Improved clinical parameters by expression of factor VIII

Abstract

Described herein are constructs used for liver-specific expression of transgenes.

Description

Technical Field

[0001] Cross - reference to related patent applications This application claims the benefit of priority to each of U.S. Provisional Patent Application No. 62 / 714,553, filed Aug. 3, 2018; U.S. Provisional Patent Application No. 62 / 826,887, filed Mar. 29, 2019; and U.S. Provisional Patent Application No. 62 / 869,445, filed Jul. 1, 2019, each of which is hereby incorporated by reference in its entirety.

[0002] Sequence listing This application is electronically filed in ASCII format and includes a Sequence Listing, which is hereby incorporated by reference in its entirety. The ASCII copy, created on Aug. 1, 2019, is named 1147465_SL.txt and is 28,207 bytes in size.

Background Art

[0003] Background Gene therapy can be used to genetically engineer cells (e.g., via insertion of a transgene and / or modification of an endogenous sequence) to have one or more inactivated genes and / or to cause the cells to express a product not previously produced in those cells. Examples of the use of transgene insertion include insertion of one or more genes encoding one or more novel therapeutic proteins, insertion of a coding sequence encoding a protein lacking in a cell or individual, insertion of a wild-type gene in a cell containing a mutated gene sequence, and / or insertion of a sequence encoding a structural nucleic acid such as microRNA or siRNA. Examples of useful applications of “modifying” an endogenous gene sequence include changing a disease-related gene mutation, changing a sequence encoding a splice site, changing a regulatory sequence, and / or targeted changing of a sequence encoding a structural property of a protein.

[0004] Liver gene delivery provides an effective means of delivering transgenes for the treatment and / or prevention of various disorders, including hemophilia and lysosomal storage disorders. See, for example, U.S. Patent No. 9,150,847 and U.S. Publication Nos. 20130177983 and 20140017212. Vectors specific for gene therapy directed to the liver have also been described. See, for example, WO 2014064277; WO 2009130208; EP 2451474B1, Chuah et al., (2014) Molecular Therapy, 22, 1605-1613; and Nair et al. (2014) Blood 123:3195-3199. These vectors can include wild-type murine minute virus (MVM) intron sequences. See, for example, Haut and Pintel (1998) J. Virol. 72: 1834-1843; Haut and Pintel (1998) Virol. 258:84-94.

[0005] Hemophilia, such as hemophilia A and hemophilia B, is a hereditary disorder of the blood coagulation system, characterized by bleeding into joints and soft tissues, and excessive bleeding at sites that have experienced trauma or undergone surgery. Hemophilia A cannot be clinically distinguished from hemophilia B, but factor VIII (FVIII or F8) is deficient or absent in patients with hemophilia A, while factor IX (FIX or F.IX) is deficient or absent in patients with hemophilia B. The F8 gene encodes a plasma glycoprotein that circulates together with inactive von Wilebrand factor. When the surface is damaged, the intrinsic coagulation cascade begins and FVIII is released from the complex and activated. The activated form acts on factor IX to activate factor X, which becomes activated Xa, ultimately resulting in the conversion of fibrinogen to fibrin and the induction of a blood clot. See Levinson et al. (1990) Genomics 7(1): 1-11. 40-50% of patients with hemophilia A have a chromosomal inversion involving F8 intron 22 (also known as IVS22). The inversion is caused by an intrachromosomal recombination event between a 9.6 kb sequence within intron 22 of the F8 gene and one of two closely related inverted orientation sequences located approximately 300 kb distal to the F8 gene, resulting in an inversion of exons 1 to 22 relative to exons 23 to 26. Text on hemophilia See. Lee et al. (eds) 2005, Blackwell Publishing. Other patients with hemophilia A have defects in F8, including active site mutations, nonsense and missense mutations.

[0006] Clinically, patients with hemophilia A are evaluated and stratified depending on the frequency with which the patient experiences bleeding episodes and the duration for which those episodes persist. Both of these characteristics depend directly on the amount of FVIII protein in the patient's blood. Patients with severe hemophilia typically have less than 1% of normal blood levels of FVIII and experience bleeding after injury and often spontaneous bleeding into joints. Moderate patients have 1–5% of normal FVIII levels, while mild patients have more than 6% of normal FVIII and have bleeding episodes only after severe injury, trauma, or surgery (Kulkami et al. (2009) Haemophilia 15 : 1281 -90). Patients with hemophilia A are treated with replacement FVIII protein (often called “factor”), which is either derived from human plasma or recombinantly produced, depending on the frequency of treatment based on the bleeding pattern and severity of the hemophilia. Patients with severe hemophilia A receive regular prophylactic treatment to prevent the occurrence of bleeding, while relatively mild patients can be treated only when required after injury.

[0007] Gene therapy for patients with hemophilia A or B is described, including the introduction of plasmids encoding functional FVIII or F.IX proteins and other vectors (e.g., AAV). (See, for example, U.S. Pat. Nos. 6,936,243; 7,238,346 and 6,200,560; Shi et al. (2007) J Thromb Haemost. (2): 352-61; Lee et al. (2004) Pharm. Res. 7: 1229-1232; Graham et al. (2008) Genet Vaccines Ther. 3:6-9; Manno et al. (2003) Blood 101(8): 2963-72; Manno et al. (2006) Nature Medicine 12(3): 342-7; Nathwani et al. (2011) Mol Ther 19(5): 876-85; Nathwani et al. (201 1); N Engl J Med. 365(25): 2357-65 and McIntosh et al. (2013) Blood 121 (17): 3335-44).

Summary of the Invention

[0008] An AAV vector expressing factor VIII and methods of treating hemophilia and other aspects are described. In some embodiments, a method of providing factor VIII (FVIII) protein to a human is provided. In some embodiments, the method is an adenovirus-associated virus (AAV) vector described herein at 6x10 11 to 1x10 13 or 3x10 13 , 1x10 13 to 1x10 14 , or 1x10 13 to 5x10 13 , or 2x10 13 to 4x10 13administering to a human one or more doses of vg / kg, wherein administration of the AAV vector results in production of Factor VIII protein in the human. In some embodiments, the dose is 9x10 11 vg / kg, 2x10 12 vg / kg, 1x10 13 vg / kg, 2x10 13 vg / kg, 3x10 13 vg / kg or 4x10 13 vg / kg. In some embodiments, the AAV vector has an AAV6 serotype and comprises a nucleotide sequence comprising AAV2 inverted terminal repeats adjacent to an expression cassette comprising a liver-specific enhancer and a promoter operably linked to a polynucleotide encoding SEQ ID NO:1.

[0009] In some embodiments, the method further comprises measuring FVIII protein in the blood of the human before and after administration.

[0010] In some embodiments, for example, administration of the AAV vector at a dose in the range of 1x10 13 vg / kg to 3x10 13 or 1x10 13 to 1x10 14 or 1x10 13 to 5x10 13 or 2x10 13 to 4x10 13 vg / kg results in a clinically relevant increase in FVIII activity in the range of 5% to 150% or more, compared to the patient's circulating FVIII activity as evaluated in the patient before administration. In some embodiments, for example, administration of the AAV vector at a dose of 3×10 13 vg / kg results in a clinically relevant increase in FVIII activity in the range of 20% to 150% or more. In some embodiments, administration results in the occurrence of one or zero spontaneous bleeding episodes in the human subject between 3 and 12 months (or, for example, 3 to 6 months, 3 months to 1, 2, 5 or 10 years, or more) after administration.

[0011] In some embodiments, provided herein is an adeno-associated virus (AAV) vector encoding a Factor VIII (FVIII) protein (optionally comprising the amino acid sequence of SEQ ID NO:1) at a dose of 2x10 12 vg / kg to 3x10 13 or 1x10 13 to 1x10 14 or 1x10 13 to 5x10 13 or 2x10 13 to 4x10 13 vg / kg to a human subject, the method of increasing Factor VIII (FVIII) protein in a human subject, wherein administration of the AAV vector results in a clinically relevant increase in the level of circulating FVIII activity, such as 5% to 150%; or 50% to 150%. In some embodiments, one or more doses of FVIII administered to the patient are in the range of 1x10 13 vg / kg to 3x10 13 vg / kg. In some embodiments, the AAV vector has an AAV6 serotype. In some embodiments, the AAV vector comprises an expression cassette comprising a polynucleotide encoding an FVIII protein operably linked to a liver-specific enhancer and promoter. In some embodiments, the liver-specific enhancer is a Serpin 1 enhancer and / or the promoter is a transthyretin minimal promoter. In some embodiments, the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO:2 and / or the promoter comprises the nucleotide sequence of SEQ ID NO:3. In some embodiments, the AAV vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence adjacent to the expression cassette. In some embodiments, the AAV2 5' ITR comprises the nucleotide sequence of SEQ ID NO:12 and / or the AAV2 3' ITR comprises the nucleotide sequence of SEQ ID NO:13. In some embodiments, the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO:5. In some embodiments, the human subject has hemophilia.

