Nucleic Acid Generation and Amplification

Specific nucleic acid polymers are used to inhibit ribosomal RNA reverse transcription, addressing noise in gene expression analysis by suppressing DNA synthesis from ribosomal RNA and improving the accuracy of nucleic acid amplification methods.

JP7722661B2Active Publication Date: 2025-08-13TOYOBO CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021505076
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-03-13
Filing Date
2020-03-10
Publication Date
2025-08-13
Estimated Expiration
2040-03-10

Smart Images

  • Figure 0007722661000010
    Figure 0007722661000010
  • Figure 0007722661000011
    Figure 0007722661000011
  • Figure 0007722661000001
    Figure 0007722661000001
Patent Text Reader

Abstract

Provided are: a composition and a method for inhibiting the reverse transcription of a ribosomal RNA. The composition for inhibiting the reverse transcription of the ribosomal RNA comprises at least one nucleic acid polymer selected from the group consisting of: inosinic acid polymer, cytidylic acid polymer, guanylic acid polymer, adenylic acid polymer, thymidylic acid polymer, uridylic acid polymer, deoxyinosinic acid polymer, deoxycytidylic acid polymer, deoxyguanylic acid polymer, deoxyadenylic acid polymer, deoxythymidylic acid polymer, and deoxyuridylic acid polymer.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the production and amplification of nucleic acids. For example, the present invention relates to compositions and methods useful for the production and amplification of nucleic acids from ribonucleic acid (RNA) templates, specifically compositions and methods for the production and amplification of nucleic acids by reverse transcription using specific nucleic acid polymers. The compositions and methods of the present invention can be used, for example, to inhibit reverse transcription of ribosomal RNA, i.e., to inhibit DNA synthesis from ribosomal RNA. [Background technology]

[0002] Ribosomal RNA is said to account for approximately 80-90% of the RNA in living organisms. Gene expression analysis typically involves converting expressed RNA into cDNA via reverse transcription and then performing gene analysis based on the cDNA. During this reverse transcription reaction, ribosomal RNA, which accounts for the majority of RNA in living organisms, is reverse transcribed and amplified, resulting in noise in the expression analysis of the RNA that is intended to be reverse transcribed and amplified. Recently, new techniques, such as the RT-RamDA method, have been developed, which can obtain large amounts of nucleic acid amplification products using RNA as a template (see Patent Document 1). In methods such as the RT-RamDA method, which can obtain large amounts of nucleic acid amplification products using RNA as a template, once reverse transcription of ribosomal RNA occurs, it undergoes isothermal linear amplification via a strand displacement reaction, resulting in a significant relative decrease in the amount of RNA to be analyzed. For this reason, it is desirable to suppress DNA synthesis derived from ribosomal RNA in nucleic acid analysis methods that involve reverse transcription. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] International Publication No. 2016 / 052619 Summary of the Invention [Problem to be solved by the invention]

[0004] One goal is to provide a means for inhibiting reverse transcription of ribosomal RNA. [Means for solving the problem]

[0005] As a result of intensive research to achieve the above object, the present inventors have found that, in a method for synthesizing DNA by reverse transcription of template RNA, the use of a specific nucleic acid polymer can suppress reverse transcription of ribosomal RNA and inhibit DNA synthesis derived from ribosomal RNA. Based on this finding, the present inventors have conducted further research and have completed the present invention.

[0006] That is, the present invention includes the following aspects. Section 1. A method for synthesizing DNA by reverse transcription of template RNA, comprising the step of suppressing DNA synthesis from ribosomal RNA using at least one nucleic acid polymer selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, adenylic acid polymers, thymidylic acid polymers, uridylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, deoxyguanylic acid polymers, deoxyadenylic acid polymers, deoxythymidylic acid polymers, and deoxyuridylic acid polymers. Section 2. Item 10. The method according to Item 1, wherein the nucleic acid polymer is at least one homopolymer selected from the group consisting of polyinosinic acid, polycytidylic acid, polyguanylic acid, polyadenylic acid, polythymidylic acid, polyuridylic acid, polydeoxyinosinic acid, polydeoxycytidylic acid, polydeoxyguanylic acid, polydeoxyadenylic acid, polydeoxythymidylic acid, polydeoxyuridylic acid, and salts thereof. Section 3. Item 3. The method according to Item 1 or 2, wherein the nucleic acid polymer is at least one homopolymer selected from the group consisting of polyinosinic acid, polycytidylic acid, polyguanylic acid, polydeoxyinosinic acid, polydeoxycytidylic acid, polydeoxyguanylic acid, and salts thereof. Section 4. Item 4. The method according to any one of Items 1 to 3, wherein the nucleic acid polymer is at least one homopolymer selected from the group consisting of polyinosinic acid, polydeoxyinosinic acid, and salts thereof. Section 5. Item 5. The method according to any one of Items 1 to 4, wherein the nucleic acid polymer comprises a nucleic acid polymer having a total length of 30 to 10,000 bases. Section 6. Item 6. The method according to any one of Items 1 to 5, wherein the reverse transcription is carried out using a random primer. Section 7. Item 7. The method according to Item 6, wherein the base sequence of the random primer is not completely complementary to the base sequence of the ribosomal RNA. Section 8. 8. The method according to any one of Items 1 to 7, wherein the reverse transcription is carried out by RT-PCR or RT-RamDA. Section 9. A composition for inhibiting reverse transcription of ribosomal RNA (or inhibiting DNA synthesis from ribosomal RNA in DNA synthesis by reverse transcription of template RNA), comprising at least one nucleic acid polymer selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, adenylic acid polymers, thymidylic acid polymers, uridylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, deoxyguanylic acid polymers, deoxyadenylic acid polymers, deoxythymidylic acid polymers, and deoxyuridylic acid polymers. Section 9A. Use of at least one nucleic acid polymer selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, adenylic acid polymers, thymidylic acid polymers, uridylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, deoxyguanylic acid polymers, deoxyadenylic acid polymers, deoxythymidylic acid polymers, and deoxyuridylic acid polymers, for suppressing reverse transcription of ribosomal RNA (or suppressing DNA synthesis from ribosomal RNA in DNA synthesis by reverse transcription of template RNA). Section 10. A reverse transcription reaction composition for preparing a reverse transcription reaction product to be used in next-generation sequencing, comprising at least one type of nucleic acid polymer selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, adenylic acid polymers, thymidylic acid polymers, uridylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, deoxyguanylic acid polymers, deoxyadenylic acid polymers, deoxythymidylic acid polymers, and deoxyuridylic acid polymers. Section 11. The composition of item 9 or 10, or the use of item 9A, wherein the reverse transcription is carried out by RT-PCR or RT-RamDA. Section 12. The method of any one of Items 1 to 8, the composition of any one of Items 9 to 11, or the use of Item 9A, wherein the nucleic acid polymer contains, of all structural units, 60 mol% or more of structural units derived from nucleotides selected from the group consisting of inosinic acid, cytidylic acid, guanylic acid, deoxyinosinic acid, deoxycytidylic acid, deoxyguanylic acid, derivatives thereof, and salts thereof. Section 13. The method of any one of Items 1 to 8 and 12, the composition of any one of Items 9 to 12, or the use of Item 9A, wherein the nucleic acid polymer contains, of all structural units, 90 mol % or more of structural units derived from nucleotides selected from the group consisting of inosinic acid, cytidylic acid, guanylic acid, deoxyinosinic acid, deoxycytidylic acid, deoxyguanylic acid, derivatives thereof, and salts thereof. Section 14. The method according to any one of Items 1 to 8 and 12 to 13, the composition according to any one of Items 9 to 13, or the use according to Item 9A, wherein the nucleic acid polymer contains 60 mol% or more of nucleotide-derived structural units selected from the group consisting of inosinic acid, deoxyinosinic acid, derivatives thereof, and salts thereof, based on all structural units. Section 15. The method according to any one of Items 1 to 8 and 12 to 14, the composition according to any one of Items 9 to 14, or the use according to Item 9A, wherein the nucleic acid polymer contains 90 mol % or more of nucleotide-derived structural units selected from the group consisting of inosinic acid, deoxyinosinic acid, derivatives thereof, and salts thereof, based on all structural units. Section 16. 16. The method according to any one of Items 1 to 8 and 12 to 15, wherein the template RNA is RNA extracted from a cell. Section 17. A method for producing DNA by reverse transcribing template RNA in the presence of a nucleic acid polymer (but not a primer), wherein the nucleic acid polymer is at least one selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, adenylic acid polymers, thymidylic acid polymers, uridylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, deoxyguanylic acid polymers, deoxyadenylic acid polymers, deoxythymidylic acid polymers, and deoxyuridylic acid polymers. Section 18. Item 18. The method according to Item 17, wherein the template RNA is RNA extracted from a cell. Section 19. A reverse transcription composition containing an inosinic acid polymer (excluding a reverse transcription composition containing guanidine thiocyanate). Section 20. Item 20. The composition according to Item 19, wherein the concentration of the inosinic acid polymer is less than 1 ng / μL. Section 21. Item 21. The composition according to Item 19 or 20, which is used in an RT-PCR method or an RT-RamDA method. Section 22. 22. The composition according to any one of items 9 to 15 and 19 to 21, which is in the form of a kit. [Effects of the Invention]

