Treatment of age-related disorders

NK cell activators or activated NK cells effectively target senescent cells to treat age-related disorders, improving skin and hair while managing obesity.

JP7773577B2Active Publication Date: 2025-11-19IMMUNITYBIO INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2024031433
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-07-31
Filing Date
2024-03-01
Publication Date
2025-11-19
Estimated Expiration
2039-08-30

AI Technical Summary

Technical Problem

The accumulation of senescent cells contributes to age-related disorders and conditions, promoting aging and chronic inflammatory responses, and existing treatments are inadequate for effectively targeting these cells.

Method used

Administration of natural killer (NK) cell activators or activated NK cells to reduce the number of senescent cells and treat age-related diseases, improve skin and hair texture, and assist in obesity treatment.

Benefits of technology

Reduces senescent cell numbers, ameliorates age-related diseases, enhances skin and hair quality, and aids in obesity management over time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007773577000104
    Figure 0007773577000104
  • Figure 0007773577000105
    Figure 0007773577000105
  • Figure 0007773577000106
    Figure 0007773577000106
Patent Text Reader

Abstract

To provide a method for treating an aging-related disease or state in a subject who needs treatment of an aging-related disease or state.SOLUTION: Provided are a method for treating an aging-related disease or state in a subject who needs treatment of an aging-related disease or state, a method for killing aged cells or reducing the number of aged cells in a subject who needs killing of aged cells or reduction of the number of aged cells, a method for improving a texture and / or an external appearance of skin and / or hair in a subject who needs improvement of a texture and / or an external appearance of skin and / or hair, and a method for assisting obesity treatment in a subject who needs assistance of obesity treatment, which include administering a treatment effective amount of one or more natural killer (NK) cell activators and / or a treatment effective number of activated NK cells to the subject.SELECTED DRAWING: Figure 107
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is incorporated herein by reference in its entirety: U.S. Patent Application No. 62 / 816,683, filed March 11, 2019; U.S. Patent Application No. 62 / 725,038, filed August 30, 2018; U.S. Patent Application No. 62 / 817,244, filed March 12, 2019; U.S. Patent Application No. 62 / 881,039, filed July 31, 2019; U.S. Patent Application No. 62 / 724,969, filed August 30, 2018; U.S. Patent Application No. 62 / 817,230, filed March 12, 2019; This application claims priority to U.S. Patent Application No. 62 / 725,043 filed on August 30, 2018, U.S. Patent Application No. 62 / 725,010 filed on August 30, 2018, U.S. Patent Application No. 62 / 749,007 filed on October 22, 2018, U.S. Patent Application No. 62 / 746,832 filed on October 17, 2018, U.S. Patent Application No. 62 / 749,506 filed on October 23, 2018, U.S. Patent Application No. 62 / 817,241 filed on March 12, 2019, and U.S. Patent Application No. 62 / 881,088 filed on July 31, 2019.

[0002] Technical Field The present disclosure relates to the fields of immunology and cell biology. [Background technology]

[0003] background Senescence is a form of irreversible growth arrest accompanied by phenotypic changes, resistance to apoptosis, and activation of damage-sensing signaling pathways. Cellular senescence was first described in cultured human fibroblasts, which lost the ability to proliferate and reached permanent arrest after approximately 50 population doublings (referred to as the Hayflick limit). Senescence is considered a stress response that can be induced by a wide range of endogenous and exogenous insults, including oxidative and genotoxic stress, DNA damage, telomere attrition, oncogenic activation, mitochondrial dysfunction, or chemotherapeutic agents.

[0004] Senescent cells remain metabolically active and can influence tissue hemostasis, disease, and aging through their secretory phenotype. Senescence is considered a physiological process and is important in promoting wound healing, tissue homeostasis, regeneration, and fibrosis regulation. For example, transient induction of senescent cells is observed during healing and contributes to wound resolution. Senescence also plays a role in tumor suppression. The accumulation of senescent cells also promotes aging and age-related diseases and conditions. The senescent phenotype also triggers chronic inflammatory responses, which may enhance chronic inflammatory conditions and promote tumor growth. The link between senescence and aging was initially based on the observation that senescent cells accumulate in aging tissues. The use of transgenic models has made it possible to systematically detect senescent cells in many age-related disorders. Strategies for selective elimination of senescent cells have demonstrated that senescent cells can play a causal role in age-related disorders. Summary of the Invention

[0005] overview The present invention is based on the discovery that administration of an NK cell activator to a mammal with cancer resulted in tumor inhibition, and administration of an NK cell activator to a diabetic animal model showed improved skin and hair appearance and texture, as well as reduced blood glucose levels. In light of the findings provided herein, provided herein are methods for treating an age-related disease or condition in a subject in need thereof, the methods comprising administering to a subject identified as having an age-related disease or condition a therapeutically effective number of one or more natural killer (NK) cell activators and / or activated NK cells. Also provided herein are methods for killing or reducing the number of senescent cells in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective number of one or more natural killer (NK) cell activators and / or activated NK cells. Also provided herein is a method of improving skin and / or hair texture and / or appearance over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective number of one or more natural killer (NK) cell activators and / or activated NK cells in a therapeutically effective amount. Also provided herein is a method of assisting in the treatment of obesity over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective number of one or more natural killer (NK) cell activators and / or activated NK cells in a therapeutically effective amount.

[0006] Provided herein are methods for treating an age-related disease or condition in a subject in need thereof, the methods comprising administering to the subject identified as having an age-related disease or condition a therapeutically effective amount of one or more natural killer (NK) cell activators.

[0007] Also provided herein are methods for killing or reducing the number of senescent cells in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more natural killer (NK) cell activators. In some embodiments of any of the methods described herein, the senescent cells are senescent cancer cells, senescent monocytes, senescent lymphocytes, senescent astrocytes, senescent microglia, senescent neurons, senescent tissue fibroblasts, senescent skin fibroblasts, senescent keratinocytes, or other differentiated tissue-specific dividing functional cells. In some embodiments of any of the methods described herein, the senescent cancer cells are chemotherapy-induced senescent cells or radiation-induced senescent cells. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with an age-related disease or condition.

[0008] In some embodiments of any of the methods described herein, the age-related disease or condition is selected from the group of cancer, autoimmune diseases, metabolic diseases, neurodegenerative diseases, cardiovascular diseases, skin diseases, progeria diseases, and frailty diseases. In some embodiments of any of the methods described herein, the cancer is selected from the group of solid tumors, hematological tumors, sarcoma, osteosarcoma, glioblastoma, neuroblastoma, melanoma, rhabdomyosarcoma, Ewing's sarcoma, osteosarcoma, B-cell neoplasms, multiple myeloma, B-cell lymphoma, B-cell non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), myelodysplastic syndromes (MDS), cutaneous T-cell lymphoma, retinoblastoma, gastric cancer, urothelial carcinoma, lung cancer, renal cell carcinoma, gastroesophageal cancer, pancreatic cancer, prostate cancer, breast cancer, colorectal cancer, ovarian cancer, non-small cell lung cancer, squamous cell head and neck cancer, endometrial cancer, cervical cancer, liver cancer, and hepatocellular carcinoma.

[0009] In some embodiments of any of the methods described herein, the autoimmune disease is type 1 diabetes.

[0010] In some embodiments of any of the methods described herein, the metabolic disease is selected from the group of obesity, lipodystrophy, and type 2 diabetes mellitus.

[0011] In some embodiments of any of the methods described herein, the neurodegenerative disease is selected from the group of Alzheimer's disease, Parkinson's disease, and dementia.

[0012] In some embodiments of any of the methods described herein, the cardiovascular disease is selected from the group of coronary artery disease, atherosclerosis, and pulmonary arterial hypertension.

[0013] In some embodiments of any of the methods described herein, the skin disorder is selected from the group of wound healing, alopecia, wrinkles, senile lentigines, thinning of the skin, xeroderma pigmentosum, and dyskeratosis congenita.

[0014] In some embodiments of any of the methods described herein, the progeria disease is selected from the group of progeria and Hutchinson-Gilford progeria syndrome.

[0015] In some embodiments of any of the methods described herein, the frailty disorder is selected from the group of frailty, response to vaccination, osteoporosis, and sarcopenia.

[0016] In some embodiments of any of the methods described herein, the age-related disease or condition is selected from the group of age-related macular degeneration, osteoarthritis, lipoatrophy, idiopathic pulmonary fibrosis, renal transplant failure, liver fibrosis, bone loss, sarcopenia, age-related loss of lung tissue elasticity, osteoporosis, age-related renal dysfunction, and chemically induced renal dysfunction.

[0017] In some embodiments of any of the methods described herein, the age-related disease or condition is type 2 diabetes or atherosclerosis.

[0018] In some embodiments of any of the methods described herein, administering results in a reduction in the number of senescent cells in a target tissue in the subject, in some embodiments of any of the methods described herein, selected from the group consisting of adipose tissue, pancreatic tissue, liver tissue, lung tissue, vasculature, bone tissue, central nervous system (CNS) tissue, eye tissue, skin tissue, muscle tissue, and secondary lymphoid organ tissue.

[0019] In some embodiments of any of the methods described herein, the administering results in increased expression levels of CD25, CD69, mTORC1, SREBP1, IFN-γ, and granzyme B in activated NK cells.

[0020] Also provided herein is a method of treating an age-related disease or condition in a subject in need thereof, the method comprising administering to a subject identified as having an age-related disease or condition a therapeutically effective number of activated NK cells.

[0021] Also provided herein are methods for killing or reducing the number of senescent cells in a subject in need thereof, comprising administering to the subject a therapeutically effective number of activated NK cells. In some embodiments of any of the methods described herein, the senescent cells are senescent cancer cells, senescent monocytes, senescent lymphocytes, senescent astrocytes, senescent microglia, senescent neurons, senescent tissue fibroblasts, senescent skin fibroblasts, senescent keratinocytes, or other differentiated tissue-specific dividing functional cells. In some embodiments of any of the methods described herein, the senescent cancer cells are chemotherapy-induced senescent cells or radiation-induced senescent cells. In some embodiments of any of the methods described herein, the subject has been identified or diagnosed with an age-related disease or condition.

[0022] In some embodiments of any of the methods described herein, the age-related disease or condition is selected from the group of cancer, autoimmune diseases, metabolic diseases, neurodegenerative diseases, cardiovascular diseases, skin diseases, progeria diseases, and frailty diseases. In some embodiments of any of the methods described herein, the cancer is selected from the group of solid tumors, hematological tumors, sarcoma, osteosarcoma, glioblastoma, neuroblastoma, melanoma, rhabdomyosarcoma, Ewing's sarcoma, osteosarcoma, B-cell neoplasms, multiple myeloma, B-cell lymphoma, B-cell non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), myelodysplastic syndromes (MDS), cutaneous T-cell lymphoma, retinoblastoma, gastric cancer, urothelial carcinoma, lung cancer, renal cell carcinoma, gastroesophageal cancer, pancreatic cancer, prostate cancer, breast cancer, colorectal cancer, ovarian cancer, non-small cell lung cancer, squamous cell head and neck cancer, endometrial cancer, cervical cancer, liver cancer, and hepatocellular carcinoma.

[0023] In some embodiments of any of the methods described herein, the autoimmune disease is type 1 diabetes.

[0024] In some embodiments of any of the methods described herein, the metabolic disease is selected from the group of obesity, lipodystrophy, and type 2 diabetes mellitus.

[0025] In some embodiments of any of the methods described herein, the neurodegenerative disease is selected from the group of Alzheimer's disease, Parkinson's disease, and dementia.

[0026] In some embodiments of any of the methods described herein, the cardiovascular disease is selected from the group of coronary artery disease, atherosclerosis, and pulmonary arterial hypertension.

[0027] In some embodiments of any of the methods described herein, the skin disorder is selected from the group of wound healing, alopecia, wrinkles, senile lentigines, thinning of the skin, xeroderma pigmentosum, and dyskeratosis congenita.

[0028] In some embodiments of any of the methods described herein, the progeria disease is selected from the group of progeria and Hutchinson-Gilford progeria syndrome.

[0029] In some embodiments of any of the methods described herein, the frailty disorder is selected from the group of frailty, response to vaccination, osteoporosis, and sarcopenia.

[0030] In some embodiments of any of the methods described herein, the age-related disease or condition is selected from the group of age-related macular degeneration, osteoarthritis, lipoatrophy, idiopathic pulmonary fibrosis, renal transplant failure, liver fibrosis, bone loss, sarcopenia, age-related loss of lung tissue elasticity, osteoporosis, age-related renal dysfunction, and chemically induced renal dysfunction.

[0031] Some embodiments of any of the methods described herein further comprise obtaining resting NK cells and contacting the resting NK cells in vitro in a liquid culture medium with one or more resting NK cell activators, resulting in the generation of activated NK cells, which are then administered to the subject. In some embodiments of any of the methods described herein, the resting NK cells are autologous NK cells obtained from the subject. In some embodiments of any of the methods described herein, the resting NK cells are allogeneic resting NK cells. In some embodiments of any of the methods described herein, the resting NK cells are artificial NK cells. In some embodiments of any of the methods described herein, the resting NK cells are haploidentical resting NK cells. In some embodiments of any of the methods described herein, the resting NK cells are genetically engineered NK cells having a chimeric antigen receptor or a recombinant T cell receptor. Some embodiments of any of the methods described herein further comprise isolating the activated NK cells before administering them to the subject. Some embodiments of any of the methods described herein further comprise introducing a nucleic acid encoding a chimeric antigen receptor or a recombinant T cell receptor into the resting NK cells or the activated NK cells before administering them to the subject.

[0032] Also provided herein is a method for improving skin and / or hair texture and / or appearance over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more natural killer (NK) cell activators.

[0033] Also provided herein are methods for improving skin and / or hair texture and / or appearance over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective number of activated NK cells. Some embodiments of any of the methods described herein further comprise obtaining resting NK cells and contacting the resting NK cells in vitro in a liquid culture medium with one or more resting NK cell activators, resulting in the generation of activated NK cells, which are then administered to the subject. In some embodiments of any of the methods described herein, the resting NK cells are autologous NK cells obtained from the subject. In some embodiments of any of the methods described herein, the resting NK cells are allogeneic resting NK cells. In some embodiments of any of the methods described herein, the resting NK cells are artificial NK cells. In some embodiments of any of the methods described herein, the resting NK cells are haploidentical resting NK cells. In some embodiments of any of the methods described herein, the resting NK cells are genetically engineered NK cells with chimeric antigen receptors or recombinant T cell receptors. Some embodiments of any of the methods described herein further comprise isolating the activated NK cells before administering the activated NK cells to the subject.

[0034] In some embodiments of any of the methods described herein, the method provides an improvement in the texture and / or appearance of the subject's skin over a period of time. In some embodiments of any of the methods described herein, the method results in a decrease in the rate of wrinkle formation in the subject's skin over a period of time. In some embodiments of any of the methods described herein, the method results in an improvement in the pigmentation of the subject's skin over a period of time. In some embodiments of any of the methods described herein, the method results in an improvement in the texture of the subject's skin over a period of time. In some embodiments of any of the methods described herein, the method provides an improvement in the texture and / or appearance of the subject's hair over a period of time. In some embodiments of any of the methods described herein, the method results in a decrease in the rate of gray hair formation in the subject over a period of time. In some embodiments of any of the methods described herein, the method results in a decrease in the number of gray hairs in the subject over a period of time. In some embodiments of any of the methods described herein, the method results in a decrease in the rate of hair shedding in the subject over time. In some embodiments of any of the methods described herein, the method results in an improvement in the texture of the subject's hair over a period of time.

[0035] In some embodiments of any of the methods described herein, the period of time is from about 1 month to about 10 years. In some embodiments of any of the methods described herein, the method results in a decrease in the number of senescent dermal fibroblasts in the subject's skin over a period of time.

[0036] Also provided herein is a method for assisting in the treatment of obesity over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more natural killer (NK) cell activators.

[0037] Also provided herein are methods for assisting in the treatment of obesity over a period of time in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective number of activated NK cells. Some embodiments of any of the methods described herein further comprise obtaining resting NK cells and contacting the resting NK cells in vitro in a liquid culture medium with one or more resting NK cell activators, resulting in the generation of activated NK cells, which are then administered to the subject. In some embodiments of any of the methods described herein, the resting NK cells are autologous NK cells obtained from the subject. In some embodiments of any of the methods described herein, the resting NK cells are allogeneic resting NK cells. In some embodiments of any of the methods described herein, the resting NK cells are artificial NK cells. In some embodiments of any of the methods described herein, the resting NK cells are haploidentical resting NK cells. In some embodiments of any of the methods described herein, the resting NK cells are genetically engineered NK cells having a chimeric antigen receptor or a recombinant T cell receptor. Some embodiments of any of the methods described herein further comprise isolating the activated NK cells before administering them to the subject.

[0038] In some embodiments of any of the methods described herein, the method results in a reduction in the subject's mass over a period of time. In some embodiments of any of the methods described herein, the method results in a reduction in the subject's body mass index (BMI) over a period of time. In some embodiments of any of the methods described herein, the method results in a reduction in the rate of progression from prediabetes to type 2 diabetes in the subject. In some embodiments of any of the methods described herein, the method results in a reduction in fasting blood glucose levels in the subject. In some embodiments of any of the methods described herein, the method results in an increase in insulin sensitivity in the subject. In some embodiments of any of the methods described herein, the method results in a reduction in the severity of atherosclerosis in the subject. In some embodiments of any of the methods described herein, the period of time is from about 2 weeks to about 10 years.

[0039] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators results in activation of one or more of IL-2 receptor, IL-7 receptor, IL-12 receptor, IL-15 receptor, IL-18 receptor, IL-21 receptor, IL-33 receptor, CD16, CD69, CD25, CD36, CD59, CD352, NKp80, DNAM-1, 2B4, NKp30, NKp44, NKp46, NKG2D, KIR2DS1, KIR2Ds2 / 3, KIR2DL4, KIR2DS4, KIR2DS5, and KIR3DS1.

[0040] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the IL-2 receptor is soluble IL-2 or an agonistic antibody that specifically binds to the IL-2 receptor.

[0041] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the IL-7 receptor is soluble IL-7 or an agonistic antibody that specifically binds to the IL-7 receptor.

[0042] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the IL-12 receptor is soluble IL-12 or an agonistic antibody that specifically binds to the IL-12 receptor.

[0043] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the IL-15 receptor is soluble IL-15 or an agonistic antibody that specifically binds to the IL-15 receptor.

[0044] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the IL-21 receptor is soluble IL-21 or an agonistic antibody that specifically binds to the IL-21 receptor.

[0045] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the IL-33 receptor is soluble IL-33 or an agonistic antibody that specifically binds to the IL-33 receptor.

[0046] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the CD16 receptor is an agonistic antibody that specifically binds to CD16.

[0047] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the CD69 receptor is an agonistic antibody that specifically binds to CD69.

[0048] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the CD25 or CD59 receptor is an agonistic antibody that specifically binds to CD25 or CD59.

[0049] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the CD352 receptor is an agonistic antibody that specifically binds to CD352.

[0050] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the NKp80 receptor is an agonistic antibody that specifically binds to NKp80.

[0051] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the DNAM-1 receptor is an agonistic antibody that specifically binds to DNAM-1.

[0052] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the 2B4 receptor is an agonist antibody that specifically binds to 2B4.

[0053] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the NKp30 receptor is an agonistic antibody that specifically binds to NKp30.

[0054] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the NKp44 receptor is an agonistic antibody that specifically binds to NKp44.

[0055] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the NKp46 receptor is an agonistic antibody that specifically binds to NKp46.

[0056] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the NKG2D receptor is an agonistic antibody that specifically binds to NKG2D.

[0057] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the KIR2DS1 receptor is an agonistic antibody that specifically binds to KIR2DS1.

[0058] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the KIR2DS2 / 3 receptor is an agonistic antibody that specifically binds to KIR2DS2 / 3.

[0059] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the KIR2DL4 receptor is an agonistic antibody that specifically binds to KIR2DL4.

[0060] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the KIR2DL4 receptor is an agonistic antibody that specifically binds to KIR2DL4.

[0061] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the KIR2DS5 receptor is an agonistic antibody that specifically binds to KIR2DS5.

[0062] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in activation of the KIR3DS1 receptor is an agonistic antibody that specifically binds to KIR3DS1.

[0063] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators results in decreased activation of one or more of PD-1, TGF-β receptor, TIGIT, CD1, TIM-3, Siglec-7, IRP60, Tactile, IL1R8, NKG2A / KLRD1, KIR2DL1, KIR2DL2 / 3, KIR2DL5, KIR3DL1, KIR3DL2, ILT2 / LIR-1, and LAG-2. In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that results in decreased activation of PD-1 is an antagonist antibody that specifically binds PD-1, soluble PD-1, soluble PD-L1, or an antibody that specifically binds PD-L1. In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased activation of TGF-β receptors is a soluble TGF-β receptor, an antibody that specifically binds to TGF-β, or an antagonist antibody that specifically binds to TGF-β receptors.

[0064] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of TIGIT is an antagonist antibody that specifically binds to TIGIT, soluble TIGIT, or an antibody that specifically binds to a ligand of TIGIT.

[0065] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased CD1 activation is an antagonist antibody that specifically binds to CD1, soluble CD1, or an antibody that specifically binds to a ligand of CD1.

[0066] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased activation of TIM-3 is an antagonist antibody that specifically binds to TIM-3, soluble TIM-3, or an antibody that specifically binds to a ligand of TIM-3.

[0067] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of Siglec-7 is an antagonist antibody that specifically binds to Siglec-7 or an antibody that specifically binds to a ligand of Siglec-7.

[0068] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of IRP60 is an antagonist antibody that specifically binds to IRP60 or an antibody that specifically binds to a ligand of IRP60.

[0069] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in a decrease in Tactile activation is an antagonist antibody that specifically binds to Tactile or an antibody that specifically binds to a ligand of Tactile.

[0070] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased activation of IL1R8 is an antagonist antibody that specifically binds to IL1R8 or an antibody that specifically binds to a ligand of IL1R8.

[0071] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased activation of NKG2A / KLRD1 is an antagonist antibody that specifically binds to NKG2A / KLRD1 or an antibody that specifically binds to a ligand of NKG2A / KLRD1.

[0072] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of KIR2DL1 is an antagonist antibody that specifically binds to KIR2DL1 or an antibody that specifically binds to a ligand of KIR2DL1.

[0073] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of KIR2DL2 / 3 is an antagonist antibody that specifically binds to KIR2DL2 / 3 or an antibody that specifically binds to a ligand of KIR2DL2 / 3.

[0074] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of KIR2DL5 is an antagonist antibody that specifically binds to KIR2DL5 or an antibody that specifically binds to a ligand of KIR2DL5.

[0075] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of KIR3DL1 is an antagonist antibody that specifically binds to KIR3DL1 or an antibody that specifically binds to a ligand of KIR3DL1.

[0076] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased activation of KIR3DL2 is an antagonist antibody that specifically binds to KIR3DL2 or an antibody that specifically binds to a ligand of KIR3DL2.

[0077] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in decreased activation of ILT2 / LIR-1 is an antagonist antibody that specifically binds to ILT2 / LIR-1 or an antibody that specifically binds to a ligand of ILT2 / LIR-1.

[0078] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators that result in reduced activation of LAG-2 is an antagonist antibody that specifically binds to LAG-2 or an antibody that specifically binds to a ligand of LAG-2.

[0079] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators is a single-chain chimeric polypeptide comprising (i) a first target binding domain, (ii) a soluble tissue factor domain, and (iii) a second target binding domain. In some embodiments of any of the methods described herein, the first target binding domain and the soluble tissue factor domain are immediately adjacent to each other. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between the first target binding domain and the soluble tissue factor domain. In some embodiments of any of the methods described herein, the soluble tissue factor domain and the second target binding domain are immediately adjacent to each other. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain and the second target binding domain. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain are immediately adjacent to each other. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between the first target binding domain and the second target binding domain. In some embodiments of any of the methods described herein, the second target binding domain and the soluble tissue factor domain are directly adjacent to each other. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between the second target binding domain and the soluble tissue factor domain.

[0080] In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to the same antigen. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to the same epitope. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain comprise the same amino acid sequence.

[0081] In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to different antigens.

[0082] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain are antigen-binding domains. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain are each antigen-binding domains. In some embodiments of any of the methods described herein, the antigen-binding domain comprises an scFv or a single-domain antibody.

[0083] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA -DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHCI ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0084] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine protein. In some embodiments of any of the methods described herein, the soluble interleukin or cytokine protein is selected from the group consisting of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0085] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine receptor. In some embodiments of any of the methods described herein, the soluble interleukin or cytokine receptor is a soluble TGF-β receptor II (TGF-βRII), a soluble TGF-βRIII, a soluble TNFα receptor, a soluble IL-4 receptor, or a soluble IL-10 receptor.

[0086] In some embodiments of any of the methods described herein, the soluble tissue factor domain is a soluble human tissue factor domain. In some embodiments of any of the methods described herein, the soluble human tissue factor domain comprises a sequence at least 80% identical to SEQ ID NO: 93. In some embodiments of any of the methods described herein, the soluble human tissue factor domain comprises a sequence at least 90% identical to SEQ ID NO: 93. In some embodiments of any of the methods described herein, the soluble human tissue factor domain comprises a sequence at least 95% identical to SEQ ID NO: 93. In some embodiments of any of the methods described herein, the soluble human tissue factor domain does not comprise one or more of: a lysine at the amino acid position corresponding to amino acid position 20 of the mature wild-type human tissue factor protein; an isoleucine at the amino acid position corresponding to amino acid position 22 of the mature wild-type human tissue factor protein; a tryptophan at the amino acid position corresponding to amino acid position 45 of the mature wild-type human tissue factor protein; an aspartic acid at the amino acid position corresponding to amino acid position 58 of the mature wild-type human tissue factor protein; a tyrosine at the amino acid position corresponding to amino acid position 94 of the mature wild-type human tissue factor protein; an arginine at the amino acid position corresponding to amino acid position 135 of the mature wild-type human tissue factor protein; and a phenylalanine at the amino acid position corresponding to amino acid position 140 of the mature wild-type human tissue factor protein.

[0087] In some embodiments of any of the methods described herein, the soluble human tissue factor domain does not comprise any of the following: a lysine at the amino acid position corresponding to amino acid 20 of the mature wild-type human tissue factor protein, an isoleucine at the amino acid position corresponding to amino acid 22 of the mature wild-type human tissue factor protein, a tryptophan at the amino acid position corresponding to amino acid 45 of the mature wild-type human tissue factor protein, an aspartic acid at the amino acid position corresponding to amino acid 58 of the mature wild-type human tissue factor protein, a tyrosine at the amino acid position corresponding to amino acid 94 of the mature wild-type human tissue factor protein, an arginine at the amino acid position corresponding to amino acid 135 of the mature wild-type human tissue factor protein, and a phenylalanine at the amino acid position corresponding to amino acid 140 of the mature wild-type human tissue factor protein.

[0088] In some embodiments of any of the methods described herein, the soluble tissue factor domain cannot bind to factor VIIa. In some embodiments of any of the methods described herein, the soluble tissue factor domain does not convert inactive factor X to factor Xa. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide does not stimulate blood clotting in a mammal. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises one or more additional target binding domains at its N-terminus and / or C-terminus.