[0012] In some embodiments, provided herein is an adeno-associated virus (AAV) vector encoding a factor VIII (FVIII) protein (optionally including the amino acid sequence of SEQ ID NO:1) at 2x10 12 vg / kg to 3x10 13 or 1x10 13 to 1x10 14 or 1x10 13 to 5x10 13 or 2x10 13 to 4x10 13 vg / kg, in one or more doses, to a human subject, the method of increasing factor VIII (FVIII) protein in a human subject, wherein administration of the AAV vector results in a decrease in the number of FVIII treatments the human subject receives. In some embodiments, the human subject does not receive FVIII treatment for 3 - 12 months (or, for example, 3 - 6 months, 3 months - 1, 2, 5 or 10 years, or more) after administration. In some embodiments, one or more doses of factor VIII administered to the patient are from 1x10 13 vg / kg to 3x10 13It is in the range of vg / kg. In some embodiments, the AAV vector has the AAV6 serotype. In some embodiments, the AAV vector comprises an expression cassette comprising a polynucleotide encoding the FVIII protein operably linked to a liver-specific enhancer and promoter. In some embodiments, the liver-specific enhancer is the Serpin 1 enhancer and / or the promoter is the transthyretin minimal promoter. In some embodiments, the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO: 2 and / or the promoter comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the AAV vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence adjacent to the expression cassette. In some embodiments, the AAV2 5' ITR comprises the nucleotide sequence of SEQ ID NO: 12 and / or the AAV2 3' ITR comprises the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the human subject has hemophilia.

[0013] In some embodiments, for example, 2x10 12 vg / kg to 3x10 13 or 1x10 13 to 1x10 14 or 1x10 13 to 5x10 13 or 2x10 13 to 4x10 13 Administration of the AAV vector at a dose in the range of vg / kg results in a decrease in the use of FVIII treatment, such as a decrease in the number of FVIII injections a patient receives per week or per month. In some embodiments, the use of FVIII is reduced by at least 20%. In further embodiments, the use of FVIII is reduced by at least 50%. In some embodiments, the use of FVIII is reduced by 90% or more.

[0014] In some embodiments, prior to administration, the human has less than 1% of normal human circulating FVIII activity, and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the human has at least 1% of normal human circulating FVIII activity.

[0015] In some embodiments, prior to administration, the human has less than 5% of normal human circulating FVIII activity, and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the human has at least 5% of normal human circulating FVIII activity.

[0016] In some embodiments, within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the human exhibits less than 1.5 times the upper limit of normal (ULN) for at least one of alanine aminotransferase (ALT), aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, or albumin.

[0017] In some embodiments, after 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks of administration, the human does not have detectable levels of FVIII inhibitor.

[0018] In some embodiments, the subject to be administered the AAV vector receives prophylactic steroid treatment.

[0019] In some embodiments, the method further comprises measuring the level of at least one of von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), galectin-3-binding protein (GAL3BP), C-reactive protein (CRP), IL-6, and circulating alpha fetoprotein before administration and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration.

[0020] In some embodiments, the levels of von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), galectin-3-binding protein (GAL3BP), C-reactive protein (CRP), IL-6, and circulating alpha fetoprotein within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration are 1.5-fold or less than the levels within 2 weeks before administration.

[0021] In some embodiments, humans exhibit fewer bleeding episodes after administration. In some embodiments, humans have 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% fewer bleeding episodes after administration.

[0022] In some embodiments, humans show a reduced need for treatment with replacement factor VIII protein. In some embodiments, humans require 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% less treatment with replacement factor VIII protein after administration.

[0023] In some embodiments, humans have hemophilia.

[0024] In some embodiments, the nucleotide sequence comprises SEQ ID NO: 5. In some embodiments, the AAV2 inverted terminal repeats are SEQ ID NO: 12 and SEQ ID NO: 13. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] [Figure 1] FIG. 1 shows FVIII activity data from Example 6 using the chromogenic assay as described in Example 1.

[0026] [Figure 2]Figure 2 shows FVIII activity data from Example 6 using the chromogenic assay as described in Example 1.

[0027] [Figure 3] Figure 3 shows FVIII activity data from Example 6 using the one-stage clotting assay as described in Example 1.

[0028] [Figure 4] Figure 4 shows FVIII activity based on the one-stage clotting assay as described in Example 1 over time in 10 patients after treatment with the vector.

[0029] [Figure 5] Figure 5 shows FVIII activity based on the chromogenic assay as described in Example 1 over time in 10 patients after treatment with the vector.

[0030] [Figure 6] Figure 6 shows data on spontaneous bleeding episodes in patients at least 3 weeks after vector administration at the indicated dose.

[0031] [Figure 7] Figure 7 shows the amount of FVIII used by patients 3 weeks or more after vector injection.

[0032] [Figure 8] Figure 8 provides an overview of serious adverse events (SAEs).

[0033] [Figure 9] Figure 9 provides an overview of treatment-related adverse events (AEs).

[0034] [Figure 10] Figure 10 provides an overview of the results.

Mode for Carrying Out the Invention

[0035] Detailed description of the invention Introduction The inventors have found that an AAV vector expressing factor VIII (FVIII) is effective in producing increased FVIII activity in humans, including humans with hemophilia. For example, administration of an AAV vector as described herein in some embodiments results in a circulating FVIII activity increased from less than 1% of normal FVIII activity to at least 1% and in some embodiments at least 2, 3, 4, or 5% of normal FVIII activity. Further, in some embodiments, circulating FVIII activity is increased in humans with little or no side effect on liver function or other biomarkers as described herein. At a concentration of vector administered at 1x10 13 vg / kg or more, the rate of bleeding episodes at 3 weeks (or more) after administration decreases to zero for most patients, and at a concentration of 1x10 13 vg / kg or more (e.g., from 1x10 13 vg / kg to 1x10 14 vg / kg, e.g., 2 - 4x10 13 vg / kg) has been shown to result in a very effective treatment. Thus, in some embodiments, patients receiving the vector at these concentrations do not require further FVIII infusions, or at least do not require them within 3, 6, 9, or 12 months after vector administration.

[0036] An adeno-associated virus (AAV) vector encoding FVIII is provided. An exemplary AAV vector is of the AAV6 serotype and includes inverted terminal repeat (ITR) sequences adjacent to an expression cassette that includes a liver-specific enhancer and promoter operably linked to a polynucleotide encoding intron and FVIII. An exemplary FVIII is SEQ ID NO:1. In some embodiments, the ITR sequences are AAV2 ITRs, and thus the vector can be referred to as an “AAV2 / 6” vector. For discussion of AAV serotype genomic sequences and genomic similarities, see, e.g., GenBank accession number AF028704.1; GenBank accession number J01901.1; Chiorini et al., J. Vir. 71: 6823-33 (1997); Srivastava et al., J. Vir. 45:555-64 (1983); Chiorini et al., J. Vir. 73: 1309-1319 (1999); Rutledge et al., J. Vir. 72:309-319 (1998); and Wu et al., J. Vir. 74: 8635-47 (2000). An exemplary AAV2 ITR sequence is as follows. AAV2 5’ ITR [Chemical formula] (SEQ ID NO:12). AAV2 3’ ITR [Chemical formula] (SEQ ID NO:13).

[0037] Exemplary liver-specific enhancers include, for example, wild-type or mutant Serpin1 enhancers, and an exemplary promoter is the transthyretin minimal (TTRm) promoter. Thus, in some embodiments, the AAV vector is an AAV2 / 6 vector comprising an AAV2 ITR sequence adjacent to a wild-type or mutant Serpin1 enhancer linked to a TTRm promoter operably linked to a polynucleotide encoding FVIII (e.g., SEQ ID NO: 1). Exemplary vector sequences are described, for example, in WO2017 / 074526.

[0038] SEQ ID NO: 1 shows the human FVIII amino acid sequence with a signal peptide:

Chemical Structure

[0039] The signal peptide portion of SEQ ID NO: 1 is

Chemical Structure

[0040] For example, an exemplary SERPIN1 enhancer is

Chemical Structure

[0041] An exemplary TTRm promoter is

Chemical Structure

[0042] An exemplary coding sequence for FVIII is

Chemical Structure

Chemistry

[0043] An exemplary sequence for an expression cassette adjacent to the reverse terminal repeat sequence is

Chemistry

Chemistry

Chemistry

[0044] The construction of recombinant AAV vectors has been described in many publications, including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). Efficient gene transfer and stable transgene delivery by integration into the genome of the cells being transfected are characteristics of this vector system. See, for example, Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996).

[0045] The effective amount of AAV vector administered can vary from patient to patient. In some embodiments, the effective amount is determined by the physician administering the composition (AAV vector). Analysis of the serum, plasma or other tissue levels of the therapeutic polypeptide and comparison to the initial levels prior to administration can determine whether the amount administered is too low, within the appropriate range, or too high. Appropriate regimens for the first and subsequent administrations are also variable, but are typified by an initial administration, followed by subsequent administrations as needed, if desired. Subsequent administrations may be given at various intervals ranging from daily to annually, up to every few years. In some embodiments, appropriate immunosuppressive techniques may be recommended to avoid inhibition or blockade of transduction by immunosuppression of the delivery vector. See, for example, Vilquin et al., (1995) Human Gene Ther., 6:1391-1401.