[0007] By using the nucleic acid polymer of the present invention, reverse transcription of ribosomal RNA or DNA synthesis derived from ribosomal RNA can be inhibited. [Brief explanation of the drawings]

[0008]

Figure 1

Figure 2

[0009] <Method for suppressing DNA synthesis derived from ribosomal RNA (rRNA) using a nucleic acid polymer in a method for synthesizing DNA by reverse transcription of template RNA> 1. Nucleic acid polymer The nucleic acid polymer is preferably at least one selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, adenylic acid polymers, thymidylic acid polymers, uridylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, deoxyguanylic acid polymers, deoxyadenylic acid polymers, deoxythymidylic acid polymers, and deoxyuridylic acid polymers. Among these, from the viewpoint of more effectively inhibiting reverse transcription of rRNA or rRNA-derived DNA synthesis, at least one selected from the group consisting of inosinic acid polymers, cytidylic acid polymers, guanylic acid polymers, deoxyinosinic acid polymers, deoxycytidylic acid polymers, and deoxyguanylic acid polymers is more preferred, with inosinic acid polymers and / or deoxyinosinic acid polymers being particularly preferred. In the present invention, two or more of the above-mentioned nucleic acid polymers may be used; for example, an inosinic acid polymer and a cytidylic acid polymer may be used in combination, or a deoxyinosinic acid polymer and a cytidylic acid polymer may be used in combination. When two or more nucleic acid polymers are used, one of the nucleic acid polymers is preferably an inosinic acid polymer or a deoxyinosinic acid polymer. Each polymer will be described in detail below.

[0010] (1) Inosinic acid polymer The term "inosinic acid polymer" is used to encompass inosinic acid homopolymers (polyinosinic acid), inosinic acid copolymers, derivatives thereof, and salts thereof. Also known in the art is a double-stranded nucleic acid polymer called poly(I:C), which is an annealed inosinic acid homopolymer (polyinosinic acid) and cytidylic acid homopolymer (polycytidylic acid). In the present invention, double-stranded nucleic acid polymers in which at least one strand of the double strand is an inosinic acid polymer (e.g., polyinosinic acid), such as the double-stranded nucleic acid polymers described above, are also included in the inosinic acid polymers. An inosinic acid copolymer is a polymer having building blocks derived from inosinic acid (IMP) and building blocks derived from nucleotides other than IMP. Nucleotide-derived building blocks, such as IMP, refer to units made up of nucleotides, such as those represented by the following formula: [ka] (In the formula, R is a hydrogen atom or hydroxyl, and Base is a nucleic acid base such as inosine, cytosine, guanine, adenine, thymine, or uracil.) The nucleotides other than IMP are not particularly limited and may be ribonucleotides or deoxyribonucleotides. Examples of nucleotides other than IMP include deoxyinosinic acid (dIMP), cytidylic acid (CMP), deoxycytidylic acid (dCMP), guanylic acid (GMP), deoxyguanylic acid (dGMP), adenylic acid (AMP), deoxyadenylic acid (dAMP), thymidylic acid (TMP), deoxythymidylic acid (dTMP), uridylic acid (UMP), deoxyuridylic acid (dUMP), and combinations of two or more of these. Among these, at least one selected from the group consisting of dIMP, CMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and dIMP is more preferred. The "derivative" refers to a polymer in which the basic skeleton of the original polymer is maintained while a portion of the structure is modified. Modifications include, for example, oxidation, reduction, atom substitution, and introduction of a functional group. The "derivative" is preferably a polymer in which a functional group (e.g., a fluorine atom, a bromine atom, an iodine atom, a lower alkyl group (e.g., a C1-6 alkyl group such as a methyl group or an ethyl group), an amino group, a mercapto group, or a combination of two or more thereof) is introduced into the base moiety of at least some of the structural units of the original polymer, and / or a polymer in which the phosphate moiety is replaced with a thiophosphate moiety. As the above-mentioned "salt", alkali metal salts are preferred, and sodium salts and potassium salts are more preferred. In the inosinic acid polymer, the IMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the IMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In the inosinic acid polymer, the number of repeats of IMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of IMP-derived constitutional units may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0011] (2) Cytidylic acid polymer The term "cytidylic acid polymer" is used to encompass cytidylic acid homopolymers (polycytidylic acid), cytidylic acid copolymers, derivatives thereof, and salts thereof. Also known in the art is a double-stranded nucleic acid polymer called poly(I:C), which is an annealed inosinic acid homopolymer (polyinosinic acid) and cytidylic acid homopolymer (polycytidylic acid). In the present invention, cytidylic acid polymers also include double-stranded nucleic acid polymers in which at least one strand of the double strand is a cytidylic acid polymer (e.g., polycytidylic acid), as in the above-described double-stranded nucleic acid polymers. A cytidylic acid copolymer is a polymer having a CMP-derived building block and a building block derived from a nucleotide other than CMP. The nucleotide other than CMP is not particularly limited and may be a ribonucleotide or a deoxyribonucleotide. Examples of nucleotides other than CMP include IMP, dIMP, dCMP, GMP, dGMP, AMP, dAMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the cytidylic acid polymer, the CMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the CMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In the cytidylic acid polymer, the number of repeats of CMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more, 150 or more. The number of repeats of CMP-derived constitutional units is, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, 1,000 or less, and may be, for example, less than 100, 95 or less, or 90 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0012] (3) Guanylic acid polymer The term "guanylic acid polymer" is used to encompass guanylic acid homopolymers (polyguanylic acid), guanylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "guanylic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand of the double strand is a guanylic acid polymer (e.g., polyguanylic acid). A guanylic acid copolymer is a polymer having a GMP-derived structural unit and a structural unit derived from a nucleotide other than GMP. The nucleotide other than GMP is not particularly limited and may be a ribonucleotide or a deoxyribonucleotide. Examples of nucleotides other than GMP include IMP, dIMP, CMP, dCMP, dGMP, AMP, dAMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the guanylic acid polymer, the GMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the GMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In the guanylic acid polymer, the number of repeats of GMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of GMP-derived constitutional units is, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less, and may be, for example, less than 100, 95 or less, or 90 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0013] (4) Adenylic acid polymer The term "adenylic acid polymer" is used to encompass adenylic acid homopolymers (polyadenylic acid), adenylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, adenylic acid polymers also include double-stranded nucleic acid polymers in which at least one strand of the double strand is an adenylic acid polymer (e.g., polyadenylic acid). Adenylic acid copolymers are polymers having AMP-derived building blocks and building blocks derived from nucleotides other than AMP. The nucleotides other than AMP are not particularly limited and may be ribonucleotides or deoxyribonucleotides. Examples of nucleotides other than AMP include IMP, dIMP, CMP, dCMP, GMP, dGMP, dAMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the adenylic acid polymer, the AMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the AMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In the adenylic acid polymer, the number of repeats of AMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of AMP-derived constitutional units may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0014] (5) Thymidylic acid polymer The term "thymidylic acid polymer" is used to encompass thymidylic acid homopolymer (polythymidylic acid), thymidylic acid copolymer, derivatives thereof, and salts thereof. In the present invention, thymidylic acid polymer also includes a double-stranded nucleic acid polymer in which at least one strand of the double strand is a thymidylic acid polymer (e.g., polythymidylic acid). Thymidylic acid copolymers are polymers having a constitutional unit derived from TMP and a constitutional unit derived from a nucleotide other than TMP. The nucleotide other than TMP is not particularly limited and may be a ribonucleotide or a deoxyribonucleotide. Examples of nucleotides other than TMP include IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, dAMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the thymidylic acid polymer, the TMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the TMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In the thymidylic acid polymer, the number of repeats of TMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more, 150 or more. The number of repeats of TMP-derived constitutional units is, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, 1,000 or less, and may be, for example, less than 100, 95 or less, or 90 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0015] (6) Uridylic acid polymer The term "uridylic acid polymer" is used to encompass uridylic acid homopolymers (polyuridylic acid), uridylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "uridylic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand is a uridylic acid polymer (e.g., polyuridylic acid). A uridylic acid copolymer is a polymer having a constitutional unit derived from UMP and a constitutional unit derived from a nucleotide other than UMP. The nucleotide other than UMP is not particularly limited and may be a ribonucleotide or a deoxyribonucleotide. Examples of nucleotides other than UMP include IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, dAMP, TMP, dTMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the uridylic acid polymer, the UMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the UMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In the uridylic acid polymer, the number of repeats of UMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of UMP-derived constitutional units may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0016] (7) Deoxyinosinic acid polymer The term "deoxyinosinic acid polymer" is used to encompass deoxyinosinic acid homopolymers (polydeoxyinosinic acid), deoxyinosinic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "deoxyinosinic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand is a deoxyinosinic acid polymer (e.g., polydeoxyinosinic acid). Deoxyinosinic acid copolymers are polymers having a dIMP-derived building block and a building block derived from a nucleotide other than dIMP. The nucleotide other than dIMP is not particularly limited and may be a ribonucleotide or a deoxyribonucleotide. Examples of nucleotides other than dIMP include IMP, CMP, dCMP, GMP, dGMP, AMP, dAMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, CMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, CMP, dCMP, GMP, and dGMP is more preferred, and IMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In a deoxyinosinic acid polymer, the dIMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the dIMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., a homopolymer), or may account for, for example, 99.9 mol% or less, or 99 mol% or less. In a deoxyinosinic acid polymer, the number of repeats of dIMP-derived building blocks (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of dIMP-derived building blocks may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0017] (8) Deoxycytidylic acid polymer The term "deoxycytidylic acid polymer" is used to encompass deoxycytidylic acid homopolymers (polydeoxycytidylic acid), deoxycytidylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "deoxycytidylic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand is a deoxycytidylic acid polymer (e.g., polydeoxycytidylic acid). Deoxycytidylic acid copolymers are polymers containing dCMP-derived building blocks and building blocks derived from nucleotides other than dCMP. The nucleotides other than dCMP are not particularly limited and may be ribonucleotides or deoxyribonucleotides. Examples of nucleotides other than dCMP include IMP, dIMP, CMP, GMP, dGMP, AMP, dAMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the deoxycytidylic acid polymer, the dCMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the dCMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may account for, for example, 99.9 mol% or less, or 99 mol% or less. In a deoxycytidylic acid polymer, the number of repeats of dCMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more, 150 or more. The number of repeats of dCMP-derived constitutional units is, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, 1,000 or less, and may be, for example, less than 100, 95 or less, or 90 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0018] (9) Deoxyguanylic acid polymer The term "deoxyguanylic acid polymer" is used to encompass deoxyguanylic acid homopolymers (polydeoxyguanylic acid), deoxyguanylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "deoxyguanylic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand is a deoxyguanylic acid polymer (e.g., polydeoxyguanylic acid). Deoxyguanylic acid copolymers are polymers containing dGMP-derived building blocks and building blocks derived from nucleotides other than dGMP. The nucleotides other than dGMP are not particularly limited and may be ribonucleotides or deoxyribonucleotides. Examples of nucleotides other than dGMP include IMP, dIMP, CMP, dCMP, GMP, AMP, dAMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, and GMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In a deoxyguanylic acid polymer, the dGMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the dGMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In a deoxyguanylic acid polymer, the number of repeats of dGMP-derived constitutional units (which may also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more, 150 or more. The number of repeats of dGMP-derived constitutional units is, for example, 10,000 or less, 8,000 or less, preferably 6,500 or less, more preferably 6,000 or less, 5,000 or less, 3,000 or less, 1,000 or less, and may be, for example, less than 100, 95 or less, or 90 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0019] (10) Deoxyadenylic acid polymer The term "deoxyadenylic acid polymer" is used to encompass deoxyadenylic acid homopolymers (polydeoxyadenylic acid), deoxyadenylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "deoxyadenylic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand is a deoxyadenylic acid polymer (e.g., polydeoxyadenylic acid). Deoxyadenylic acid copolymers are polymers having a dAMP-derived building block and a building block derived from a nucleotide other than dAMP. The nucleotide other than dAMP is not particularly limited and may be a ribonucleotide or a deoxyribonucleotide. Examples of nucleotides other than dAMP include IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, TMP, dTMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, and AMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In a deoxyadenylic acid polymer, the dAMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the dAMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In a deoxyadenylic acid polymer, the number of repeats of dAMP-derived constitutional units (which may also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, even more preferably 60 or more, and even more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of dAMP-derived constitutional units may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0020] (11) Deoxythymidylic acid polymer The term "deoxythymidylic acid polymer" is used to encompass deoxythymidylic acid homopolymers (polydeoxythymidylic acid), deoxythymidylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, deoxythymidylic acid polymers also include double-stranded nucleic acid polymers in which at least one strand is a deoxythymidylic acid polymer (e.g., polydeoxythymidylic acid). Deoxythymidylic acid copolymers are polymers containing building blocks derived from dTMP and building blocks derived from nucleotides other than dTMP. The nucleotides other than dTMP are not particularly limited and may be ribonucleotides or deoxyribonucleotides. Examples of nucleotides other than dTMP include IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, dAMP, TMP, UMP, dUMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the deoxythymidylic acid polymer, the dTMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. The dTMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In a deoxythymidylic acid polymer, the number of repeats of dTMP-derived constitutional units (which may also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, preferably 60 or more, more preferably 70 or more, and may be, for example, 100 or more, 150 or more. The number of repeats of dTMP-derived constitutional units may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0021] (12) Deoxyuridylic acid polymer The term "deoxyuridylic acid polymer" is used to encompass deoxyuridylic acid homopolymers (polydeoxyuridylic acid), deoxyuridylic acid copolymers, derivatives thereof, and salts thereof. In the present invention, the term "deoxyuridylic acid polymer" also encompasses double-stranded nucleic acid polymers in which at least one strand is a deoxyuridylic acid polymer (e.g., polydeoxyuridylic acid). Deoxyuridylic acid copolymers are polymers having building blocks derived from dUMP and building blocks derived from nucleotides other than dUMP. The nucleotides other than dUMP are not particularly limited and may be ribonucleotides or deoxyribonucleotides. Examples of nucleotides other than dUMP include IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, dAMP, TMP, dTMP, UMP, and combinations of two or more of these. Among these, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, AMP, and dAMP is preferred, at least one selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, and dGMP is more preferred, and at least one selected from the group consisting of IMP and dIMP is even more preferred. The "derivatives" and "salts" mentioned above include those similar to those described above in "(1) Inosinic acid polymer." In the deoxyuridylic acid polymer, the dUMP-derived constitutional units account for, for example, more than 50 mol%, preferably 60 mol% or more, more preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of all constitutional units. Furthermore, the dUMP-derived constitutional units may account for 100 mol% of all constitutional units (i.e., homopolymer), or may be, for example, 99.9 mol% or less, or 99 mol% or less. In a deoxyuridylic acid polymer, the number of repeats of dUMP-derived constitutional units (which can also be expressed as base length, etc.) is, for example, 30 or more, preferably 40 or more, more preferably 50 or more, preferably 60 or more, more preferably 70 or more, and may be, for example, 100 or more or 150 or more. The number of repeats of dUMP-derived constitutional units may be, for example, 10,000 or less, 8,000 or less, 5,000 or less, 3,000 or less, or 1,000 or less. The repeats may be continuous or discontinuous, and are preferably continuous.