[0089] In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide comprises one or more additional target binding domains at its N-terminus. In some embodiments of any of the methods described herein, the one or more additional target binding domains are immediately adjacent to the first target binding domain, the second target binding domain, or the soluble tissue factor domain. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between one of the at least one additional target binding domain and the first target binding domain, the second target binding domain, or the soluble tissue factor domain.

[0090] In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide comprises one or more additional target binding domains at its C-terminus. In some embodiments of any of the methods described herein, one of the one or more additional target binding domains is immediately adjacent to the first target binding domain, the second target binding domain, or the soluble tissue factor domain. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between one of the at least one additional target binding domain and the first target binding domain, the second target binding domain, or the soluble tissue factor domain.

[0091] In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide comprises one or more additional target binding domains at its N-terminus and C-terminus. In some embodiments of any of the methods described herein, one of the one or more additional antigen binding domains at the N-terminus is immediately adjacent to the first target binding domain, the second target binding domain, or the soluble tissue factor domain. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between one of the one or more additional antigen binding domains at the N-terminus and the first target binding domain, the second target binding domain, or the soluble tissue factor domain. In some embodiments of any of the methods described herein, one of the one or more additional antigen binding domains at the C-terminus is immediately adjacent to the first target binding domain, the second target binding domain, or the soluble tissue factor domain. In some embodiments of any of the methods described herein, the single-chain chimeric polypeptide further comprises a linker sequence between one of the one or more additional antigen binding domains at the C-terminus and the first target binding domain, the second target binding domain, or the soluble tissue factor domain.

[0092] In some embodiments of any of the methods described herein, two or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to the same antigen. In some embodiments of any of the methods described herein, two or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to the same epitope. In some embodiments of any of the methods described herein, two or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains comprise the same amino acid sequence. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each specifically bind to the same antigen. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each specifically bind to the same epitope. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each comprise the same amino acid sequence.

[0093] In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to different antigens.

[0094] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more target binding domains are antigen binding domains. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains are each antigen binding domains. In some embodiments of any of the methods described herein, the antigen binding domain comprises an scFv or a single domain antibody.

[0095] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more target binding domains are selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein. The antibody specifically binds to a target selected from the group consisting of protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHC1 ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0096] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains are soluble interleukin or cytokine proteins. In some embodiments of any of the methods described herein, the soluble interleukin or cytokine protein is selected from the group of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0097] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains are soluble interleukin or cytokine receptors. In some embodiments of any of the methods described herein, the soluble receptor is soluble TGF-β receptor II (TGF-βRII), soluble TGF-βRIII, soluble TNFα receptor, soluble IL-4 receptor, or soluble IL-10 receptor.

[0098] In some embodiments of any of the methods described herein, one or more of the one or more NK cell activators is a multi-chain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target binding domain, (ii) a soluble tissue factor domain, and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of the pair of affinity domains and (ii) a second target binding domain, wherein the first chimeric polypeptide and the second chimeric polypeptide are associated via binding between the first domain and the second domain of the pair of affinity domains.

[0099] In some embodiments of any of the methods described herein, the first target binding domain and the soluble tissue factor domain are immediately adjacent to each other in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between the first target binding domain and the soluble tissue factor domain in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the soluble tissue factor domain and the first domain of the pair of affinity domains are immediately adjacent to each other in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain and the first domain of the pair of affinity domains in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the second domain of the pair of affinity domains and the second target binding domain are immediately adjacent to each other in the second chimeric polypeptide. In some embodiments of any of the methods described herein, the second chimeric polypeptide further comprises a linker sequence between the second domain of the pair of affinity domains and the second target binding domain in the second chimeric polypeptide.

[0100] In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to the same antigen. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to the same epitope. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain comprise the same amino acid sequence.

[0101] In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to different antigens.

[0102] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain are antigen-binding domains. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain are each antigen-binding domains. In some embodiments of any of the methods described herein, the antigen-binding domain comprises an scFv or a single-domain antibody.

[0103] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA-D Specifically binds to a target selected from the group consisting of R, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHC1 ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0104] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine protein. In some embodiments of any of the methods described herein, the soluble interleukin or cytokine protein is selected from the group consisting of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0105] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine receptor. In some embodiments of any of the methods described herein, the soluble receptor is a soluble TGF-β receptor II (TGF-βRII), a soluble TGF-βRIII, a soluble TNFα receptor, a soluble IL-4 receptor, or a soluble IL-10 receptor.

[0106] In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises one or more additional target-binding domains, wherein at least one of the one or more additional antigen-binding domains is positioned between the soluble tissue factor domain and the first domain of the pair of affinity domains. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain and at least one of the one or more additional antigen-binding domains, and / or a linker sequence between at least one of the one or more additional antigen-binding domains and the first domain of the pair of affinity domains.

[0107] In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises one or more additional target binding domains at the N-terminus and / or C-terminus of the first chimeric polypeptide. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains is immediately adjacent to the first domain of the pair of affinity domains in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between at least one of the one or more additional target binding domains and the first domain of the pair of affinity domains. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains is immediately adjacent to the first target binding domain in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between at least one of the one or more additional target binding domains and the first target binding domain.

[0108] In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains is located at the N-terminus and / or C-terminus of the first chimeric polypeptide, and at least one of the one or more additional target binding domains is located between the soluble tissue factor domain and the first domain of the pair of affinity domains in the first chimeric polypeptide. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains located at the N-terminus is immediately adjacent to the first target binding domain or the first domain of the pair of affinity domains in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence located between the at least one additional target binding domain in the first chimeric polypeptide and the first target binding domain or the first domain of the pair of affinity domains. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains located at the C-terminus is immediately adjacent to the first target binding domain or the first domain of the pair of affinity domains in the first chimeric polypeptide. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence disposed between at least one additional target binding domain in the first chimeric polypeptide and the first target binding domain or the first domain of the pair of affinity domains. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains positioned between the soluble tissue factor domain and the first domain of the pair of affinity domains is immediately adjacent to the soluble tissue factor domain and / or the first domain of the pair of affinity domains.In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence disposed between (i) the soluble tissue factor domain and at least one of the one or more additional target binding domains positioned between the soluble tissue factor domain and the first domain of the pair of affinity domains, and / or (ii) between the first domain of the pair of affinity domains and at least one of the one or more additional target binding domains positioned between the soluble tissue factor domain and the first domain of the pair of affinity domains.

[0109] In some embodiments of any of the methods described herein, the second chimeric polypeptide further comprises one or more additional target binding domains at the N-terminus and / or C-terminus of the second chimeric polypeptide. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains is immediately adjacent to the second domain of the pair of affinity domains in the second chimeric polypeptide. In some embodiments of any of the methods described herein, the second chimeric polypeptide further comprises a linker sequence between at least one of the one or more additional target binding domains in the second chimeric polypeptide and the second domain of the pair of affinity domains. In some embodiments of any of the methods described herein, at least one of the one or more additional target binding domains is immediately adjacent to the second target binding domain in the second chimeric polypeptide. In some embodiments of any of the methods described herein, the second chimeric polypeptide further comprises a linker sequence between at least one of the one or more additional target binding domains in the second chimeric polypeptide and the second target binding domain.

[0110] In some embodiments of any of the methods described herein, two or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to the same antigen. In some embodiments of any of the methods described herein, two or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to the same epitope. In some embodiments of any of the methods described herein, two or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains comprise the same amino acid sequence. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each specifically bind to the same antigen. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each specifically bind to the same epitope. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each comprise the same amino acid sequence.

[0111] In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to different antigens. In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more target binding domains are antigen binding domains. In some embodiments of any of the methods described herein, the first target binding domain, the second target binding domain, and the one or more additional target binding domains are each antigen binding domains. In some embodiments of any of the methods described herein, the antigen binding domain comprises an scFv.

[0112] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more target binding domains are selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein. The antibody specifically binds to a target selected from the group consisting of protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHC1 ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0113] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains are soluble interleukin or cytokine proteins. In some embodiments of any of the methods described herein, the soluble interleukin or cytokine protein is selected from the group of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0114] In some embodiments of any of the methods described herein, one or more of the first target binding domain, the second target binding domain, and the one or more additional target binding domains are soluble interleukin or cytokine receptors. In some embodiments of any of the methods described herein, the soluble receptor is soluble TGF-β receptor II (TGF-βRII), soluble TGF-βRIII, soluble TNFα receptor, soluble IL-4 receptor, or soluble IL-10 receptor.

[0115] In some embodiments of any of the methods described herein, the soluble tissue factor domain is a soluble human tissue factor domain. In some embodiments of any of the methods described herein, the soluble human tissue factor domain comprises a sequence at least 80% identical to SEQ ID NO: 93. In some embodiments of any of the methods described herein, the soluble human tissue factor domain comprises a sequence at least 90% identical to SEQ ID NO: 93. In some embodiments of any of the methods described herein, the soluble human tissue factor domain comprises a sequence at least 95% identical to SEQ ID NO: 93.

[0116] In some embodiments of any of the methods described herein, the soluble human tissue factor domain does not comprise one or more of: a lysine at the amino acid position corresponding to amino acid position 20 of the mature wild-type human tissue factor protein; an isoleucine at the amino acid position corresponding to amino acid position 22 of the mature wild-type human tissue factor protein; a tryptophan at the amino acid position corresponding to amino acid position 45 of the mature wild-type human tissue factor protein; an aspartic acid at the amino acid position corresponding to amino acid position 58 of the mature wild-type human tissue factor protein; a tyrosine at the amino acid position corresponding to amino acid position 94 of the mature wild-type human tissue factor protein; an arginine at the amino acid position corresponding to amino acid position 135 of the mature wild-type human tissue factor protein; and a phenylalanine at the amino acid position corresponding to amino acid position 140 of the mature wild-type human tissue factor protein.

[0117] In some embodiments of any of the methods described herein, the soluble human tissue factor domain does not comprise any of the following: a lysine at the amino acid position corresponding to amino acid 20 of the mature wild-type human tissue factor protein, an isoleucine at the amino acid position corresponding to amino acid 22 of the mature wild-type human tissue factor protein, a tryptophan at the amino acid position corresponding to amino acid 45 of the mature wild-type human tissue factor protein, an aspartic acid at the amino acid position corresponding to amino acid 58 of the mature wild-type human tissue factor protein, a tyrosine at the amino acid position corresponding to amino acid 94 of the mature wild-type human tissue factor protein, an arginine at the amino acid position corresponding to amino acid 135 of the mature wild-type human tissue factor protein, and a phenylalanine at the amino acid position corresponding to amino acid 140 of the mature wild-type human tissue factor protein.

[0118] In some embodiments of any of the methods described herein, the soluble tissue factor domain cannot bind to factor VIIa. In some embodiments of any of the methods described herein, the soluble tissue factor domain does not convert inactive factor X to factor Xa. In some embodiments of any of the methods described herein, the multi-chain chimeric polypeptide does not stimulate blood coagulation in a mammal. In some embodiments of any of the methods described herein, the pair of affinity domains is a sushi domain from human IL-15 receptor alpha chain (IL-15Rα) and soluble IL-15. In some embodiments of any of the methods described herein, the soluble IL-15 has a D8N or D8A amino acid substitution. In some embodiments of any of the methods described herein, the human IL-15Rα is mature full-length IL-15Rα.

[0119] In some embodiments of any of the methods described herein, the pair of affinity domains is selected from the group of barnase and barnstar, PKA and AKAP, adapter / docking tag modules based on mutant RNase I fragments, and SNARE modules based on the interaction of the proteins syntaxin, synaptotagmin, synaptobrevin, and SNAP25.

[0120] In some embodiments of any of the methods described herein, at least one of the one or more NK cell activators is a multi-chain chimeric polypeptide comprising: (a) first and second chimeric polypeptides, each comprising (i) a first target binding domain, (ii) an Fc domain, and (iii) a first domain of a pair of affinity domains; and (b) third and fourth chimeric polypeptides, each comprising (i) a second domain of the pair of affinity domains and (ii) a second target binding domain, wherein the first and second chimeric polypeptides and the third and fourth chimeric polypeptides are associated via binding of the first and second domains of the pair of affinity domains, and the first and second chimeric polypeptides are associated via their Fc domains.

[0121] In some embodiments of any of the methods described herein, the first target binding domain and the Fc domain are immediately adjacent to each other in the first and second chimeric polypeptides. In some embodiments of any of the methods described herein, the first and second chimeric polypeptides further comprise a linker sequence between the first target binding domain and the Fc domain in the first and second chimeric polypeptides. In some embodiments of any of the methods described herein, the Fc domain and the first domain of the pair of affinity domains are immediately adjacent to each other in the first and second chimeric polypeptides. In some embodiments of any of the methods described herein, the first chimeric polypeptide further comprises a linker sequence between the Fc domain and the first domain of the pair of affinity domains in the first and second chimeric polypeptides.

[0122] In some embodiments of any of the methods described herein, the second domain of the pair of affinity domains and the second target binding domain are immediately adjacent to each other in the third and fourth chimeric polypeptides. In some embodiments of any of the methods described herein, the third and fourth chimeric polypeptides further comprise a linker sequence between the second domain of the pair of affinity domains and the second target binding domain in the third and fourth chimeric polypeptides.

[0123] In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to the same antigen. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to the same epitope. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain comprise the same amino acid sequence.

[0124] In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain specifically bind to different antigens. In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain are antigen binding domains. In some embodiments of any of the methods described herein, the first target binding domain and the second target binding domain are each antigen binding domains. In some embodiments of any of the methods described herein, the antigen binding domain comprises an scFv or a single domain antibody.

[0125] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA-D Specifically binds to a target selected from the group consisting of R, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHC1 ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0126] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine protein. In some embodiments of any of the methods described herein, the soluble interleukin or cytokine protein is selected from the group consisting of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0127] In some embodiments of any of the methods described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine receptor. In some embodiments of any of the methods described herein, the soluble receptor is a soluble TGF-β receptor II (TGF-βRII), a soluble TGF-βRIII, a soluble TNFα receptor, a soluble IL-4 receptor, or a soluble IL-10 receptor.

[0128] In some embodiments of any of the methods described herein, the soluble tissue factor domain is a soluble human tissue factor domain that does not stimulate blood clotting. In some embodiments of any of the methods described herein, the soluble tissue factor domain comprises or consists of a sequence from wild-type soluble human tissue factor.

[0129] As used herein, the term "chimeric" refers to a polypeptide that includes amino acid sequences (e.g., domains) that are originally derived from two different sources (e.g., two different naturally occurring proteins, from the same or different species). For example, a chimeric polypeptide can include domains that are derived from at least two different naturally occurring human proteins. In some examples, a chimeric polypeptide can include a domain that is a synthetic sequence (e.g., an scFv) and a domain that is derived from a naturally occurring protein (e.g., a naturally occurring human protein). In some embodiments, a chimeric polypeptide can include at least two different domains that are synthetic sequences (e.g., two different scFvs).

[0130] "Activated NK cells" are, for example, NK cells that exhibit increased expression levels of two or more (e.g., three, four, five, or six) of CD25, CD69, MTOR-C1, SREBP, IFN-γ, and a granzyme (e.g., granzyme B) compared to resting NK cells. Exemplary methods for identifying the expression levels of CD25, CD69, MTOR-C1, SREBP, IFN-γ, and a granzyme (e.g., granzyme B) are described herein.

[0131] "Resting NK cells" are NK cells that have reduced expression of two or more (e.g., three, four, five, or six) of CD25, CD69, MTOR-C1, SREBP, IFN-γ, and a granzyme (e.g., granzyme B), for example, compared to activated NK cells.

[0132] An "NK cell activator" is an agent that induces or promotes (alone or in combination with additional NK cell activators) resting NK cells to evolve into activated NK cells. Non-limiting examples and embodiments of NK cell activators are described herein.

[0133] An "antigen-binding domain" is one or more protein domains (e.g., formed from amino acids from a single polypeptide or formed from amino acids from two or more polypeptides (e.g., the same or different polypeptides)) that can specifically bind to one or more different antigens. In some examples, an antigen-binding domain can bind to an antigen or epitope with specificity and affinity similar to that of a naturally occurring antibody. In some embodiments, the antigen-binding domain may be an antibody or fragment thereof. In some embodiments, the antigen-binding domain may comprise an alternative scaffold. Non-limiting examples of antigen-binding domains are described herein. Additional examples of antigen-binding domains are known in the art.

[0134] A "soluble tissue factor domain" refers to a polypeptide having at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 99% identity, or 100% identity) to a segment of a wild-type mammalian tissue factor protein (e.g., a wild-type human tissue factor protein) lacking the transmembrane and intracellular domains. Non-limiting examples of soluble tissue factor domains are described herein.

[0135] The term "soluble interleukin protein" is used herein to refer to a mature secreted interleukin protein or a biologically active fragment thereof. In some examples, a soluble interleukin protein can comprise a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical to a wild-type mature secreted mammalian interleukin protein (e.g., a wild-type human interleukin protein) and retains its biological activity. Non-limiting examples of soluble interleukin proteins are described herein.

[0136] The term "soluble cytokine protein" is used herein to refer to a mature secreted cytokine protein or a biologically active fragment thereof. In some examples, a soluble cytokine protein can comprise a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical to a wild-type mature secreted mammalian interleukin protein (e.g., a wild-type human interleukin protein) and retains its biological activity. Non-limiting examples of soluble cytokine proteins are described herein.

[0137] The term "soluble interleukin receptor" is used herein in the broadest sense to refer to a polypeptide lacking a transmembrane domain (and optionally an intracellular domain) that can bind to one or more of its natural ligands (e.g., under physiological conditions, e.g., in phosphate-buffered saline at room temperature). For example, a soluble interleukin receptor can include a sequence that is at least 70% identical (e.g., at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical) to the extracellular domain of a wild-type interleukin receptor and retains the ability to specifically bind to one or more of its natural ligands, but lacks its transmembrane domain (and optionally further lacks the intracellular domain). Non-limiting examples of soluble interleukin receptors are described herein.

[0138] The term "soluble cytokine receptor" is used herein in the broadest sense to refer to a polypeptide lacking a transmembrane domain (and optionally an intracellular domain) that is capable of binding to one or more of its natural ligands (e.g., under physiological conditions, e.g., in phosphate-buffered saline at room temperature). For example, a soluble cytokine receptor can include a sequence that is at least 70% identical (e.g., at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical) to the extracellular domain of a wild-type cytokine receptor and retains the ability to specifically bind to one or more of its natural ligands, but lacks its transmembrane domain (and optionally further lacks the intracellular domain). Non-limiting examples of soluble cytokine receptors are described herein.

[0139] The term "antibody" is used herein in its broadest sense and includes certain types of immunoglobulin molecules that contain one or more antigen-binding domains that specifically bind to an antigen or epitope. Antibodies specifically include, for example, intact antibodies (e.g., intact immunoglobulins), antibody fragments, and multispecific antibodies. An example of an antigen-binding domain is an antigen-binding domain formed by a VH-VL dimer. Additional examples of antibodies are described herein. Additional examples of antibodies are known in the art.

[0140] "Affinity" refers to the strength of the sum of non-covalent interactions between an antigen-binding site and its binding partner (e.g., antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between a member of the antigen-binding domain and the antigen or epitope. The affinity of a molecule X for its partner Y is determined by the dissociation equilibrium constant (K D) The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including those described herein. Affinity can be determined, for example, using surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®). Additional methods for determining the affinity of an antigen-binding domain for its corresponding antigen or epitope are known in the art.

[0141] As used herein, a "single-chain polypeptide" refers to a single protein chain.

[0142] As used herein, a "multi-chain polypeptide" refers to a polypeptide comprising two or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) protein chains (e.g., at least a first chimeric polypeptide and a second polypeptide), wherein the two or more protein chains are linked via non-covalent bonds to form a quaternary structure.

[0143] The term "pair of affinity domains" refers to 1 × 10 -7 Less than M (e.g., 1 × 10 -8 Less than M, 1 x 10 -9 Less than M, 1 x 10 -10 Less than M or 1 x 10 -11 K (less than M) D A pair of affinity domains is two different protein domains that specifically bind to each other at a specific site. In some examples, the pair of affinity domains can be a pair of naturally occurring proteins. In some embodiments, the pair of affinity domains can be a pair of synthetic proteins. Non-limiting examples of paired affinity domains are described herein.

[0144] The term "epitope" refers to a portion of an antigen that specifically binds to an antigen-binding domain. An epitope may consist of, for example, surface-accessible amino acid residues and / or sugar side chains, and may have specific three-dimensional structural characteristics and specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that the binding to the former may be lost in the presence of denaturing solvents, but the binding to the latter may not be lost. An epitope may include amino acid residues directly involved in binding and other amino acid residues not directly involved in binding. Methods for identifying the epitope bound by an antigen-binding domain are known in the art.

[0145] The term "treatment" refers to ameliorating at least one symptom of a disorder. In some examples, the disorder being treated is cancer, and ameliorating at least one symptom of cancer includes reducing abnormal proliferation, gene expression, signal transduction, translation, and / or secretion of a factor. Generally, treatment methods involve administering to a subject in need of, or determined to be in need of, such treatment a therapeutically effective amount of a composition that alleviates at least one symptom of the disorder.

[0146] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Methods and materials are described herein for use in the present invention, and other suitable methods and materials known in the art may also be used. Materials, methods, and examples are merely illustrative and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification, including definitions, shall control.