[0046] Administration may be by any means. Both in vivo and ex vivo methods are contemplated. In some embodiments, intravenous injection (e.g., via the portal vein, but not limited thereto) is the method of administration. In some embodiments, administration is via standard intravenous administration. Other in vivo administration modes include, for example, direct injection into a liver lobe or bile duct, and intravenous injection distal to the liver via the hepatic artery, direct injection into the liver parenchyma, injection via the hepatic artery, and / or retrograde injection via the biliary system. Ex vivo administration modes include, for example, in vitro transduction of excised hepatocytes or other cells of the liver, followed by reinjection of the transduced excised hepatocytes into the portal vascular system, liver parenchyma, or biliary system of a human patient. See, e.g., Grossman et al., (1994) Nature Genetics, 6:335-341.

[0047] As described herein, exemplary intravenous doses of AAV vectors are, in some embodiments, 6x10 11 to 1x10 13 or 3x10 13 or 1x10 13 to 1x10 14 or 1x10 13 to 5x10 13 or 2x10 13 to 4x10 13 vg / kg, e.g., 1x10 12 or 2x10 12 to 3x10 13 viral genomes per kilogram (vg / kg) of body weight of a human recipient may be. In some embodiments, the dose is 1x10 11 to 1x10 12 vg / kg. In some embodiments, the dose is 1x10 12 to 1x10 13 vg / kg or 3x10 13 . In some embodiments, the dose is 2x10 12 to 3x10 13 . In some embodiments, the dose is 5x10 12 to 5x10 13It is vg / kg. As described above, in some embodiments, the AAV vector is provided to the recipient as a single administration. In some embodiments, the dosage is 6x10 11 , 9x10 11 , 1.2x10 12 , 2x10 12 , 4x10 12 , 6x10 12 , 1x10 13 , 3x10 13 , 4x10 13 or 5x10 13 vg / kg. In some embodiments, the patient receives a single administration of the AAV vector.

[0048] A pharmaceutically acceptable carrier can be included as part of the formulation to be administered. The pharmaceutically acceptable carrier is determined in part by the particular composition being administered and by the particular method used to administer the composition. Thus, as described below, there are suitable formulations of a wide variety of pharmaceutically available compositions (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0049] Formulations for both ex vivo and in vivo administration can include a suspension (e.g., of genetically modified cells, liposomes or nanoparticles) in a liquid or an emulsified liquid. The active ingredient can be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, etc., and combinations thereof. In addition, the composition may contain small amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, stabilizers or other reagents that enhance the effectiveness of the pharmaceutical composition.

[0050] The subject receiving the described AAV vector can be any human. Exemplary recipients include, for example, individuals having hemophilia (e.g., hemophilia A). In some embodiments, for use in the treatment of hemophilia A or in a method for reducing bleeding time during a bleeding episode in a subject suffering from hemophilia A, a therapeutically effective amount refers to an amount capable of causing one or more of the following effects: (1) a certain degree of reduction, inhibition, or prevention of one or more of the physiological symptoms of hemophilia A, including, for example, bruises, joint pain or swelling, chronic headache, vomiting, or fatigue; (2) improvement in the ability to clot blood; (3) reduction in the overall bleeding time during a bleeding episode; (4) administration that causes a measurable increase in the concentration or activity of functional FVIII protein in the plasma of the subject; and / or (5) a certain degree of alleviation of one or more symptoms associated with the disorder.

[0051] In some embodiments, an FVIII blood concentration greater than 1% of the factor concentration found in normal individuals results from administration of the AAV vectors described herein, thereby changing a severe disease phenotype to a moderate one. Severe phenotypes are characterized by joint damage and life-threatening bleeding. In some embodiments, administration of AAV vectors as described herein results in an FVIII blood concentration of at least 5% of normal. In some embodiments, an FVIII blood concentration greater than 5% of normal is required to change a moderate disease phenotype to a mild one. FVIII levels in normal humans are, for example, about 1.14 ± 0.48 nM plasma by the activated partial thromboplastin time (aPTT) one-stage clotting assay (see, for example, Butenas, et al., Thromb Res. (2010 Aug); 126(2): 119 - 123). Thus, a therapeutic effect can be achieved by expression of FVIII such that the total amount of FVIII in the subject / human is greater than 1% of the FVIII present in a normal subject / human, for example, 1% of 1.14 ± 0.48 nM.

[0052] In some embodiments, prior to administration, a human has less than 1%, 2%, 3%, 4%, or 5% of normal human circulating FVIII activity, and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the human has at least 1%, 2%, 3%, 4%, or 5% of normal human circulating FVIII activity, respectively. In some embodiments, administration of the AAV vectors described herein results in an increase in functional FVIII protein activity in the plasma of a human recipient of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more IU / dl as compared to the amount of functional FVIII protein activity present in the plasma of the subject prior to administration (e.g., within 14 days prior to administration). In some embodiments, administration of the AAV vectors described herein results in expression of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more IU / dl of circulating FVIII activity in the plasma of the subject. In this regard, the term "IU" or "international unit" is a generally understood term with respect to FVIII activity, and 1 IU of FVIII activity corresponds to the amount of FVIII in 1 ml of normal human plasma. In some embodiments, normal human FVIII activity is 0.500 - 1.500 IU / ml plasma. The World Health Organization describes the levels of severity of hemophilia as follows: [Table 1]

[0053] FVIII activity in plasma may be quantitatively determined by a number of well-known and accepted assays, including, for example, the activated partial thromboplastin time (APTT) method (e.g., Miletich JP: Activated partial thromboplastin time. In Williams Hematology. Fifth edition. Edited by E Beutler, MA Lichtman, BA Coller, TJ Kipps. New York, McGraw-Hill, 1995, pp L85-86, Greaves and Preston, Approach to the bleeding patient. In Hemostasis and Thrombosis: Basic Principles and Clinical Practice . Fourth edition. Edited by RW Colman, J Hirsh, VJ Marder, et al. Philadelphia, JB Lippincott Co, 2001, pp 1197-1234 and Olson et al, Arch. Pathol. Lab. Med. 122:782-798 (1998)) or a chromogenic FXa assay (see Harris et al., Thromb. Res. 128(6): 125-129 (2011)).

[0054] In other aspects, the bleeding time in a subject may be measured by well-known and accepted techniques, including, for example, the Ivy method (see, e.g., Ivy et al., Surg. Gynec. Obstet. 60:781 (1935) and Ivy et al., J. Lab. Clin. Med. 26: 1812 (1941)) or the Duke method (see, e.g., Duke et al., JAMA 55: 1185 (1910)). A "bleeding episode" in a subject refers to an injury that causes bleeding in the subject, either externally or internally, and generally includes the period from the injury until the formation of a blood clot. In some aspects, the frequency of bleeding episodes is decreased in a subject after administration of the AAV vectors described herein. In some aspects, the frequency of bleeding episodes is decreased by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% after administration.

[0055] In some aspects, the concentration of FVIII protein in human blood is measured before, after, or both before and after administration. Direct or indirect assays can be used to measure FVIII blood concentration. Exemplary indirect methods include those described, for example, in Over, J. (1986) Scand. J. Haematol. 33 (Suppl. 41), 13-24; Kemball-Cook, G., et al. (1993) Brit. J. Haematol. 84, 273-278. Direct detection methods include those described, for example, in U.S. Patent No. 8,715,951. In some aspects, the FVIII blood concentration is determined within two weeks prior to the first administration of the AAV vector in order to best determine the effect after administration.

[0056] In some embodiments, administration and treatment with the AAV vectors described herein cause a decrease in the need for treatment of the subject with replacement Factor VIII protein. This can be measured by noting the frequency of the need for treatment before administration of the AAV vectors described herein and then noting the frequency of the need for treatment after administration. In some embodiments, the decrease in the need for treatment is a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease after administration.

[0057] In some embodiments, administration and treatment with the AAV vectors described herein cause little or no harm to the liver. The state of the liver can be measured, for example, by measuring one or more markers in an individual's blood. Exemplary markers indicative of liver health include, but are not limited to, alanine aminotransferase (ALT) or aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, and albumin. In some embodiments, a human exhibits less than or equal to 1.0, 1.2, 1.5, 1.7, or 2.0 times the normal upper limit (ULN) of at least one of alanine aminotransferase (ALT), aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, or albumin within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks of administration. The ULN can generally be determined from a population. See, for example, Neuschwander-Tetri, B., et al., Arch Intern Med. 2004 Mar 24; 168(6): 663-666, which discusses ALT. In some embodiments, the ULN for ALT is 44 U / L. In some embodiments, the ULN for AST is 39 U / L. In some embodiments, the ULN for bilirubin is 0.1 - 1.0 mg / dL for total bilirubin, 0.2 - 0.7 mg / dL for conjugated bilirubin, and 0.1 - 0.4 mg / dL for unconjugated bilirubin. See, for example, Lisa B, VanWagner (2015). Journal of American Medical Association (JAMA) 313 (5): 516-517. In some embodiments, the ULN for alkaline phosphatase is 129 or 133 U / L. See, for example, Gowda, et al., Pan Afr Med J. (2009) 3:17. In some embodiments, the normal range for albumin is 35 - 55 g / liter (Burtis and Ashwood (1999)Tietz Textbook of Clinical Chemistry , 3 rd edition. Saunders Editor).