[0022] In a preferred embodiment, the nucleic acid polymer contains, for example, 60 mol% or more, preferably 65 mol% or more, more preferably 70 mol% or more, more preferably 75 mol% or more, more preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more of nucleotide-derived structural units selected from the group consisting of IMP, dIMP, CMP, dCMP, GMP, dGMP, derivatives thereof, and salts thereof, of all structural units. The upper limit is not particularly limited, and for example, these structural units may constitute 100 mol%, 99.9 mol% or less, or 99 mol% or less of all structural units of the nucleic acid polymer. In a more preferred embodiment, the nucleic acid polymer contains, for example, 60 mol % or more, preferably 65 mol % or more, more preferably 70 mol % or more, more preferably 75 mol % or more, more preferably 80 mol % or more, more preferably 85 mol % or more, more preferably 90 mol % or more, and more preferably 95 mol % or more of nucleotide-derived structural units selected from the group consisting of IMP, dIMP, derivatives thereof, and salts thereof, of all structural units. The upper limit is not particularly limited, and for example, these structural units may account for 100 mol %, 99.9 mol % or less, or 99 mol % or less of all structural units of the nucleic acid polymer.

[0023] In a preferred embodiment, the nucleic acid polymer is at least one selected from the group consisting of polyinosinic acid, polycytidylic acid, polyguanylic acid, polyadenylic acid, polythymidylic acid, polyuridylic acid, polydeoxyinosinic acid, polydeoxycytidylic acid, polydeoxyguanylic acid, polydeoxyadenylic acid, polydeoxythymidylic acid, polydeoxyuridylic acid, and salts thereof. In a more preferred embodiment, the nucleic acid polymer is at least one selected from the group consisting of polyinosinic acid, polycytidylic acid, polyguanylic acid, polyadenylic acid, polydeoxyinosinic acid, polydeoxycytidylic acid, polydeoxyguanylic acid, polydeoxyadenylic acid, and salts thereof. In a more preferred embodiment, the nucleic acid polymer is at least one selected from the group consisting of polyinosinic acid, polycytidylic acid, polyguanylic acid, polydeoxyinosinic acid, polydeoxycytidylic acid, polydeoxyguanylic acid, and salts thereof. In a more preferred embodiment, the nucleic acid polymer is at least one selected from the group consisting of polyinosinic acid, polydeoxyinosinic acid, and salts thereof.