[0147] [The present invention 1001] A method for treating an age-related disease or condition in a subject in need thereof, comprising administering to the subject identified as having an age-related disease or condition a therapeutically effective amount of one or more natural killer (NK) cell activators. [The present invention 1002] 1. A method for killing or reducing the number of senescent cells in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more NK cell activators. [The present invention 1003] 1001 or 1002, wherein said administering results in a reduction in the number of senescent cells in a target tissue in said subject. [The present invention 1004] The method of claim 1003, wherein said target tissue is selected from the group consisting of adipose tissue, pancreatic tissue, liver tissue, lung tissue, vasculature, bone tissue, central nervous system (CNS) tissue, eye tissue, skin tissue, muscle tissue, and secondary lymphoid organ tissue. [The present invention 1005] 1. A method for treating an age-related disease or condition in a subject in need thereof, the method comprising administering to the subject identified as having an age-related disease or condition a therapeutically effective number of activated NK cells. [The present invention 1006] 1. A method of killing or reducing the number of senescent cells in a subject in need thereof, comprising administering to the subject a therapeutically effective number of activated NK cells. [The present invention 1007] The method of any of claims 1001 to 1006, wherein said subject has been identified or diagnosed as having an age-related disease or condition. [The present invention 1008] 1007. The method of claim 1007, wherein said age-related disease or condition is selected from the group consisting of cancer, an autoimmune disease, a metabolic disease, a neurodegenerative disease, a cardiovascular disease, a skin disease, a progeria disease, and a frailty disease. [The present invention 1009] 1008. The method of claim 1008, wherein said cancer is selected from the group consisting of solid tumors, hematological tumors, sarcoma, osteosarcoma, glioblastoma, neuroblastoma, melanoma, rhabdomyosarcoma, Ewing's sarcoma, osteosarcoma, B-cell neoplasms, multiple myeloma, B-cell lymphoma, B-cell non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), myelodysplastic syndrome (MDS), cutaneous T-cell lymphoma, retinoblastoma, gastric cancer, urothelial carcinoma, lung cancer, renal cell carcinoma, gastroesophageal cancer, pancreatic cancer, prostate cancer, breast cancer, colorectal cancer, ovarian cancer, non-small cell lung cancer, squamous cell head and neck cancer, endometrial cancer, cervical cancer, liver cancer, and hepatocellular carcinoma. [The present invention 1010] 1008. The method of claim 10, wherein said autoimmune disease is type 1 diabetes. [The present invention 1011] The method of claim 1008, wherein said metabolic disease is selected from the group consisting of obesity, lipodystrophy, and type 2 diabetes mellitus. [The present invention 1012] 1008. The method of claim 1008, wherein said neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease, and dementia. [The present invention 1013] 1008. The method of claim 1008, wherein said cardiovascular disease is selected from the group consisting of coronary artery disease, atherosclerosis, and pulmonary arterial hypertension. [The present invention 1014] 1008. The method of claim 1008, wherein said skin disease is selected from the group consisting of wound healing, alopecia, wrinkles, senile lentigines, thinning of the skin, xeroderma pigmentosum, and dyskeratosis congenita. [The present invention 1015] 1008. The method of claim 1008, wherein said progeria disease is selected from the group consisting of progeria and Hutchinson-Gilford progeria syndrome. [The present invention 1016] 1008. The method of claim 1008, wherein said frailty disorder is selected from the group consisting of frailty, response to vaccination, osteoporosis, and sarcopenia. [The present invention 1017] Any of the methods of inventions 1001 to 1006, wherein said age-related disease or condition is selected from the group consisting of age-related macular degeneration, osteoarthritis, lipoatrophy, idiopathic pulmonary fibrosis, renal transplant failure, liver fibrosis, bone loss, sarcopenia, age-related loss of lung tissue elasticity, osteoporosis, age-related renal dysfunction, and chemically induced renal dysfunction. [The present invention 1018] The method of any one of claims 1001 to 1006, wherein said age-related disease or condition is type 2 diabetes or atherosclerosis. [The present invention 1019] A method for improving the texture and / or appearance of skin and / or hair over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more natural killer (NK) cell activators. [The present invention 1020] 1. A method of improving the texture and / or appearance of skin and / or hair over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective number of activated NK cells. [The present invention 1021] 1021. The method of claim 1019 or 1020, wherein said method provides an improvement in the texture and / or appearance of said subject's skin over said period of time. [The present invention 1022] The method of claim 1021, which results in a reduction in the rate of wrinkle formation in said subject's skin over said period of time. [The present invention 1023] 1023. The method of claim 1021 or 1022, which results in an improvement in skin pigmentation of said subject over said period of time. [The present invention 1024] 1024. The method of any of claims 1021 to 1023, which results in an improvement in the texture of the subject's skin over said period of time. [The present invention 1025] 1025. The method of any of claims 1020 to 1024, wherein said method provides an improvement in the texture and / or appearance of said subject's hair over said period of time. [The present invention 1026] 1026. The method of claim 1025, wherein said method results in a reduction in the rate of gray hair formation in said subject over said period of time. [The present invention 1027] 1027. The method of claim 1025 or 1026, which results in a reduction in the number of gray hairs in said subject over said period of time. [The present invention 1028] Any of the methods of claims 1025 to 1027, which results in a decrease in the rate of hair loss in said subject over time. [The present invention 1029] 1029. The method of any of claims 1025 to 1028, which results in an improvement in the texture of the subject's hair over said period of time. [The present invention 1030] 1029. Any of the methods of claims 1019 to 1029, which results in a decrease in the number of senescent dermal fibroblasts in the skin of said subject over said period of time. [The present invention 1031] A method for assisting in the treatment of obesity over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more natural killer (NK) cell activators. [The present invention 1032] 1. A method of assisting in the treatment of obesity over a period of time in a subject in need thereof, the method comprising administering to the subject a therapeutically effective number of activated NK cells. [The present invention 1033] Obtaining resting NK cells; contacting the resting NK cells in vitro in a liquid culture medium with one or more NK cell activators, resulting in the production of the activated NK cells, which are then administered to the subject; Any of the methods of inventions 1001 to 1032, further comprising: [The present invention 1034] 103. The method of claim 1033, wherein said resting NK cells are genetically engineered NK cells bearing a chimeric antigen receptor or a recombinant T cell receptor. [This invention 1035] The method of claim 1033, further comprising introducing a nucleic acid encoding a chimeric antigen receptor or a recombinant T cell receptor into said resting NK cells or said activated NK cells prior to administration to said subject. [The present invention 1036] Any of the methods of claims 1031 to 1035, which results in a decrease in the mass of the subject over said period of time. [This invention 1037] 1037. The method of any of claims 1031 to 1036, which results in a decrease in the body mass index (BMI) of said subject over said period of time. [The present invention 1038] 1036. Any of the methods of claims 1031 to 1035, which results in a reduction in the rate of progression from prediabetes to type 2 diabetes in said subject. [This invention 1039] 1036. The method of any of claims 1031 to 1035, which results in a decrease in fasting serum glucose levels in said subject. [The present invention 1040] 1036. The method of any of claims 1031 to 1035, which results in increased insulin sensitivity in said subject. [This invention 1041] 1036. The method of any of claims 1031 to 1035, which results in a reduction in the severity of atherosclerosis in said subject. [The present invention 1042] 10. The method of any of claims 1001 to 1041, wherein at least one of said one or more NK cell activators results in activation of one or more of IL-2 receptor, IL-7 receptor, IL-12 receptor, IL-15 receptor, IL-18 receptor, IL-21 receptor, IL-33 receptor, CD16, CD69, CD25, CD36, CD59, CD352, NKp80, DNAM-1, 2B4, NKp30, NKp44, NKp46, NKG2D, KIR2DS1, KIR2Ds2 / 3, KIR2DL4, KIR2DS4, KIR2DS5, and KIR3DS1. [This invention 1043] 3. The method of any of claims 1001 to 1042, wherein at least one of said one or more NK cell activators results in a decrease in activation of one or more of PD-1, TGF-β receptor, TIGIT, CD1, TIM-3, Siglec-7, IRP60, Tactile, IL1R8, NKG2A / KLRD1, KIR2DL1, KIR2DL2 / 3, KIR2DL5, KIR3DL1, KIR3DL2, ILT2 / LIR-1, and LAG-2. [This invention 1044] at least one of the one or more NK cell activators (i) a first target binding domain; (ii) a soluble tissue factor domain, and (iii) a second target-binding domain The method of any one of claims 1001 to 1041, wherein the chimeric polypeptide is a single-chain chimeric polypeptide comprising the above. [This invention 1045] 1045. The method of claim 1044, wherein said first target binding domain and said soluble tissue factor domain are immediately adjacent to each other. [The present invention 1046] 1045. The method of claim 1044, wherein said single-chain chimeric polypeptide further comprises a linker sequence between said first target binding domain and said soluble tissue factor domain. [This invention 1047] 1047. The method of any of claims 1044 to 1046, wherein said soluble tissue factor domain and said second target binding domain are immediately adjacent to each other. [This invention 1048] 1047. The method of any of claims 1044 to 1046, wherein said single-chain chimeric polypeptide further comprises a linker sequence between said soluble tissue factor domain and said second target binding domain. [This invention 1049] At least one of the one or more NK cell activators is a multi-chain chimeric polypeptide, the multi-chain chimeric polypeptide comprising: (e) a first chimeric polypeptide, (i) a first target binding domain; (ii) a soluble tissue factor domain, and (iii) the first domain of the pair of affinity domains a first chimeric polypeptide comprising: (f) a second chimeric polypeptide, (i) the second domain of the pair of affinity domains, and (ii) a second target-binding domain and a second chimeric polypeptide comprising: Including, Any of the methods of claims 1001 to 1041, wherein the first chimeric polypeptide and the second chimeric polypeptide are associated via binding between the first domain and the second domain of the pair of affinity domains. [The present invention 1050] 1049. The method of claim 1049, wherein said first target binding domain and said soluble tissue factor domain are immediately adjacent to each other within said first chimeric polypeptide. [This invention 1051] 1049. The method of claim 1049, wherein said first chimeric polypeptide further comprises a linker sequence between said first target binding domain and said soluble tissue factor domain within said first chimeric polypeptide. [This invention 1052] 1052. The method of any of claims 1049 to 1051, wherein said soluble tissue factor domain and said first domain of said pair of affinity domains are immediately adjacent to each other within said first chimeric polypeptide. [This invention 1053] Any of the methods of claims 1049 to 1051, wherein the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain in the first chimeric polypeptide and the first domain of the pair of affinity domains. [This invention 1054] The method of any of claims 1049 to 1053, wherein the second domain of said pair of affinity domains and said second target binding domain are immediately adjacent to each other within said second chimeric polypeptide. [This invention 1055] Any of the methods of claims 1049 to 1053, wherein the second chimeric polypeptide further comprises a linker sequence between the second domain of the pair of affinity domains within the second chimeric polypeptide and the second target binding domain. [This invention 1056] At least one of the one or more NK cell activators is a multi-chain chimeric polypeptide, the multi-chain chimeric polypeptide comprising: (a) first and second chimeric polypeptides, each comprising: (i) a first target binding domain; (ii) an Fc domain, and (iii) the first domain of the pair of affinity domains and a first and a second chimeric polypeptide comprising: (b) a third and a fourth chimeric polypeptide, each comprising: (i) the second domain of the pair of affinity domains, and (ii) a second target-binding domain and a third and fourth chimeric polypeptide comprising: Including, Any of the methods of inventions 1001 to 1041, wherein the first and second chimeric polypeptides and the third and fourth chimeric polypeptides are associated via binding between the first domain and the second domain of the pair of affinity domains, and the first and second chimeric polypeptides are associated via their Fc domains. [This invention 1057] One or both of the first target binding domain and the second target binding domain may be selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD12 2. Any of the methods of claims 1044 to 1056, wherein the antibody specifically binds to a target selected from the group consisting of CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHC1 ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor. [This invention 1058] The method of any of claims 1044 to 1056, wherein one or both of said first target binding domain and said second target binding domain is a soluble interleukin or cytokine protein. [This invention 1059] 1058. The method of claim 1058, wherein said soluble interleukin or cytokine protein is selected from the group consisting of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF. [The present invention 1060] The method of any of claims 1044 to 1056, wherein one or both of said first target binding domain and said second target binding domain is a soluble interleukin or cytokine receptor. [This invention 1061] 1060. The method of claim 1060, wherein said soluble receptor is a soluble TGF-β receptor II (TGF-βRII), a soluble TGF-βRIII, a soluble TNFα receptor, a soluble IL-4 receptor, or a soluble IL-10 receptor. [This invention 1062] 1056. The method of any one of claims 1044 to 1055, wherein said soluble tissue factor domain is a soluble human tissue factor domain that does not stimulate blood coagulation. [The present invention 1063] 1056. The method of any of claims 1043 to 1055, wherein said soluble tissue factor domain comprises or consists of a sequence derived from wild-type soluble human tissue factor. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. [Brief explanation of the drawings]

[0148] [Figure 1] 1A-1B show the results of immune stimulation of an exemplary multi-chain polypeptide in C57BL / 6 mice. Figure 1A shows the spleen weight of mice treated with increasing doses of an exemplary multi-chain polypeptide compared to mice treated with a control solution. Figure 1B shows the percentage of immune cell types present in the spleens of mice treated with increasing doses of an exemplary multi-chain polypeptide compared to mice treated with a control solution. [Figure 2] Figures 2A-2B show the duration of immune stimulation of an exemplary multi-chain polypeptide in C57BL / 6 mice. Figure 2A shows spleen weight over 92 hours in mice treated with 3 mg / kg of an exemplary multi-chain polypeptide. Figure 2B shows the percentage of immune cell types present in the spleen over 92 hours in mice treated with 3 mg / kg of an exemplary multi-chain polypeptide. [Figure 3] Figures 3A-3B show the expression of Ki67 and granzyme B in immune cells induced by an exemplary multi-chain polypeptide. Figure 3A shows the expression of Ki67 in CD4+ T cells, CD8+ T cells, natural killer (NK) cells, and CD19+ B cells at various time points after treatment with the multi-chain polypeptide. Figure 3B shows the expression of granzyme B in CD4+ T cells, CD8+ T cells, natural killer (NK) cells, and CD19+ B cells at various time points after treatment with the multi-chain polypeptide. [Figure 4] 1 shows the effect of tumor inhibition by splenocytes prepared from mice treated with exemplary multi-chain polypeptides at various time points after treatment. [Figure 5A]Figures 5A-5B show the percentages and proliferation rates of CD4+ T cells, CD8+ T cells, natural killer (NK) cells, and CD19+ B cells in the blood of untreated B6.129P2-ApoEtm1Unc / J mice (purchased from The Jackson Laboratory) fed a control diet, a high-fat diet, and mice fed a high-fat diet and treated with TGFRt15-TGFRs, 2t2, or 21t15-TGFRs. Figure 5A shows the percentages of different cell types in each control and experimental group. Figure 5B shows the proliferation rates of different cell types in each control and experimental group. [Figure 5B] See legend to Figure 5A. [Figure 6] 6A-6E show exemplary physical appearances of mice fed either a control diet or a high-fat diet and either untreated or treated with TGFRt15-TGFR, 2t2, or 21t15-TGFRs. [Figure 7] Fasting body weights of mice fed either a control or high-fat diet and either untreated or treated with TGFRt15-TGFR, 2t2, or 21t15-TGFRs are shown. [Figure 8] Fasting blood glucose levels are shown for mice fed either a control or high-fat diet and either untreated or treated with TGFRt15-TGFR, 2t2, or 21t15-TGFRs. [Figure 9] Figures 9A-9F show chemotherapy-induced senescent B16F10 cells and the expression of senescent genes. Figure 9A shows chemotherapy-induced senescent B16F10 cells visualized using SAβ-gal staining. Figures 9B-9F show the time-dependent expression of p21, IL6, DPP4, RATE1E, and ULBP1 in chemotherapy-induced senescent B16F10 cells. [Figure 10]Figures 10A-10F show colony formation and stem cell marker expression by chemotherapy-induced senescent B16F10 cells. Figure 10A shows colony formation by chemotherapy-induced senescent B16F10 cells. Figures 10B and 10C show Oct4 mRNA and Notch4 mRNA expression by chemotherapy-induced senescent B16F10 cells compared to control B16F10 cells. Figures 10D-10F show the percentage of chemotherapy-induced senescent B16F10 cells double-positive for two of three stem cell markers, including CD44, CD24, and CD133. [Figure 11] Figures 11A-11C show the migration and invasion properties of chemotherapy-induced senescent B16F10 cells. Figure 11A shows the results of a migration assay comparing chemotherapy-induced senescent cells with stem cell properties (B16F10-SNC-CSC) with control B16F10 cells. Figures 11B and 11C show the results of an invasion assay comparing chemotherapy-induced senescent cells with stem cell properties (B16F10-SNC-CSC) with control B16F10 cells. [Figure 12] Figures 12A and 12B show in vitro expanded NK cells and their cytotoxicity against chemotherapy-induced senescent cells with stem cell properties (B16F10-SNC-CSC) or control B16F10 cells. Figure 12A shows an exemplary schematic diagram of the process for obtaining in vitro expanded NK cells. Figure 12B shows the cytotoxicity of expanded NK cells against chemotherapy-induced senescent cells with stem cell properties (B16F10-SNC-CSC) or control B16F10 cells. [Figure 13] Figures 13A-13C show the results of combination therapy using a mouse melanoma model. Figure 13A shows an exemplary schematic diagram for treating melanoma in a mouse model. Figures 13B and 13C show the change in tumor volume over time with combination therapy including TGFRt15-TGFR compared to chemotherapy or TA99 treatment alone. [Figure 14]1 shows the induction of senescence in the human pancreatic tumor cell line SW1990 and the expression of CD44 and CD24 in senescent SW1990 cells compared to control SW1990 cells. [Figure 15] 1 shows the expression of senescence markers by chemotherapy-induced senescent SW1990 cells. [Figure 16] Figure 1 shows the cytotoxicity of in vitro activated human NK cells against chemotherapy-induced senescent SW1990 cells or control SW1990 cells. [Figure 17] 1 shows a schematic diagram of an exemplary IL-12 / IL-15RαSu DNA construct. [Figure 18] Schematic diagram of an exemplary IL-18 / TF / IL-15 DNA construct is shown. [Figure 19] FIG. 1 shows a schematic diagram of the interaction between exemplary IL-12 / IL-15RαSu and IL-18 / TF / IL-15 DNA constructs. [Figure 20] FIG. 1 shows a schematic diagram of the interaction between an exemplary IL-12 / IL-15RαSu fusion protein and an IL-18 / TF / IL-15 fusion protein, resulting in an IL-18 / TF / IL-15:IL-12 / IL-15RαSu complex (18t15-12s). [Figure 21] Chromatograph of purified 18t15-12s elution from an anti-TF antibody affinity column. [Figure 22] 1 shows an exemplary chromatographic profile of anti-TF antibody / SEC-purified 18t15-12s protein after elution on an analytical size-exclusion column, demonstrating the separation of the monomeric multiprotein 18t15-12s complex from protein aggregates. [Figure 23] An example of 4-12% SDS-PAGE of the 18t15-12s complex after disulfide bond reduction is shown. Lane 1: SeeBlue Plus2 marker, Lane 2: anti-TF Ab-purified 18t15-12s (0.5 μg), Lane 3: anti-TF Ab-purified 18t15-12s (1 μg). [Figure 24]SDS PAGE analysis of deglycosylated and non-deglycosylated 18t15-12s is shown. Lane 1: anti-TF Ab purified 18t15-12s (0.5 μg) (non-deglycosylated), lane 2: anti-TF Ab purified 18t15-12s (1 μg) (non-deglycosylated), lane 3: 18t15-12s (1 μg) (deglycosylated), lane 4: Mark12 unstained marker. [Figure 25] Sandwich ELISA of the 18t15-12s complex containing an anti-human tissue factor capture antibody and a biotinylated anti-human IL-12 detection antibody (BAF 219) is shown. [Figure 26] Sandwich ELISA of the 18t15-12s complex containing an anti-human tissue factor capture antibody and a biotinylated anti-human IL-15 detection antibody (BAM 247, R&D Systems) is shown. [Figure 27] Sandwich ELISA of the 18t15-12s complex containing an anti-human tissue factor capture antibody and a biotinylated anti-human IL-18 detection antibody (D045-6) is shown. [Figure 28] Sandwich ELISA of the 18t15-12s complex containing an anti-human tissue factor (I43) capture antibody and an anti-human tissue factor detection antibody. [Figure 29] IL-15-dependent 32D β-cell proliferation mediated by the 18t15-12s complex (open squares) and recombinant IL-15 (closed squares) is shown. [Figure 30] The biological activity of IL-18 in the 18t15-12s complex (open squares) is shown, with recombinant IL-18 (closed squares) and recombinant IL-12 (closed circles) serving as positive and negative controls, respectively. [Figure 31] The biological activity of IL-12 in the 18t15-12s complex (open squares) is shown, with recombinant IL-12 (closed circles) and recombinant IL-18 (closed squares) serving as positive and negative controls, respectively. [Figure 32] Figures 32A and 32B show the cell surface expression of CD25 on NK cells induced by the 18t15-12s complex and the cell surface expression of CD69 on NK cells induced by the 18t15-12s complex. [Figure 33] 1 shows flow cytometry graphs of intracellular IFN-γ expression in NK cells induced by the 18t15-12s complex. [Figure 34] 1 shows the cytotoxicity of 18t15-12s-induced human NK cells against K562 cells. [Figure 35] 1 shows a schematic diagram of an exemplary IL-12 / IL-15RαSu / αCD16 DNA construct. [Figure 36] Schematic diagram of an exemplary IL-18 / TF / IL-15 DNA construct is shown. [Figure 37] FIG. 1 shows a schematic diagram of the interaction between an exemplary IL-12 / IL-15RαSu / αCD16scFv DNA construct and an IL-18 / TF / IL-15 DNA construct. [Figure 38] 1 shows a schematic diagram of an exemplary 18t15-12s / αCD16 protein complex. [Figure 39] Sandwich ELISA of the 18t15-12s16 complex with anti-human tissue factor capture antibody and biotinylated anti-human IL-12 (BAF 219) (dark line) or anti-human tissue factor detection antibody (light line) is shown. [Figure 40] Schematic diagram of an exemplary TGFβRII / IL-15RαSu DNA construct is shown. [Figure 41] 1 shows a schematic diagram of an exemplary IL-21 / TF / IL-15 construct. [Figure 42] FIG. 1 shows a schematic diagram of the interaction between an exemplary IL-IL-21 / TF / IL-15 construct and a TGFβRII / IL-15RαSu construct. [Figure 43] FIG. 1 shows a schematic diagram of the interaction between an exemplary TGFβRII / IL-15RαSu fusion protein and an IL-21 / TF / IL-15 fusion protein, resulting in an IL-21 / TF / IL-15 / TGFβRII / IL-15RαSu complex (21t15-TGFRs). [Figure 44] Chromatograph of purified 21t15-TGFRs eluted from an anti-TF antibody affinity column. [Figure 45]1 shows an exemplary 21t15-TGFRs size exclusion chromatogram showing the main protein peak and a high molecular weight peak. [Figure 46] An example of 4-12% SDS-PAGE of the 21t15-TGFRs complex after disulfide bond reduction is shown. Lane 1: Mark12 unstained marker (numbers on the left indicate molecular weight in kDa), lane 2: 21t15-TGFRs (0.5 μg), lane 3: 21t15-TGFRs (1 μg), lane 4: 21t15-TGFRs (deglycosylated) (1 μg). The expected MW was 53 kDa and 39.08 kDa. [Figure 47] Sandwich ELISA of 21t15-TGFRs complexes containing anti-human tissue factor capture antibody and biotinylated anti-human IL-21 detection antibody (13-7218-81, BioLegend) is shown. [Figure 48] Sandwich ELISA of 21t15-TGFRs complexes containing anti-human tissue factor capture antibody and biotinylated anti-human IL-15 detection antibody (BAM 247, R&D Systems) is shown. [Figure 49] Sandwich ELISA of 21t15-TGFRs complexes containing anti-human tissue factor capture antibody and biotinylated anti-human TGFβRII detection antibody (BAF241, R&D Systems) is shown. [Figure 50] Sandwich ELISA of 21t15-TGFRs complexes containing anti-human tissue factor (I43) capture antibody and anti-human tissue factor detection antibody. [Figure 51] IL-15 dependent proliferation of 32D β cells mediated by 21t15-TGFRs complex (open squares) compared to IL-15 (closed squares). [Figure 52] The biological activity of the TGFβRII domain within the 21t15-TGFRs complex (open squares) is shown. TGFβRII / Fc (closed squares) served as a positive control. [Figure 53] 1 shows a flow cytometry graph of cell surface CD25 expression of NK cells induced by the 21t15-TGFRs complex. [Figure 54]1 shows a flow cytometry graph of cell surface CD69 expression of NK cells induced by the 21t15-TGFRs complex. [Figure 55] 1 shows flow cytometry graphs of intracellular IFN-γ expression in NK cells induced by the 21t15-TGFRs complex. [Figure 56] 1 shows the cytotoxicity of human NK cells induced by 21t15-TGFRs against K562 cells. [Figure 57] FIG. 1 is a schematic diagram of an exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptide. [Figure 58] 1 is a chromatograph showing the elution of an exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptide from an anti-tissue factor affinity column. [Figure 59] 1 is a chromatograph showing the elution of a Superdex 200 Increase 10 / 300 GL gel filtration column loaded with an exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptide. [Figure 60] Sodium dodecyl sulfate polyacrylamide gel (4-12% NuPage Bis-Tris gel) of an exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptide purified using an anti-tissue factor affinity column. [Figure 61] Figure 1 is a graph showing ELISA quantification of exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptides performed using the method described in Example 1. Purified tissue factor was used as a control. [Figure 62] 1 is a graph showing the ability of exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptides to stimulate CD25 expression in CD4+ T cells isolated from blood from two donors. The experiment was performed as described in Example 2. [Figure 63]1 is a graph showing the ability of exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptides to stimulate CD25 expression in CD8+ T cells isolated from blood from two donors. The experiment was performed as described in Example 2. [Figure 64] 1 is a graph showing the ability of exemplary αCD3scFv / TF / αCD28scFv single-chain chimeric polypeptides to stimulate CD69 expression in CD4+ T cells isolated from blood from two donors. The experiment was performed as described in Example 2. [Figure 65] Schematic diagram of an exemplary IL-7 / IL-15RαSu DNA construct is shown. [Figure 66] Schematic diagram of an exemplary IL-21 / TF / IL-15 DNA construct is shown. [Figure 67] FIG. 1 shows a schematic diagram of the interaction between exemplary IL-7 / IL-15RαSu and IL-21 / TF / IL-15 DNA constructs. [Figure 68] FIG. 1 shows a schematic diagram of the interaction between an exemplary IL-7 / IL-15RαSu fusion protein and an IL-21 / TF / IL-15 fusion protein, resulting in an IL-21 / TF / IL-15:IL-7 / IL-15RαSu complex (21t15-7s). [Figure 69] 1 shows a schematic diagram of an exemplary IL-21 / IL-15RαSu DNA construct. [Figure 70] Schematic diagram of an exemplary IL-7 / TF / IL-15 DNA construct is shown. [Figure 71] FIG. 1 shows a schematic diagram of the interaction between exemplary IL-21 / IL-15RαSu and IL-7 / TF / IL-15 DNA constructs. [Figure 72] FIG. 1 shows a schematic diagram of the interaction between an exemplary IL-21 / IL-15RαSu fusion protein and an IL-7 / TF / IL-15 fusion protein, resulting in an IL-7 / TF / IL-15:IL-21 / IL-15RαSU complex (7t15-21s). [Figure 73]Shown is the oxygen consumption rate (OCR) in picomoles / min of human NK cells (2 x 106 cells / mL) isolated from the blood of two different donors. [Figure 74] Figure 1 shows the extracellular acidification rate (ECAR) in mpH / min of human NK cells (2 x 106 cells / mL) isolated from the blood of two different donors. [Figure 75] A schematic diagram of the 7t15-16s21 construct is shown. [Figure 76] An additional schematic of the 7t15-16s21 construct is shown. [Figure 77] Figures 77A and 77B show the binding of 7t15-16s21 to CHO cells expressing human CD16b compared to a control protein. [Figure 78A] Figures 78A-78C show the results of an ELISA experiment using antibodies against IL-15, IL-21, and IL-7 to detect 7t15-16s21. [Figure 78B] See legend to Figure 78A. [Figure 78C] See legend to Figure 78A. [Figure 79] 1 shows the results of a 32D β cell proliferation assay using 7t15-16s21 or recombinant IL-15. [Figure 80] Chromatographic profile of 7t15-16s21 protein-containing cell culture supernatant after binding to and elution from anti-TF antibody resin. [Figure 81] 1 shows the analytical SEC profile of 7t15-16s21. [Figure 82] A schematic diagram of the TGFRt15-16s21 construct is shown. [Figure 83] An additional schematic of the TGFRt15-16s21 construct is shown. [Figure 84A]Figures 84A and 84B show the binding affinity of TGFRt15-16S21 and 7t15-21s to CHO cells expressing human CD16b. Figure 84A shows the binding affinity of TGFRt15-16S21 to CHO cells expressing human CD16b. Figure 84B shows the binding affinity of 7t15-21s to CHO cells expressing human CD16b. [Figure 84B] See legend to Figure 84A. [Figure 85] The results of TGFβ1 inhibition by TGFRt15-16s21 and TGFR-Fc are shown. [Figure 86] 1 shows the results of a 32D β cell proliferation assay using TGFRt15-16s21 or recombinant IL-15. [Figure 87A] Figures 87A to 87C show the results of ELISA to detect IL-15, IL-21, and TGFβRII in TGFRt15-16s21 with the corresponding antibodies. [Figure 87B] See legend to Figure 87A. [Figure 87C] See legend to Figure 87A. [Figure 88] 1 shows the chromatographic profile of TGFRt15-16s21 protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 89] The results of reducing SDS-PAGE analysis of TGFRt15-16s21 are shown. [Figure 90] A schematic diagram of the 7t15-7s construct is shown. [Figure 91] An additional schematic of the 7t15-7s construct is shown. [Figure 92] Chromatographic profile of 7t15-7s protein-containing cell culture supernatant after binding to and elution from anti-TF antibody resin. [Figure 93] 1 shows detection of TF, IL-15, and IL-7 in 7t15-7s using ELISA. [Figure 94]Figures 94A and 94B show spleen weights and percentages of immune cell types in TGFRt15-TGFRs-treated and control-treated mice. Figure 94A shows spleen weights in mice treated with 7t15-7s compared to PBS controls. Figure 94B shows the percentages of CD4+ T cells, CD8+ T cells, and NK cells in mice treated with 7t15-7s compared to PBS controls. [Figure 95] A schematic diagram of the TGFRt15-TGFRs construct is shown. [Figure 96] An additional schematic of the TGFRt15-TGFRs construct is shown. [Figure 97] The results of TGFβ1 inhibition by TGFRt15-TGFRs and TGFR-Fc are shown. [Figure 98] 1 shows the results of a 32D β cell proliferation assay using TGFRt15-TGFRs or recombinant IL-15. [Figure 99] Figures 99A and 99B show the results of detecting IL-15 and TGFβRII in TGFRt15-TGFRs with the corresponding antibodies using ELISA. [Figure 100] 1 is a line graph showing the chromatographic profile of TGFRt15-TGFRs protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 101] 1 shows the analytical SEC profile of TGFRt15-TGFRs. [Figure 102] Shown are TGFRt15-TGFRs before and after deglycosylation analyzed by reducing SDS-PAGE. [Figure 103] Figures 103A and 103B show spleen weights and percentages of immune cell types in TGFRt15-TGFRs-treated and control-treated mice. Figure 103A shows spleen weights in mice treated with TGFRt15-TGFRs compared to PBS controls. Figure 103B shows the percentages of CD4+ T cells, CD8+ T cells, and NK cells in mice treated with TGFRt15-TGFRs compared to PBS controls. [Figure 104] Figures 104A and 104B show spleen weight and immune stimulation over 92 hours in mice treated with TGFRt15-TGFRs. Figure 104A shows the spleen weight of mice treated with TGFRt15-TGFRs at 16, 24, 48, 72, and 92 hours after treatment. Figure 104B shows the percentage of immune cells in mice treated with TGFRt15-TGFRs at 16, 24, 48, 72, and 92 hours after treatment. [Figure 105] Figures 105A and 105B show Ki67 and Granzyme B expression over time in mice treated with TGFRt15-TGFRs. [Figure 106] 1 shows enhanced cytotoxicity of splenocytes by TGFRt15-TGFRs in C57BL / 6 mice. [Figure 107] 1 shows the change in tumor size in response to PBS treatment, chemotherapy alone, TGFRt15-TGFRs alone, or the combination of chemotherapy and TGFRt15-TGFRs in a mouse model of pancreatic cancer. [Figure 108] 1 shows the cytotoxicity of NK cells isolated from mice treated with TGFRt15-TGFRs. [Figure 109] A schematic diagram of the 7t15-21s137L (long version) construct is shown. [Figure 110] An additional schematic of the 7t15-21s137L (long version) construct is shown. [Figure 111] 1 is a line graph showing the chromatographic profile of 7t15-21s137L (long version) protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 112] The analytical SEC profile of 7t15-21s137L (long version) is shown. [Figure 113] Binding of 7t15-21s137L (short version) to CD137L (4.1BBL) is shown. [Figure 114A]Figures 114A-114C show the detection of IL-15, IL21, and IL7 in 7t15-21s137L (short version) using ELISA. Figure 114A shows the detection of IL-15 in 7t15-21s137L (short version) using ELISA. Figure 114B shows the detection of IL21 in 7t15-21s137L (short version) using ELISA. Figure 114C shows the detection of IL7 in 7t15-21s137L (short version) using ELISA. [Figure 114B] See legend to Figure 114A. [Figure 114C] See legend to Figure 114A. [Figure 115] 1 shows the results of a CTLL-2 cell proliferation assay. [Figure 116] 1 shows the activity of 7t15-1s137L (short version) in promoting proliferation of IL21R-containing B9 cells. [Figure 117] A schematic diagram of the 7t15-TGFRs construct is shown. [Figure 118] An additional schematic of the 7t15-TGFRs construct is shown. [Figure 119] The results of TGFβ1 inhibition by 7t15-TGFRs and TGFR-Fc are shown. [Figure 120A] 120A-120C show the detection of IL-15, TGFβRII, and IL-7 in 7t15-TGFRs using ELISA. [Figure 120B] See legend to Figure 120A. [Figure 120C] See legend to Figure 120A. [Figure 121] 1 shows the results of a 32D β cell proliferation assay using 7t15-TGFRs or recombinant IL-15. [Figure 122] 1 is a line graph showing the chromatographic profile of 7t15-TGFRs protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 123]Shown are 7t15-TGFRs before and after deglycosylation analyzed using reducing SDS-PAGE. [Figure 124] ELISA detection of IL-7, IL-15, and TGFβRII in 7t15-TGFRs protein. [Figure 125] Figures 125A and 125B show spleen weights and percentages of immune cell types in TGFRt15-TGFRs-treated and control-treated mice. Figure 125A shows the spleen weights of mice treated with various doses of 7t15-TGFRs compared to the PBS control. Figure 125B shows the percentages of CD4+ T cells, CD8+ T cells, and NK cells in mice treated with various doses of 7t15-TGFRs compared to the PBS control. [Figure 126] Figures 126A and 126B show upregulation of CD44 expression on CD4+ and CD8+ T cells by 7t15-TGFRs in C57BL / 6 mice. [Figure 127] Figures 127A and 127B show upregulation of Ki67 and Granzyme B expression in CD8+ T cells and NK cells by 7t15-TGFRs in C57BL / 6 mice. [Figure 128] 1 shows the enhanced cytotoxicity of splenocytes by 7t15-TGFRs in C57BL / 6 mice. [Figure 129] A schematic diagram of the TGFRt15-21s137L construct is shown. [Figure 130] An additional schematic of the TGFRt15-21s137L construct is shown. [Figure 131] 1 is a line graph showing the chromatographic profile of TGFRt15-21s137L protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 132] A schematic diagram of the TGFRt15-TGFRs21 construct is shown. [Figure 133] An additional schematic of the TGFRt15-TGFRs21 construct is shown. [Figure 134]1 is a line graph showing the chromatographic profile of TGFRt15-TGFRs21 protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 135] Shown is TGFRt15-TGFRs21 before and after deglycosylation analyzed by reducing SDS-PAGE. [Figure 136] Figures 136A and 136B show detection of the TGFRt15-TGFRs21 component using ELISA. [Figure 137] Figures 137A and 137B show the percentage and proliferation of CD4+ T cells, CD8+ T cells, and natural killer (NK) cells present in the spleens of control-treated and TGFRt15-TGFRs21-treated mice. [Figure 138] 1 shows upregulation of granzyme B expression in splenocytes in mice treated with TGFRt15-TGFRs21. [Figure 139] 1 shows the enhanced cytotoxicity of splenocytes by TGFRt15-TGFRs21 in C57BL / 6 mice. [Figure 140] A schematic diagram of the TGFRt15-TGFRs16 construct is shown. [Figure 141] An additional schematic of the TGFRt15-TGFRs16 construct is shown. [Figure 142] A schematic diagram of the TGFRt15-TGFRs137L construct is shown. [Figure 143] An additional schematic of the TGFRt15-TGFRs137L construct is shown. [Figure 144] FIG. 1 is a schematic diagram of an exemplary 2t2 single-chain chimeric polypeptide. [Figure 145] Figure 1 shows IL-2 activity in 2t2 compared to recombinant IL-2 using a 32D beta cell proliferation assay. [Figure 146] Figure 1 shows IL-2 activity in 2t2 compared to recombinant IL-2 using a CTLL-2 cell proliferation assay. [Figure 147]Fasting blood glucose levels in ApoE- / - mice fed a standard chow diet or a high-fat diet and treated with PBS control (untreated) or 2t2 are shown. [Figure 148] Shown are the ratios of CD4+CD25+FoxP3+ T regulatory cells in blood lymphocytes from ApoE- / - mice fed a standard chow diet or a high-fat diet and treated with PBS control (untreated) or 2t2. [Figure 149] 1 is a line graph showing the chromatographic profile of 2t2 protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 150] 2 shows the analytical SEC profile of 2t2. [Figure 151] Figures 151A and 151B show reducing SDS-PAGE analysis of 2t2 before and after deglycosylation. Figure 151A shows reducing SDS-PAGE analysis of 2t2 before deglycosylation. Figure 151B shows reducing SDS-PAGE analysis of 2t2 after deglycosylation. [Figure 152] Figures 152A and 152B show the results of immune stimulation of C57BL / 6 mice with 2t2. Figure 152A shows spleen weight after treatment with 2t2. Figure 152B shows the percentage of immune cell types after treatment with 2t2. [Figure 153] Figure 1 shows upregulation of CD25 expression on CD4+ T cells in mice treated with 2t2. [Fig. 154] Pharmacokinetics of 2t2 in C57BL / 6 mice. [Figure 155] Figures 155A and 155B show the effect of 2t2 in attenuating high-fat-induced atherosclerotic plaque formation in ApoE- / - mice. Figure 155A shows representative images of atherosclerotic plaques from ApoE- / - mice fed a standard chow diet or a high-fat diet and treated with either PBS control or 2t2. Figure 155B shows the results of quantitative analysis of atherosclerotic plaques in each group. [Figure 156] Fasting blood glucose levels in 2t2-treated mice compared to control-treated mice are shown. [Figure 157] The percentage of CD4+CD25+FoxP3+ Tregs in blood lymphocytes from 2t2-treated and control-treated mice is shown. [Figure 158] FIG. 1 is a schematic diagram of an exemplary 15t15 single-chain chimeric polypeptide. [Figure 159] Figure 1 shows the IL-15 activity of 15t15 compared to recombinant IL-15 in a 32D beta cell proliferation assay. [Figure 160] 1 is a line graph showing the chromatographic profile of 15t15 protein-containing cell culture supernatant after binding to and elution from an anti-TF antibody resin. [Figure 161] Figures 161A and 161B show reducing SDS-PAGE analysis of 15t15 before and after deglycosylation. Figure 161A shows reducing SDS-PAGE analysis of 15t15 before deglycosylation. Figure 161B shows reducing SDS-PAGE analysis of 15t15 after deglycosylation. [Figure 162A] Figures 162A and 162B are a series of histograms (Figure 162A) and a series of graphs (Figure 162B) showing changes in the surface phenotype of NK cells after stimulation with 18t15-12s, 18t15-12s16, and 7t15-21s plus anti-TF antibody. [Figure 162B] See legend to Figure 162A. [Figure 163] 1 is a series of graphs showing changes in surface phenotype of lymphocyte populations following stimulation with 18t15-12s, 18t15-12s16, and 7t15-21s. [Fig. 164] 10 is a series of graphs showing increased glycolysis in NK cells following treatment with 18t15-12s. [Figure 165] 1 is a series of graphs showing increased phospho-STAT4 and phospho-STAT5 levels in NK cells after stimulation with 18t15-12s. [Figure 166] 1 is a series of graphs showing that overnight stimulation of NK cells with 18t15-12s enhances cellular metabolism. [Figure 167]Figures 167A-C are a series of graphs showing immune stimulation in C57BL / 6 mice after treatment with 2t2. [Figure 168] Figures 168A-B are a series of graphs showing immune stimulation in C57BL / 6 mice following treatment with TGFRt15-TGFRs. [Figure 169A] Figures 169A-C are a series of graphs showing in vivo stimulation of Treg cells, NK cells, and CD8+ T cells in ApoE- / - mice fed a Western diet and treated with TGFRt15-TGFRs or 2t2. [Figure 169B] See legend to Figure 169A. [Figure 169C] See legend to Figure 169A. [Figure 170] Figures 170A-B are a series of graphs showing induction of splenocyte proliferation by 2t2 in C57BL / 6 mice. [Figure 171] Figures 171A-C are a series of graphs showing immune stimulation in C57BL / 6 mice following treatment with TGFRt15-TGFRs. [Fig. 172] FIG. 172A-B is a series of graphs showing in vivo induction of NK cell and CD8+ T cell proliferation in ApoE− / − mice fed a Western diet and treated with TGFRt15-TGFRs or 2t2. [Figure 173] 1 is a schematic diagram and series of graphs showing the persistence of 7t15-21s and anti-TF antibody-expanded NK cells in NSG mice after treatment with 7t15-21, TGFRt15-TGFRs, or 2t2. [Fig. 174] Figures 174A-B are a series of graphs showing enhanced NK cell cytotoxicity following treatment of NK cells with TGFRt15-TGFRs. [Figure 175] Figures 175A-B are a series of graphs showing enhanced ADCC activity of NK cells after treatment of the cells with TGFRt15-TGFRs. [Figure 176] 1 is a graph of in vitro killing of senescent B16F10 melanoma cells by TGFRt15-TGFRs / 2t2 activated mouse NK cells. [Figure 177A] Figures 177A-H are a series of graphs showing the anti-tumor activity of TGFRt15-TGFRs + anti-TRP1 antibody (TA99) in combination with chemotherapy in a melanoma mouse model. [Figure 177B] See legend to Figure 177A. [Figure 177C] See legend to Figure 177A. [Figure 177D] See legend to Figure 177A. [Figure 177E] See legend to Figure 177A. [Figure 177F] See legend to Figure 177A. [Figure 177G] See legend to Figure 177A. [Figure 177H] See legend to Figure 177A. [Figure 178] Figures 178A-C are a series of graphs showing amelioration of Western diet-induced hyperglycemia in ApoE- / - mice by 2t2. [Figure 179] 1 is a series of graphs showing cell surface staining summarizing the differentiation of NK cells into cytokine-induced memory-like NK cells (CIML-NK cells) after stimulation with 18t15-12s and culture in rhIL15. [Figure 180] The upper panel shows the upregulation of CD44 memory T cells upon treatment with TGFRt15-TGFRs. The lower panel shows the upregulation of CD44 memory T cells upon treatment with 2t2. [Figure 181A] Figures 181A and 181B show the improvement of hair growth after depilation in mice treated with 2t2 or IL-2. Figure 181A shows the pigmentation of the skin 10 days after depilation in mice treated with PBS, 2t2, or IL-2. Figure 181B shows the pigmentation rate of mice treated with PBS, 2t2, or IL-2, analyzed using ImageJ software. [Figure 181B] See legend to Figure 181A. [Figure 182]Skin pigmentation 14 days after depilation in mice treated with PBS, 2t2, and IL-2. [Figure 183] 1 shows a graph of Factor X (FX) activation after treatment with single-chain or multi-chain chimeric polypeptides. [Figure 184] 1 shows the clotting time of buffer solutions with various concentrations of Innovin in a prothrombin time (PT) test. [Figure 185] 1 shows the clotting time of multi-chain chimeric polypeptides in a PT assay. [Figure 186] 1 shows the clotting time of multi-chain chimeric polypeptides in a PT assay when mixed with 32DB cells. [Figure 187] 1 shows the clotting time of multi-chain chimeric polypeptides in a PT assay when mixed with human PBMCs. [Figure 188] Binding of 7t15-21s137L (long version) and 7t15-21s137L (short version) to CD137 (4.1BB) is shown. [Figure 189A] Figures 189A to 189D show the detection of IL7, IL21, IL15, and 4.1BBL in 7t15-21s137L (long version) by their respective antibodies using ELISA. [Figure 189B] See legend to Figure 189A. [Figure 189C] See legend to Figure 189A. [Figure 189D] See legend to Figure 189A. [Figure 190] IL-15 activity of 7t15-21s137L (long version) and 7t15-21s137L (short version) assessed by IL2Rαβγ-containing CTLL2 cell proliferation assay is shown. [Figure 191]Figures 191A-191C show human blood lymphocyte pStat5a responses in CD4+CD25high Treg cells, CD4+CD25- Tcon cells, or CD8+ Tcon cells in response to treatment with 2T2 or IL2. Figure 191A shows the pSTAT5 response in CD4+CD25high Treg cells. Figure 191B shows the pSTAT5 response in CD4+CD25high Treg cells. Figure 191C shows the pSTAT5 response in CD8+ Tcon cells. [Figure 192] Figures 192A-192E are a series of images showing that treatment with an IL-2-based molecule (2t2) can induce hair follicle formation after hair removal in a mouse model. Figure 192A shows an image from a control mouse that was shaved and then depilated; Figure 192B shows an image from a mouse that received a low dose of IL-2 (1 mg / kg) after hair removal; and Figures 192C-192E show images from mice that received 0.3 mg / kg (Figure 192C), 1 mg / kg (Figure 192D), and (Figure 192E) 3 mg / kg 2t2 after hair removal. Black arrows indicate anagen hair follicles that later extend into the dermis and promote hair growth. [Figure 193] The total number of anagen hair follicles counted per 10 fields for each treatment group is shown. [Figure 194] Graph showing different percentages of DNA demethylation in NK cells from two different donors after expansion with 7t15-21s plus anti-tissue factor (TF) antibody (IgG1) (50 nM) compared to unexposed NK cells. DETAILED DESCRIPTION OF THE INVENTION