[0058] In some embodiments, administration and treatment with the AAV vectors described herein do not result in detectable levels of FVIII inhibitors at one or more of, for example, 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks post - administration. FVIII inhibitors are detected by the Nijmegen - Bethesda assay (Duncan, et al., Methods Mol Biol. 2013;992:321 - 33 and Miller CH, et al. Am J Hematol. 90:871 - 876 (2015)). The detection limit of this assay is 0.6 BU. Results less than 0.6 BU are considered undetectable.

[0059] In some embodiments, administration and treatment with the AAV vectors described herein do not significantly affect the expression of certain biomarkers and, ideally, result in improved outcomes for the biomarkers. Exemplary biomarkers include, for example, von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), galectin - 3 - binding protein (GAL3BP), C - reactive protein (CRP), IL - 6, and circulating alpha - fetoprotein. In some embodiments, one or more of the biomarkers listed above are measured in the blood of an individual before, after, or both before and after administration. In some embodiments, the blood levels of one or more of the biomarkers assayed within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks post - administration are 1.0, 1.2, 1.5, 1.7, or 2.0 - fold or less than the levels within 2 weeks prior to administration.

[0060] General The practice of the methods described herein, as well as the manufacture and use of the compositions, employs conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA, and related fields within the art, unless otherwise described. These techniques are fully explained in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, “Chromatin” (P.M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, “Chromatin Protocols” (P.B. Becker, ed.) Humana Press, Totowa, 1999.

[0061] Definitions The terms "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably and refer to deoxyribonucleotide or ribonucleotide polymers in linear or circular conformation and in either single-stranded or double-stranded form. For the purposes of the present disclosure, these terms should not be construed as being limiting with respect to the length of the polymer. These terms can include known analogs of natural nucleotides, as well as nucleotides that are modified in the bases, sugars and / or phosphate moieties (e.g., phosphorothioate backbone). In general, analogs of a particular nucleotide have the same base-pairing specificity; i.e., an analog of A forms a base pair with T.

[0062] The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to polymers of amino acid residues. This term also applies to amino acid polymers in which one or more amino acids are chemical analogs or modified derivatives of the corresponding natural amino acids.

[0063] In any of the methods described herein, an exogenous nucleotide sequence (an "expression construct" or "expression cassette" or "vector") contains a sequence that is homologous but not identical to the genomic sequence of the region of interest, thereby stimulating homologous recombination to insert a non-identical sequence into the region of interest. Thus, in one embodiment, the portion of the expression cassette sequence that is homologous to the sequence within the region of interest exhibits about 80 to 99% (or any integer therebetween) sequence identity to the genomic sequence to be replaced. In other embodiments, for example, if only one nucleotide differs between the homologous regions of an expression cassette and a genomic sequence of, for example, more than 100 contiguous base pairs, the homology between the expression cassette and the genomic sequence is higher than 99%. In certain cases, the non-homologous portion of the expression cassette can contain a sequence that does not exist in the region of interest, such that a new sequence is introduced into the region of interest. In these examples, the non-homologous sequence is generally adjacent to a sequence of 50 - 1,000 base pairs (or any integer value therebetween) or any number of base pairs greater than 1,000 that is homologous or identical to the sequence of the region of interest.

[0064] The term "sequence" refers to a nucleotide sequence of any length that can be DNA or RNA, can be linear, circular, or branched, and can be either single-stranded or double-stranded. The term "transgene" refers to a nucleotide sequence inserted into the genome. A transgene can be of any length, for example, 2 to 100,000,000 nucleotides in length (or any integer therebetween or greater), preferably about 100 to 100,000 nucleotides in length (or any value therebetween), more preferably about 2,000 to 20,000 nucleotides in length (or any value therebetween) and even more preferably, about 5 to 15 kb (or any value therebetween).

[0065] A "chromosome" is a chromatin complex that contains all or a portion of the genome of a cell. The genome of a cell is often characterized by a karyotype, which is the set of all chromosomes that contain the genome of the cell. The genome of a cell can contain one or more chromosomes.

[0066] An "episome" is a replicating nucleic acid, a nucleoprotein complex, or other structure that contains nucleic acids that are not part of the cell's chromosomal karyotype. Examples of episomes include plasmids and certain viral genomes. The liver-specific constructs described herein may be maintained episomally or may be stably integrated into the cell.

[0067] An "exogenous" molecule is a molecule that is not normally present within a cell but can be introduced into the cell by one or more of genetic, biochemical, or other means. "Normal presence in a cell" is determined with respect to a particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to adult muscle cells. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to cells that have not been heat shocked. Exogenous molecules can include, for example, functional versions of dysfunctional endogenous molecules or dysfunctional versions of normally functioning endogenous molecules.

[0068] Exogenous molecules may be, inter alia, small molecules, or macromolecules such as proteins, nucleic acids, carbohydrates, lipids, glycoproteins, lipoproteins, polysaccharides, any modified derivatives of the foregoing molecules, or any complexes comprising one or more of the foregoing molecules, such as those produced by combinatorial chemistry processes. Nucleic acids include DNA and RNA, may be single-stranded or double-stranded, may be linear, branched, or circular, and may be of any length. Nucleic acids include those capable of forming double-stranded structures, as well as nucleic acids capable of forming triple-stranded structures. See, for example, U.S. Pat. Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA-binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, ligases, deubiquitinating enzymes, integrases, recombinases, ligases, topoisomerases, gyrases, and helicases.

[0069] An exogenous molecule can be a molecule of the same type as an endogenous molecule, such as an exogenous protein or nucleic acid. For example, an exogenous nucleic acid can include an infectious viral genome, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell. Methods for introducing exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer. An exogenous molecule can also be a molecule of the same type as an endogenous molecule, but can be derived from a different species than that from which the cell is derived. For example, a human nucleic acid sequence can be introduced into a cell line that is originally derived from a mouse or hamster. Methods for introducing exogenous molecules into plant cells are known to those of skill in the art and include, but are not limited to, protoplast transformation, silicon carbide (e.g., WHISKERS™), Agrobacterium-mediated transformation, lipid-mediated delivery (i.e., liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment (e.g., using a "gene gun"), calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer.

[0070] In contrast, an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions. For example, an endogenous nucleic acid can include chromosomal, mitochondrial, chloroplast, or other organellar genomes, or naturally occurring episomal nucleic acids. Additional endogenous molecules can include proteins, such as transcription factors and enzymes.

[0071] As used herein, the term "product of an exogenous nucleic acid" includes both polynucleotide and polypeptide products, such as transcription products (polynucleotides such as RNA) and translation products (polypeptides).

[0072] For the purposes of the present disclosure, a "gene" includes the DNA region encoding the gene product (see below), as well as all DNA regions that regulate the production of the gene product, whether or not the regulatory sequences are adjacent to the coding and / or transcriptional sequences. Thus, a gene includes, but is not limited to, translational regulatory sequences such as promoter sequences, terminators, ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites and locus control regions.

[0073] "Gene expression" refers to the change of the information contained in a gene into a gene product. The gene product may be the direct transcript of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA), or a protein produced by translation of mRNA. Gene products also include RNAs modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by methylation, acetylation, phosphorylation, ubiquitination, ADP ribosylation, myristoylation, glycosylation.

[0074] "Regulation" of gene expression refers to a change in the activity of a gene. Regulation of expression can include, but is not limited to, gene activation and gene repression. Genome editing (e.g., cleavage, alteration, inactivation, random mutagenesis) can be used to regulate expression. Inactivation of a gene refers to a decrease in gene expression when compared to a cell that does not contain the ZFP, TALE, or CRISPR / Cas system described herein. Thus, inactivation of a gene may be partial or complete.

[0075] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g., T cells), such as stem cells (pluripotent and multipotent).

[0076] The terms "operably linked" and "operably connected" (or "operably connected thereto") are used interchangeably with reference to the juxtaposition of two or more components (such as array elements) arranged so that both components function properly and at least one of the components is capable of mediating a function exerted on at least one of the other components. As an example, when a transcriptional regulatory sequence controls the transcriptional level of a coding sequence in response to the presence or absence of one or more transcriptional regulatory factors, the transcriptional regulatory sequence, such as a promoter, is operably linked to the coding sequence. Transcriptional regulatory sequences are generally operably linked to coding sequences in cis, but need not be directly adjacent thereto. For example, an enhancer is a transcriptional regulatory sequence that is operably linked to a coding sequence even if not adjacent.