[0024] The nucleic acid polymer preferably includes a nucleic acid polymer having a total length of 25 to 15,000 bases, preferably a nucleic acid polymer having a total length of 30 to 10,000 bases, more preferably a nucleic acid polymer having a total length of 40 to 9,000 bases, and even more preferably a nucleic acid polymer having a total length of 50 to 8,000 bases, and may be, for example, 100 to 5,000 bases. For example, the content of the nucleic acid polymer having a total length of 25 to 15,000 bases, 30 to 10,000 bases, 40 to 9,000 bases, 50 to 8,000 bases, or 100 to 5,000 bases is, for example, 70 mol% or more, preferably 80 mol% or more, more preferably 85 mol% or more, more preferably 90 mol% or more, and more preferably 95 mol% or more, relative to the total nucleic acid polymer. That is, the nucleic acid polymer may be a mixture of nucleic acid polymers of various base lengths, for example, a mixture of nucleic acid polymers substantially distributed in the range of 25 to 15,000 base lengths, preferably a mixture of nucleic acid polymers substantially distributed in the range of 30 to 10,000 base lengths, more preferably a mixture of nucleic acid polymers substantially distributed in the range of 40 to 9,000 base lengths, and even more preferably a mixture of nucleic acid polymers substantially distributed in the range of 50 to 8,000 base lengths, and for example, a mixture of nucleic acid polymers substantially distributed in the range of 100 to 5,000 base lengths can also be used. "Substantially distributed in the range of base lengths A to B" means, for example, that nucleic acid polymers of base lengths A to B account for 70 mol % or more of the total nucleic acid polymers. The nucleic acid polymer may be, for example, a mixture of nucleic acid polymers exhibiting a distribution having a peak (or average value or mode) around 30 to 3000 bases in length, a mixture of nucleic acid polymers exhibiting a distribution having a peak (or average value or mode) around 50 to 1500 bases in length, or preferably a mixture of nucleic acid polymers exhibiting a distribution having a peak (or average value or mode) around 60 to 1000 bases in length, or a mixture of nucleic acid polymers exhibiting a distribution having a peak (or average value or mode) around 70 to 800 bases in length. "Around" means that the lower limit and / or upper limit may be increased or decreased by 10%. The total length of the nucleic acid polymer is, for example, 30 bases or more, preferably 40 bases or more, more preferably 50 bases or more, even more preferably 60 bases or more, and even more preferably 70 bases or more, and may be, for example, 100 bases or more, or 150 bases or more. Thus, the total length of the nucleic acid polymer is preferably longer than the base length designed as a probe or primer. Furthermore, the total length of the nucleic acid polymer may be, for example, 10,000 bases or less, or even 8,000 bases or less, or may be, for example, 5,000 bases or less.

[0025] Nucleic acid polymers can be synthesized by any method that can be used to synthesize oligonucleotides, such as the phosphate triester method, the H-phosphonate method, or the thiophosphonate method. Natural products may be used, or commercially available products can also be used. Examples of commercially available nucleic acid polymers that can be used include potassium polyinosinate (Sigma), potassium polyadenylate (Sigma), and potassium polyinosinate (Santa Cruz).

[0026] 2. Method for synthesizing DNA by reverse transcription of template RNA The method for synthesizing DNA by reverse transcription of template RNA is not particularly limited, and various conventionally known methods can be used. The method typically includes a step of incubating a reverse transcription composition (or a reverse transcription reaction solution) containing a protein with reverse transcription activity, such as a reverse transcriptase.

[0027] 2-1. Composition for reverse transcription The reverse transcription composition contains, for example, the nucleic acid polymer, template RNA, primers, deoxyribonucleotides, and reverse transcriptase, and may optionally contain other components such as DNA polymerase. In the reverse transcription composition, the concentration of the nucleic acid polymer is, for example, 0.1 ng / μL or more, preferably 0.2 ng / μL or more, more preferably 1 ng / μL or more, and even more preferably 1.5 ng / μL or more, and may be, for example, 2 ng / μL or more, 3 ng / μL or more, 4 ng / μL or more, or 5 ng / μL or more, from the viewpoint of inhibiting rRNA reverse transcription and rRNA-derived DNA synthesis. The concentration of the nucleic acid polymer may be, for example, 50 ng / μL or less, preferably 25 ng / μL or less, more preferably 20 ng / μL or less, and may be, for example, 10 ng / μL or less, 5 ng / μL or less, 3 ng / μL or less, 2.5 ng / μL or less, 2 ng / μL or less, 1 ng / μL or less, or less than 1 ng / μL. Even when such a low concentration of nucleic acid polymer is used, the present invention can inhibit rRNA reverse transcription and rRNA-derived DNA synthesis. The content of the nucleic acid polymer is, for example, 100 to 50,000 parts by mass, preferably 1,000 to 10,000 parts by mass, and more preferably 1,000 to 5,000 parts by mass, per 100 parts by mass of the total amount of RNA (including rRNA) contained in the reverse transcription composition.

[0028] (1) Template RNA The template RNA can be any RNA, such as RNA extracted from tissues or cells (e.g., extracted RNA treated by any extraction method known in the art, such as phenol-chloroform extraction), or RNA extracted from tissues or cells and further purified (e.g., purified RNA treated by any purification method known in the art, such as ethanol precipitation or column purification). However, it is particularly preferable to use RNA extracted from cells. RNA extracted from cells is usually inevitably contaminated with rRNA in addition to the mRNA and other components that serve as the template RNA. However, because reverse transcription of rRNA is inhibited in the presence of the nucleic acid polymer, the template RNA can be specifically reverse transcribed even when RNA extracted from cells is used directly as the template RNA. In other words, the step of removing rRNA from RNA extracted from cells can be omitted. The type of cells from which RNA is extracted is not particularly limited and may be any type of cell. The number of cells can be appropriately adjusted using a cell sorter. For example, RNA extracted from a small number of cells (e.g., 1 to 100, preferably 1 to 10, more preferably 1 or 2, more preferably 1) can also be used. Methods for extracting RNA from cells typically include a step of lysing the cells using a cell lysis composition containing a cell lysis agent. Examples of cell lysing agents include surfactants and chaotropic agents. Surfactants include anionic surfactants (e.g., sodium dodecyl sulfate, sodium cholate, sodium deoxycholate), cationic surfactants (e.g., cetyltrimethylammonium bromide), nonionic surfactants (e.g., octylphenol ethoxylate, polyoxyethylene lauryl ether, polyoxyethylene stearyl ether, polyoxyethylene sorbitan monolaurate), and zwitterionic surfactants (e.g., 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid). Chaotropic agents include, for example, urea and lithium salts such as lithium perchlorate. Cell lysing agents are usually dissolved in water (preferably nuclease-free water) and used in the form of an aqueous solution. The cell lysis composition may comprise a protease (eg, protease K), an RNase inhibitor, or a combination of two or more thereof. The cell lysis composition may or may not contain the nucleic acid polymer. When RNA extracted from cells using a cell lysis composition containing the nucleic acid polymer is used as template RNA, the nucleic acid polymer does not need to be added separately to the reverse transcription composition. Details of the cell lysis composition are described in, for example, US Patent Application Publication No. 2011 / 0111463 (the entire specification of which is incorporated by reference). In the reverse transcription composition, the concentration of RNA (including rRNA) is, for example, 1 to 10,000 pg / μl, preferably 10 to 1,000 pg / μl, and more preferably 1 to 100 pg / μl.

[0029] (2) Primer Examples of primers include primers specific to template RNA, oligo-dT primers, random primers, and combinations of two or more of these. Among these, oligo-dT primers and random primers tend to anneal to any RNA more easily than primers specific to a particular sequence, and are more likely to induce DNA synthesis from rRNA. According to the present invention, even when such oligo-dT primers or random primers are used, DNA synthesis from rRNA can be effectively suppressed. From this perspective, the present invention is useful when performing a reverse transcription reaction using an oligo-dT primer and / or a random primer, and is particularly useful when performing a reverse transcription reaction using a combination of an oligo-dT primer and a random primer. The molar ratio of the oligo-dT primer to the random primer is, for example, 1:5 to 1:15, preferably 1:8 to 1:12. Examples of random primers include completely random primers and NSR (Not So Random) primers. A completely random primer is a mixture of primers with various base sequences, each of which is a completely random base sequence. A completely random primer may contain a sequence that is completely identical (or completely complementary) to an rRNA sequence. Examples of completely random primers include a completely random pentamer, a completely random hexamer, a completely random heptamer, a completely random octamer, and combinations thereof. For example, a completely random hexamer can be used to generate all possible base sequences (4 sequences) using four types of nucleotides (A, T, C, G). 6 It may also be a mixture of (types). NSR primers are fully random primers that have been stripped of primers with sequences completely complementary to rRNA sequences, such as 18S rRNA, 28S rRNA, 12S rRNA, 16S rRNA, and combinations thereof. Examples of NSR primers include fully random hexamers excluding hexamers with sequences completely complementary to rRNA sequences, and also fully random pentamers, heptamers, octamers, and other primer sets excluding those with sequences completely complementary to rRNA sequences. By using such NSR primers, it is possible to improve the sensitivity of analyzing mRNA and the like. Details of NSR primers are described in, for example, 1) Amour et al., Digital transcriptome profiling using selective hexamer priming for cDNA synthesis, Nature Methods, Vol. 6, No. 9, 2009, pp. 647-649; 2) Ozsolak et al., Digital transcriptome profiling from attomole-level RNA samples, Genome Research, Vol. 20, 2010, pp. 519-525; and 3) U.S. Patent Application Publication No. 2010 / 0029511 (the entire contents of which are incorporated herein by reference). Although NSR primers are designed so that their base sequences are not completely complementary to the base sequence of rRNA, some primers can bind to rRNA, and the reverse transcription product may contain DNA derived from rRNA in addition to DNA derived from the template RNA. However, by using the above-mentioned nucleic acid polymer, rRNA-derived DNA synthesis can be suppressed. One possible reason for this, without being bound by theory, is that the above-mentioned nucleic acid polymer competitively inhibits the binding of primers such as NSR primers to rRNA. The length of the primer is, for example, 5 bases or more, preferably 6 bases or more, from the viewpoint of annealing, and, for example, 30 bases or less, preferably 25 bases or less, more preferably 20 bases or less, from the viewpoint of synthesis. In the reverse transcription composition, the concentration of the primer is not particularly limited, but is, for example, 1 to 10 μM, preferably 2 to 6 μM, and more preferably 3 to 5 μM.