[0149] Detailed Description Provided herein are methods for treating an age-related disease or condition in a subject in need thereof, the methods comprising administering to the subject identified as having an age-related disease or condition a therapeutically effective number of one or more natural killer (NK) cell activators and / or activated NK cells. Also provided herein are methods for killing or reducing the number of senescent cells in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective number of one or more NK cell activators and / or activated NK cells. Also provided herein are methods for improving skin and / or hair texture and / or appearance over a period of time in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective number of one or more natural killer (NK) cell activators and / or activated NK cells. Also provided herein are methods for assisting in the treatment of obesity over a period of time in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective number of a therapeutically effective amount of one or more natural killer (NK) cell activators and / or activated NK cells.

[0150] Activated NK cells Some embodiments of any of the methods described herein may include administering to a subject (e.g., any of the exemplary subjects described herein) a therapeutically effective number of activated NK cells (e.g., human activated NK cells). Activated NK cells are, for example, NK cells (e.g., human NK cells) that exhibit increased expression levels of two or more (e.g., three, four, five, or six) of CD25, CD69, MTOR-C1, SREBP1, IFN-γ, and a granzyme (e.g., granzyme B) compared to resting NK cells (e.g., human resting NK cells). For example, activated NK cells may exhibit at least a 10% increase (e.g., at least a 15% increase, at least a 20% increase, at least a 25% increase, at least a 30% increase, at least a 35% increase, at least a 40% increase, at least a 45% increase, at least a 50% increase, at least a 55% increase, at least a 60% increase, at least a 70% increase, at least a 80% increase, at least a 90% increase, at least a 10 ... increase, at least a 65% increase, at least a 70% increase, at least a 75% increase, at least an 80% increase, at least an 85% increase, at least a 90% increase, at least a 95% increase, at least a 100% increase, at least a 120% increase, at least a 140% increase, at least a 160% increase, at least a 180% increase, at least a 200% increase, at least a 220% increase, at least a 240% increase, at least a 260% increase, at least a 280% increase, or at least a 300% increase) (e.g., compared to resting NK cells (e.g., human activated NK cells)).

[0151] In some embodiments, the activated NK cells optionally contain one or more of the following: CD25, CD59, CD352, NKp80, DNAM-1, 2B4, NKp30, NKp44, NKp46, NKG2D, CD16, KIR2DS1, KIR2Ds2 / 3, KIR2DL4, KIR2DS4, KIR2DS5, KIR3DS1, NKG2C, CCR7, CXCR3, L-selectin, CXCR1, CXCR2, CX3CR at least a 10% increase (e.g., at least a 15% increase, at least a 20% increase, at least a 30% increase, at least a 40% increase, at least a 50% increase, at least a 60% increase, at least a 70% increase, at least a 90% increase, at least a 1 ... The NK cells may further have at least a 25% increase, at least a 30% increase, at least a 35% increase, at least a 40% increase, at least a 45% increase, at least a 50% increase, at least a 55% increase, at least a 60% increase, at least a 65% increase, at least a 70% increase, at least a 75% increase, at least an 80% increase, at least an 85% increase, at least a 90% increase, at least a 95% increase, at least a 100% increase, at least a 120% increase, at least a 140% increase, at least a 160% increase, at least a 180% increase, at least a 200% increase, at least a 220% increase, at least a 240% increase, at least a 260% increase, at least a 280% increase, or at least a 300% increase) (e.g., compared to resting NK cells (e.g., human activated NK cells)).

[0152] For example, activated NK cells (e.g., human activated NK cells) may exhibit an increase in expression levels of two or more (e.g., three, four, five, or six) of CD25, CD69, mTORC1, SREBP1, IFN-γ, and granzymes (e.g., granzyme B) of about 10% to about 500% increase, about 10% to about 450% increase, about 10% to about 400% increase, about 10% to about 350% increase, about 10% to about 300% increase, about 10% to about 280% increase, about 10% to about 260% increase, about 10% increase, or about 10% increase. Increased to approximately 240% increase, increased by approximately 10% to approximately 220% increase, increased by approximately 10% to approximately 200% increase, increased by approximately 10% to approximately 180% increase, increased by approximately 10% to approximately 160% increase, increased by approximately 10% to approximately 140% increase, increased by approximately 10% to approximately 120% increase, increased by approximately 10% to approximately 100% increase, increased by approximately 10% to approximately 80% increase, increased by approximately 10% to approximately 60% increase, increased by approximately 10% to approximately 40% increase, increased by approximately 10% to approximately 20% increase, increased by approximately 20% to approximately 500% increase, increased by approximately 20% to approximately 450% increase, increased by approximately 20% to approximately 400% increase, increased by approximately 20% Increased to approximately 350% increase, approximately 20% increase to approximately 300% increase, approximately 20% increase to approximately 280% increase, approximately 20% increase to approximately 260% increase, approximately 20% increase to approximately 240% increase, approximately 20% increase to approximately 220% increase, approximately 20% increase to approximately 200% increase, approximately 20% increase to approximately 180% increase, approximately 20% increase to approximately 160% increase, approximately 20% increase to approximately 140% increase, approximately 20% increase to approximately 120% increase, approximately 20% increase to approximately 100% increase, approximately 20% increase to approximately 80% increase, approximately 20% increase to approximately 60% increase, approximately 20% increase to approximately 40% increase, 40% increase Increase ~ approximately 500% increase, approximately 40% increase ~ approximately 450% increase, approximately 40% increase ~ approximately 400% increase, approximately 40% increase ~ approximately 350% increase, approximately 40% increase ~ approximately 300% increase, approximately 40% increase ~ approximately 280% increase, approximately 40% increase ~ approximately 260% increase, approximately 40% increase ~ approximately 240% increase, approximately 40% increase ~ approximately 220% increase, approximately 40% increase ~ approximately 200% increase, approximately 40% increase ~ approximately 180% increase, approximately 40% increase ~ approximately 160% increase, approximately 40% increase ~ approximately 140% increase, approximately 40% increase ~ approximately 120% increase, approximately 40% increase ~ approximately 100% increase,Approximately 40% increase to approximately 80% increase, approximately 40% increase to approximately 60% increase, 60% increase to approximately 500% increase, approximately 60% increase to approximately 450% increase, approximately 60% increase to approximately 400% increase, approximately 60% increase to approximately 350% increase, approximately 60% increase to approximately 300% increase, approximately 60% increase to approximately 280% increase, approximately 60% increase to approximately 260% increase, approximately 60% increase to approximately 240% increase, approximately 60% increase to approximately 220% increase, approximately 60% increase to approximately 200% increase, approximately 60% increase to approximately 180% increase, approximately 60% increase to approximately 160% increase, approximately 60% increase to approximately 14 0% increase, approximately 60% increase to approximately 120% increase, approximately 60% increase to approximately 100% increase, approximately 60% increase to approximately 80% increase, 80% increase to approximately 500% increase, approximately 80% increase to approximately 450% increase, approximately 80% increase to approximately 400% increase, approximately 80% increase to approximately 350% increase, approximately 80% increase to approximately 300% increase, approximately 80% increase to approximately 280% increase, approximately 80% increase to approximately 260% increase, approximately 80% increase to approximately 240% increase, approximately 80% increase to approximately 220% increase, approximately 80% increase to approximately 200% increase, approximately 80% increase to approximately 180% increase, approximately 80% Increase ~ approximately 160% increase, approximately 80% increase ~ approximately 140% increase, approximately 80% increase ~ approximately 120% increase, approximately 80% increase ~ approximately 100% increase, 100% increase ~ approximately 500% increase, approximately 100% increase ~ approximately 450% increase, approximately 100% increase ~ approximately 400% increase, approximately 100% increase ~ approximately 350% increase, approximately 100% increase ~ approximately 300% increase, approximately 100% increase ~ approximately 280% increase, approximately 100% increase ~ approximately 260% increase, approximately 100% increase ~ approximately 240% increase, approximately 100% increase ~ approximately 220% increase, approximately 100% increase ~ approximately 200% increase, approximately 100 % increase ~ approximately 180% increase, approximately 100% increase ~ approximately 160% increase, approximately 100% increase ~ approximately 140% increase, approximately 100% increase ~ approximately 120% increase, 120% increase ~ approximately 500% increase, approximately 120% increase ~ approximately 450% increase, approximately 120% increase ~ approximately 400% increase, approximately 120% increase ~ approximately 350% increase, approximately 120% increase ~ approximately 300% increase, approximately 120% increase ~ approximately 280% increase, approximately 120% increase ~ approximately 260% increase, approximately 120% increase ~ approximately 240% increase, approximately 120% increase ~ approximately 220% increase, approximately 120% increase ~ approximately 200% increase,Approximately 120% increase to approximately 180% increase, approximately 120% increase to approximately 160% increase, approximately 120% increase to approximately 140% increase, 140% increase to approximately 500% increase, approximately 140% increase to approximately 450% increase, approximately 140% increase to approximately 400% increase, approximately 140% increase to approximately 350% increase, approximately 140% increase to approximately 300% increase, approximately 140% increase to approximately 280% increase, approximately 140% increase to approximately 260% increase, approximately 140% increase to approximately 240% increase, approximately 140% increase to approximately 220% increase, approximately 140% increase to approximately 200% increase, approximately 140% increase to approximately 180 % increase, approximately 140% increase to approximately 160% increase, 160% increase to approximately 500% increase, approximately 160% increase to approximately 450% increase, approximately 160% increase to approximately 400% increase, approximately 160% increase to approximately 350% increase, approximately 160% increase to approximately 300% increase, approximately 160% increase to approximately 280% increase, approximately 160% increase to approximately 260% increase, approximately 160% increase to approximately 240% increase, approximately 160% increase to approximately 220% increase, approximately 160% increase to approximately 200% increase, approximately 160% increase to approximately 180% increase, 180% increase to approximately 500% increase, approximately 180% increase Approximately 450% increase, approximately 180% increase to approximately 400% increase, approximately 180% increase to approximately 350% increase, approximately 180% increase to approximately 300% increase, approximately 180% increase to approximately 280% increase, approximately 180% increase to approximately 260% increase, approximately 180% increase to approximately 240% increase, approximately 180% increase to approximately 220% increase, approximately 180% increase to approximately 200% increase, 200% increase to approximately 500% increase, approximately 200% increase to approximately 450% increase, approximately 200% increase to approximately 400% increase, approximately 200% increase to approximately 350% increase, approximately 200% increase to approximately 300% increase, approximately 200 % increase ~ approximately 280% increase, approximately 200% increase ~ approximately 260% increase, approximately 200% increase ~ approximately 240% increase, approximately 200% increase ~ approximately 220% increase, 220% increase ~ approximately 500% increase, approximately 220% increase ~ approximately 450% increase, approximately 220% increase ~ approximately 400% increase, approximately 220% increase ~ approximately 350% increase, approximately 220% increase ~ approximately 300% increase, approximately 220% increase ~ approximately 280% increase, approximately 220% increase ~ approximately 260% increase, approximately 220% increase ~ approximately 240% increase, 240% increase ~ approximately 500% increase, approximately 240% increase ~ approximately 450% increase,Approximately 240% increase to approximately 400% increase, approximately 240% increase to approximately 350% increase, approximately 240% increase to approximately 300% increase, approximately 240% increase to approximately 280% increase, approximately 240% increase to approximately 260% increase, 260% increase to approximately 500% increase, approximately 260% increase to approximately 450% increase, approximately 260% increase to approximately 400% increase, approximately 260% increase to approximately 350% increase, approximately 260% increase to approximately 300% increase, approximately 260% increase to approximately 280% increase, 280% increase to approximately 500% increase, approximately 280% increase to approximately 450% increase, approximately 280% increase to approximately 400% increase, The NK cells may have an increase of about 280% to about 350%, an increase of about 280% to about 300%, an increase of 300% to about 500%, an increase of about 300% to about 450%, an increase of about 300% to about 400%, an increase of about 300% to about 350%, an increase of 350% to about 500%, an increase of about 350% to about 450%, an increase of about 350% to about 400%, an increase of 400% to about 500%, an increase of about 400% to about 450%, or an increase of 400% to about 500% (e.g., compared to resting NK cells (e.g., human resting NK cells)).

[0153] In some embodiments, the activated NK cells are selected from the group consisting of CD25, CD59, CD352, NKp80, DNAM-1, 2B4, NKp30, NKp44, NKp46, NKG2D, CD16, KIR2DS1, KIR2Ds2 / 3, KIR2DL4, KIR2DS4, KIR2DS5, KIR3DS1, NKG2C, CCR7, CXCR3, L-selectin, CXCR1, CXCR2, CX3CR1, ChemR23, CXCR4, CCR5, S1P5, c-Kit , may further have about a 10% increase to about a 500% increase (e.g., or any sub-range of this range described herein) in the expression levels of two or more (e.g., three, four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) of mTORC1 (e.g., compared to resting NK cells (e.g., human activated NK cells)).

[0154] Non-limiting examples of assays that can be used to determine expression levels of CD25, CD69, CD59, CD352, NKp80, DNAM-1, 2B4, NKp30, NKp44, NKp46, NKG2D, CD16, KIR2DS1, KIR2Ds2 / 3, KIR2DL4, KIR2DS4, KIR2DS5, KIR3DS1, NKG2C, CCR7, CXCR3, L-selectin, CXCR1, CXCR2, CX3CR1, ChemR23, CXCR4, CCR5, S1P5, c-Kit, mTORC1, SREBP1, IFN-γ, and granzymes (e.g., granzyme B) include, for example, immunoblotting, fluorescence-assisted cell sorting, enzyme-linked immunosorbent assay, and RT-PCR.