[0077] A "functional fragment" of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, but which retains the same function as the full-length protein, polypeptide or nucleic acid. Functional fragments can have more, fewer, or the same number of residues as the corresponding native molecule, and / or can include one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid) are well known in the art. Similarly, methods for determining the function of a protein are well known. For example, human factor VIII lacking the B domain is a functional fragment of the full-length factor VIII protein.

[0078] A polynucleotide "vector" or "construct" can transfer a gene sequence into a target cell. Typically, "vector construct", "expression vector", "expression construct", "expression cassette", and "gene transfer vector" mean any nucleic acid construct capable of directing the expression of a gene of interest and transferring the gene sequence into a target cell. Thus, the term includes cloning, expression vehicles, and integration vectors.

[0079] The terms "subject" and "patient" are used interchangeably and refer to mammalian patients such as human patients and non-human primates, as well as laboratory animals such as rabbits, dogs, cats, rats, mice, and other animals. Thus, the term "subject" or "patient" as used herein means any mammalian patient or subject to whom the expression cassette of the present invention can be administered. Subjects of the present invention include those having a disorder.

[0080] As used herein, the terms "treating" and "treatment" refer to a decrease in the severity and / or frequency of symptoms, the elimination of symptoms and / or underlying causes, the prevention of the occurrence of symptoms and / or their underlying causes, and the improvement or correction of damage. Cancer and graft-versus-host disease are non-limiting examples of conditions that can be treated using the compositions and methods described herein. Thus, "treating" and "treatment" (i) in particular, preventing the occurrence of a disease or condition in a mammal when the mammal is predisposed to the condition but has not yet been diagnosed as having it; (ii) inhibiting a disease or condition, i.e., preventing its onset; (iii) alleviating a disease or condition, i.e., causing regression of the disease or condition; and / or (iv) alleviating or eliminating symptoms resulting from a disease or condition, i.e., relieving pain whether or not dealing with the underlying disease or condition are included.

[0081] The terms "disease" and "condition" as used herein may be used interchangeably or may differ in that a particular disease or condition may not have a known causative agent (thus, the etiology has not yet been elucidated) and, thus, is not yet recognized as a disease but is recognized only as an undesirable state or syndrome in which a more or less specific set of symptoms has been identified by a clinician.

[0082] "Pharmaceutical composition" refers to a formulation of the compound of the present invention and a biologically active compound in a medium generally accepted in the art for delivery to a mammal, such as a human. Such a medium includes all pharmaceutically acceptable carriers, diluents or excipients therefor.

[0083] "Effective amount" or "therapeutically effective amount" refers to the amount of the compound of the present invention that is sufficient to effect treatment in a mammal, preferably a human, when administered to the mammal, preferably a human. The amount of the composition of the present invention that constitutes a "therapeutically effective amount" will vary depending on the compound, the condition and its severity, the mode of administration, and the age of the mammal being treated, but can be routinely determined by one of ordinary skill in the art in view of the knowledge of one of ordinary skill in the art and this disclosure.

[0084] Liver-specific expression construct Also described herein are expression cassettes (constructs) for use in directing the expression of a transgene in hepatocytes, including in vivo, after administration of the expression cassette to a subject (e.g., liver delivery). The expression construct may be episomally maintained and drive the expression of the transgene extrachromosomally, or the expression construct may be integrated into the genome of hepatocytes, for example, by nuclease-mediated targeted integration.

[0085] The polynucleotide expression construct includes an enhancer sequence, a promoter sequence, and one or more transgenes. Optionally, one or more of the following are included: an intron sequence, a polyadenylation sequence and / or a signal peptide. In the expression constructs described herein, any enhancer sequence may be used. In one embodiment, the enhancer is a wild-type or modified Serpin1 enhancer (Chuah et al., (2014) Molecular Therapy, 22, 1605-1613,; Nair et al., (2014) Blood, 123, 3195-3199).

[0086] As is clear, any transgene can be used in the constructs described herein. Further, the individual components of the constructs described herein (promoters, enhancers, insulators, transgenes, etc.) may be mixed and adapted in any combination.

[0087] The constructs described herein may be contained within any viral or non-viral vector. The constructs may be maintained episomally or integrated into the genome of the cell (e.g., via nuclease-mediated targeted integration).

[0088] Non-viral vectors include DNA or RNA plasmids, DNA MC, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes, nanoparticles, or poloxamers. Viral vectors that may be used to carry the expression cassettes described herein include, but are not limited to, retroviruses, lentiviruses, adenoviruses, adeno-associated viral vectors, vaccinia, and herpes simplex viral vectors. Integration into the host genome is possible with retroviral, lentiviral, and adeno-associated viral gene delivery methods and may be facilitated by nuclease-mediated integration as described herein.

[0089] In one aspect, the construct is contained within an adeno-associated virus (「AAV」) vector or vector system that may be maintained episomally or integrated into the genome of hepatocytes (e.g., via nuclease-mediated targeted integration). The construction of recombinant AAV vectors is described in many publications including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0090] Thus, in one aspect, the expression construct is carried on an AAV construct and further includes 5' and 3' ITRs adjacent to expression construct elements (e.g., enhancers, promoters, any introns, transgenes, etc.) as described herein. Optionally, spacer molecules are also included between one or more of the components of the expression construct, e.g., between the 5' ITR and the enhancer, and / or between the polyadenylation signal and the 3' ITR. The spacer may function as a homology arm to facilitate recombination into a safe harbor locus (e.g., albumin).

[0091] In one aspect, an AAV vector as described herein can be derived from any AAV. In one aspect, the AAV vector is derived from the defective non-pathogenic parvovirus adeno-associated type 2 virus. All such vectors are derived from plasmids that retain only the 145 bp AAV inverted terminal repeats adjacent to the transgene expression cassette. Efficient gene transfer and stable transgene delivery by integration into the genome of the transduced cell are important features of this vector system. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh.10 and any novel AAV serotypes can also be used according to the present invention. In some aspects, chimeric AAVs are used when the viral origin of the LTR sequence of the viral nucleic acid is heterologous to the viral origin of the capsid sequence. Non-limiting examples include chimeric viruses having an LTR derived from AAV2 and a capsid derived from AAV5, AAV6, AAV8 or AAV9 (i.e., AAV2 / 5, AAV2 / 6, AAV2 / 8 and AAV2 / 9, respectively).

[0092] Packaging cells are used to form virus particles capable of infecting host cells. Such cells include HEK293 and Sf9 cells that can be used to package AAV and adenovirus, and Ψ2 cells or PA317 cells that can package retroviruses. Virus vectors used in gene therapy are typically produced by a production cell line that packages a nucleic acid vector into virus particles. The vector typically contains the minimal viral sequences necessary for packaging and subsequent integration into the host (if applicable), and other viral sequences are replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically have only the inverted terminal repeat (ITR) sequences from the AAV genome that are necessary for packaging and integration into the host genome. The viral DNA is packaged into a cell line that contains a helper plasmid that encodes the other AAV genes, i.e., rep and cap, but lacks the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates the replication of the AAV vector and the expression of the AAV genes from the helper plasmid. Due to the deletion of the ITR sequences, the helper plasmid is not packaged in large amounts. Contamination by adenovirus can be reduced, for example, by heat treatment, as adenovirus is more sensitive than AAV. In some embodiments, AAV is produced using a baculovirus expression system.

[0093] In many gene therapy applications, it is desirable for the gene therapy vector to be delivered with a high degree of specificity to a particular tissue type. Thus, viral vectors can be modified to have specificity for a given cell type by expressing a ligand on the outer surface of the virus as a fusion protein with a viral coat protein. The ligand is selected to have an affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and that the recombinant virus infects certain human breast cancer cells that express the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs where the target cell expresses a receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., Fab or Fv) with specific binding affinity for substantially any selected cell receptor. The above description applies mainly to viral vectors, but the same principle can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that are advantageous for uptake by a particular target cell.

[0094] The polynucleotides described herein may contain one or more non-natural bases and / or backbones. In particular, as described herein, expression cassettes may contain methylated cytosines to achieve a state of transcriptional quiescence in regions of interest.

[0095] Furthermore, the expression constructs described herein may also include additional transcriptional or translational regulatory or other sequences, such as Kozak sequences, additional promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites, and / or polyadenylation signals. Further, regulatory elements of a gene of interest can be operably linked to a reporter gene to create a chimeric gene (e.g., a reporter expression cassette).

[0096] Delivery The constructs described herein may be delivered in vivo or ex vivo to any cell type, preferably the liver, by any suitable means (liver delivery). Similarly, when used in combination with nucleases for targeted integration, the nucleases may be delivered, for example, using non-viral vectors, viral vectors, in polynucleotide and / or protein form, and / or in RNA form, such as as mRNA.