[0030] (3) Deoxyribonucleotide Deoxyribonucleotides are preferably deoxyribonucleoside triphosphates. Examples of deoxyribonucleotide triphosphates include deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxyuridine triphosphate (dUTP), derivatives thereof, and combinations of two or more thereof. Among these, mixtures of dCTP, dGTP, dATP, and dTTP, mixtures of dCTP, dGTP, dATP, and dUTP, mixtures of dCTP, dGTP, dATP, dTTP, and dUTP, etc. are preferred.

[0031] (4) Reverse transcriptase Reverse transcriptase refers to any protein (enzyme) having reverse transcription activity (RNA-dependent DNA polymerase activity). While not particularly limited, polymerases exhibiting reverse transcriptase activity are preferred. Furthermore, reverse transcriptases with low or no RNase H activity are preferred. Examples of reverse transcriptases include avian myeloblastosis virus reverse transcriptase (AMV-RT), Moloney murine leukemia virus reverse transcriptase (MMLV-RT), human immunovirus reverse transcriptase (HIV-RT), EIRV-RT, RAV2-RT, C. hydrogenogormans DNA polymerase, rTth DNA polymerase, SuperScript I, SuperScript II, mutants thereof, and derivatives thereof. Of these, MMLV-RT is preferred.

[0032] (5) DNA polymerase The reverse transcription composition may or may not include the following DNA polymerases: Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT™, DEEPVENT™, and variants thereof

[0033] (6) RNase inhibitor The reverse transcription composition may contain an RNase inhibitor. The RNase inhibitor is not particularly limited, and examples thereof include proteins derived from human placenta, rat lung, or pig liver.

[0034] (7) Additive The reverse transcription composition may contain additives, such as buffers, salts, and combinations of two or more thereof. Examples of buffers include Tris, Tricine, Bis-Tricine, Hepes, Mops, Tes, Taps, Pipes, Caps, and combinations of two or more of these. Buffers are usually dissolved in water (preferably nuclease-free water) and used in the form of an aqueous solution. Examples of salts include chlorides (e.g., lithium chloride, sodium chloride, potassium chloride, magnesium chloride, manganese chloride), acetates (e.g., lithium acetate, sodium acetate, potassium acetate, magnesium acetate, manganese acetate), sulfates (e.g., potassium sulfate, magnesium sulfate, manganese sulfate), and combinations of two or more thereof.

[0035] 2-2. Incubation The incubation conditions for the reverse transcription composition are not particularly limited as long as reverse transcription of the template RNA proceeds, and any conditions known in the art can be used. The incubation temperature is, for example, 30 to 65°C, preferably 35 to 60°C. The incubation time is, for example, 5 to 120 minutes, preferably 10 to 60 minutes.

[0036] 2-3. When carried out in an amplification reverse transcription method (also referred to as RT-RamDA method) in which reverse transcription of template RNA amplifies cDNA using RNA as a template The RT-RamDA method is a nucleic acid amplification method that includes incubating a mixture containing template RNA, primers, DNA strand-specific RNA:DNA hybrid strand degrading enzyme, RNase H minus reverse transcriptase, and a substrate. In the RT-RamDA method, a complementary DNA (cDNA) strand of the template RNA is synthesized using the RNA-dependent DNA polymerase activity of the RNase H minus reverse transcriptase. The cDNA strand of the RNA-cDNA hybrid strand is then randomly cleaved by the DNA strand-specific RNA:DNA hybrid strand degrading enzyme. Starting from the cleavage site, the strand displacement activity of the RNase H minus reverse transcriptase removes the 3' end of the cDNA strand from the RNA, and a new cDNA strand is synthesized at the site removed by the RNase H minus reverse transcriptase. Details of the RT-RamDA method are described in U.S. Patent Application Publication No. 2017 / 0275685 (incorporated herein by reference in its entirety), among other places.

[0037] When reverse transcription of template RNA is performed in the RT-RamDA method, the reverse transcription composition contains a DNA strand-specific RNA:DNA hybrid strand-degrading enzyme.

[0038] The DNA strand-specific RNA:DNA hybrid strand-cleaving enzyme is preferably an enzyme that has the activity of cleaving the DNA strand in an RNA-DNA hybrid strand, and examples of such enzymes that can be used include double-strand-specific DNases and non-specific DNases.

[0039] The double-strand-specific degrading enzyme (also called double-strand-specific nuclease; DSN) can be derived from a prokaryote or a eukaryote, but preferably, a double-strand-specific DNA degrading enzyme derived from crustaceans or a modified form thereof can be used. Specific examples include the following: Solenocera melantho (shrimp shrimp) DNase Penaeus japonicus (prawn) DNase Paralithodes camtschaticus (red king crab) DSN Pandalus borealis (sea shrimp) dsDNase Chionoecetes opilio (snow crab) DSN Other DSN homologs The double-strand-specific DNase is preferably an enzyme that has DNA degradation activity even at temperatures below 60° C. Among the above, shrimp-derived double-strand-specific DNase or a modified form thereof is preferred. Commercially available double-strand-specific DNases can be used, including dsDNase (ArcticZymes), H1-dsDNase (ArcticZymes), dsDNase (Thermo Scientific), Shrimp DNase, Recombinant (Affymetrix), Atlantis dsDNase (Zymo Research), and Thermolabile Nuclease (Roche).

[0040] Examples of nonspecific DNases include enzymes that have the activity to cleave the DNA strand of an RNA-DNA hybrid chain, but have substantially no activity to cleave the RNA strand of an RNA-DNA hybrid chain or single-stranded RNA, and preferably have a lower activity to cleave single-stranded DNA compared to the activity to cleave the DNA strand of an RNA-DNA hybrid chain. Nonspecific DNases are preferably enzymes that have DNA degradation activity even at temperatures below 60°C. Commercially available nonspecific DNases, such as DNase I (manufactured by Thermo Fisher Scientific), can be used. Enzymes derived from prokaryotes or eukaryotes can be used as nonspecific DNases. Preferably, mammalian nonspecific DNases or modified versions thereof, more preferably bovine nonspecific DNases or modified versions thereof, can be used.

[0041] The above-mentioned variant refers to an enzyme obtained by modifying a naturally occurring amino acid sequence. Specifically, it refers to an enzyme consisting of an amino acid sequence that has 80% or more (preferably 90% or more, more preferably 95% or more) sequence identity with a naturally occurring amino acid sequence, as well as an enzyme consisting of an amino acid sequence in which one or several (for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3) amino acids have been deleted, substituted, and / or added in the naturally occurring amino acid sequence.

[0042] When reverse transcription of template RNA is performed by the RT-RamDA method, the reverse transcription composition may contain a single-stranded DNA binding protein. Single-stranded DNA binding proteins are typically used in conjunction with DNA strand-specific RNA:DNA hybrid strand-resolving enzymes. Examples of single-stranded DNA binding proteins include T4 gene 32 protein, RecA, SSB (single-stranded DNA binding protein), and combinations of two or more of these.

[0043] When reverse transcription of template RNA is carried out by the RT-RamDA method, the reverse transcription composition may be incubated under isothermal conditions or under thermocycling conditions.