[0155] Non-limiting examples of commercially available ELISA assays that can be used to determine CD25 expression levels are available from Diaclone, Covalab Biotechnology, and CaltagMedsystems. The protein and cDNA sequences of mature human CD25 are shown below. Mature human CD25 protein (SEQ ID NO: 1) TIFF0007773577000001.tif21152 Human CD25 cDNA (SEQ ID NO: 2) TIFF0007773577000002.tif57151

[0156] Non-limiting examples of commercially available ELISA assays that can be used to determine the expression level of CD69 are available from RayBiotech, Novus Biologicals, and AvisceraBioscience. The protein and cDNA sequences of mature human CD69 are shown below. Mature human CD69 protein (SEQ ID NO: 3) TIFF0007773577000003.tif17152 Human CD69 cDNA (SEQ ID NO: 4) TIFF0007773577000004.tif43151

[0157] The protein and cDNA sequences of mature human CD59 are shown below. Mature human CD59 protein (SEQ ID NO: 5) TIFF0007773577000005.tif8137 Human CD59 cDNA (SEQ ID NO: 6) TIFF0007773577000006.tif30151

[0158] The protein and cDNA sequences of mature human CD352 are shown below. Mature human CD352 protein (SEQ ID NO: 7) TIFF0007773577000007.tif27152 Human CD352 cDNA (SEQ ID NO: 8) TIFF0007773577000008.tif74151

[0159] The protein and cDNA sequences of mature human NKp80 are shown below. Mature human NKp80 protein (SEQ ID NO: 9) TIFF0007773577000009.tif17152 Human NKp80 cDNA (SEQ ID NO: 10) TIFF0007773577000010.tif43151

[0160] The protein and cDNA sequences of mature human DNAM-1 are shown below. Mature human DNAM-1 protein (SEQ ID NO: 11) TIFF0007773577000011.tif28152 Human DNAM-1 cDNA (SEQ ID NO: 12) TIFF0007773577000012.tif74151

[0161] The protein and cDNA sequences of mature human 2B4 are shown below. Mature human 2B4 protein (SEQ ID NO: 13) TIFF0007773577000013.tif28152 Human 2B4 cDNA (SEQ ID NO: 14) TIFF0007773577000014.tif83151

[0162] The protein and cDNA sequences of mature human NKp30 are shown below. Mature human NKp30 protein (SEQ ID NO: 15) TIFF0007773577000015.tif18152 Human NKp30 cDNA (SEQ ID NO: 16) TIFF0007773577000016.tif43151

[0163] The protein and cDNA sequences of mature human NKp44 are shown below. Mature human NKp44 protein (SEQ ID NO: 17) TIFF0007773577000017.tif22152 Human NKp44 cDNA (SEQ ID NO: 18) TIFF0007773577000018.tif56151

[0164] The protein and cDNA sequences of mature human NKp46 are shown below. Mature human NKp46 protein (SEQ ID NO: 19) TIFF0007773577000019.tif23152 Human NKp46 cDNA (SEQ ID NO: 20) TIFF0007773577000020.tif56151

[0165] The protein and cDNA sequences of mature human NKG2D are shown below. Mature human NKG2D protein (SEQ ID NO: 21) TIFF0007773577000021.tif17152 Human NKG2D cDNA (SEQ ID NO: 22) TIFF0007773577000022.tif48151

[0166] The protein and cDNA sequences of mature human CD16a are shown below. Mature human CD16a protein (SEQ ID NO: 23) TIFF0007773577000023.tif26152 Human CD16a cDNA (SEQ ID NO: 24) TIFF0007773577000024.tif96128

[0167] The protein and cDNA sequences of mature human CD16b are shown below. Mature human CD16b protein (SEQ ID NO: 25) TIFF0007773577000025.tif17152 Human CD16b cDNA (SEQ ID NO: 26) TIFF0007773577000026.tif65128

[0168] The protein and cDNA sequences of mature human KIR2DS1 are shown below. Human KIR2DS1 protein (SEQ ID NO: 27) TIFF0007773577000027.tif26152 Human KIR2DS1 cDNA (SEQ ID NO: 28) TIFF0007773577000028.tif83128

[0169] The protein and cDNA sequences of mature human KIR2DS2 are shown below. Human KIR2DS2 protein (SEQ ID NO: 29) TIFF0007773577000029.tif26152 Human KIR2DS2 cDNA (SEQ ID NO: 30) TIFF0007773577000030.tif91128

[0170] The protein and cDNA sequences of mature human KIR2DS3 are shown below. Mature human KIR2DS3 protein (SEQ ID NO: 31) TIFF0007773577000031.tif26152 Human KIR2DS3 cDNA (SEQ ID NO: 32) TIFF0007773577000032.tif83128

[0171] The protein and cDNA sequences of mature human KIR2DL4 are shown below. Mature human KIR2DL4 protein (SEQ ID NO: 33) TIFF0007773577000033.tif28152 Human KIR2DL4 cDNA (SEQ ID NO: 34) TIFF0007773577000034.tif113128

[0172] The protein and cDNA sequences of mature human KIR2DS4 are shown below. Mature human KIR2DS4 protein (SEQ ID NO: 35) TIFF0007773577000035.tif18152 Human KIR2DS4 cDNA (SEQ ID NO: 36) TIFF0007773577000036.tif78128

[0173] The protein and cDNA sequences of mature human KIR2DS5 are shown below. Mature human KIR2DS5 (SEQ ID NO: 37) TIFF0007773577000037.tif23152 Human KIR2DS5 cDNA (SEQ ID NO: 38) TIFF0007773577000038.tif83128

[0174] The protein and cDNA sequences of mature human KIR3DS1 are shown below. Mature human KIR3DS1 cDNA (SEQ ID NO: 39) TIFF0007773577000039.tif32152 Human KIR3DS1 cDNA (SEQ ID NO: 40) TIFF0007773577000040.tif101128

[0175] The protein and cDNA sequences of mature human NKG2C are shown below. Mature human NKG2C protein (SEQ ID NO: 41) TIFF0007773577000041.tif17152 Human NKG2C cDNA (SEQ ID NO: 42) TIFF0007773577000042.tif61128

[0176] The protein and cDNA sequences of mature human CCR7 are shown below. Mature human CCR7 protein (SEQ ID NO: 43) TIFF0007773577000043.tif28152 Human CCR7 cDNA (SEQ ID NO: 44) TIFF0007773577000044.tif100128

[0177] The protein and cDNA sequences of mature human CXCR3 are shown below. Mature human CXCR3 protein (SEQ ID NO: 45) TIFF0007773577000045.tif30152 Human CXCR3 cDNA (SEQ ID NO: 46) TIFF0007773577000046.tif109128

[0178] The protein and cDNA sequences of mature human L-selectin are shown below. Mature human L-selectin protein (SEQ ID NO: 47) TIFF0007773577000047.tif28152 Human L-selectin cDNA (SEQ ID NO: 48) TIFF0007773577000048.tif104128

[0179] The protein and cDNA sequences of mature human CXCR1 are shown below. Mature human CXCR1 protein (SEQ ID NO: 49) TIFF0007773577000049.tif26152 Human CXCR1 cDNA (SEQ ID NO: 50) TIFF0007773577000050.tif96128

[0180] The protein and cDNA sequences of mature human CXCR2 are shown below. Mature human CXCR2 protein (SEQ ID NO: 51) TIFF0007773577000051.tif26152 Human CXCR2 cDNA (SEQ ID NO: 52) TIFF0007773577000052.tif96128

[0181] The protein and cDNA sequences of mature human CX3CR1 are shown below. Mature human CX3CR1 protein (SEQ ID NO: 53) TIFF0007773577000053.tif26152 Human CX3CR1 cDNA (SEQ ID NO: 54) TIFF0007773577000054.tif96128

[0182] The protein and cDNA sequences of mature human ChemR23 are shown below. Mature human ChemR23 protein (SEQ ID NO: 55) TIFF0007773577000055.tif30152 Human ChemR23 cDNA (SEQ ID NO: 56) TIFF0007773577000056.tif101128

[0183] The protein and cDNA sequences of mature human CXCR4 are shown below. Mature human CXCR4 protein (SEQ ID NO: 57) TIFF0007773577000057.tif26152 Human CXCR4 cDNA (SEQ ID NO: 58) TIFF0007773577000058.tif97130

[0184] The protein and cDNA sequences of mature human CCR5 are shown below. Mature human CCR5 protein (SEQ ID NO: 59) TIFF0007773577000059.tif26152 Human CCR5 cDNA (SEQ ID NO: 60) TIFF0007773577000060.tif96128

[0185] The protein and cDNA sequences of mature human S1P5 are shown below. Mature human S1P5 protein (SEQ ID NO: 61) TIFF0007773577000061.tif31152 Human S1P5 cDNA (SEQ ID NO: 62) TIFF0007773577000062.tif105128

[0186] The protein and cDNA sequences of mature human C-kit are shown below. Mature human C-kit protein (SEQ ID NO: 63) TIFF0007773577000063.tif75152 Human C-kit cDNA (SEQ ID NO: 64) TIFF0007773577000064.tif184128TIFF0007773577000065.tif74128

[0187] The protein and cDNA sequences of mature human mTOR are shown below. Mature human mTOR protein (SEQ ID NO: 65) TIFF0007773577000066.tif188152 Human mTOR cDNA (SEQ ID NO: 66) TIFF0007773577000067.tif124138TIFF0007773577000068.tif218138TIFF0007773577000069.tif218138TIFF0007773577000070.tif134138

[0188] Non-limiting examples of commercially available ELISA assays that can be used to determine expression levels of SREBP1 are available from Novus Biologicals and Abcam. The protein and cDNA sequences of mature human SREBP1 are shown below. Mature human SREBP1 protein (SEQ ID NO: 67) TIFF0007773577000071.tif157153 Human SREBP1 cDNA (SEQ ID NO: 68) TIFF0007773577000072.tif78128TIFF0007773577000073.tif223116

[0189] Non-limiting examples of commercially available ELISA assays that can be used to determine IFN-γ expression levels are available from R&D Systems, Thermo Fisher Scientific, Abcam, Enzo Life Sciences, and RayBiotech. The protein and cDNA sequences for mature human IFN-γ are shown below. Mature human IFN-γ (SEQ ID NO: 69) TIFF0007773577000074.tif11138 Human IFN-γ cDNA (SEQ ID NO: 70) TIFF0007773577000075.tif36138

[0190] Non-limiting examples of commercially available ELISA assays that can be used to determine expression levels of granzyme B are available from RayBiotech, Thermo Fisher Scientific, and R&D Systems. The protein and cDNA sequences of mature human granzyme B are shown below. Mature human granzyme B (SEQ ID NO: 71) TIFF0007773577000076.tif24152 Human granzyme B cDNA (SEQ ID NO: 72) TIFF0007773577000077.tif64138

[0191] Non-limiting examples of commercially available ELISA assays that can be used to determine expression levels of MYC are available from Invitrogen, LSBio, Biocodon Technologies, and ElisaGenie. The protein and cDNA sequences of mature human MYC are shown below. Human Myc protein (SEQ ID NO: 329) TIFF0007773577000078.tif45138 Human Myc cDNA (SEQ ID NO: 330) TIFF0007773577000079.tif135138

[0192] In some embodiments, activated NK cells (e.g., human activated NK cells) may exhibit an increased ability (e.g., at least a 10% increase, at least a 20% increase, at least a 30% increase, at least a 40% increase, at least a 50% increase, at least a 60% increase, at least a 70% increase, at least a 80% increase, at least a 90% increase, at least a 100% increase, at least a 120% increase, at least a 140% increase, at least a 160% increase, at least a 180% increase, at least a 200% increase, at least a 220% increase, at least a 240% increase, at least a 260% increase, at least a 280% increase, or at least a 300% increase) to kill senescent cells (e.g., any of the senescent cells described herein) in a subject (e.g., any of the subjects described herein) or in vitro (compared to resting NK cells (e.g., human resting NK cells)).

[0193] In some embodiments, activated NK cells (e.g., human activated NK cells) may exhibit about a 10% increase to about a 500% increase (or any sub-range within this range described herein) in the ability to kill senescent cells (e.g., any of the senescent cells described herein) in a subject (e.g., any of the subjects described herein) or in vivo (compared to resting NK cells (e.g., human resting NK cells)).

[0194] In some embodiments, activated NK cells (e.g., human activated NK cells) may exhibit increased cytotoxic activity (e.g., at least a 10% increase, at least a 20% increase, at least a 30% increase, at least a 40% increase, at least a 50% increase, at least a 60% increase, at least a 70% increase, at least a 80% increase, at least a 90% increase, at least a 100% increase, at least a 120% increase, at least a 140% increase, at least a 160% increase, at least a 180% increase, at least a 200% increase, at least a 220% increase, at least a 240% increase, at least a 260% increase, at least a 280% increase, or at least a 300% increase) in a contact-cytotoxicity assay in the presence of an antibody that specifically binds to an antigen present on senescent or target cells (e.g., compared to resting NK cells (e.g., human resting NK cells)).

[0195] In some embodiments, activated NK cells (e.g., human activated NK cells) may exhibit increased cytotoxic activity (e.g., at least a 10% increase to about a 500% increase, or any sub-range within this range described herein) in a contact cytotoxicity assay, e.g., in the presence of an antibody that specifically binds to an antigen present on senescent or target cells, compared to resting NK cells (e.g., human resting NK cells).

[0196] In some embodiments, activated NK cells may be produced by a method comprising obtaining resting NK cells and contacting the resting NK cells in vitro in a liquid culture medium with one or more resting NK cell activators, resulting in the generation of activated NK cells, which are then administered to a subject. In some examples of these methods, the resting NK cells are autologous NK cells obtained from the subject. In some examples of these methods, the resting NK cells are autologous NK cells obtained from the subject. In some examples of these methods, the resting NK cells are haploidentical resting NK cells. In some examples of these methods, the resting NK cells are allogeneic resting NK cells. In some examples of these methods, the resting NK cells are artificial NK cells. In some examples of any of these methods, the resting NK cells are genetically engineered NK cells with a chimeric antigen receptor or a recombinant T cell receptor.

[0197] In some examples of these methods, the liquid culture medium is a serum-free liquid culture medium. In some embodiments of any of the methods described herein, the liquid culture medium is a chemically defined liquid culture medium. Some examples of these methods further include isolating the activated NK cells (and optionally further administering a therapeutically effective amount of the activated NK cells to a subject, e.g., any of the subjects described herein).

[0198] In some embodiments of these methods, the contacting step is carried out for about 2 hours to about 20 days (e.g., about 2 hours to about 18 days, about 2 hours to about 16 days, about 2 hours to about 14 days, about 2 hours to about 12 days, about 2 hours to about 10 days, about 2 hours to about 8 days, about 2 hours to about 7 days, about 2 hours to about 6 days, about 2 hours to about 5 days, about 2 hours to about 4 days, about 2 hours to about 3 days, about 2 hours to about 2 days, about 2 hours to about 1 day, about 6 hours to about 18 days, about 6 hours to about 16 days, about 6 hours to about 14 days, about 6 hours to about 12 days, about 6 hours to about 10 days, about 6 hours to about 8 days, about 6 hours to about 7 days, about 6 hours to about 6, about 6 hours to about 5 days) , about 6 hours to about 4 days, about 6 hours to about 3 days, about 6 hours to about 2 days, about 6 hours to about 1 day, about 12 hours to about 18 days, about 12 hours to about 16 days, about 12 hours to about 14 days, about 12 hours to about 12 days, about 12 hours to about 10 days, about 12 hours to about 8 days, about 12 hours to about 7 days, about 12 hours to about 6 days, about 12 hours to about 5 days, about 12 hours to about 4 days, about 12 hours to about 3 days, about 12 hours to about 2 days, about 12 hours to about 1 day, about 1 day to about 18 days, about 1 day to about 16 days, about 1 day to about 15 days, about 1 day to about 14 days, about 1 day to about 12 days, about 1 day to about 10 days, about 1 day to about 8 days, about 1 day to about 7 days, about 1 day to about 6 days , about 1 to about 5 days, about 1 to about 4 days, about 1 to about 3 days, about 1 to about 2 days, about 2 to about 18 days, about 2 to about 16 days, about 2 to about 14 days, about 2 to about 12 days, about 2 to about 10 days, about 2 to about 8 days, about 2 to about 7 days, about 2 to about 6 days, about 2 to about 5 days, about 2 to about 4 days, about 2 to about 3 days, about 3 to about 18 days, about 3 to about 16 days, about 3 to about 14 days, about 3 to about 12 days, about 3 to about 10 days, about 3 to about 8 days, about 3 to about 7 days, about 3 to about 6 days, about 3 to about 5 days, about 3 to about 4 days, about 4 to about 18 days, about 4 to about 16 days, about 4 to about 14 days, about 4 to about 12 days, about 4 10 days to 10 days, 4 days to 8 days, 4 days to 7 days, 4 days to 6 days, 4 days to 5 days, 5 days to 18 days, 5 days to 16 days, 5 days to 14 days, 5 days to 12 days, 5 days to 10 days, 5 days to 8 days, 5 days to 7 days, 5 days to 6 days, 6 days to 18 days, 6 days to 16 days Sun, about 6 to 14 days, about 6 to 12 days, about 6 to 10 days, about 6 to 8 days, about 6 to 7 days, about 7 to 18 days, about 7 to 16 days, about 7 to 14 days, about 7 to 12 days, about 7 to 10 days, about 7 to 8 days, about 8 to 18 days, about 8 to 16 days, about 8 to 14 days,The incubation period is typically about 8 to about 12 days, about 8 to about 10 days, about 9 to about 18 days, about 9 to about 16 days, about 9 to about 14 days, about 9 to about 12 days, about 12 to about 18 days, about 12 to about 16 days, about 12 to about 14 days, about 14 to about 18 days, about 14 to about 16 days, or about 16 to about 18 days.

[0199] NK cell activator Methods are provided herein that include the use or administration of one or more NK cell activators. In some embodiments, the NK cell activator can be a protein. In some embodiments, the NK cell activator can be a single-chain chimeric polypeptide (e.g., any of the single-chain chimeric polypeptides described herein), a multi-chain chimeric polypeptide (e.g., any of the multi-chain chimeric polypeptides described herein, e.g., the exemplary Type A and Type B multi-chain chimeric polypeptides described herein), an antibody, a recombinant cytokine or interleukin (e.g., any of the recombinant cytokines or interleukins described herein), and a soluble interleukin or cytokine receptor (e.g., any of the soluble interleukin or cytokine receptors described herein). In some embodiments, the NK cell activator can be a small molecule (e.g., a glycogen synthase kinase-3 (GSK3) inhibitor, e.g., CHIR99021, as described in Cichocki et al., Cancer Res. 77:5664-5675, 2017), or an aptamer.

[0200] In some embodiments of any of the one or more NK cell activators provided herein, at least one of the one or more NK cell activators results in activation of one or more (e.g., two, three, four, five, six, seven, or eight) of IL-2 receptor, IL-7 receptor, IL-12 receptor, IL-15 receptor, IL-18 receptor, IL-21 receptor, IL-33 receptor, CD16, CD69, CD25, CD59, CD352, NKp80, DNAM-1, 2B4, NKp30, NKp44, NKp46, NKG2D, KIR2DS1, KIR2Ds2 / 3, KIR2DL4, KIR2DS4, KIR2DS5, and KIR3DS1 (e.g., in an immune cell, e.g., a human immune cell, e.g., a human NK cell), compared to the level of activation in the absence of the one or more NK cell activators.

[0201] In some embodiments, at least one of the one or more NK cell activators that result in activation of the IL-2 receptor is soluble IL-2 or an agonistic antibody that specifically binds to the IL-2 receptor.

[0202] In some embodiments, at least one of the one or more NK cell activators that result in activation of the IL-7 receptor is soluble IL-7 or an agonistic antibody that specifically binds to the IL-7 receptor.

[0203] In some embodiments, at least one of the one or more NK cell activators that result in activation of the IL-12 receptor is soluble IL-12 or an agonistic antibody that specifically binds to the IL-12 receptor.

[0204] In some embodiments, at least one of the one or more NK cell activators that result in activation of the IL-15 receptor is soluble IL-15 or an agonistic antibody that specifically binds to the IL-15 receptor.

[0205] In some embodiments, at least one of the one or more NK cell activators that result in activation of the IL-21 receptor is soluble IL-21 or an agonistic antibody that specifically binds to the IL-21 receptor.

[0206] In some embodiments, at least one of the one or more NK cell activators that result in activation of the IL-33 receptor is soluble IL-33 or an agonistic antibody that specifically binds to the IL-33 receptor.

[0207] In some embodiments, at least one of the one or more NK cell activators that result in activation of CD16 is an agonistic antibody that specifically binds to CD16.

[0208] In some embodiments, at least one of the one or more NK cell activators that result in activation of CD69 is an agonistic antibody that specifically binds to CD69.

[0209] In some embodiments, at least one of the one or more NK cell activators that result in activation of CD25, CD59 is an agonistic antibody that specifically binds to CD25, CD59.

[0210] In some embodiments, at least one of the one or more NK cell activators that result in activation of CD352 is an agonistic antibody that specifically binds to CD352.

[0211] In some embodiments, at least one of the one or more NK cell activators that result in activation of NKp80 is an agonistic antibody that specifically binds to NKp80.

[0212] In some embodiments, at least one of the one or more NK cell activators that result in activation of DNAM-1 is an agonistic antibody that specifically binds to DNAM-1.

[0213] In some embodiments, at least one of the one or more NK cell activators that result in activation of 2B4 is an agonistic antibody that specifically binds to 2B4.

[0214] In some embodiments, at least one of the one or more NK cell activators that result in activation of NKp30 is an agonistic antibody that specifically binds to NKp30.

[0215] In some embodiments, at least one of the one or more NK cell activators that result in activation of NKp44 is an agonistic antibody that specifically binds to NKp44.

[0216] In some embodiments, at least one of the one or more NK cell activators that result in activation of NKp46 is an agonistic antibody that specifically binds to NKp46.

[0217] In some embodiments, at least one of the one or more NK cell activators that result in activation of NKG2D is an agonistic antibody that specifically binds to NKG2D.

[0218] In some embodiments, at least one of the one or more NK cell activators that result in activation of KIR2DS1 is an agonistic antibody that specifically binds to KIT2DS1.

[0219] In some embodiments, at least one of the one or more NK cell activators that result in activation of KIR2DS2 / 3 is an agonistic antibody that specifically binds to KIT2DS2 / 3.

[0220] In some embodiments, at least one of the one or more NK cell activators that result in activation of KIR2DL4 is an agonistic antibody that specifically binds to KIT2DL4.

[0221] In some embodiments, at least one of the one or more NK cell activators that result in activation of KIR2DS4 is an agonistic antibody that specifically binds to KIT2DS4.

[0222] In some embodiments, at least one of the one or more NK cell activators that result in activation of KIR2DS5 is an agonistic antibody that specifically binds to KIT2DS5.

[0223] In some embodiments, at least one of the one or more NK cell activators that result in activation of KIR3DS1 is an agonistic antibody that specifically binds to KIT3DS1.

[0224] In some embodiments of any of the one or more NK cell activators provided herein, at least one (e.g., two, three, four, or five) of the one or more NK cell activators results in decreased activation of one or more of PD-1, TGF-β receptor, TIGIT, CD1, TIM-3, Siglec-7, IRP60, Tactile, IL1R8, NKG2A / KLRD1, KIR2DL1, KIR2DL2 / 3, KIR2DL5, KIR3DL1, KIR3DL2, ILT2 / LIR-1, and LAG-2 (e.g., in an immune cell, e.g., a human immune cell, e.g., a human NK cell), compared to the activation level in the absence of the one or more NK cell activators.

[0225] In some embodiments, at least one of the one or more NK cell activators that result in decreased activation of the TGF-β receptor is a soluble TGF-β receptor, an antibody that specifically binds to TGF-β, or an antagonist antibody that specifically binds to the TGF-β receptor.

[0226] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in TIGIT activation is an antagonist antibody that specifically binds to TIGIT, soluble TIGIT, or an antibody that specifically binds to a ligand of TIGIT.

[0227] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in CD1 activation is an antagonist antibody that specifically binds to CD1, soluble CD1, or an antibody that specifically binds to a ligand of CD1.

[0228] In some embodiments, at least one of the one or more NK cell activators that result in decreased activation of TIM-3 is an antagonist antibody that specifically binds to TIM-3, soluble TIM-3, or an antibody that specifically binds to a ligand of TIM-3.

[0229] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in Siglec-7 activation is an antagonist antibody that specifically binds to Siglec-7, soluble Siglec-7, or an antibody that specifically binds to a ligand of Siglec-7.

[0230] In some embodiments, at least one of the one or more NK cell activators that result in reduced activation of IRP-60 is an antagonist antibody that specifically binds to IRP-60, soluble IRP-60, or an antibody that specifically binds to a ligand of IRP-60.

[0231] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in Tactile activation is an antagonist antibody that specifically binds to Tactile, a soluble Tactile, or an antibody that specifically binds to a ligand of Tactile.

[0232] In some embodiments, at least one of the one or more NK cell activators that result in decreased activation of IL1R8 is an antagonist antibody that specifically binds to IL1R8, soluble IL1R8, or an antibody that specifically binds to a ligand of IL1R8.

[0233] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in NKG2A / KLRD1 activation is an antagonist antibody that specifically binds to NKG2A / KLRD1, soluble NKG2A / KLRD1, or an antibody that specifically binds to a ligand of NKG2A / KLRD1.

[0234] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in KIR2DL1 activation is an antagonist antibody that specifically binds to KIR2DL1, soluble KIR2DL1, or an antibody that specifically binds to a ligand of KIR2DL1.

[0235] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in KIR2DL2 / 3 activation is an antagonist antibody that specifically binds to KIR2DL2 / 3, a soluble KIR2DL2 / 3, or an antibody that specifically binds to a ligand of KIR2DL2 / 3.

[0236] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in KIR2DL5 activation is an antagonist antibody that specifically binds to KIR2DL5, soluble KIR2DL5, or an antibody that specifically binds to a ligand of KIR2DL5.

[0237] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in KIR3DL1 activation is an antagonist antibody that specifically binds to KIR3DL1, soluble KIR3DL1, or an antibody that specifically binds to a ligand of KIR3DL1.

[0238] In some embodiments, at least one of the one or more NK cell activators that result in reduced activation of KIR3DL2 is an antagonist antibody that specifically binds to KIR3DL2, soluble KIR3DL2, or an antibody that specifically binds to a ligand of KIR3DL2.

[0239] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in ILT2 / LIR-1 activation is an antagonist antibody that specifically binds to ILT2 / LIR-1, soluble ILT2 / LIR-1, or an antibody that specifically binds to a ligand of ILT2 / LIR-1.

[0240] In some embodiments, at least one of the one or more NK cell activators that result in a decrease in LAG2 activation is an antagonist antibody that specifically binds to LAG2, soluble LAG2, or an antibody that specifically binds to a ligand of LAG2.

[0241] Non-limiting examples of NK cell activators are described below and can be used in any combination.