[0097] Using conventional viral and non-viral based gene transfer methods, nucleic acids encoding engineered gene modulators can be introduced into cells (e.g., mammalian cells) and target tissues. Such methods can also be used to administer nucleic acids encoding such repressors (or components thereof) to cells in vitro. In one embodiment, nucleic acids encoding repressors are administered for use in in vivo or ex vivo gene therapy. Non-viral vector delivery systems include DNA plasmids, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. Viral vector delivery systems include DNA and RNA viruses that have either episomal or integrated genomes after delivery to cells. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds.) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0098] Any vector system may be used, including but not limited to plasmid vectors, retroviral vectors, lentiviral vectors, adenoviral vectors, poxviral vectors, herpes viral vectors, and adeno-associated viral vectors. See also U.S. Pat. Nos. 8,586,526; 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, which are hereby incorporated by reference in their entirety.

[0099] Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, other nanoparticles, polycations or lipid:nucleic acid conjugates, naked DNA, artificial virions, and drug-enhanced uptake of DNA. For example, sonoporation using the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Further exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA), and Copernicus Therapeutics Inc., (see, e.g., US6008336).

[0100] In some embodiments, the expression construct is an AAV vector. The desired nuclease may be administered in mRNA form or using one or more viral vectors (such as AAV, Ad, etc.). Administration can be by any means by which the polynucleotide is delivered to the desired target cell. Both in vivo and ex vivo methods are contemplated. Intravenous injection into the portal vein is a possible method of administration. Other in vivo modes of administration include, for example, direct injection into a liver lobe or bile duct, and intravenous injection distal to the liver via the hepatic artery, direct injection into the liver parenchyma, injection via the hepatic artery, and / or retrograde injection via the biliary system. Ex vivo modes of administration include, for example, in vitro transduction of excised hepatocytes or other cells of the liver, followed by reinjection of the transduced excised hepatocytes into the portal vascular system, liver parenchyma or biliary system of a human patient; see, for example, Grossman et al., (1994) Nature Genetics, 6:335-341.

[0101] In a system involving delivery of two or more polynucleotides (such as the constructs and nuclease in polynucleotide form described herein), the two or more polynucleotides are delivered using one or more same and / or different vectors. For example, the nuclease in polynucleotide form may be delivered in mRNA form, and the liver-specific constructs described herein may be delivered via other modalities such as viral vectors (such as AAV), minicircle DNA, plasmid DNA, linear DNA, liposomes, nanoparticles, etc.

[0102] Additional exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc, (see, e.g., US6008336). Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386; 4,946,787; and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam (登録商標) and Lipofectin (登録商標) and Lipofectamine (登録商標) and RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those of Felgner, WO 91 / 17424, WO 91 / 16024. Delivery can be to cells (ex vivo administration) or target tissue (in vivo administration).

[0103] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); see U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).

[0104] Further methods of delivery include the use of packaging nucleic acids to be delivered into an EnGeneIC Delivery Vehicle (EDV). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other arm has specificity for the EDV. The antibody carries the EDV to the target cell surface, and the EDV is then carried into the cell by endocytosis. Upon entering the cell, the contents are released (see MacDiarmid et al (2009) Nature Biotechnology 27(7):643).

[0105] In applications where transient expression is desired, an adenovirus-based system can be used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. Such vectors provide high titers and high levels of expression. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors are also used, for example, in the in vitro production of nucleic acids and peptides, as well as for in vivo and ex vivo gene therapy procedures, to transduce cells with a target nucleic acid (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994)). The construction of recombinant AAV vectors is described in many references, including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0106] Recombinant adeno-associated virus vector (rAAV) is a promising alternative gene delivery system based on the defective non-pathogenic parvovirus adeno-associated virus type 2. All vectors are derived from plasmids that retain only the 145 bp AAV inverted terminal repeats adjacent to the transgene expression cassette. Efficient gene transfer and stable transgene delivery by integration into the genome of the transduced cells are important features of this vector system. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8 AAV 8.2, AAV9, and AAV rh10, as well as pseudotyped AAV such as AAV2 / 8, AAV2 / 9, AAV2 / 5, AAV2 / 6 can also be used according to the present invention. Novel AAV serotypes that can cross the blood-brain barrier can also be used according to the present invention (see, for example, US20150079038). In some embodiments, AAV6 is used.

[0107] Packaging cells are used to form virus particles that can infect host cells. Such cells include 293 cells that package adenovirus, and Ψ2 cells or PA317 cells that package retrovirus. Virus vectors used in gene therapy are usually produced by a production cell line that packages a nucleic acid vector into virus particles. The vector typically contains the minimal viral sequences necessary for packaging and subsequent integration into the host (if applicable), and other viral sequences are replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, an AAV vector used in gene therapy typically has only the inverted terminal repeat (ITR) sequences from the AAV genome that are necessary for packaging and integration into the host genome. The viral DNA is packaged into a cell line that contains a helper plasmid that encodes the other AAV genes, namely rep and cap, but lacks the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates the replication of the AAV vector and the expression of the AAV genes from the helper plasmid. Due to the deletion of the ITR sequences, the helper plasmid is not packaged in large amounts. Contamination by adenovirus can be reduced, for example, by heat treatment, as adenovirus is more sensitive than AAV.

[0108] Purification of AAV particles from 293 or baculovirus systems typically involves growth of the cells that produce the virus, followed by recovery of the virus particles from the cell supernatant, or lysis of the cells and recovery of the virus from the crude lysate. The AAV is then purified by methods known in the art, including ion exchange chromatography (see, e.g., U.S. Pat. Nos. 7,419,817 and 6,989,264), ion exchange chromatography and CsCl density centrifugation (see, e.g., PCT Publication WO2011094198A10), immunoaffinity chromatography (see, e.g., WO2016128408) or purification using AVB Sepharose (e.g., GE Healthcare Life Sciences).

[0109] In many gene therapy applications, it is desirable for the gene therapy vector to be delivered with a high degree of specificity to a particular tissue type. Thus, viral vectors can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is selected to have an affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995) reported that Moloney murine leukemia virus could be modified to express human heregulin fused to gp70, and that the recombinant virus infected certain human breast cancer cells that express the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs where the target cell expresses a receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., Fab or Fv) with specific binding affinity for substantially any selected cell receptor. The foregoing description applies primarily to viral vectors, but the same principle can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that are advantageous for uptake by a particular target cell.

[0110] Gene therapy vectors can be delivered in vivo by administration to individual patients, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial injection, including direct injection into the brain) or by local application, as described below.

[0111] A pharmaceutically acceptable carrier is partially determined by the particular composition being administered and by the particular method used to administer the composition. Thus, as described below, there are a variety of suitable formulations of the pharmaceutical compositions available (see, e.g., Remington’s Pharmaceutical Sciences, 17th ed., 1989).

[0112] The effective amount of the expression cassette (and the desired nuclease, and / or modified cell) to be administered will vary from patient to patient. Thus, the effective amount is often determined by the physician who administers the composition (e.g., the cell), and the appropriate dosage can be readily determined by one of ordinary skill in the art. Analysis of the serum, plasma or other tissue levels of the therapeutic polypeptide and comparison to the initial levels prior to administration can determine whether the amount administered is too low, within the appropriate range, or too high. The appropriate regimens for initial and subsequent administrations will also vary, but are typified by an initial administration followed, if necessary, by subsequent administrations. Subsequent administrations may be administered at a variety of intervals ranging from daily to annually, every few years. One of ordinary skill in the art will understand that appropriate immunosuppressive techniques may be recommended to avoid inhibition or blockade of transduction by the immunosuppression of the delivery vector, see, e.g., Vilquin et al., (1995) Human Gene Ther., 6:1391-1401.

[0113] Formulations for both ex vivo and in vivo administration include suspensions in liquids or emulsified liquids (e.g., of genetically modified cells, liposomes or nanoparticles). The active ingredient is often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, and combinations thereof. In addition, the composition may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, stabilizers or other reagents that enhance the effectiveness of the pharmaceutical composition.

