 N HCl solution. (See Table 6 for yields). [Table 6] Table 6. Yields of P-PMO conjugates for cell culture analysis and in vivo experiments (Yields are based on the dry weight of lyophilized purified P-PMO. The purity of P-PMO is higher than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm.

[0313] Peptide-PMO conjugate synthesis. Peptides were synthesized and conjugated to PMOs as described above. The PMO sequence targeting the CUG / CTG expansion repeat (5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 107)) was purchased from Gene Tools LLC and is referred to elsewhere herein as [CAG]7 PMO.

[0314] Cell culture and peptide-PMO treatment Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG repeats were cultured in growth medium consisting of a mixture of M199:DMEM (1:4 ratio, Life technologies) supplemented with 20% FBS (Life technologies), 50 μg / ml gentamicin (Life technologies), 25 μg / ml fetuin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 μg / ml dexamethasone (Sigma-Aldrich). Myogenic differentiation was induced by switching confluent cell cultures to DMEM medium supplemented with 5 μg / ml insulin (Sigma-Aldrich) for myoblasts. For treatment, WT or DM1 cells were allowed to differentiate for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO conjugates at 1, 2, 5, 10, 20 or 40 μM concentrations. Cells were harvested for analysis 48 hours after treatment. Two days after transfection of peptide-PMO at 40 uM into human hepatocytes or 1, 2, 5, 10, 20 or 40 μM concentrations into human myoblasts, cell viability in human hepatocytes and human myoblasts was quantified using a fluorescence-based assay (Promega).

[0315] RNA isolation, RT-PCR and qPCR analysis. For mouse tissues: Muscles were disrupted with TriReagent (Sigma-Aldrich) using a Fastprep system and Lysing Matrix D tubes (MP biomedicals) prior to RNA extraction. For human cells: Cells were lysed in protein kinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl2, 10 mM EDTA, 2% SDS and 0.5 mg / ml protein kinase K) for 45 min at 55 °C prior to RNA extraction. Total RNA was isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using a total of 20 μL of M-MLV first strand synthesis system (Life Technologies) according to the manufacturer's instructions. One microliter of cDNA preparation was then used in semi-quantitative PCR analysis following standard protocols (ReddyMix, Thermo Scientific). PCR amplification was performed for each gene for 25–35 cycles within the linear amplification range. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified with ImageJ software. Exon inclusion rates were quantified as the percentage of inclusion relative to the total intensity of the isoform signal. Primers are listed in Table 7 below. [Table 7] Table 7: Primers for PCR

[0316] toxicology Toxicology assessment was performed as described in section 1.10 above.

[0317] result Treated muscle cells (myoblasts) from DM1 patients showed that DPEP1 or 3 peptide-[CAG]7 PMO conjugates specifically target mutant CUGexp-DMPK transcripts and abrogate the deleterious sequestration of MBNL1 splicing factors by nuclear RNA foci and the resulting MBNL1 reduced function, which causes splicing defects and muscular dystrophy. DPEP1 / 3 peptide-[CAG]7 PMO conjugates penetrate cells and induce splicing normalization with high efficacy (Figure 13). These de novo generation of so-called "DPEP1 and DPEP3" peptides showed high efficacy in correcting splicing defects in vitro when conjugated with CAG7 repeat antisense oligonucleotide PMO, indicating that they could be used therapeutically for the treatment of DM1.

[0318] Furthermore, preliminary toxicological evaluation of the conjugates formed with DPEP1 / 3 indicates that ALP, ALT, AST, KIM-1, BUN, NGAL and creatinine levels were similar to saline control injections, in contrast to the fold increases typically induced by currently available peptide carriers from the Pip system. With this preliminary data, we have demonstrated that conjugates formed from DPEP peptide and [CAG]7PMO are as active as conjugates formed with previous peptides such as Pip6a, but have a broader therapeutic window due to lower toxicity (Figures 15-19).