[0242] In some examples, the NK cell activator can be soluble PD-1, soluble PD-L1, soluble TIGIT, soluble CD1, or soluble TIM-3. Non-limiting examples of soluble PD-1, PD-L1, TIGIT, CD1, and TIM-3 are provided below. Human soluble PD-1 (SEQ ID NO: 73) TIFF0007773577000080.tif40138 Human soluble PD-L1 (SEQ ID NO: 74) TIFF0007773577000081.tif40142 Human soluble TIGIT (SEQ ID NO: 75) TIFF0007773577000082.tif33138 Human soluble CD1A (SEQ ID NO: 76) TIFF0007773577000083.tif46148 Human soluble TIM3 (SEQ ID NO: 77) TIFF0007773577000084.tif40137

[0243] In some embodiments, the soluble PD-1 protein may comprise a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:73.

[0244] In some embodiments, the soluble PD-L1 protein may comprise a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:74.

[0245] In some embodiments, the soluble TIGIT protein may comprise a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:75.

[0246] In some embodiments, the soluble CD1A protein may comprise a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:76.

[0247] In some embodiments, the soluble TIM3 protein may comprise a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:77.

[0248] Recombinant antibodies In some examples, the NK activator is an agonist antibody that specifically binds to the IL-2 receptor (see, e.g., those described in Gaulton et al., Clinical Immunology and Immunopathology 36(1):18-29, 1985), an agonist antibody that specifically binds to the IL-7 receptor, an agonist antibody that specifically binds to the IL-12 receptor (see, e.g., those described in Rogge et al., Clinical Immunology and Immunopathology 36(1):18-29, 1985), ... al., J. Immunol. 162(7):3926-3932, 1999), agonistic antibodies that specifically bind to the IL-15 receptor, agonistic antibodies that specifically bind to the IL-21 receptor (see, for example, those described in U.S. Patent Application Publication No. 2006 / 159655), agonistic antibodies that specifically bind to the IL-33 receptor (see, for example, those described in U.S. Patent Application Publication No. 2007 / 160579), antagonistic antibodies that specifically bind to PD-1 (see, for example, those described in U.S. Patent Application Publication No. 7,521,051), antibodies that specifically bind to PD-L1 (see, for example, those described in U.S. Patent No. 8,217,149), antibodies that specifically bind to the TGF-β receptor, antagonistic antibodies that specifically bind to the TGF-β receptor (see, for example, those described in European Patent Application Publication No. 1245667 A1), antagonistic antibodies that specifically bind to TIGIT (see, for example, those described in WO2017 / 053748), antibodies that specifically bind to a ligand of TIGIT (see, for example, those described in WO2011 / 127324), antagonistic antibodies that specifically bind to CD1 (see, for example, those described in Szalay et al., J. Immunol. 162(12):6955-6958, 1999), antibodies that specifically bind to a ligand of CD1 (see, for example, those described in Kain et al., Immunity 41(4):543-554, 2014), antagonistic antibodies that specifically bind to TIM-3 (see, for example, those described in U.S. Patent Application Publication No. 2015 / 218274), antibodies that specifically bind to a ligand of TIM-3 (see, for example, those described in U.S. Patent Application Publication No. 2017 / 283499), agonistic antibodies that specifically bind to CD69 (see, for example, those described in Moretta et al., Journal of Experimental Medicine 174:1393, 1991), agonistic antibodies that specifically bind to CD25, CD59, agonistic antibodies that specifically bind to CD352 (see, for example, those described in Yigit et al., Oncotarget 7:26346-26360, 2016), agonistic antibodies that specifically bind to NKp80 (see, for example, those described in Peipp et al., Oncotarget 6:32075-32088, 2015), agonistic antibodies that specifically bind to DNAM-1, agonistic antibodies that specifically bind to 2B4 (see, for example, those described in Sandusky et al., European J. Immunol. 36:3268-3276, 2006), agonistic antibodies that specifically bind to NKp30 (see, for example, those described in Kellner et al., OncoImmunology 5:1-12, 2016), agonistic antibodies that specifically bind to NKp44, agonistic antibodies that specifically bind to NKp46 (see, for example, those described in Xiong et al., J. Clin. Invest. 123:4264-4272, 2013), agonistic antibodies that specifically bind to NKG2D (see, for example, those described in Kellner et al., OncoImmunology 5:1-12, 2016), agonistic antibodies that specifically bind to KIR2DS1 (see, for example, those described in Xiong et al., J. Clin. Invest. 123:4264-4272, 2013), agonistic antibodies that specifically bind to KIR2Ds2 / 3 (see, for example, those described in Borgerding et al., Exp.Hematology 38:213-221, 2010), agonistic antibodies that specifically bind to KIR2DL4 (see, for example, those described in Miah et al., J. Immunol. 180:2922-32, 2008), agonistic antibodies that specifically bind to KIR2DS4 (see, for example, those described in Czaja et al., Genes and Immunity 15:33-37, 2014), agonistic antibodies that specifically bind to KIR2DS5 (see, for example, those described in Czaja et al., Genes and Immunity 15:33-37, 2014), agonistic antibodies that specifically bind to KIR3DS1 (see, for example, those described in Czaja et al., Genes and Immunity 15:33-37, 2014), antagonistic antibodies that specifically bind to Siglec-7 (see, for example, Hudak et al., Nature Chemical Biology 10:69-75, 2014), antagonistic antibodies that specifically bind to IRP60 (see, for example, those described in Bachelet et al., J. Biol. Chem. 281:27190-27196, 2006), antagonistic antibodies that specifically bind to Tactile (see, for example, those described in Brooks et al., Eur. J. Cancer 61(Suppl. 1):S189, 2016), antagonistic antibodies that specifically bind to IL1R8 (see, for example, those described in Molgora et al., Frontiers Immunol. 7:1, 2016), antagonistic antibodies that specifically bind to NKG2A / KLRD1 (see, for example, those described in Kim et al., Infection Immunity 76:5873-5882,2008), antagonist antibodies that specifically bind to KIR2DL1 (see, for example, those described in Weiner et al., Cell 148:1081-1084,2012), antagonist antibodies that specifically bind to KIR2DL2 / 3 (see, for example, those described in Weiner et al., Cell 148:1081-1084, 2012), an antagonist antibody that specifically binds to KIR2DL5 (see, for example, those described in US 9,067,997), and an antagonist antibody that specifically binds to KIR3DL1 (see, for example, those described in US 9,067,997), an antagonist antibody that specifically binds to KIR3DL2 (see, for example, those described in US 9,067,997), an antagonist antibody that specifically binds to ILT2 / LIR-1 (see, for example, those described in US 8,133,485), and an antagonist antibody that specifically binds to LAG-2.

[0249] Recombinant antibodies that are NK cell activators can be any of the exemplary types of antibodies (e.g., human or humanized antibodies) or any of the exemplary antibody fragments described herein. Recombinant antibodies that are NK cell activators can include, for example, any of the antigen-binding domains described herein.

[0250] Recombinant interleukins or cytokines In some examples, the NK activator can be, for example, soluble IL-2, soluble IL-7, soluble IL-12, soluble IL-15, soluble IL-21, and soluble IL-33. Non-limiting examples of soluble IL-12, IL-15, IL-21, and IL-33 are provided below. Human soluble IL-2 (SEQ ID NO: 78) TIFF0007773577000085.tif18137 Human soluble IL-7 (SEQ ID NO: 79) TIFF0007773577000086.tif18150 Human soluble IL-12 subunit alpha (SEQ ID NO: 80) TIFF0007773577000087.tif26138 Human soluble IL-12 subunit beta (SEQ ID NO: 81) TIFF0007773577000088.tif47137 Human soluble IL-15 (SEQ ID NO: 82) TIFF0007773577000089.tif18142 Human soluble IL-21 (SEQ ID NO: 83) TIFF0007773577000090.tif18137 Human soluble IL-33 (SEQ ID NO: 84) TIFF0007773577000091.tif39138

[0251] In some embodiments, the soluble IL-2 protein may comprise a sequence at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:78.

[0252] In some embodiments, the soluble IL-7 protein may comprise a sequence at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:79.

[0253] In some embodiments, the soluble IL-2 protein comprises a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO: 80 and a sequence that is at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO: 81.

[0254] In some embodiments, the soluble IL-15 protein may comprise a sequence at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:82.

[0255] In some embodiments, the soluble IL-21 protein may comprise a sequence at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:83.

[0256] In some embodiments, the soluble IL-33 protein may comprise a sequence at least 80% identical, at least 82% identical, at least 84% identical, at least 86% identical, at least 88% identical, at least 90% identical, at least 92% identical, at least 94% identical, at least 96% identical, at least 98% identical, at least 99% identical, or 100% identical to SEQ ID NO:84.

[0257] Soluble cytokine or interleukin receptors In some examples of any of the soluble cytokine or interleukin receptors described herein, the soluble cytokine or interleukin receptor can be a soluble TGF-β receptor.In some examples, the soluble TGF-β receptor is a soluble TGF-β receptor I (TGF-βRI) (see, for example, Docagne et al., Journal of Biological Chemistry 276(49):46243-46250,2001), a soluble TGF-β receptor II (TGF-βRII) (see, for example, Yung et al., Am.J.Resp.Crit.Care Med.194(9):1140-1151,2016), or a soluble TGF-βRIII (see, for example, Heng et al., Placenta 57:320,2017). In some instances, the soluble TGF-β receptor is a receptor "trap" for TGF-β (see, e.g., those described in Zwaagstra et al., Mol. Cancer Ther. 11(7):1477-1487, 2012 and De Crescenzo et al. Transforming Growth Factor-β in Cancer Therapy, Volume II, pp671-684).

[0258] Additional examples of soluble cytokine or soluble interleukin receptors are known in the art.

[0259] Single-chain chimeric polypeptide A non-limiting example of an NK cell activator is a single-chain chimeric polypeptide comprising: (i) a first target binding domain (e.g., any of the target binding domains described herein or known in the art), (ii) a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein or known in the art), and (iii) a second target binding domain (e.g., any of the target binding domains described herein or known in the art).

[0260] In some examples of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide may have a total length of about 50 amino acids to about 3000 amino acids, about 50 amino acids to about 2500 amino acids, about 50 amino acids to about 2000 amino acids, about 50 amino acids to about 1500 amino acids, about 50 amino acids to about 1000 amino acids, about 50 amino acids to about 950 amino acids, about 50 amino acids to about 900 amino acids, about 50 amino acids to about 850 amino acids, about 50 amino acids to about 800 amino acids, about 50 amino acids to about 750 amino acids, about 50 amino acids to about 7 ... to about 650 amino acids, about 50 amino acids to about 600 amino acids, about 50 amino acids to about 550 amino acids, about 50 amino acids to about 500 amino acids, about 50 amino acids to about 480 amino acids, about 50 amino acids to about 460 amino acids, about 50 amino acids to about 440 amino acids, about 50 amino acids to about 420 amino acids, about 50 amino acids to about 400 amino acids, about 50 amino acids to about 380 amino acids, about 50 amino acids to about 360 amino acids, about 50 amino acids to about 340 amino acids, about 50 amino acids to about 320 amino acids, about 50 amino acids to about 300 amino acids, about 50 amino acids to about 280 amino acids, about 5 0 amino acids to about 260 amino acids, about 50 amino acids to about 240 amino acids, about 50 amino acids to about 220 amino acids, about 50 amino acids to about 200 amino acids, about 50 amino acids to about 150 amino acids, about 50 amino acids to about 100 amino acids, about 100 amino acids to about 3000 amino acids, about 100 amino acids to about 2500 amino acids, about 100 amino acids to about 2000 amino acids, about 100 amino acids to about 1500 amino acids, about 100 amino acids to about 1000 amino acids, about 100 amino acids to about 950 amino acids, about 100 amino acids to about 900 amino acids, about 100 amino acids to about 850 amino acids, about 100 amino acids to about 800 amino acids, about 100 amino acids to about 750 amino acids, about 100 amino acids to about 700 amino acids, about 100 amino acids to about 650 amino acids, about 100 amino acids to about 600 amino acids, about 100 amino acids to about 550 amino acids, about 100 amino acids to about 500 amino acids, about 100 amino acids to about 480 amino acids, about 100 amino acids to about 460 amino acids, about 100 amino acids to about 440 amino acids, about 100 amino acids to about 420 amino acids, about 100 amino acids to about 400 amino acids, about 100 amino acids to about 380 amino acids, about 100 amino acids to about 360 amino acids,About 100 amino acids to about 340 amino acids, about 100 amino acids to about 320 amino acids, about 100 amino acids to about 300 amino acids, about 100 amino acids to about 280 amino acids, about 100 amino acids to about 260 amino acids, about 100 amino acids to about 240 amino acids, about 100 amino acids to about 220 amino acids, about 100 amino acids to about 200 amino acids, about 100 amino acids to about 150 amino acids, about 150 amino acids to about 3000 amino acids, about 150 amino acids to about 2500 amino acids, about 150 amino acids to about 2000 amino acids, about 150 amino acids to about 1500 amino acids, about 150 amino acids to about 10 00 amino acids, about 150 amino acids to about 950 amino acids, about 150 amino acids to about 900 amino acids, about 150 amino acids to about 850 amino acids, about 150 amino acids to about 800 amino acids, about 150 amino acids to about 750 amino acids, about 150 amino acids to about 700 amino acids, about 150 amino acids to about 650 amino acids, about 150 amino acids to about 600 amino acids, about 150 amino acids to about 550 amino acids, about 150 amino acids to about 500 amino acids, about 150 amino acids to about 480 amino acids, about 150 amino acids to about 460 amino acids, about 150 amino acids to about 4 ...500 amino acids, about 150 amino acids to about About 420 amino acids, about 150 to about 400 amino acids, about 150 to about 380 amino acids, about 150 to about 360 amino acids, about 150 to about 340 amino acids, about 150 to about 320 amino acids, about 150 to about 300 amino acids, about 150 to about 280 amino acids, about 150 to about 260 amino acids, about 150 to about 240 amino acids, about 150 to about 220 amino acids, about 150 to about 200 amino acids, about 200 to about 3000 amino acids, about 200 to about 2500 amino acids, about 200 amino acids amino acids to about 2000 amino acids, about 200 amino acids to about 1500 amino acids, about 200 amino acids to about 1000 amino acids, about 200 amino acids to about 950 amino acids, about 200 amino acids to about 900 amino acids, about 200 amino acids to about 850 amino acids, about 200 amino acids to about 800 amino acids, about 200 amino acids to about 750 amino acids, about 200 amino acids to about 700 amino acids, about 200 amino acids to about 650 amino acids, about 200 amino acids to about 600 amino acids, about 200 amino acids to about 550 amino acids, about 200 amino acids to about 500 amino acids, about 200 amino acids to about 480 amino acids,About 200 amino acids to about 460 amino acids, about 200 amino acids to about 440 amino acids, about 200 amino acids to about 420 amino acids, about 200 amino acids to about 400 amino acids, about 200 amino acids to about 380 amino acids, about 200 amino acids to about 360 amino acids, about 200 amino acids to about 340 amino acids, about 200 amino acids to about 320 amino acids, about 200 amino acids to about 300 amino acids, about 200 amino acids to about 280 amino acids, about 200 amino acids to about 260 amino acids, about 200 amino acids to about 240 amino acids, about 200 amino acids to about 220 amino acids, about 220 amino acids to about 3000 amino acids amino acids, about 220 amino acids to about 2500 amino acids, about 220 amino acids to about 2000 amino acids, about 220 amino acids to about 1500 amino acids, about 220 amino acids to about 1000 amino acids, about 220 amino acids to about 950 amino acids, about 220 amino acids to about 900 amino acids, about 220 amino acids to about 850 amino acids, about 220 amino acids to about 800 amino acids, about 220 amino acids to about 750 amino acids, about 220 amino acids to about 700 amino acids, about 220 amino acids to about 650 amino acids, about 220 amino acids to about 600 amino acids, about 220 amino acids to about 550 amino acids, about 220 amino acids to about About 500 amino acids, about 220 amino acids to about 480 amino acids, about 220 amino acids to about 460 amino acids, about 220 amino acids to about 440 amino acids, about 220 amino acids to about 420 amino acids, about 220 amino acids to about 400 amino acids, about 220 amino acids to about 380 amino acids, about 220 amino acids to about 360 amino acids, about 220 amino acids to about 340 amino acids, about 220 amino acids to about 320 amino acids, about 220 amino acids to about 300 amino acids, about 220 amino acids to about 280 amino acids, about 220 amino acids to about 260 amino acids, about 220 amino acids to about 240 amino acids, about 240 amino acids amino acids to about 3000 amino acids, about 240 amino acids to about 2500 amino acids, about 240 amino acids to about 2000 amino acids, about 240 amino acids to about 1500 amino acids, about 240 amino acids to about 1000 amino acids, about 240 amino acids to about 950 amino acids, about 240 amino acids to about 900 amino acids, about 240 amino acids to about 850 amino acids, about 240 amino acids to about 800 amino acids, about 240 amino acids to about 750 amino acids, about 240 amino acids to about 700 amino acids, about 240 amino acids to about 650 amino acids, about 240 amino acids to about 600 amino acids, about 240 amino acids to about 550 amino acids,About 240 amino acids to about 500 amino acids, about 240 amino acids to about 480 amino acids, about 240 amino acids to about 460 amino acids, about 240 amino acids to about 440 amino acids, about 240 amino acids to about 420 amino acids, about 240 amino acids to about 400 amino acids, about 240 amino acids to about 380 amino acids, about 240 amino acids to about 360 amino acids, about 240 amino acids to about 340 amino acids, about 240 amino acids to about 320 amino acids, about 240 amino acids to about 300 amino acids, about 240 amino acids to about 280 amino acids, about 240 amino acids to about 260 amino acids, about 260 amino acids to about 3000 amino acids amino acids, about 260 amino acids to about 2500 amino acids, about 260 amino acids to about 2000 amino acids, about 260 amino acids to about 1500 amino acids, about 260 amino acids to about 1000 amino acids, about 260 amino acids to about 950 amino acids, about 260 amino acids to about 900 amino acids, about 260 amino acids to about 850 amino acids, about 260 amino acids to about 800 amino acids, about 260 amino acids to about 750 amino acids, about 260 amino acids to about 700 amino acids, about 260 amino acids to about 650 amino acids, about 260 amino acids to about 600 amino acids, about 260 amino acids to about 550 amino acids, about 260 amino acids to about About 500 amino acids, about 260 amino acids to about 480 amino acids, about 260 amino acids to about 460 amino acids, about 260 amino acids to about 440 amino acids, about 260 amino acids to about 420 amino acids, about 260 amino acids to about 400 amino acids, about 260 amino acids to about 380 amino acids, about 260 amino acids to about 360 amino acids, about 260 amino acids to about 340 amino acids, about 260 amino acids to about 320 amino acids, about 260 amino acids to about 300 amino acids, about 260 amino acids to about 280 amino acids, about 280 amino acids to about 3000 amino acids, about 280 amino acids to about 2500 amino acids, about 280 amino acids amino acids to about 2000 amino acids, about 280 amino acids to about 1500 amino acids, about 280 amino acids to about 1000 amino acids, about 280 amino acids to about 950 amino acids, about 280 amino acids to about 900 amino acids, about 280 amino acids to about 850 amino acids, about 280 amino acids to about 800 amino acids, about 280 amino acids to about 750 amino acids, about 280 amino acids to about 700 amino acids, about 280 amino acids to about 650 amino acids, about 280 amino acids to about 600 amino acids, about 280 amino acids to about 550 amino acids, about 280 amino acids to about 500 amino acids, about 280 amino acids to about 480 amino acids,About 280 amino acids to about 460 amino acids, about 280 amino acids to about 440 amino acids, about 280 amino acids to about 420 amino acids, about 280 amino acids to about 400 amino acids, about 280 amino acids to about 380 amino acids, about 280 amino acids to about 360 amino acids, about 280 amino acids to about 340 amino acids, about 280 amino acids to about 320 amino acids, about 280 amino acids to about 300 amino acids, about 300 amino acids to about 3000 amino acids, about 300 amino acids to about 2500 amino acids, about 300 amino acids to about 2000 amino acids, about 300 amino acids to about 1500 amino acids, about 300 amino acids to about 10 00 amino acids, about 300 amino acids to about 950 amino acids, about 300 amino acids to about 900 amino acids, about 300 amino acids to about 850 amino acids, about 300 amino acids to about 800 amino acids, about 300 amino acids to about 750 amino acids, about 300 amino acids to about 700 amino acids, about 300 amino acids to about 650 amino acids, about 300 amino acids to about 600 amino acids, about 300 amino acids to about 550 amino acids, about 300 amino acids to about 500 amino acids, about 300 amino acids to about 480 amino acids, about 300 amino acids to about 460 amino acids, about 300 amino acids to about 4 ... About 420 amino acids, about 300 to about 400 amino acids, about 300 to about 380 amino acids, about 300 to about 360 amino acids, about 300 to about 340 amino acids, about 300 to about 320 amino acids, about 320 to about 3000 amino acids, about 320 to about 2500 amino acids, about 320 to about 2000 amino acids, about 320 to about 1500 amino acids, about 320 to about 1000 amino acids, about 320 to about 950 amino acids, about 320 to about 900 amino acids, about 320 to about 850 amino acids, about 3 20 amino acids to about 800 amino acids, about 320 amino acids to about 750 amino acids, about 320 amino acids to about 700 amino acids, about 320 amino acids to about 650 amino acids, about 320 amino acids to about 600 amino acids, about 320 amino acids to about 550 amino acids, about 320 amino acids to about 500 amino acids, about 320 amino acids to about 480 amino acids, about 320 amino acids to about 460 amino acids, about 320 amino acids to about 440 amino acids, about 320 amino acids to about 420 amino acids, about 320 amino acids to about 400 amino acids, about 320 amino acids to about 380 amino acids, about 320 amino acids to about 360 amino acids,About 320 amino acids to about 340 amino acids, about 340 amino acids to about 3000 amino acids, about 340 amino acids to about 2500 amino acids, about 340 amino acids to about 2000 amino acids, about 340 amino acids to about 1500 amino acids, about 340 amino acids to about 1000 amino acids, about 340 amino acids, amino acids to about 950 amino acids, about 340 amino acids to about 900 amino acids, about 340 amino acids to about 850 amino acids, about 340 amino acids to about 800 amino acids, about 340 amino acids to about 750 amino acids, about 340 amino acids to about 700 amino acids, about 340 amino acids to about 650 amino acids, about 340 amino acids to about 600 amino acids, about 340 amino acids to about 550 amino acids, about 340 amino acids to about 500 amino acids, about 340 amino acids to about 480 amino acids, about 340 amino acids to about 460 amino acids, about 340 amino acids to about 440 amino acids, about 340 amino acids to about 420 amino acids, 340 amino acids to about 400 amino acids, about 340 amino acids to about 380 amino acids, about 340 amino acids to about 360 amino acids, about 360 amino acids to about 3000 amino acids, about 360 amino acids to about 2500 amino acids, about 360 amino acids to about 2000 amino acids, about 360 amino acids to about 1500 amino acids, about 360 amino acids to about 1000 amino acids, about 360 amino acids to about 950 amino acids, about 360 amino acids to about 900 amino acids, about 360 amino acids to about 850 amino acids, about 360 amino acids to about 800 amino acids, about 360 amino acids to about 750 amino acids, about 360 amino acids to about 7 00 amino acids, about 360 amino acids to about 650 amino acids, about 360 amino acids to about 600 amino acids, about 360 amino acids to about 550 amino acids, about 360 amino acids to about 500 amino acids, about 360 amino acids to about 480 amino acids, about 360 amino acids to about 460 amino acids, about 360 amino acids to about 440 amino acids, about 360 amino acids to about 420 amino acids, about 360 amino acids to about 400 amino acids, about 360 amino acids to about 380 amino acids, about 380 amino acids to about 3000 amino acids, about 380 amino acids to about 2500 amino acids, about 380 amino acids to about 2000 amino acids, about 380 amino acids amino acids to about 1500 amino acids, about 380 amino acids to about 1000 amino acids, about 380 amino acids to about 950 amino acids, about 380 amino acids to about 900 amino acids, about 380 amino acids to about 850 amino acids, about 380 amino acids to about 800 amino acids, about 380 amino acids to about 750 amino acids, about 380 amino acids to about 700 amino acids, about 380 amino acids to about 650 amino acids, about 380 amino acids to about 600 amino acids, about 380 amino acids to about 550 amino acids, about 380 amino acids to about 500 amino acids, about 380 amino acids to about 480 amino acids, about 380 amino acids to about 460 amino acids,About 380 amino acids to about 440 amino acids, about 380 amino acids to about 420 amino acids, about 380 amino acids to about 400 amino acids, about 400 amino acids to about 3000 amino acids, about 400 amino acids to about 2500 amino acids, about 400 amino acids to about 2000 amino acids, about 400 amino acids to about 1500 amino acids, about 400 amino acids to about 1000 amino acids, about 400 amino acids to about 950 amino acids, about 400 amino acids to about 900 amino acids, about 400 amino acids to about 850 amino acids, about 400 amino acids to about 800 amino acids, about 400 amino acids to about 750 amino acids, about 400 amino acids amino acids to about 700 amino acids, about 400 amino acids to about 650 amino acids, about 400 amino acids to about 600 amino acids, about 400 amino acids to about 550 amino acids, about 400 amino acids to about 500 amino acids, about 400 amino acids to about 480 amino acids, about 400 amino acids to about 460 amino acids, about 400 amino acids to about 440 amino acids, about 400 amino acids to about 420 amino acids, about 420 amino acids to about 3000 amino acids, about 420 amino acids to about 2500 amino acids, about 420 amino acids to about 2000 amino acids, about 420 amino acids to about 1500 amino acids, about 420 amino acids to about 1000 amino acids amino acids, about 420 amino acids to about 950 amino acids, about 420 amino acids to about 900 amino acids, about 420 amino acids to about 850 amino acids, about 420 amino acids to about 800 amino acids, about 420 amino acids to about 750 amino acids, about 420 amino acids to about 700 amino acids, about 420 amino acids to about 650 amino acids, about 420 amino acids to about 600 amino acids, about 420 amino acids to about 550 amino acids, about 420 amino acids to about 500 amino acids, about 420 amino acids to about 480 amino acids, about 420 amino acids to about 460 amino acids, about 420 amino acids to about 440 amino acids, about 440 amino acids to about 3000 amino acids, about 440 amino acids to about 2500 amino acids, about 440 amino acids to about 2000 amino acids, about 440 amino acids to about 1500 amino acids, about 440 amino acids to about 1000 amino acids, about 440 amino acids to about 950 amino acids, about 440 amino acids to about 900 amino acids, about 440 amino acids to about 850 amino acids, about 440 amino acids to about 800 amino acids, about 440 amino acids to about 750 amino acids, about 440 amino acids to about 700 amino acids, about 440 amino acids to about 650 amino acids, about 440 amino acids to about 600 amino acids, about 440 amino acids to about 550 amino acids,About 440 amino acids to about 500 amino acids, about 440 amino acids to about 480 amino acids, about 440 amino acids to about 460 amino acids, about 460 amino acids to about 3000 amino acids, about 460 amino acids to about 2500 amino acids, about 460 amino acids to about 2000 amino acids, about 460 amino acids to about 1500 amino acids, about 460 amino acids to about 1000 amino acids, about 460 amino acids to about 950 amino acids, about 460 amino acids to about 900 amino acids, about 460 amino acids to about 850 amino acids, about 460 amino acids to about 800 amino acids, about 460 amino acids to about 750 amino acids, about 460 amino acids to about about 700 amino acids, about 460 amino acids to about 650 amino acids, about 460 amino acids to about 600 amino acids, about 460 amino acids to about 550 amino acids, about 460 amino acids to about 500 amino acids, about 460 amino acids to about 480 amino acids, about 480 amino acids to about 3000 amino acids, about 480 amino acids to about 2500 amino acids, about 480 amino acids to about 2000 amino acids, about 480 amino acids to about 1500 amino acids, about 480 amino acids to about 1000 amino acids, about 480 amino acids to about 950 amino acids, about 480 amino acids to about 900 amino acids, about 480 amino acids to about 850 amino acids, About 480 amino acids to about 800 amino acids, about 480 amino acids to about 750 amino acids, about 480 amino acids to about 700 amino acids, about 480 amino acids to about 650 amino acids, about 480 amino acids to about 600 amino acids, about 480 amino acids to about 550 amino acids, about 480 amino acids to about 500 amino acids, about 500 amino acids to about 3000 amino acids, about 500 amino acids to about 2500 amino acids, about 500 amino acids to about 2000 amino acids, about 500 amino acids to about 1500 amino acids, about 500 amino acids to about 1000 amino acids, about 500 amino acids to about 950 amino acids, about 500 amino acids to about 1500 amino acids about 900 amino acids, about 500 to about 850 amino acids, about 500 to about 800 amino acids, about 500 to about 750 amino acids, about 500 to about 700 amino acids, about 500 to about 650 amino acids, about 500 to about 600 amino acids, about 500 to about 550 amino acids, about 550 to about 3000 amino acids, about 550 to about 2500 amino acids, about 550 to about 2000 amino acids, about 550 to about 1500 amino acids, about 550 to about 1000 amino acids, about 550 to about 950 amino acids,About 550 amino acids to about 900 amino acids, about 550 amino acids to about 850 amino acids, about 550 amino acids to about 800 amino acids, about 550 amino acids to about 750 amino acids, about 550 amino acids to about 700 amino acids, about 550 amino acids to about 650 amino acids, about 550 amino acids to about 600 amino acids, about 600 amino acids to about 3000 amino acids, about 600 amino acids to about 2500 amino acids, about 600 amino acids to about 2000 amino acids, about 600 amino acids to about 1500 amino acids, about 600 amino acids to about 1000 amino acids, about 600 amino acids to about 950 amino acids, about 600 amino acids to about 900 amino acids, about 600 amino acids to about 850 amino acids, about 600 amino acids to about 800 amino acids, about 600 amino acids to about 750 amino acids, about 600 amino acids to about 700 amino acids, about 600 amino acids to about 650 amino acids, about 650 amino acids to about 3000 amino acids, about 650 amino acids to about 2500 amino acids, about 650 amino acids to about 2000 amino acids, about 650 amino acids to about 1500 amino acids, about 650 amino acids to about 1000 amino acids, about 650 amino acids to about 950 amino acids, about 650 amino acids to about 900 amino acids, about 650 amino acids to about 850 amino acids, about 50 amino acids to about 800 amino acids, about 650 amino acids to about 750 amino acids, about 650 amino acids to about 700 amino acids, about 700 amino acids to about 3000 amino acids, about 700 amino acids to about 2500 amino acids, about 700 amino acids to about 2000 amino acids, about 700 amino acids to about 1500 amino acids, about 700 amino acids to about 1000 amino acids, about 700 amino acids to about 950 amino acids, about 700 amino acids to about 900 amino acids, about 700 amino acids to about 850 amino acids, about 700 amino acids to about 800 amino acids, about 700 amino acids to about 750 amino acids, about 750 amino acids to about 30 00 amino acids, about 750 amino acids to about 2500 amino acids, about 750 amino acids to about 2000 amino acids, about 750 amino acids to about 1500 amino acids, about 750 amino acids to about 1000 amino acids, about 750 amino acids to about 950 amino acids, about 750 amino acids to about 900 amino acids, about 750 amino acids to about 850 amino acids, about 750 amino acids to about 800 amino acids, about 800 amino acids to about 3000 amino acids, about 800 amino acids to about 2500 amino acids, about 800 amino acids to about 2000 amino acids, about 800 amino acids to about 1500 amino acids, about 800 amino acids to about 1000 amino acids,About 800 amino acids to about 950 amino acids, about 800 amino acids to about 900 amino acids, about 800 amino acids to about 850 amino acids, about 850 amino acids to about 3000 amino acids, about 850 amino acids to about 2500 amino acids, about 850 amino acids to about 2000 amino acids, about 850 amino acids to about 1500 amino acids, about 850 amino acids to about 1000 amino acids, about 850 amino acids to about 950 amino acids, about 850 amino acids to about 900 amino acids, about 900 amino acids to about 3000 amino acids, about 900 amino acids to about 2500 amino acids, about 900 amino acids to about 2000 amino acids, about 900 amino acids to about 1500 amino acids, about 900 amino acids to about 1000 amino acids, about 900 amino acids to about 950 amino acids, about 9 It may have from 50 amino acids to about 3000 amino acids, from about 950 amino acids to about 2500 amino acids, from about 950 amino acids to about 2000 amino acids, from about 950 amino acids to about 1500 amino acids, from about 950 amino acids to about 1000 amino acids, from about 1000 amino acids to about 3000 amino acids, from about 1000 amino acids to about 2500 amino acids, from about 1000 amino acids to about 2000 amino acids, from about 1000 amino acids to about 1500 amino acids, from about 1500 amino acids to about 3000 amino acids, from about 1500 amino acids to about 2500 amino acids, from about 1500 amino acids to about 2000 amino acids, from about 2000 amino acids to about 3000 amino acids, from about 2000 amino acids to about 2500 amino acids, or from about 2500 amino acids to about 3000 amino acids.