[0114] Application The methods and compositions described herein are for providing treatment of any disease by providing a transgene that expresses a product that lacks or is deficient in the disease or, alternatively, treats or prevents the disease. The present disclosure relates to, for example, the following. [Item 1] A method for increasing factor VIII (FVIII) protein in a human subject, comprising administering to the human subject one or more doses of an adeno - associated virus (AAV) vector encoding factor VIII (FVIII) protein at 5×10 12 to 5×10 13 vg / kg, wherein the administration of the AAV vector results in a clinically relevant increase in the level of circulating FVIII activity. [Item 2] A method for increasing factor VIII (FVIII) protein in a human subject, comprising administering to the human subject one or more doses of an adeno - associated virus (AAV) vector encoding factor VIII (FVIII) protein at 5×10 12 to 5×10 13 vg / kg, wherein the administration of the AAV vector results in a decrease in the number of FVIII treatments received by the human subject. [Item 3] The method according to item 1 or 2, wherein the administration results in the occurrence of one or zero spontaneous bleeding episodes in the human subject between 3 - 12 months after administration. [Item 4] 1x10 13 The method according to item 1 or 2, comprising administering one or more doses from 13 vg / kg to 3x10 [Item 5] 2x10 13 The method according to item 1 or 2, comprising administering one or more doses from 13 vg / kg to 4x10 [Item 6] 3x10 13 The method according to item 1 or 2, comprising administering one or more doses of [Item 7] The method according to item 1 or 2, wherein FVIII comprises the amino acid sequence of SEQ ID NO: 1. [Item 8] The method according to any one of items 1 - 7, wherein the AAV vector has an AAV6 serotype. [Item 9] The method according to item 8, wherein the AAV vector comprises an expression cassette comprising a polynucleotide encoding FVIII protein operably linked to a liver - specific enhancer and promoter. [Item 10] The method according to item 9, wherein the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO: 2 and / or the promoter comprises the nucleotide sequence of SEQ ID NO: 3. [Item 11] The method according to any one of items 8 to 10, wherein the AAV vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence adjacent to the expression cassette. [Item 12] The method according to any one of items 8 to 10, wherein the AAV2 5' ITR comprises the nucleotide sequence of SEQ ID NO: 12 and / or the AAV2 3' ITR comprises the nucleotide sequence of SEQ ID NO: 13. [Item 13] The method according to any one of items 8 to 12, wherein the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 5. [Item 14] The method according to any one of items 1 to 13, wherein the human subject has hemophilia. [Item 15] The method according to item 2, wherein the human subject does not receive FVIII treatment 3 to 12 months after administration.

Example

[0115] Example 1: Clinical Method Quantitative PCR qRT-PCR (for human factor VIII mRNA level): RNA / DNA is isolated from plasma using the AllPrep DNA / RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad CA). Next, the extracted RNA is used to create cDNA using the Quantitect cDNA synthesis kit (Qiagen, Carlsbad CA). Next, quantitative PCR is performed on a Biorad CFX96 using SsoAdvanced Universal Probes Supermix (Biorad, Hercules CA) with labeled primer / probe assays from IDT (Coralville IA). For specific detection of human factor VIII mRNA, the primer / probe assay is custom; forward primer (GGAGATGAAGAAGGAGGACTTTG) (SEQ ID NO: 6), probe (ACATCTACGACGAGGACGAGAACCA) (SEQ ID NO: 7) and reverse primer (TCCACAGCAGCAATGAAGTAG) (SEQ ID NO: 8). Quantitative qRT-PCR (not absolute) is used for normalization to GAPDH for each sample, and the final data analysis is reported relative to one sample set to 1.0. No-template controls and reverse transcriptase-free controls are run on all samples and do not generate detectable signals.

[0116] qPCR (for vector genome, VG, analysis): RNA / DNA is isolated from plasma using the AllPrep DNA / RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad CA). The extracted DNA is used for quantitative PCR with TaqMan Fast Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, Foster City, CA) on an AB 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA). For specific detection of human factor VIII, the primer / probe assay is custom; forward primer (CCTGGGCCAGTTCCTGCT) (SEQ ID NO: 9), probe (TTCTGCCACATCAGCAGCCACCA) (SEQ ID NO: 10) and reverse primer (GGCCTCCATGCCATCATG) (SEQ ID NO: 11). A no-template control is run on all samples and does not generate a detectable signal. A qPCR DNA standard curve is generated from seven serial 4-fold dilutions of known amounts of purified and linearized human factor VIII plasmid.

[0117] Human FVIII Total Antigen Immunoassay. The total antigen of human factor VIII B domain deleted (hFVIII-BDD) in citrated human plasma is measured using the hFVIII BDD immunoassay developed by Sangamo Therapeutics, Inc. The Xyntha® (human recombinant BDD-FVIII) reference material is used as a calibrator. Xyntha® is also used as a QC to represent the hFVIII-BDD antigen. This assay is a sandwich ELISA that uses monoclonal antibodies (mAbs) that both have the A2 domain of FVIII as an epitope as the capture antibody and a biotinylated mAb as the detection antibody. After coating, blocking, and washing with the capture mAb (GMA-8023; Green Mountain Antibodies), plasma samples, calibration, and quality control samples at the minimum required dilution (MRD) of 5 are incubated and then washed in the assay plate. Before adding the streptavidin-horseradish peroxidase (SA-HRP) conjugate reagent, the biotinylated mAb (GMA-8024; Green Mountain Antibodies) is applied to the plate by incubation and then washed. After SA-HRP incubation and washing, the 3,3’,5,5’-tetramethylbenzidine (TMB) substrate solution is added for 10 minutes, followed by the addition of an acidic stop solution to quench the reaction and detection at 450 run. The captured hFVIII-BDD antigen is quantified against a linear standard curve regressed using a biphasic logarithmic fit over the range of 0.020 IU / mL to 0.500 IU / mL. The calibrator is prepared using a 10.0 IU / mL Xyntha® diluted standard solution prepared with pooled congenital FVIII-deficient plasma (George King Bio-Medical, or equivalent).

[0118] A 9-point calibration curve (quantification range from 0.500 IU / mL to 0.020 IU / mL with anchor points at 0.010 IU / mL and 0.000 IU / mL) is generated using an assay calibrator diluted to applicable levels in assay diluent. Calibration is performed as a single curve in duplicate using a log-log linear fitting with the total hFVIII-BDD antigen content measured in IU / mL on the x-axis and the optical density (OD, measured at 450 nm) on the y-axis. The last two standard levels are the anchor points generated at 0.010 IU / mL and 0.000 IU / mL and have no acceptance criteria. Samples and QCs are assayed in duplicate and back-calculated against the calibration curve to determine the total hFVIII-BDD antigen (concentration reported as IU / mL).

[0119] Chromogenic human factor VIII activity assay. The activity of secreted human factor VIII in plasma is determined using the Diapharma Chromogenic Coamatic Factor VIII assay (West Chester, OH) according to the manufacturer's protocol, except for the human factor VIII standard. The human factor VIII standard used in the ELISA assay is recombinant purified human factor VIII (#F0016-06) from US Biologicals (Salem, MA).

[0120] Coagulation Activity Assay The activity of secreted human Factor VIII in plasma is determined using the Activated Partial Thromboplastin Time (aPTT) assay by Diagnostica Stago (Boston MA) according to the manufacturer's protocol, except for human Factor VIII standard and human Factor VIII - deficient plasma. The human Factor VIII standard is the same as that used in the ELISA assay (recombinant purified human Factor VIII, #F0016 - 06 from US Biologicals, Salem, MA). The FVIII - deficient reagent used in the coagulation assay is FVIII - CD <1% FVIII activity (frozen FVIII - deficient) from Haematologic Technologies, Inc. (Essex Junction, VT).

[0121] Example 2: Preparation of SB - 525 CaCl 2 、MgCl 2 、35 mM NaCl (i.e., 0.90 mM CaCl 2 、0.49 mM MgCl 2 、2.68 mM KCl, 1.47 mM KH 2 PO 4 、172 mM NaCl, 8.10 mM Na 2 HPO 4 ) SBR - 0099, the final product formulation base buffer composed of phosphate - buffered saline (PBS), was prepared using USP - grade reagents. SB - 525 Bulk was adjusted to a target concentration of 1.0 x 10 2 、MgCl 2 、35 mM NaCl, 1% sucrose, 0.05% Kolliphor (Poloxamer) P 188 in the final formulation buffer composed of PBS. 13 vg / mL.

[0122] The SB - 525 vector contains the AAV6 capsid and is an AAV vector containing SEQ ID NO: 5 flanked 5' and 3' by SEQ ID NOs: 12 and 13 of AAV2 ITR respectively.

[0123] The SB-525 product was prepared by calculating the product component volume by multiplying the target body weight (kg) by the dose level (vg / kg) and then dividing by the viral genome concentration (vg / mL). The volume of normal saline (NS) was calculated such that the ratio of the SB-525 product was 1:1. The total volume was calculated by summing the volume of NS and the volume of the SB-525 product. Exemplary doses for the SB-525 product in the subject are shown in Table I below: Table I: Exemplary SB-525 Doses

Table I

[0124] Example 3: Injection Protocol The total volume was expected to be between 4 mL and 200 mL, depending on the assigned dose level and body weight of the subject. When the total volume was less than 50 mL, the injection product was administered via a syringe, and when the volume was greater than 50 mL, the injection product was administered via an infusion bag. Both infusion rates were 100 mL / hour using a constant-rate infusion pump.

[0125] Example 4: Objectives of the Study and Clinical Endpoints Inclusion and Exclusion Criteria: For this study, the inclusion criteria included male subjects 18 years of age or older who had been treated or exposed to FVIII concentrate or cryoprecipitate for at least 150 exposure days. In addition, the subject needed to have had more than 12 bleeding episodes in the past 12 months. The exclusion criteria included subjects with neutralizing antibodies against the AAV6 capsid, FVIII inhibitor or its history, hypersensitivity to FVIII, evidence of any bleeding disorder in addition to hemophilia A, markers of liver inflammation, and use of systemic (IV or oral) immunomodulatory drugs.