Claims

1. formula [cationic domain] - [hydrophobic domain] - [cationic domain] [Here, the cationic domains are RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B ( a cell-penetrating peptide represented by the following: R[Hyp]H[Hyp]HB (SEQ ID NO:17), R[Hyp]RR[Hyp]R (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) (wherein B is β-alanine and [Hyp] is hydroxyproline); and the hydrophobic domain consists of an amino acid sequence selected from YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW,WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26).

2. The cell-penetrating peptide of claim 1, wherein the cell-penetrating peptide is N-acetylated at the N-terminus.

3. Sequence: RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRBRFQILYRRBRBR (SEQ ID NO: 29), RBRBRFQILYRBRRBRR (SEQ ID NO: 30), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRRFQILYRBRBR (SEQ ID NO: 33), RBRRBRRFQILYBRBR (SEQ ID NO: 35), RBRRBFQILYRBRBR (SEQ ID NO: 36), RBRRBRRFQILYR The cell-penetrating peptide of claim 1 or 2, comprising one of the following: BHBH (sequence number 37), RBRRBRRFQILYHBHBR (sequence number 38), RBRRBRRYQFLIRBHBH (sequence number 40), RBRRBRRILFQYRBHBH (sequence number 41), RBRHBHRFQILYRBRBR (sequence number 42), RBRRBRRFQILYRBHBH (sequence number 44), RBRRBRWWBRBR (sequence number 104), and RBRRBRRWWPWWBRBR (sequence number 105).

4. A cell-penetrating peptide according to any one of claims 1 to 3, consisting of the sequence RBRRBRRFQILYRBRBR (SEQ ID NO: 27).

5. A cell-penetrating peptide according to any one of claims 1 to 3, consisting of RBRRBRRFQILYRBHBH (SEQ ID NO: 44).

6. The cell-penetrating peptide according to any one of claims 1 to 3, which consists of RBRRBRRFQILYBRBR (SEQ ID NO: 35).

7. A conjugate comprising a cell-permeable peptide according to any one of claims 1 to 6 covalently attached to an antisense oligonucleotide.

8. The conjugate of claim 7, further comprising a linker, said linker linking the cell penetrating peptide to the antisense oligonucleotide.

9. 9. The conjugate of claim 8, wherein the linker is selected from G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX and XB.

10. A conjugate according to any one of claims 7 to 9 for use as a medicament.

11. 11. The conjugate of claim 10 for use as a medicament in the treatment of a disease of the musculoskeletal system, a genetic disease of the musculoskeletal system, an inherited genetic disease of the musculoskeletal system, or an inherited X-linked genetic disease of the musculoskeletal system.

12. 12. A conjugate according to claim 10 or 11 for use as a medicament in the treatment of Duchenne muscular dystrophy (DMD).

13. The conjugate according to claim 10 , wherein the antisense oligonucleotide consists of a sequence for inducing exon skipping in the dystrophin gene.

14. The conjugate according to claim 10 , wherein the antisense oligonucleotide consists of a sequence for inducing exon skipping of a single exon of the dystrophin gene.

15. 15. The conjugate of claim 13 or 14, wherein the exon is exon 45, 51, or 53 of the dystrophin gene.

16. 1. A conjugate comprising a cell penetrating peptide covalently attached to an antisense oligonucleotide, said cell penetrating peptide consisting of one of the sequences: RBRRBRRFQILYRBRBR (SEQ ID NO:27), RBRRBRRYQFLIRBRBR (SEQ ID NO:31), RBRRBRRILFQYRBRBR (SEQ ID NO:32), RBRRBRRFQILYBRBR (SEQ ID NO:35), RBRRBRRFQILYRBHBH (SEQ ID NO:37), RBRRBRRFQILYHBHBR (SEQ ID NO:38), RBRRBRRFQILYRBHBH (SEQ ID NO:44), said conjugate for use in the treatment of a disease of the musculoskeletal system or a genetic disease of the musculoskeletal system or a genetic genetic disease of the musculoskeletal system or a genetic X-linked genetic disease of the musculoskeletal system.

17. 17. The conjugate of claim 16, further comprising a linker, said linker linking the cell penetrating peptide to the antisense oligonucleotide.

18. 18. The conjugate of claim 16 or 17, wherein the disease is Duchenne muscular dystrophy (DMD).

Images