[0044] (1) Isothermal condition When incubation is performed under isothermal conditions, it can be performed at a predetermined temperature, for example, between 25°C and less than 50°C, preferably between 30 and 45°C, more preferably between 35 and 40°C, for example, 37°C, for a predetermined time (for example, 5 to 180 minutes, preferably 10 to 150 minutes). Incubation at a predetermined temperature between 25°C and less than 50°C may be carried out in two or more stages. For example, incubation may be performed at a predetermined temperature between 25°C and less than 30°C for 5 to 15 minutes, then at a predetermined temperature between 30°C and less than 35°C for 5 to 15 minutes, and then at a predetermined temperature between 35°C and less than 50°C for a predetermined time (e.g., 5 to 60 minutes). After incubation at a predetermined temperature between 25°C and less than 50°C, incubation may be performed at a predetermined temperature between 50°C and less than 100°C, for example. Incubation at a predetermined temperature between 50°C and less than 100°C may be performed in two or more stages. For example, incubation may be performed at a predetermined temperature between 50°C and less than 80°C for 5 to 15 minutes, followed by incubation at a predetermined temperature between 80°C and 90°C for 5 to 15 minutes.

[0045] (2) Thermal cycle condition When incubation is performed under thermal cycling conditions, for example, a predetermined temperature T1 (e.g., 25°C) between 20°C and less than 30°C and a predetermined temperature T2 (e.g., 37°C) between 30 and 45°C may be combined, with one cycle consisting of a predetermined time at T1 (e.g., 1 to 3 minutes, e.g., 2 minutes) and a predetermined time at T2 (e.g., 1 to 3 minutes, e.g., 2 minutes), and this cycle may be repeated preferably 10 to 40 times, more preferably 15 to 35 times. Prior to the thermal cycling, the sample may be incubated at a predetermined temperature between 25°C and less than 30°C for a predetermined time (e.g., 5 to 15 minutes), then at a predetermined temperature between 30°C and less than 35°C for a predetermined time (e.g., 5 to 15 minutes), and then at a predetermined temperature between 35°C and less than 50°C for a predetermined time (e.g., 1 to 5 minutes). After the thermal cycle, the mixture may be incubated at a predetermined temperature between 50°C and 80°C for a predetermined time (e.g., 5 to 15 minutes), and then at a predetermined temperature between 80°C and 90°C for a predetermined time (e.g., 5 to 15 minutes).

[0046] 2-4. When reverse transcription of template RNA is carried out in RT-PCR method When reverse transcription of template RNA is performed by RT-PCR, the reverse transcription composition can be incubated under the conditions described in 2-2, and the reverse transcriptase may then be inactivated as necessary. The method for inactivating reverse transcription is not particularly limited, but may be, for example, incubation at 90 to 100°C for a predetermined time (e.g., 1 to 10 minutes).

[0047] When reverse transcription of template RNA is performed in RT-PCR, the method for synthesizing DNA by reverse transcription of template RNA includes a step of amplifying the DNA contained in the incubated reverse transcription composition (also referred to as the reverse transcription product). The step of amplifying the DNA typically includes a step of incubating the DNA amplification composition under thermal cycling conditions.

[0048] The composition for DNA amplification may contain the reverse transcription product as is, or may contain the reverse transcription product diluted with water, preferably nuclease-free water, for example, so that the mass of the reverse transcription product becomes 1 / 20 to 1 / 30. The DNA amplification composition contains, in addition to the reverse transcription product, for example, primers, deoxyribonucleotides, and DNA polymerase. Furthermore, if the reverse transcription composition described in 2-1 above contains components necessary for DNA amplification reactions, such as DNA polymerase, the reverse transcription composition can be used as a DNA amplification composition as is, and the two compositions can be referred to interchangeably. As the primers, primers (forward primer, reverse primer) specific to DNA (including DNA reverse transcribed from RNA) are preferred. The deoxyribonucleotides and DNA polymerases that can be used are the same as those described in 2-1.(3) and (5) above. The composition for DNA amplification may contain an anti-DNA polymerase antibody, a reaction buffer, a metal ion (such as magnesium ion), a fluorescent dye, a fluorescently labeled probe, or a combination of two or more of these.

[0049] Incubation under thermal cycle conditions may be performed by repeating, for example, 10 to 50 cycles, more preferably 15 to 40 cycles, with one cycle consisting of a predetermined temperature between 80°C and less than 100°C for a predetermined time (e.g., 10 to 30 seconds) and a predetermined temperature between 50°C and 70°C for a predetermined time (e.g., 30 seconds to 2 minutes).

[0050] 3. Method for suppressing DNA synthesis derived from rRNA using a nucleic acid polymer The method for inhibiting rRNA-derived DNA synthesis using the nucleic acid polymer typically includes a step of reverse transcribing a template RNA in the presence of the nucleic acid polymer. This step specifically reverse-transcribes the template RNA, allowing specific synthesis of DNA derived from the template RNA and inhibiting rRNA-derived DNA synthesis. The rRNA is preferably 18S rRNA, 28S rRNA, 12S rRNA, 16S rRNA, or a combination of two or more of these. The conditions for reverse transcription are as described above in 2-1 to 2-4.

[0051] <Nucleic acid polymer-containing composition for suppressing reverse transcription of rRNA (or suppressing DNA synthesis derived from rRNA), use of a nucleic acid polymer for suppressing reverse transcription of rRNA (or suppressing DNA synthesis derived from rRNA)> A composition for inhibiting rRNA reverse transcription preferably contains the above-mentioned nucleic acid polymer. Furthermore, it is preferable to use the above-mentioned nucleic acid polymer to inhibit rRNA reverse transcription. The reverse transcription of rRNA is not particularly limited as long as it is reverse transcription of an RNA sample containing at least rRNA, and may be reverse transcription of an RNA sample containing template RNA and rRNA. The RNA sample containing template RNA and rRNA may be RNA extracted from cells or tissues, or RNA further purified after extraction from cells or tissues, but is preferably RNA extracted from cells. The RNA may be the same as that described in 2-1.(1) above. The conditions for reverse transcription may be, for example, the same as those described in 2-2. to 2-4. above. The composition for inhibiting reverse transcription of rRNA may contain, in addition to the nucleic acid polymer, components such as those described in 2-1, 2-2, and 2-3 above (particularly components necessary for reverse transcription). The composition for inhibiting reverse transcription of rRNA may be in the form of a mixture of each component, or may be in the form of a kit containing each component separately.

[0052] <Reverse transcription reaction composition for preparing a reverse transcription reaction product used in next-generation sequencing> A reverse transcription reaction composition for preparing a reverse transcription reaction product for next-generation sequencing (NGS analysis, also known as next-generation sequencer analysis) preferably contains the above-described nucleic acid polymer. Next-generation sequencing typically refers to a sequencing technology that can simultaneously perform a huge number of sequencing reactions, ranging from millions to billions of sequences. Examples of next-generation sequencing include parallel sequence analysis methods using amplification techniques such as emulsion PCR and bridge PCR, or highly sensitive detection techniques such as single-molecule observation. Devices (sequencers) used for next-generation sequencing include, but are not limited to, MiSeq, HiSeq, and NovaSeq (Illumina); Genetic Analyzer V2.0, Ion Proton (Thermo Fisher Scientific); MinION and PromethION (Nanopore). Next-generation sequencing is described, for example, in U.S. Patent Application Publication No. 2014 / 178438 (incorporated herein by reference in its entirety). According to the present invention, it is possible to effectively suppress reverse transcription products from rRNA, which can become noise in large-scale gene expression analyses such as next-generation sequencing. In NGS analysis, the number of reads obtained per analysis is often limited, making it important to reduce unnecessary rRNA-derived DNA reads. According to the present invention, it is possible to reduce DNA reads derived from rRNA not intended for analysis, thereby increasing the number of useful reads (number of reads other than rRNA: amount of genetic information), which is advantageous. It may also lead to a reduction in the number of NGS analyses, which is cost-effective. Therefore, reverse transcription products from RNA samples that may contain rRNA prepared according to the present invention are suitable for next-generation sequencing. The RNA sample that may contain rRNA may be the reverse transcription of an RNA sample containing template RNA and rRNA. The RNA sample containing template RNA and rRNA may be RNA extracted from cells or tissues, or RNA further purified after extraction from cells or tissues, but is preferably RNA extracted from cells. The RNA may be the same as that described in 2-1.(1) above. The conditions for reverse transcription may be, for example, the same as those described in 2-2. to 2-4. above. The reverse transcription reaction composition for preparing a reverse transcription reaction product to be used in next-generation sequencing may contain, in addition to the nucleic acid polymer, the components described in 2-1, 2-2, and 2-3 above (particularly, the components necessary for reverse transcription). The reverse transcription reaction composition for preparing a reverse transcription reaction product to be used in next-generation sequencing may be in the form of a mixture of each component, or may be in the form of a kit containing each component separately. [Example]

[0053] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0054] Example 1: Suppression of DNA synthesis derived from rRNA by inosinic acid polymer in RT-PCR method (10 pg of purified RNA) In this example, the following test was carried out in order to confirm the amount of DNA synthesis derived from ribosomal RNA by inosinic acid polymers in the RT-PCR method. Polyinosinic acid potassium salt (potassium salt of inosinic acid homopolymer (also called poly I)) was added to the sample solution as an inosinic acid polymer, and single-stranded cDNA was synthesized by reverse transcription. Subsequently, quantitative polymerase chain reaction (qPCR) was used to compare the amount of DNA synthesis derived from ribosomal RNA in the presence or absence of polyinosinic acid potassium salt. Specifically, the following method was used. The nucleic acid fragment sample used in this example was 10 pg of RNA purified from NIH3T3 cells using an RNeasy Mini Kit (Qiagen). The components contained in the sample solution used in this example for the reverse transcription reaction of 10 pg of RNA and their final concentrations in the sample solution are shown in Table 1 below. [Table 1] *: The base length distribution of polyinosinic acid potassium salt was analyzed using the reagent kit DNA-12000 (Shimadzu Corporation) with a microchip electrophoresis device (Shimadzu Corporation). As shown in Figure 1, the peak base length of polyinosinic acid potassium salt was approximately 450 bases, and it was found to contain polyinosinic acid with a length of approximately 150 to 8000 bases (reference value).