[0126] Objective of the study: The main objective of this study was to evaluate safety. This main objective was to investigate the safety and tolerability of SB-525 and to evaluate the time-course profile of FVIII activity after SB-525 administration. Secondary endpoints included observation of changes in baseline use of FVIII replacement therapy ("factor"), frequency and severity of bleeding episodes, assessment of the clinical impact on hemophilia A after administration, and assessment of the immune response to FVIII and vector shedding of the AAV2 / 6 vector. Exploratory objectives included assessment of the concordance between FVIII levels by ELISA and FVIII activity assays and assessment of the immune response to SB-525.

[0127] Approximately 20 subjects may be enrolled in this trial. Dose selection and the number of subjects to be tested at each dose level are based on safety and the cumulative pharmacodynamic response (kinetics of circulating FVIII levels) observed in previously dosed subjects.

[0128] To identify safety and an acceptable therapeutic range, it may be necessary to test approximately seven dose levels. Potential dose levels are 6x10 11 、9x10 11 、1.2x10 12 、2x10 12 、4x10 12 、6x10 12 and 1x10 13 vg / kg. The starting dose level (9x10 11 vg / kg) is associated with 12% of normal FVIII activity in NHP studies.

[0129] Example 5: Preliminary Results Five patients were treated pre - emptively. SB - 525 was generally well - tolerated without serious adverse events associated with treatment and without the use of steroid tapering. One patient treated in the third cohort (dose level 3) achieved expression of factor VIII and factor use at therapeutically appropriate levels that may predict a significant reduction or elimination of spontaneous bleeding. In the second cohort (dose level 2), a decrease in factor use was observed post - treatment.

[0130] Example 6: Eight patients treated with SB - 525 gene therapy showed a dose - dependent increase in FVIII activity, and two patients treated at the 3x10 13 vg / kg dose reached normal FVIII levels The Phase 1 / 2 Alta trial is an open - label, dose - escalation clinical trial designed to evaluate the safety and tolerability of SB - 525 in up to 20 adult patients with severe hemophilia A. The data show that SB - 525 was generally well - tolerated and demonstrated a dose - dependent increase in factor VIII (FVIII) levels across four dosing cohorts.

[0131] Data from the first eight patients with hemophilia A treated with SB - 525 gene therapy facilitate and demonstrate a dose - dependent relationship, evidence of sustained factor levels, and low variability both within each patient and within each cohort.

[0132] The Phase 1 / 2 data include eight patients treated in four escalating dosing cohorts (9x10 11 vg / kg, 2x10 12 vg / kg, 1x10 13 vg / kg, and 3x10 13 vg / kg, two patients per cohort). The patients showed a dose - dependent increase in FVIII levels, a clinically relevant increase in FVIII activity in the high - dose cohort, and at 3x10 13In the vg / kg dosing cohort, normal FVIII levels (normal range: 50 - 150%) were achieved. A dose-dependent decrease in the use of factor VIII replacement therapy was also observed, with a significant decrease in the high-dose cohort. SB-525 was generally well tolerated, and one patient (treated at a dose of 3x10 13 vg / kg) reported a serious treatment-related adverse event of hypotension and fever, which occurred after vector injection and resolved with treatment within 24 hours of completion of vector injection.

[0133] In this study, patients were not treated with prophylactic steroids. Serious treatment-related adverse events and ALT elevations requiring corticosteroid treatment for more than 7 days were not observed in the first three cohorts. One patient in the fourth cohort experienced an ALT elevation (> 1.5x ULN) at week 4 and required a tapering course of oral steroids. Seven weeks after the initiation of steroid therapy, the patient had no associated loss of factor VIII activity or ALT elevation. The same patient experienced a treatment-related infusion reaction but was discharged the next day according to the protocol-specified timeline.

[0134] Table II provides data showing the results of administration of doses of AAV vectors of 9 x 10 11 、2 x 10 12 、1 x 10 13 and 3 x 10 13 vg / Kg. Figures 1 - 3 provide FVIII activity data obtained after administration. Table II. Results of administration of AAV dose. "Follow-up" refers to the period after administration during which FVIII activity levels (column 2) and frequency of FVIII treatment (column 5) were measured.

Table II

[0135] Example 7: Ten patients treated with SB-525 gene therapy showed a dose-dependent increase in FVIII activity, with 3x1013 Four patients treated at a dose of vg / kg reached normal FVIII levels Eight patients described in Example 6 were followed for a longer period of time, and two additional patients (Patients 9 and 10) were added to the study at a dose of 3×10 13 vg / kg. Figures 4 and 5 show FVIII activity in all ten patients over time after treatment with the vector.

[0136] As the dose increased, spontaneous bleeding episodes disappeared and no bleeding episodes were reported for any of the high-dose patients. See Figure 6. The use of FVIII decreased to zero in one patient in Cohort 3 (1 x 10 13 vg / kg) and all patients in the high-dose cohort (3 x 10 13 vg / kg) approximately three weeks after vector injection application. Patient 9 received the last injection at three weeks and two days and has not been injected since. See Figure 7 (asterisk indicating that the injection occurred more than three weeks and two days).

[0137] Figures 8 - 10 summarize the findings of adverse events from the clinical trial.

[0138] All patents, patent applications, and literature described herein are hereby incorporated by reference in their entirety.

[0139] The disclosure has been provided in some detail by way of illustration and example for purposes of clarity of understanding, but it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit or scope of the disclosure. Accordingly, the foregoing description and examples should not be construed as limiting.

Claims

1. A composition comprising an adeno-associated virus serotype 6 (AAV6) vector for increasing factor VIII (FVIII) activity in a human subject, wherein the AAV6 vector comprises an expression cassette encoding a substituted FVIII protein, and a first insulator sequence comprising nucleotides 14-32 of SEQ ID NO: 5, an enhancer sequence comprising SEQ ID NO: 2, a promoter sequence comprising SEQ ID NO: 3, a coding sequence comprising SEQ ID NO: 1, and a second insulator sequence comprising nucleotides 4869-4885 of SEQ ID NO: 5 is included, The AAV6 vector is administered intravenously to a human subject at one or more doses of 1x10 １３ to 5x10 １３ vg / kg, and administration of the AAV6 vector results in a clinically relevant increase in the level of circulating FVIII activity, composition.

2. A composition comprising an adeno-associated virus serotype 6 (AAV6) vector for increasing factor VIII (FVIII) activity in a human subject, wherein the AAV6 vector comprises an expression cassette encoding a substituted FVIII protein, and a first insulator sequence comprising nucleotides 14-32 of SEQ ID NO: 5, an enhancer sequence comprising SEQ ID NO: 2, a promoter sequence comprising SEQ ID NO: 3, a coding sequence comprising SEQ ID NO: 1, and a second insulator sequence comprising nucleotides 4869-4885 of SEQ ID NO: 5 is included, The AAV6 vector is administered intravenously to a human subject at one or more doses from 1x10 １３ to 5x10 １３ vg / kg, and administration of the AAV6 vector results in a decrease in the number of FVIII treatments received by the human subject, a composition.

3. The composition according to claim 1 or 2, wherein administration results in the occurrence of one or zero spontaneous bleeding episodes in the human subject between 3 and 12 months after administration.

4. The AAV6 vector is administered at one or more dosages from 1x10 １３ vg / kg to 3x10 １３ vg / kg, the composition according to claim 1 or 2.

5. The AAV6 vector is administered at one or more doses from 2x10 １３ vg / kg to 4x10 １３ vg / kg, the composition according to claim 1 or 2.

6. The AAV6 vector is administered at one or more doses of 3x10 １３ vg / kg, the composition according to claim 1 or 2.

7. The composition according to any one of claims 1 to 6, wherein the expression cassette comprises SEQ ID NO:

5.

8. The composition according to any one of claims 1 to 7, wherein the AAV6 vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence adjacent to the expression cassette.

9. The composition according to claim 8, wherein the AAV2 5' ITR comprises the nucleotide sequence of SEQ ID NO: 12 and / or the AAV2 3' ITR comprises the nucleotide sequence of SEQ ID NO:

13.

10. The composition according to any one of claims 1 to 9, wherein the human subject has hemophilia.

11. The composition according to claim 10, wherein the human subject has hemophilia A.

12. The composition according to any one of claims 2 to 11, wherein the human subject does not receive FVIII treatment 3 to 12 months after AAV6 administration.

13. The composition according to any one of claims 1 to 12, wherein the AAV6 vector is administered intravenously into the portal vein of the human subject. **Claim 14** A composition for treating hemophilia A in a human subject in need thereof, the composition comprising an adeno-associated virus (AAV) vector, the AAV vector having AAV serotype 6 and comprising an expression cassette comprising SEQ ID NO: 5 flanked by an AAV2 5’ ITR comprising SEQ ID NO: 12 and an AAV2 3’ ITR comprising SEQ ID NO: 13, The AAV vector encodes a replacement FVIII protein and is administered to a human subject at one or more doses of 1x10 １３ to 5x10 １３ vg / kg the composition.

Images