[0261] In some embodiments of any of the single-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) are immediately adjacent to each other. In some embodiments of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein). In some embodiments of any of the single-chain chimeric polypeptides described herein, the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) are immediately adjacent to each other. In some embodiments of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art).

[0262] In some embodiments of any of the single-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) are immediately adjacent to each other. In some embodiments of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art). In some embodiments of any of the single-chain chimeric polypeptides described herein, the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) are immediately adjacent to each other. In some embodiments of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein or known in the art).

[0263] In some embodiments, the single chain chimeric polypeptide comprises: (SEQ ID NO: 85), may include a sequence that is at least 70% identical (e.g., at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical).

[0264] In some embodiments, the single chain chimeric polypeptide comprises:

[0265] In some embodiments, the single chain chimeric polypeptide comprises: (SEQ ID NO: 87), may include a sequence that is at least 70% identical (e.g., at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical).

[0266] In some embodiments, the single chain chimeric polypeptide comprises: ATGAAGTGGGTGACCTTCATCAGCTTATTATTTTTATTCAGCTCCGCCTATTCC CAGATCGTGCTGACCCAAAGCCCCGCCATCATGAGCGCTAGCCCCGGTGAGAAGGTGACCATGACATGCTCCGCTTCCAGCTCCGTGTCCTACATGAACTGGTATCAGCAGAAAAGCGGAACCAGCCCCAAAAGGTGGATCTACGACACCAGCAAGCTGGCCTCCGGAGTGCCCGCTCATTTCCGGGGCTCTGGATCCGGCACCAGCTACTCTTTAACCATTTCCGGCATGGAAGCTGAAGACGCTGCCACCTACTATTGCCAGCAATGGAGCAGCAACCCCTTCACATTCGGATCTGGCACCAAGCTCGAAATCAATCGTGGAGGAGGTGGCAGCGGCGGCGGTGGATCCGGCGGAGGAGGAAGCCAAGTTCAACTCCAGCAGAGCGGCGCTGAACTGGCCCGGCCCGGCGCCTCCGTCAAGATGAGCTGCAAGGCTTCCGGCTATACATTTACTCGTTACACAATGCATTGGGTCAAGCAGAGGCCCGGTCAAGGTTTAGAGTGGATCGGATATATCAACCCTTCCCGGGGCTACACCAACTATAACCAAAAGTTCAAGGATAAAGCCACTTTAACCACTGACAAGAGCTCCTCCACCGCCTACATGCAGCTGTCCTCTTTAACCAGCGAGGACTCCGCTGTTTACTACTGCGCTAGGTATTACGACGACCACTACTGTTTAGACTATTGGGGACAAGGTACCACTTTAACCGTCAGCAGCTCCGGCACCACCAATACCGTGGCCGCTTATAACCTCACATGGAAGAGCACCAACTTCAAGACAATTCTGGAATGGGAACCCAAGCCCGTCAATCAAGTTTACACCGTGCAGATCTCCACCAAATCCGGAGACTGGAAGAGCAAGTGCTTCTACACAACAGACACCGAGTGTGATTTAACCGACGAAATCGTCAAGGACGTCAAGCAAACCTATCTGGCTCGGGTCTTTTCCTACCCCGCTGGCAATGTCGAGTCCACCGGCTCCGCTGGCGAGCCTCTCTACGAGAATTCCCCCGAATTCACCCCTTATTTAGAGACCAATTTAGGCCAGCCTACCATCCAGAGCTTCGAGCAAGTTGGCACCAAGGTGAACGTCACCGTCGAGGATGAAAGGACTTTAGTGCGGCGGAATAACACATTTTTATCCCTCCGGGATGTGTTCGGCAAAGACCTCATCTACACACTGTACTATTGGAAGTCCAGCTCCTCCGGCAAAAAGACCGCTAAGACCAACACCAACGAGTTTTTAATTGACGTGGACAAAGGCGAGAACTACTGCTTCAGCGTGCAAGCCGTGATCCCTTCTCGTACCGTCAACCGGAAGAGCACAGATTCCCCCGTTGAGTGCATGGGCCAAGAAAAGGGCGAGTTCCGGGAGGTCCAGCTGCAGCAGAGCGGACCCGAACTCGTGAAACCCGGTGCTTCCGTGAAAATGTCTTGTAAGGCCAGCGGATACACCTTCACCTCCTATGTGATCCAGTGGGTCAAACAGAAGCCCGGACAAGGTCTCGAGTGGATCGGCAGCATCAACCCTTACAACGACTATACCAAATACAACGAGAAGTTTAAGGGAAAGGCTACTTTAACCTCCGACAAAAGCTCCATCACAGCCTACATGGAGTTCAGCTCTTTAACATCCGAGGACAGCGCTCTGTACTATTGCGCCCGGTGGGGCGACGGCAATTACTGGGGACGGGGCACAACACTGACCGTGAGCAGCGGAGGCGGAGGCTCCGGCGGAGGCGGATCTGGCGGTGGCGGCTCCGACATCGAGATGACCCAGTCCCCCGCTATCATGTCCGCCTCTTTAGGCGAGCGGGTCACAATGACTTGTACAGCCTCCTCCAGCGTCTCCTCCTCCTACTTCCATTGGTACCAACAGAAACCCGGAAGCTCCCCTAAACTGTGCATCTACAGCACCAGCAATCTCGCCAGCGGCGTGCCCCCTAGGTTTTCCGGAAGCGGAAGCACCAGCTACTCTTTAACCATCTCCTCCATGGAGGCTGAGGATGCCGCCACCTACTTTTGTCACCAGTACCACCGGTCCCCCACCTTCGGAGGCGGCACCAAACTGGAGACAAAGAGG (SEQ ID NO: 88).

[0267] In some embodiments, the single chain chimeric polypeptide comprises: (SEQ ID NO: 89).

[0268] In some embodiments, the single chain chimeric polypeptide comprises: GTGCAGCTGCAGCAGTCCGGACCCGAACTGGTCAAGCCCGGTGCCTCCGTGAAAATGTCTTGTAAGGCTTCTGGCTACACCTTTACCTCCTACGTCATCCAATGGGTGAAGCAGAAGCCCGGTCAAGGTCTCGAGTGGATCGGCAGCATCAATCCCTACAACGATTACACCAAGTATAACGAAAAGTTTAAGGGCAAGGCCACTCTGACAAGCGACAAGAGCTCCATTACCGCCTACATGGAGTTTTCCTCTTTAACTTCTGAGGACTCCGCTTTATACTATTGCGCTCGTTGGGGCGATGGCAATTATTGGGGCCGGGGAACTACTTTAACAGTGAGCTCCGGCGGCGGCGGAAGCGGAGGTGGAGGATCTGGCGGTGGAGGCAGCGACATCGAGATGACACAGTCCCCCGCTATCATGAGCGCCTCTTTAGGAGAACGTGTGACCATGACTTGTACAGCTTCCTCCAGCGTGAGCAGCTCCTATTTCCACTGGTACCAGCAGAAACCCGGCTCCTCCCCTAAACTGTGTATCTACTCCACAAGCAATTTAGCTAGCGGCGTGCCTCCTCGTTTTAGCGGCTCCGGCAGCACCTCTTACTCTTTAACCATTAGCTCTATGGAGGCCGAAGATGCCGCCACATACTTTTGCCATCAGTACCACCGGTCCCCTACCTTTGGCGGAGGCACAAAGCTGGAGACCAAGCGGAGCGGCACCACCAACACAGTGGCCGCCTACAATCTGACTTGGAAATCCACCAACTTCAAGACCATCCTCGAGTGGGAGCCCAAGCCCGTTAATCAAGTTTATACCGTGCAGATTTCCACCAAGAGCGGCGACTGGAAATCCAAGTGCTTCTATACCACAGACACCGAGTGCGATCTCACCGACGAGATCGTCAAAGACGTGAAGCAGACATATTTAGCTAGGGTGTTCTCCTACCCCGCTGGAAACGTGGAGAGCACCGGATCCGCTGGAGAGCCTTTATACGAGAACTCCCCCGAATTCACCCCCTATCTGGAAACCAATTTAGGCCAGCCCACCATCCAGAGCTTCGAACAAGTTGGCACAAAGGTGAACGTCACCGTCGAAGATGAGAGGACTTTAGTGCGGAGGAACAATACATTTTTATCCTTACGTGACGTCTTCGGCAAGGATTTAATCTACACACTGTATTACTGGAAGTCTAGCTCCTCCGGCAAGAAGACCGCCAAGACCAATACCAACGAATTTTTAATTGACGTGGACAAGGGCGAGAACTACTGCTTCTCCGTGCAAGCTGTGATCCCCTCCCGGACAGTGAACCGGAAGTCCACCGACTCCCCCGTGGAGTGCATGGGCCAAGAGAAGGGAGAGTTTCGTGAGCAGATCGTGCTGACCCAGTCCCCCGCTATTATGAGCGCTAGCCCCGGTGAAAAGGTGACTATGACATGCAGCGCCAGCTCTTCCGTGAGCTACATGAACTGGTATCAGCAGAAGTCCGGCACCAGCCCTAAAAGGTGGATCTACGACACCAGCAAGCTGGCCAGCGGCGTCCCCGCTCACTTTCGGGGCTCCGGCTCCGGAACAAGCTACTCTCTGACCATCAGCGGCATGGAAGCCGAGGATGCCGCTACCTATTACTGTCAGCAGTGGAGCTCCAACCCCTTCACCTTTGGATCCGGCACCAAGCTCGAGATTAATCGTGGAGGCGGAGGTAGCGGAGGAGGCGGATCCGGCGGTGGAGGTAGCCAAGTTCAGCTCCAGCAAAGCGGCGCCGAACTCGCTCGGCCCGGCGCTTCCGTGAAGATGTCTTGTAAGGCCTCCGGCTATACCTTCACCCGGTACACAATGCACTGGGTCAAGCAACGGCCCGGTCAAGGTTTAGAGTGGATTGGCTATATCAACCCCTCCCGGGGCTATACCAACTACAACCAGAAGTTCAAGGACAAAGCCACCCTCACCACCGACAAGTCCAGCAGCACCGCTTACATGCAGCTGAGCTCTTTAACATCCGAGGATTCCGCCGTGTACTACTGCGCTCGGTACTACGACGATCATTACTGCCTCGATTACTGGGGCCAAGGTACCACCTTAACAGTCTCCTCC (SEQ ID NO: 90).

[0269] In some embodiments, the single chain chimeric polypeptide comprises: (SEQ ID NO: 91), may include a sequence that is at least 70% identical (e.g., at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 99% identical, or 100% identical).

[0270] In some embodiments, the single chain chimeric polypeptide comprises: ATGAAATGGGTCACCTTCATCTCTTTACTGTTTTTATTTAGCAGCGCCTACAGCGTGCAGCTGCAGCAGTCCGGACCCGAACTGGTCAAGCCCGGTGCCTCCGTGAAAATGTCTTGTAAGGCTTCTGGCTACACCTTTACCTCCTACGTCATCCAATGGGTGAAGCAGAAGCCCGGTCAAGGTCTCGAGTGGATCGGCAGCATCAATCCCTACAACGATTACACCAAGTATAACGAAAAGTTTAAGGGCAAGGCCACTCTGACAAGCGACAAGAGCTCCATTACCGCCTACATGGAGTTTTCCTCTTTAACTTCTGAGGACTCCGCTTTATACTATTGCGCTCGTTGGGGCGATGGCAATTATTGGGGCCGGGGAACTACTTTAACAGTGAGCTCCGGCGGCGGCGGAAGCGGAGGTGGAGGATCTGGCGGTGGAGGCAGCGACATCGAGATGACACAGTCCCCCGCTATCATGAGCGCCTCTTTAGGAGAACGTGTGACCATGACTTGTACAGCTTCCTCCAGCGTGAGCAGCTCCTATTTCCACTGGTACCAGCAGAAACCCGGCTCCTCCCCTAAACTGTGTATCTACTCCACAAGCAATTTAGCTAGCGGCGTGCCTCCTCGTTTTAGCGGCTCCGGCAGCACCTCTTACTCTTTAACCATTAGCTCTATGGAGGCCGAAGATGCCGCCACATACTTTTGCCATCAGTACCACCGGTCCCCTACCTTTGGCGGAGGCACAAAGCTGGAGACCAAGCGGAGCGGCACCACCAACACAGTGGCCGCCTACAATCTGACTTGGAAATCCACCAACTTCAAGACCATCCTCGAGTGGGAGCCCAAGCCCGTTAATCAAGTTTATACCGTGCAGATTTCCACCAAGAGCGGCGACTGGAAATCCAAGTGCTTCTATACCACAGACACCGAGTGCGATCTCACCGACGAGATCGTCAAAGACGTGAAGCAGACATATTTAGCTAGGGTGTTCTCCTACCCCGCTGGAAACGTGGAGAGCACCGGATCCGCTGGAGAGCCTTTATACGAGAACTCCCCCGAATTCACCCCCTATCTGGAAACCAATTTAGGCCAGCCCACCATCCAGAGCTTCGAACAAGTTGGCACAAAGGTGAACGTCACCGTCGAAGATGAGAGGACTTTAGTGCGGAGGAACAATACATTTTTATCCTTACGTGACGTCTTCGGCAAGGATTTAATCTACACACTGTATTACTGGAAGTCTAGCTCCTCCGGCAAGAAGACCGCCAAGACCAATACCAACGAATTTTTAATTGACGTGGACAAGGGCGAGAACTACTGCTTCTCCGTGCAAGCTGTGATCCCCTCCCGGACAGTGAACCGGAAGTCCACCGACTCCCCCGTGGAGTGCATGGGCCAAGAGAAGGGAGAGTTTCGTGAGCAGATCGTGCTGACCCAGTCCCCCGCTATTATGAGCGCTAGCCCCGGTGAAAAGGTGACTATGACATGCAGCGCCAGCTCTTCCGTGAGCTACATGAACTGGTATCAGCAGAAGTCCGGCACCAGCCCTAAAAGGTGGATCTACGACACCAGCAAGCTGGCCAGCGGCGTCCCCGCTCACTTTCGGGGCTCCGGCTCCGGAACAAGCTACTCTCTGACCATCAGCGGCATGGAAGCCGAGGATGCCGCTACCTATTACTGTCAGCAGTGGAGCTCCAACCCCTTCACCTTTGGATCCGGCACCAAGCTCGAGATTAATCGTGGAGGCGGAGGTAGCGGAGGAGGCGGATCCGGCGGTGGAGGTAGCCAAGTTCAGCTCCAGCAAAGCGGCGCCGAACTCGCTCGGCCCGGCGCTTCCGTGAAGATGTCTTGTAAGGCCTCCGGCTATACCTTCACCCGGTACACAATGCACTGGGTCAAGCAACGGCCCGGTCAAGGTTTAGAGTGGATTGGCTATATCAACCCCTCCCGGGGCTATACCAACTACAACCAGAAGTTCAAGGACAAAGCCACCCTCACCACCGACAAGTCCAGCAGCACCGCTTACATGCAGCTGAGCTCTTTAACATCCGAGGATTCCGCCGTGTACTACTGCGCTCGGTACTACGACGATCATTACTGCCTCGATTACTGGGGCCAAGGTACCACCTTAACAGTCTCCTCC (SEQ ID NO: 92).

[0271] Some embodiments of any of the single-chain chimeric polypeptides described herein further comprise one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at their N-terminus and / or C-terminus.

[0272] In some embodiments, a single-chain chimeric polypeptide can comprise one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at its N-terminus. In some embodiments, one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at the N-terminus of the single-chain chimeric polypeptide can be immediately adjacent to a first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), a second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), or a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein). In some embodiments, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between one of at least one additional target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) at the N-terminus of the single-chain chimeric polypeptide and the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), or the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein).

[0273] In some embodiments of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at the C-terminus of the single-chain chimeric polypeptide. In some embodiments, one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at the C-terminus of the single-chain chimeric polypeptide is immediately adjacent to a first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), a second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), or a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein). In some embodiments, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between one of at least one additional target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) at the C-terminus of the single-chain chimeric polypeptide and the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), or the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein).

[0274] In some embodiments of any of the single-chain chimeric polypeptides described herein, the single-chain chimeric polypeptide comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at its N-terminus and C-terminus. In some embodiments, one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at the N-terminus of the single-chain chimeric polypeptide is immediately adjacent to a first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), a second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), or a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein). In some embodiments, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between one of the one or more additional antigen-binding domains (e.g., any of the exemplary target-binding domains described herein or known in the art) at the N-terminus and the first target-binding domain (e.g., any of the exemplary target-binding domains described herein or known in the art), the second target-binding domain (e.g., any of the exemplary target-binding domains described herein or known in the art), or the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains).In some embodiments, one of the one or more additional target binding domains at the C-terminus (e.g., any of the exemplary target binding domains described herein or known in the art) is immediately adjacent to the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), or the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains). In some embodiments, the single-chain chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between one of the one or more additional antigen-binding domains (e.g., any of the exemplary target-binding domains described herein or known in the art) at the C-terminus of the single-chain chimeric polypeptide and the first target-binding domain (e.g., any of the exemplary target-binding domains described herein or known in the art), the second target-binding domain (e.g., any of the exemplary target-binding domains described herein or known in the art), or the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein).

[0275] In some embodiments of any of the single-chain chimeric polypeptides described herein, two or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) specifically bind to the same antigen. In some embodiments, two or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) specifically bind to the same epitope. In some embodiments, two or more (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) comprise the same amino acid sequence.

[0276] In some embodiments of any of the single-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) each specifically bind to the same antigen. In some embodiments, the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) each specifically bind to the same epitope. In some embodiments, the first target binding domain, the second target binding domain, and the one or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains each comprise the same amino acid sequence.

[0277] In some embodiments of any of the single-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) specifically bind to different antigens.

[0278] In some embodiments of any of the single-chain chimeric polypeptides, one or more of the first target binding domain, the second target binding domain, and the one or more target binding domains are antigen-binding domains (e.g., any of the exemplary antigen-binding domains described herein or known in the art). In some embodiments of any of the single-chain chimeric polypeptides described herein, the first target binding domain, the second target binding domain, and the one or more target binding domains are each antigen-binding domains (e.g., any of the exemplary antigen-binding domains described herein or known in the art). In some embodiments, the antigen-binding domain may comprise an scFv or a single-domain antibody.

[0279] In some embodiments of any of the single-chain chimeric polypeptides described herein, one or more of a first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), a second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art). Above (e.g. 2, 3, 4, 5, 6, 7, 8, 9, or 10) are CD16a, CD28, CD3, CD33, CD20, CD19, CD22, CD123, IL-1R, IL-1, VEGF, IL-6R, IL-4, IL-10, PDL-1, TIGIT , PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER 2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16-binding protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKP30 ligand, scMHCII ligand, scTCR ligand, I The antibody specifically binds to a target selected from the group consisting of IL-1 receptor, IL-2 receptor, IL-3 receptor, IL-7 receptor, IL-8 receptor, IL-10 receptor, IL-12 receptor, IL-15 receptor, IL-17 receptor, IL-18 receptor, IL-21 receptor, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, CD122 receptor, and CD28 receptor.

[0280] In some embodiments of any of the single-chain chimeric polypeptides described herein, one or more of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine proteins. Non-limiting examples of soluble interleukin and soluble cytokine proteins include IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0281] In some embodiments of any of the single-chain chimeric polypeptides described herein, one or more of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine receptors. Non-limiting examples of soluble interleukin receptors and soluble cytokine receptors include soluble TGF-β receptor II (TGF-βRII), soluble TGF-βRIII, soluble NKG2D, soluble NKP30, soluble NKp44, soluble NKp46, soluble DNAM1, scMHCI, scMHCII, scTCR, soluble CD155, soluble CD122, soluble CD3, or soluble CD28.

[0282] In some embodiments of any of the single chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the target binding domains described herein), the second target binding domain (e.g., any of the target binding domains described herein), and the one or more target binding domains (e.g., any of the target binding domains described herein) are each independently selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, The antibody can specifically bind to a target selected from the group consisting of CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKP30 ligand, scMHCI ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0283] In some embodiments of any of the single-chain chimeric polypeptides described herein, one or more of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine proteins. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the soluble interleukin or cytokine protein is selected from the group of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0284] In some embodiments of any of the single-chain chimeric polypeptides described herein, one or more of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine receptors. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the soluble receptor is soluble TGF-β receptor II (TGF-βRII), soluble TGF-βRIII, soluble TNFα receptor, soluble IL-4 receptor, or soluble IL-10 receptor.

[0285] Multi-chain chimeric polypeptide - Type A A non-limiting example of an NK cell activator is a multi-chain chimeric polypeptide comprising: (a) a first chimeric polypeptide comprising (i) a first target binding domain, (ii) a soluble tissue factor domain, and (iii) a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide comprising (i) a second domain of the pair of affinity domains and (ii) a second target binding domain, wherein the first chimeric polypeptide and the second chimeric polypeptide are associated via binding between the first domain and the second domain of the pair of affinity domains.