[0055] The purified RNA was added to the above composition to perform reverse transcription using a sample solution. This reaction was carried out at 37°C for 10 minutes, followed by 95°C for 5 minutes to synthesize single-stranded cDNA. The DNA amounts were then compared using the following quantitative polymerase chain reaction (qPCR). The reverse transcription reaction solution was diluted with nuclease-free water (Qiagen), and 1 / 25 of the volume was used for the qPCR reaction. qPCR was performed using StepOne Plus (Life Technologies) under the following conditions. The qPCR reaction solution [20 μl (THUNDERBIRD™ SYBR qPCR Mix (TOYOBO)), 6 pmol forward primer, 6 pmol reverse primer, 2 μl diluted reverse transcription reaction solution, nuclease-free water] was treated at 95°C for 1 minute to activate the enzyme, and then 40 cycles of denaturation at 95°C for 15 seconds and extension at 60°C for 1 minute were performed.

[0056] Melting curve analysis was performed at 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. The target genes used were the messenger RNAs (mRNAs) βactin and Hprt-1, the long non-coding RNA (lncRNA) Neat-1, and the 18S ribosomal RNA Rn18s.

[0057] The primers for each gene are as follows: β-actin (mRNA) Forward primer: CAGCTGAGAGGGAAATCGTG (SEQ ID NO: 1) Reverse primer: CGTTGCCAATAGTGATGACC (SEQ ID NO: 2) Neat-1 (lncRNA) Forward primer: GATCGGGACCCCAGTGACCT (SEQ ID NO: 3) Reverse primer: AGCTTTCCCCAACACCCACA (SEQ ID NO: 4) Hprt-1(mRNA) Forward primer: TCAGTCAACGGGGGACATAAA (SEQ ID NO: 5) Reverse primer: GGGGCTGTACTGCTTAACCAG (SEQ ID NO: 6) Rn18s (ribosomal RNA) Forward primer: CTCAACACGGGAAACCTCAC (SEQ ID NO: 7) Reverse primer: CGCTCCACCAACTAAGAACG (SEQ ID NO: 8)

[0058] The results are shown in Table 2. [Table 2] The mean Ct value under the condition where polyinosinic acid potassium salt was added was subtracted from the mean Ct value under the condition where polyinosinic acid potassium salt was not added, and the value was defined as ΔCt.

[0059] Compared to the difference in Ct values (difference in DNA synthesis amount derived from mRNA and lncRNA) between the presence and absence of polyinosinic acid potassium salt for the mRNAs βactin and Hprt-1, and the lncRNA Neat-1, the difference in Ct values between the presence and absence of polyinosinic acid potassium salt for the ribosomal RNA Rn18s was greater. This indicates that the Ct value of Rn18s is slower (larger) with the addition of polyinosinic acid potassium salt than for other RNAs, and that the amount of DNA synthesis derived from ribosomal RNA is reduced. Therefore, it was confirmed that inosinic acid polymers suppress DNA synthesis from ribosomal RNA, the reverse transcription of which is usually undesirable.

[0060] Example 2: Suppression of DNA synthesis derived from ribosomal RNA by inosinic acid polymer in RT-RamDA method (10 pg of purified RNA) In this example, the following test was carried out in order to confirm the amount of DNA synthesis derived from ribosomal RNA by inosinic acid polymers in the RT-RamDA method. Polyinosinic acid potassium salt was added to the sample solution, and single-stranded cDNA was synthesized using the RT-RamDA method, generating double-stranded cDNA of the Klenow fragment. Libraries were then prepared using Nexteta (Illumina), and next-generation sequencing (NGS) was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 (150 cycles) (Illumina) according to the manufacturer's instructions. Analysis was performed using Illumina Basespace TopHat (Illumina), and the proportion of ribosomal RNA in the reads was calculated according to the manufacturer's instructions. Specifically, the following procedure was used. The nucleic acid fragment sample used in this example was 10 pg of RNA purified from NIH3T3 cells using an RNeasy Mini Kit (Qiagen). The components contained in the sample solution used in this example to subject 10 pg of this RNA to the RT-RamDA method and their final concentrations in the sample solution are shown in Table 3. NSR primers (hexamers) were synthesized using Sigma custom oligos and mixed to achieve the primer composition described in Ozsolak et al., Digital transcriptome profiling from attomole-level RNA samples, Genome Research, Vol. 20, 2010, pp. 519-525. [Table 3]

[0061] The purified RNA was added to the above-mentioned sample solution, and the RT-RamDA assay was carried out at 25°C for 10 minutes, 30°C for 10 minutes, 37°C for 30 minutes, 50°C for 5 minutes, and 85°C for 5 minutes. The results are shown in Table 4. [Table 4] The "Number of Reads" in Table 4 is the total number of reads obtained. %Total Aligned indicates the percentage of reads that matched the reference genome (UCSC mm10), including ribosomal RNA, among the total reads, and %Abundant indicates the percentage of ribosomal RNA. %Abundant / %Total Aligned indicates the percentage of ribosomal RNA among the reads that matched the reference genome.

[0062] When polyinosinic acid potassium salt was added, the %Abundant / %Total Aligned ratio decreased compared to when it was not added, and the proportion of ribosomal RNA decreased. Therefore, it was confirmed that inosinic acid polymers inhibited ribosomal RNA-derived DNA synthesis in the RT-RamDA method.

[0063] Example 3: Suppression of DNA synthesis derived from ribosomal RNA by inosinic acid polymer in RT-RamDA method (NIH3T3 cells) In this example, the following test was carried out in order to confirm the amount of DNA synthesis derived from ribosomal RNA by inosinic acid polymers in the RamDA reaction. Polyinosinic acid potassium salt was added to the sample solution, and single-stranded cDNA was synthesized using the RT-RamDA method, generating double-stranded cDNA of the Klenow fragment. Libraries were then prepared using Nexteta (Illumina), and next-generation sequencing (NGS) was performed on a MiSeq (Illumina) using the MiSeq Reagent Kit v3 (150 cycles) (Illumina) according to the manufacturer's instructions. Analysis was performed using Illumina Basespace TopHat (Illumina), and the proportion of ribosomal RNA in the reads was calculated according to the manufacturer's instructions. Specifically, the following procedure was used. The cell sample used in this example was prepared with the following composition. NIH3T3 cells were dissociated into single cells using trypsin solution (Nacalai Tesque) at 37°C for 2 minutes. After dissociation, the solution was immediately replaced with PBS(-) to stop the reaction. Using a FACS Melody cell sorter (BD), PI-negative cells, a fluorescent marker dye for dead cells, were separated into a live cell fraction, and 40 cells were separated from this fraction into 3 μl of the lysis buffer shown below. After separation, the cells were immediately centrifuged and stored at -80°C. When using in the reverse transcription reaction, 117 μl of lysis buffer was added after thawing, and 3 μl of the 40-fold diluted cell lysate was used as a single cell lysate. Lysis Buffer 0.1mg / ml protease K 0.5% Triton X-100 0 or 5 ng / ul Polyinosinic acid potassium salt used in Example 1 1U / ul RNase inhibitor (Toyobo Co., Ltd., RNase Inhibitor)

[0064] To subject this single-cell lysate to the RT-RamDA method, the components contained in the sample solution used in this example and their final concentrations in the sample solution are shown in Table 5 below. [Table 5]

[0065] Three microliters of one cell lysate was heat-treated at 70°C for two minutes, and then added to 6 μl of the sample solution with the above composition, followed by the RT-RamDA method (the final concentration of polyinosinic acid potassium salt in the reaction solution was 0 or 1.67 ng / μl). The reaction was carried out at 25°C for 10 minutes, 30°C for 10 minutes, 37°C for 30 minutes, 50°C for 5 minutes, and 85°C for 5 minutes. The results are shown in Table 6. [Table 6] When polyinosinic acid potassium salt was added, the %Abundant / %Total Aligned ratio decreased compared to when it was not added, and the proportion of ribosomal RNA decreased. Therefore, by including polyinosinic acid potassium salt in the cell lysate, polyinosinic acid potassium salt is also added to the sample solution for the RT-RamDA method, and it was confirmed that polyinosinic acid potassium salt inhibits DNA synthesis derived from ribosomal RNA.

[0066] Example 4: Suppression of DNA synthesis derived from ribosomal RNA by inosinic acid polymer, deoxyguanylic acid polymer, adenylic acid polymer, and deoxythymidylic acid polymer in RT-PCR method (NIH3T3 cells) In this example, the following test was performed to confirm the amount of DNA synthesis derived from ribosomal RNA using four types of nucleic acid polymers (polyinosinic acid potassium salt as an inosinic acid polymer; polydeoxyguanylic acid as a deoxyguanylic acid polymer; polyadenylic acid potassium salt as an adenylic acid polymer; and polydeoxythymidylic acid as a deoxythymidylic acid polymer) in the RT-PCR method. Nucleic acid polymers were added to the cell lysate, and single-stranded cDNA was synthesized by reverse transcription. The amount of DNA synthesized was then compared using quantitative polymerase chain reaction (qPCR). Specifically, this was done using the following method. The cell sample used in this example was prepared with the following composition. NIH3T3 cells were dissociated into single cells using trypsin solution (Nacalai Tesque) at 37°C for 2 minutes. After dissociation, the solution was immediately replaced with PBS(-) to stop the reaction. PI-negative cells, a fluorescent marker dye for dead cells, were separated into live cell fractions using a FACS Melody cell sorter (BD), and 10 cells were separated from this fraction into 3 μl of the lysis buffer shown below. After separation, the cells were immediately centrifuged and stored at -80°C. When using in the reverse transcription reaction, the cells were thawed and heat-treated, and 3 μl was used as the 10 cell lysate. Lysis Buffer 0.1mg / ml protease K 0.1% Nonidet-40 1U / μl RNase inhibitor (Toyobo Co., Ltd., RNase Inhibitor)

[0067] The components contained in the sample solution used in this example for the reverse transcription reaction of this cell lysate and their final concentrations in the sample solution are shown in Table 7 below. [Table 7] *: The base length distribution of potassium polyadenylate was analyzed using a microchip electrophoresis device (Shimadzu Corporation) with the DNA-12000 reagent kit. As shown in Figure 2, potassium polyadenylate had a peak base length of approximately 300 bases and contained polyadenylic acid of approximately 100 to 5000 bases (reference value).

[0068] Three microliters of cell lysate from 10 cells was heat-treated at 70°C for 2 minutes, and then added to the above composition for reverse transcription. This reaction was carried out at 37°C for 10 minutes, followed by another reaction at 95°C for 5 minutes to synthesize single-stranded cDNA. The amounts of DNA amplified were then compared using the following quantitative polymerase chain reaction (qPCR). The reverse transcription reaction solution was diluted with nuclease-free water (Qiagen), and 1 / 25 of the volume was used in the qPCR reaction. qPCR was performed using StepOne Plus (Life Technologies) under the following conditions: 20 μl of the qPCR reaction solution (THUNDERBIRD™ SYBR qPCR Mix (TOYOBO), 6 pmol forward primer, 6 pmol reverse primer, 2 μl diluted reverse transcription reaction solution, nuclease-free water) was activated at 95°C for 1 minute, followed by 40 cycles of denaturation at 95°C for 15 seconds and extension at 60°C for 1 minute. Melting curve analysis was performed at 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. β-actin (mRNA) and Rn18s (18S ribosomal RNA) were used as target genes. The results are shown in Table 8. [Table 8] ΔCt was calculated by subtracting the average Ct value under the condition where each nucleic acid polymer was not added from the average Ct value under the condition where each nucleic acid polymer was added.

[0069] The difference in Ct values (difference in mRNA-derived DNA synthesis) between the presence and absence of nucleic acid polymers for the ribosomal RNA Rn18S was greater than the difference in Ct values (difference in mRNA-derived DNA synthesis) between the presence and absence of nucleic acid polymers for the mRNA β-actin. This indicates that the addition of polyinosinic acid potassium salt or polydeoxyguanylic acid significantly delayed (increased) the Ct value for Rn18S compared to other RNAs, demonstrating that rRNA-derived DNA synthesis is suppressed. Furthermore, increasing the amount of polyinosinic acid potassium salt or polydeoxyguanylic acid further inhibited rRNA-derived DNA synthesis. Polyadenylic acid potassium salt also delayed (increased) the Ct value, demonstrating inhibition of rRNA-derived DNA synthesis, although this was somewhat less than with polyinosinic acid potassium salt or polydeoxyguanylic acid. Polydeoxythymidylic acid, while showing a smaller delay in Ct values compared to other nucleic acid polymers, also slightly delayed the Ct value. Therefore, it was confirmed that the addition of nucleic acid polymers suppresses DNA synthesis from ribosomal RNA, which is usually not desired for reverse transcription.

Claims

1. A method for synthesizing DNA by reverse transcription of a template RNA (excluding reverse transcription in the presence of a DNA-dependent DNA polymerase), comprising inhibiting ribosomal RNA-derived DNA synthesis using at least one nucleic acid polymer selected from the group consisting of an inosinic acid polymer, an adenylic acid polymer, and a deoxyguanylic acid polymer, the method comprising: The inosinic acid polymer is an inosinic acid polymer or a salt thereof, in which inosinic acid-derived constitutional units account for 90 mol% or more of all constitutional units and the number of consecutive repeats of inosinic acid-derived constitutional units is 70 or more; the adenylic acid polymer is an adenylic acid polymer or a salt thereof, in which adenylic acid-derived constitutional units account for 90 mol % or more of all constitutional units and the number of consecutive repeats of adenylic acid-derived constitutional units is 70 or more; The deoxyguanylic acid polymer is a deoxyguanylic acid polymer or a salt thereof, in which deoxyguanylic acid-derived structural units account for 90 mol % or more of all structural units and the number of consecutive repeats of deoxyguanylic acid-derived structural units is 70 or more.

2. 2. The method of claim 1, wherein the nucleic acid polymer is at least one homopolymer selected from the group consisting of polyinosinic acid, polyadenylic acid, polydeoxyguanylic acid, and salts thereof.

3. The method according to claim 1 or 2, wherein the nucleic acid polymer is at least one homopolymer selected from the group consisting of polyinosinic acid and salts thereof.

4. The method according to any one of claims 1 to 3, wherein the nucleic acid polymer comprises a nucleic acid polymer having a total length of 70 to 10,000 bases.

5. The method according to any one of claims 1 to 4, wherein the reverse transcription is carried out using random primers.

6. The method of claim 5, wherein the base sequence of the random primer is not completely complementary to the base sequence of the ribosomal RNA.

7. The method according to any one of claims 1 to 6, wherein the reverse transcription is carried out by an RT-PCR method or an RT-RamDA method.

8. A composition for inhibiting reverse transcription of ribosomal RNA (excluding reverse transcription in the presence of a DNA-dependent DNA polymerase), comprising at least one nucleic acid polymer selected from the group consisting of an inosinic acid polymer, an adenylic acid polymer, and a deoxyguanylic acid polymer, The inosinic acid polymer is an inosinic acid polymer or a salt thereof, in which inosinic acid-derived constitutional units account for 90 mol% or more of all constitutional units and the number of consecutive repeats of inosinic acid-derived constitutional units is 70 or more; the adenylic acid polymer is an adenylic acid polymer or a salt thereof, in which adenylic acid-derived constitutional units account for 90 mol % or more of all constitutional units and the number of consecutive repeats of adenylic acid-derived constitutional units is 70 or more; The composition is a deoxyguanylic acid polymer or a salt thereof, in which structural units derived from deoxyguanylic acid account for 90 mol% or more of all structural units and the number of consecutive repeats of structural units derived from deoxyguanylic acid is 70 or more.

9. A reverse transcription reaction composition for preparing a reverse transcription reaction product to be used in next-generation sequencing, comprising at least one nucleic acid polymer selected from the group consisting of an inosinic acid polymer, an adenylic acid polymer, and a deoxyguanylic acid polymer, The inosinic acid polymer is an inosinic acid polymer or a salt thereof, in which inosinic acid-derived constitutional units account for 90 mol% or more of all constitutional units and the number of consecutive repeats of inosinic acid-derived constitutional units is 70 or more; the adenylic acid polymer is an adenylic acid polymer or a salt thereof, in which adenylic acid-derived constitutional units account for 90 mol % or more of all constitutional units and the number of consecutive repeats of adenylic acid-derived constitutional units is 70 or more; The deoxyguanylic acid polymer is a deoxyguanylic acid polymer or a salt thereof, in which deoxyguanylic acid-derived structural units account for 90 mol % or more of all structural units and the number of consecutive repeats of deoxyguanylic acid-derived structural units is 70 or more (excluding reverse transcription reaction compositions containing a DNA-dependent DNA polymerase).

10. The composition according to claim 8 or 9, wherein the reverse transcription is carried out in an RT-PCR method or an RT-RamDA method.

Citation Information

Patent Citations

  • Inhibition reduction in one-step RT-PCR

    JP2011504754A

  • Method for nucleic acid amplification

    WO2016052619A1