[0286] In some examples of any of the multi-chain chimeric polypeptides described herein, the total length of the first chimeric polypeptide and / or the second chimeric polypeptide is each independently from about 50 amino acids to about 3000 amino acids, from about 50 amino acids to about 2500 amino acids, from about 50 amino acids to about 2000 amino acids, from about 50 amino acids to about 1500 amino acids, from about 50 amino acids to about 1000 amino acids, from about 50 amino acids to about 950 amino acids, from about 50 amino acids to about 900 amino acids, from about 50 amino acids to about 850 amino acids, from about 50 amino acids to about 800 amino acids, from about 50 amino acids to about 75 0 amino acids, about 50 amino acids to about 700 amino acids, about 50 amino acids to about 650 amino acids, about 50 amino acids to about 600 amino acids, about 50 amino acids to about 550 amino acids, about 50 amino acids to about 500 amino acids, about 50 amino acids to about 480 amino acids, about 50 amino acids to about 460 amino acids, about 50 amino acids to about 440 amino acids, about 50 amino acids to about 420 amino acids, about 50 amino acids to about 400 amino acids, about 50 amino acids to about 380 amino acids, about 50 amino acids to about 360 amino acids, about 50 amino acids to about 340 amino acids, about 50 amino acids to about 320 amino acids, about 50 amino acids amino acids to about 300 amino acids, about 50 amino acids to about 280 amino acids, about 50 amino acids to about 260 amino acids, about 50 amino acids to about 240 amino acids, about 50 amino acids to about 220 amino acids, about 50 amino acids to about 200 amino acids, about 50 amino acids to about 150 amino acids, about 50 amino acids to about 100 amino acids, about 100 amino acids to about 3000 amino acids, about 100 amino acids to about 2500 amino acids, about 100 amino acids to about 2000 amino acids, about 100 amino acids to about 1500 amino acids, about 100 amino acids to about 1000 amino acids, about 100 amino acids to about 950 amino acids, about 10 0 amino acids to about 900 amino acids, about 100 amino acids to about 850 amino acids, about 100 amino acids to about 800 amino acids, about 100 amino acids to about 750 amino acids, about 100 amino acids to about 700 amino acids, about 100 amino acids to about 650 amino acids, about 100 amino acids to about 600 amino acids, about 100 amino acids to about 550 amino acids, about 100 amino acids to about 500 amino acids, about 100 amino acids to about 480 amino acids, about 100 amino acids to about 460 amino acids, about 100 amino acids to about 440 amino acids, about 100 amino acids to about 420 amino acids, about 100 amino acids to about 400 amino acids,About 100 amino acids to about 380 amino acids, about 100 amino acids to about 360 amino acids, about 100 amino acids to about 340 amino acids, about 100 amino acids to about 320 amino acids, about 100 amino acids to about 300 amino acids, about 100 amino acids to about 280 amino acids, about 100 amino acids to about 260 amino acids, about 100 amino acids to about 240 amino acids, about 100 amino acids to about 220 amino acids, about 100 amino acids to about 200 amino acids, about 100 amino acids to about 150 amino acids, about 150 amino acids to about 3000 amino acids, about 150 amino acids to about 2500 amino acids, about 150 amino acids to about 2000 Amino acids, about 150 amino acids to about 1500 amino acids, about 150 amino acids to about 1000 amino acids, about 150 amino acids to about 950 amino acids, about 150 amino acids to about 900 amino acids, about 150 amino acids to about 850 amino acids, about 150 amino acids to about 800 amino acids, about 150 amino acids to about 750 amino acids, about 150 amino acids to about 700 amino acids, about 150 amino acids to about 650 amino acids, about 150 amino acids to about 600 amino acids, about 150 amino acids to about 550 amino acids, about 150 amino acids to about 500 amino acids, about 150 amino acids to about 480 amino acids, about 150 amino acids to about About 460 amino acids, about 150 to about 440 amino acids, about 150 to about 420 amino acids, about 150 to about 400 amino acids, about 150 to about 380 amino acids, about 150 to about 360 amino acids, about 150 to about 340 amino acids, about 150 to about 320 amino acids, about 150 to about 300 amino acids, about 150 to about 280 amino acids, about 150 to about 260 amino acids, about 150 to about 240 amino acids, about 150 to about 220 amino acids, about 150 to about 200 amino acids, about 200 amino acids amino acids to about 3000 amino acids, about 200 amino acids to about 2500 amino acids, about 200 amino acids to about 2000 amino acids, about 200 amino acids to about 1500 amino acids, about 200 amino acids to about 1000 amino acids, about 200 amino acids to about 950 amino acids, about 200 amino acids to about 900 amino acids, about 200 amino acids to about 850 amino acids, about 200 amino acids to about 800 amino acids, about 200 amino acids to about 750 amino acids, about 200 amino acids to about 700 amino acids, about 200 amino acids to about 650 amino acids, about 200 amino acids to about 600 amino acids, about 200 amino acids to about 550 amino acids,About 200 to about 500 amino acids, about 200 to about 480 amino acids, about 200 to about 460 amino acids, about 200 to about 440 amino acids, about 200 to about 420 amino acids, about 200 to about 400 amino acids, about 200 to about 380 amino acids, about 200 to about 360 amino acids, about 200 to about 340 amino acids, about 200 to about 320 amino acids, about 200 to about 300 amino acids, about 200 to about 280 amino acids, about 200 to about 260 amino acids, about 200 to about 240 amino acids amino acids, about 200 amino acids to about 220 amino acids, about 220 amino acids to about 3000 amino acids, about 220 amino acids to about 2500 amino acids, about 220 amino acids to about 2000 amino acids, about 220 amino acids to about 1500 amino acids, about 220 amino acids to about 1000 amino acids, about 220 amino acids to about 950 amino acids, about 220 amino acids to about 900 amino acids, about 220 amino acids to about 850 amino acids, about 220 amino acids to about 800 amino acids, about 220 amino acids to about 750 amino acids, about 220 amino acids to about 700 amino acids, about 220 amino acids to about 650 amino acids, about 220 amino acids to about About 600 amino acids, about 220 amino acids to about 550 amino acids, about 220 amino acids to about 500 amino acids, about 220 amino acids to about 480 amino acids, about 220 amino acids to about 460 amino acids, about 220 amino acids to about 440 amino acids, about 220 amino acids to about 420 amino acids, about 220 amino acids to about 400 amino acids, about 220 amino acids to about 380 amino acids, about 220 amino acids to about 360 amino acids, about 220 amino acids to about 340 amino acids, about 220 amino acids to about 320 amino acids, about 220 amino acids to about 300 amino acids, about 220 amino acids to about 280 amino acids, about 220 amino acids amino acids to about 260 amino acids, about 220 amino acids to about 240 amino acids, about 240 amino acids to about 3000 amino acids, about 240 amino acids to about 2500 amino acids, about 240 amino acids to about 2000 amino acids, about 240 amino acids to about 1500 amino acids, about 240 amino acids to about 1000 amino acids, about 240 amino acids to about 950 amino acids, about 240 amino acids to about 900 amino acids, about 240 amino acids to about 850 amino acids, about 240 amino acids to about 800 amino acids, about 240 amino acids to about 750 amino acids, about 240 amino acids to about 700 amino acids, about 240 amino acids to about 650 amino acids,About 240 amino acids to about 600 amino acids, about 240 amino acids to about 550 amino acids, about 240 amino acids to about 500 amino acids, about 240 amino acids to about 480 amino acids, about 240 amino acids to about 460 amino acids, about 240 amino acids to about 440 amino acids, about 240 amino acids to about 420 amino acids, about 240 amino acids to about 400 amino acids, about 240 amino acids to about 380 amino acids, about 240 amino acids to about 360 amino acids, about 240 amino acids to about 340 amino acids, about 240 amino acids to about 320 amino acids, about 240 amino acids to about 300 amino acids, about 240 amino acids to about 280 amino acids amino acids, about 240 amino acids to about 260 amino acids, about 260 amino acids to about 3000 amino acids, about 260 amino acids to about 2500 amino acids, about 260 amino acids to about 2000 amino acids, about 260 amino acids to about 1500 amino acids, about 260 amino acids to about 1000 amino acids, about 260 amino acids to about 950 amino acids, about 260 amino acids to about 900 amino acids, about 260 amino acids to about 850 amino acids, about 260 amino acids to about 800 amino acids, about 260 amino acids to about 750 amino acids, about 260 amino acids to about 700 amino acids, about 260 amino acids to about 650 amino acids, about 260 amino acids to about About 600 amino acids, about 260 amino acids to about 550 amino acids, about 260 amino acids to about 500 amino acids, about 260 amino acids to about 480 amino acids, about 260 amino acids to about 460 amino acids, about 260 amino acids to about 440 amino acids, about 260 amino acids to about 420 amino acids, about 260 amino acids to about 400 amino acids, about 260 amino acids to about 380 amino acids, about 260 amino acids to about 360 amino acids, about 260 amino acids to about 340 amino acids, about 260 amino acids to about 320 amino acids, about 260 amino acids to about 300 amino acids, about 260 amino acids to about 280 amino acids, about 280 amino acids amino acids to about 3000 amino acids, about 280 amino acids to about 2500 amino acids, about 280 amino acids to about 2000 amino acids, about 280 amino acids to about 1500 amino acids, about 280 amino acids to about 1000 amino acids, about 280 amino acids to about 950 amino acids, about 280 amino acids to about 900 amino acids, about 280 amino acids to about 850 amino acids, about 280 amino acids to about 800 amino acids, about 280 amino acids to about 750 amino acids, about 280 amino acids to about 700 amino acids, about 280 amino acids to about 650 amino acids, about 280 amino acids to about 600 amino acids, about 280 amino acids to about 550 amino acids,About 280 amino acids to about 500 amino acids, about 280 amino acids to about 480 amino acids, about 280 amino acids to about 460 amino acids, about 280 amino acids to about 440 amino acids, about 280 amino acids to about 420 amino acids, about 280 amino acids to about 400 amino acids, about 280 amino acids to about 380 amino acids, about 280 amino acids to about 360 amino acids, about 280 amino acids to about 340 amino acids, about 280 amino acids to about 320 amino acids, about 280 amino acids to about 300 amino acids, about 300 amino acids to about 3000 amino acids, about 300 amino acids to about 2500 amino acids, about 300 amino acids to about 2000 Amino acids, about 300 to about 1500 amino acids, about 300 to about 1000 amino acids, about 300 to about 950 amino acids, about 300 to about 900 amino acids, about 300 to about 850 amino acids, about 300 to about 800 amino acids, about 300 to about 750 amino acids, about 300 to about 700 amino acids, about 300 to about 650 amino acids, about 300 to about 600 amino acids, about 300 to about 550 amino acids, about 300 to about 500 amino acids, about 300 to about 480 amino acids, about 300 to about About 460 amino acids, about 300 to about 440 amino acids, about 300 to about 420 amino acids, about 300 to about 400 amino acids, about 300 to about 380 amino acids, about 300 to about 360 amino acids, about 300 to about 340 amino acids, about 300 to about 320 amino acids, about 320 to about 3000 amino acids, about 320 to about 2500 amino acids, about 320 to about 2000 amino acids, about 320 to about 1500 amino acids, about 320 to about 1000 amino acids, about 320 to about 950 amino acids, about 3 20 amino acids to about 900 amino acids, about 320 amino acids to about 850 amino acids, about 320 amino acids to about 800 amino acids, about 320 amino acids to about 750 amino acids, about 320 amino acids to about 700 amino acids, about 320 amino acids to about 650 amino acids, about 320 amino acids to about 600 amino acids, about 320 amino acids to about 550 amino acids, about 320 amino acids to about 500 amino acids, about 320 amino acids to about 480 amino acids, about 320 amino acids to about 460 amino acids, about 320 amino acids to about 440 amino acids, about 320 amino acids to about 420 amino acids, about 320 amino acids to about 400 amino acids,About 320 amino acids to about 380 amino acids, about 320 amino acids to about 360 amino acids, about 320 amino acids to about 340 amino acids, about 340 amino acids to about 3000 amino acids, about 340 amino acids to about 2500 amino acids, about 340 amino acids to about 2000 amino acids, about 340 amino acids to about 1500 amino acids, amino acids, about 340 amino acids to about 1000 amino acids, about 340 amino acids to about 950 amino acids, about 340 amino acids to about 900 amino acids, about 340 amino acids to about 850 amino acids, about 340 amino acids to about 800 amino acids, about 340 amino acids to about 750 amino acids, about 340 amino acids to about 700 amino acids, about 340 amino acids to about 650 amino acids, about 340 amino acids to about 600 amino acids, about 340 amino acids to about 550 amino acids, about 340 amino acids to about 500 amino acids, about 340 amino acids to about 480 amino acids, about 340 amino acids to about 460 amino acids, about 340 amino acids to about 500 amino acids amino acids to about 440 amino acids, about 340 amino acids to about 420 amino acids, about 340 amino acids to about 400 amino acids, about 340 amino acids to about 380 amino acids, about 340 amino acids to about 360 amino acids, about 360 amino acids to about 3000 amino acids, about 360 amino acids to about 2500 amino acids, about 360 amino acids to about 2000 amino acids, about 360 amino acids to about 1500 amino acids, about 360 amino acids to about 1000 amino acids, about 360 amino acids to about 950 amino acids, about 360 amino acids to about 900 amino acids, about 360 amino acids to about 850 amino acids, about 360 amino acids to about 800 amino acids amino acids, about 360 amino acids to about 750 amino acids, about 360 amino acids to about 700 amino acids, about 360 amino acids to about 650 amino acids, about 360 amino acids to about 600 amino acids, about 360 amino acids to about 550 amino acids, about 360 amino acids to about 500 amino acids, about 360 amino acids to about 480 amino acids, about 360 amino acids to about 460 amino acids, about 360 amino acids to about 440 amino acids, about 360 amino acids to about 420 amino acids, about 360 amino acids to about 400 amino acids, about 360 amino acids to about 380 amino acids, about 380 amino acids to about 3000 amino acids, about 380 amino acids to about 5000 amino acids About 2500 amino acids, about 380 amino acids to about 2000 amino acids, about 380 amino acids to about 1500 amino acids, about 380 amino acids to about 1000 amino acids, about 380 amino acids to about 950 amino acids, about 380 amino acids to about 900 amino acids, about 380 amino acids to about 850 amino acids, about 380 amino acids to about 800 amino acids, about 380 amino acids to about 750 amino acids, about 380 amino acids to about 700 amino acids, about 380 amino acids to about 650 amino acids, about 380 amino acids to about 600 amino acids, about 380 amino acids to about 550 amino acids, about 380 amino acids to about 500 amino acids,About 380 amino acids to about 480 amino acids, about 380 amino acids to about 460 amino acids, about 380 amino acids to about 440 amino acids, about 380 amino acids to about 420 amino acids, about 380 amino acids to about 400 amino acids, about 400 amino acids to about 3000 amino acids, about 400 amino acids to about 2500 amino acids, about 400 amino acids to about 2000 amino acids, about 400 amino acids to about 1500 amino acids, about 400 amino acids to about 1000 amino acids, about 400 amino acids to about 950 amino acids, about 400 amino acids to about 900 amino acids, about 400 amino acids to about 850 amino acids, about 400 amino acids amino acids to about 800 amino acids, about 400 amino acids to about 750 amino acids, about 400 amino acids to about 700 amino acids, about 400 amino acids to about 650 amino acids, about 400 amino acids to about 600 amino acids, about 400 amino acids to about 550 amino acids, about 400 amino acids to about 500 amino acids, about 400 amino acids to about 480 amino acids, about 400 amino acids to about 460 amino acids, about 400 amino acids to about 440 amino acids, about 400 amino acids to about 420 amino acids, about 420 amino acids to about 3000 amino acids, about 420 amino acids to about 2500 amino acids, about 420 amino acids to about 2000 amino acids , about 420 amino acids to about 1500 amino acids, about 420 amino acids to about 1000 amino acids, about 420 amino acids to about 950 amino acids, about 420 amino acids to about 900 amino acids, about 420 amino acids to about 850 amino acids, about 420 amino acids to about 800 amino acids, about 420 amino acids to about 750 amino acids, about 420 amino acids to about 700 amino acids, about 420 amino acids to about 650 amino acids, about 420 amino acids to about 600 amino acids, about 420 amino acids to about 550 amino acids, about 420 amino acids to about 500 amino acids, about 420 amino acids to about 480 amino acids, about 420 amino acids to about 460 amino acids, about 420 amino acids to about 440 amino acids, about 440 amino acids to about 3000 amino acids, about 440 amino acids to about 2500 amino acids, about 440 amino acids to about 2000 amino acids, about 440 amino acids to about 1500 amino acids, about 440 amino acids to about 1000 amino acids, about 440 amino acids to about 950 amino acids, about 440 amino acids to about 900 amino acids, about 440 amino acids to about 850 amino acids, about 440 amino acids to about 800 amino acids, about 440 amino acids to about 750 amino acids, about 440 amino acids to about 700 amino acids, about 440 amino acids to about 650 amino acids,About 440 amino acids to about 600 amino acids, about 440 amino acids to about 550 amino acids, about 440 amino acids to about 500 amino acids, about 440 amino acids to about 480 amino acids, about 440 amino acids to about 460 amino acids, about 460 amino acids to about 3000 amino acids, about 460 amino acids to about 2500 amino acids, about 460 amino acids to about 2000 amino acids, about 460 amino acids to about 1500 amino acids, about 460 amino acids to about 1000 amino acids, about 460 amino acids to about 950 amino acids, about 460 amino acids to about 900 amino acids, about 460 amino acids to about 850 amino acids, about 460 amino acids up to about 800 amino acids, about 460 amino acids to about 750 amino acids, about 460 amino acids to about 700 amino acids, about 460 amino acids to about 650 amino acids, about 460 amino acids to about 600 amino acids, about 460 amino acids to about 550 amino acids, about 460 amino acids to about 500 amino acids, about 460 amino acids to about 480 amino acids, about 480 amino acids to about 3000 amino acids, about 480 amino acids to about 2500 amino acids, about 480 amino acids to about 2000 amino acids, about 480 amino acids to about 1500 amino acids, about 480 amino acids to about 1000 amino acids, about 480 amino acids to about 950 amino acids , about 480 amino acids to about 900 amino acids, about 480 amino acids to about 850 amino acids, about 480 amino acids to about 800 amino acids, about 480 amino acids to about 750 amino acids, about 480 amino acids to about 700 amino acids, about 480 amino acids to about 650 amino acids, about 480 amino acids to about 600 amino acids, about 480 amino acids to about 550 amino acids, about 480 amino acids to about 500 amino acids, about 500 amino acids to about 3000 amino acids, about 500 amino acids to about 2500 amino acids, about 500 amino acids to about 2000 amino acids, about 500 amino acids to about 1500 amino acids, about 500 amino acids to about 1 about 1000 amino acids, about 500 amino acids to about 950 amino acids, about 500 amino acids to about 900 amino acids, about 500 amino acids to about 850 amino acids, about 500 amino acids to about 800 amino acids, about 500 amino acids to about 750 amino acids, about 500 amino acids to about 700 amino acids, about 500 amino acids to about 650 amino acids, about 500 amino acids to about 600 amino acids, about 500 amino acids to about 550 amino acids, about 550 amino acids to about 3000 amino acids, about 550 amino acids to about 2500 amino acids, about 550 amino acids to about 2000 amino acids, about 550 amino acids to about 1500 amino acids,About 550 amino acids to about 1000 amino acids, about 550 amino acids to about 950 amino acids, about 550 amino acids to about 900 amino acids, about 550 amino acids to about 850 amino acids, about 550 amino acids to about 800 amino acids, about 550 amino acids to about 750 amino acids, about 550 amino acids to about 700 amino acids, about 550 amino acids to about 650 amino acids, about 550 amino acids to about 600 amino acids, about 600 amino acids to about 3000 amino acids, about 600 amino acids to about 2500 amino acids, about 600 amino acids to about 2000 amino acids, about 600 amino acids to about 1500 amino acids, about 600 amino acids to about 1000 amino acids, about 600 amino acids to about 950 amino acids, about 600 amino acids to about 900 amino acids, about 600 amino acids to about 850 amino acids, about 600 amino acids to about 800 amino acids, about 600 amino acids to about 750 amino acids, about 600 amino acids to about 700 amino acids, about 600 amino acids to about 650 amino acids, about 650 amino acids to about 3000 amino acids, about 650 amino acids to about 2500 amino acids, about 650 amino acids to about 2000 amino acids, about 650 amino acids to about 1500 amino acids, about 650 amino acids to about 1000 amino acids, about 650 amino acids to about 950 amino acids, about 650 amino acids to about 900 amino acids, about 650 amino acids to about 850 amino acids, about 650 amino acids to about 800 amino acids, about 650 amino acids to about 750 amino acids, about 650 amino acids to about 700 amino acids, about 700 amino acids to about 3000 amino acids, about 700 amino acids to about 2500 amino acids, about 700 amino acids to about 2000 amino acids, about 700 amino acids to about 1500 amino acids, about 700 amino acids to about 1000 amino acids, about 700 amino acids to about 950 amino acids, about 700 amino acids to about 900 amino acids, about 700 amino acids to about 850 amino acids, about 700 amino acids to about 8 00 amino acids, about 700 amino acids to about 750 amino acids, about 750 amino acids to about 3000 amino acids, about 750 amino acids to about 2500 amino acids, about 750 amino acids to about 2000 amino acids, about 750 amino acids to about 1500 amino acids, about 750 amino acids to about 1000 amino acids, about 750 amino acids to about 950 amino acids, about 750 amino acids to about 900 amino acids, about 750 amino acids to about 850 amino acids, about 750 amino acids to about 800 amino acids, about 800 amino acids to about 3000 amino acids, about 800 amino acids to about 2500 amino acids, about 800 amino acids to about 2000 amino acids,About 800 amino acids to about 1500 amino acids, about 800 amino acids to about 1000 amino acids, about 800 amino acids to about 950 amino acids, about 800 amino acids to about 900 amino acids, about 800 amino acids to about 850 amino acids, about 850 amino acids to about 3000 amino acids, about 850 amino acids to about 2500 amino acids, about 850 amino acids to about 2000 amino acids, about 850 amino acids to about 1500 amino acids, about 850 amino acids to about 1000 amino acids, about 850 amino acids to about 950 amino acids, about 850 amino acids to about 900 amino acids, about 900 amino acids to about 3000 amino acids, about 900 amino acids to about 2500 amino acids, about 900 amino acids to about 2000 amino acids, about 900 amino acids to about 1500 amino acids, about 900 amino acids to about 1000 amino acids, about The length may be 900 to about 950 amino acids, about 950 to about 3000 amino acids, about 950 to about 2500 amino acids, about 950 to about 2000 amino acids, about 950 to about 1500 amino acids, about 950 to about 1000 amino acids, about 1000 to about 3000 amino acids, about 1000 to about 2500 amino acids, about 1000 to about 2000 amino acids, about 1000 to about 1500 amino acids, about 1500 to about 3000 amino acids, about 1500 to about 2500 amino acids, about 1500 to about 2000 amino acids, about 2000 to about 3000 amino acids, about 2000 to about 2500 amino acids, or about 2500 to about 3000 amino acids.

[0287] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the first target binding domains described herein) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) are immediately adjacent to each other within the first chimeric polypeptide. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the first target binding domain (e.g., any of the exemplary first target binding domains described herein) and the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) within the first chimeric polypeptide.

[0288] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and the first domain of the paired affinity domain (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein) are immediately adjacent to each other within the first chimeric polypeptide. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and the first domain of the paired affinity domain (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein) within the first chimeric polypeptide.

[0289] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the second domain of the pair of affinity domains (e.g., any of the exemplary second domains of any of the exemplary pairs of affinity domains described herein) and the second target binding domain (e.g., any of the exemplary second target binding domains described herein) are immediately adjacent to each other in the second chimeric polypeptide. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the second chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the second domain of the pair of affinity domains (e.g., any of the exemplary second domains of any of the exemplary pairs of affinity domains described herein) and the second target binding domain (e.g., any of the exemplary second target binding domains described herein) in the second chimeric polypeptide.

[0290] In some embodiments of any of the multi-chain chimeric polypeptides, the first chimeric polypeptide further comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art), wherein at least one of the one or more additional antigen binding domains is positioned between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein or known in the art) and the first domain of the pair of affinity domains (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein). In some embodiments, the first chimeric polypeptide may further comprise a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art), and / or a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) and a first domain of a pair of affinity domains (e.g., any of the exemplary first domains described herein of any of the exemplary pairs of affinity domains described herein).

[0291] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first chimeric polypeptide further comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains at the N-terminus and / or C-terminus of the first chimeric polypeptide. In some embodiments, at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) is immediately adjacent to the first domain of a pair of affinity domains (e.g., any of the exemplary first domains described herein of any of the exemplary pairs of affinity domains described herein) in the first chimeric polypeptide. In some embodiments, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) and the first domain of the pair of affinity domains (e.g., any of the exemplary first domains described herein of any of the exemplary pairs of affinity domains described herein). In some embodiments, at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) is immediately adjacent to the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) in the first chimeric polypeptide. In some embodiments, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) and the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art).

[0292] In some embodiments of any of the multi-chain chimeric polypeptides described herein, at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) is disposed at the N-terminus and / or C-terminus of the first chimeric polypeptide, and at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) is positioned between a soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein or known in the art) and a first domain of a pair of affinity domains (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein) in the first chimeric polypeptide. In some embodiments, at least one additional target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) of the one or more additional target binding domains disposed at the N-terminus is immediately adjacent to the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) or the first domain of a pair of affinity domains (e.g., any of the exemplary first domains described herein of any of the exemplary pairs of affinity domains described herein) in the first chimeric polypeptide. In some embodiments, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the linker sequences described herein or known in the art) disposed between the at least one additional target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) in the first chimeric polypeptide and the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) or the first domain of a pair of affinity domains (e.g., any of the exemplary first domains described herein of any of the exemplary pairs of affinity domains described herein).In some embodiments, at least one additional target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) of the one or more additional target binding domains disposed at the C-terminus is immediately adjacent to the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) or the first domain of a pair of affinity domains (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein) in the first chimeric polypeptide. In some embodiments, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) disposed between the at least one additional target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) in the first chimeric polypeptide and the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) or the first domain of a pair of affinity domains (e.g., any of the exemplary first domains described herein of any of the exemplary pairs of affinity domains described herein). In some embodiments, at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) positioned between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factor domains described herein) and the first domain of the pair of affinity domains (e.g., any of the first domains described herein or any of the exemplary pair of affinity domains described herein) is immediately adjacent to the soluble tissue factor domain and / or the first domain of the pair of affinity domains.In some embodiments, the first chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) disposed between (i) the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factors described herein) and at least one of one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) positioned between the soluble tissue factor domain (e.g., any of the exemplary soluble tissue factors described herein) and the first domain of the pair of affinity domains (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein), and / or (ii) between the first domain of the pair of affinity domains and at least one of the one or more additional target binding domains positioned between the soluble tissue factor domain and the first domain of the pair of affinity domains.

[0293] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the second chimeric polypeptide further comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) at the N-terminus and / or C-terminus of the second chimeric polypeptide. In some embodiments, at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) is immediately adjacent to the second domain of a pair of affinity domains (e.g., any of the exemplary second domains of any of the exemplary pairs of affinity domains described herein) in the second chimeric polypeptide. In some embodiments, the second chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) in the second chimeric polypeptide and the second domain of the pair of affinity domains (e.g., any of the exemplary second domains described herein of any of the exemplary pairs of affinity domains described herein). In some embodiments, at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) is immediately adjacent to the second target binding domain (e.g., any of the target binding domains described herein or known in the art) in the second chimeric polypeptide.In some embodiments, the second chimeric polypeptide further comprises a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between at least one of the one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) in the second chimeric polypeptide and the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art).

[0294] In some embodiments of any of the multi-chain chimeric polypeptides described herein, two or more (e.g., three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more) of the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to the same antigen. In some embodiments, two or more (e.g., three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more) of the first target binding domain, the second target binding domain, and the one or more additional target binding domains specifically bind to the same epitope. In some embodiments, two or more (e.g., three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more) of the first target binding domain, the second target binding domain, and the one or more additional target binding domains comprise the same amino acid sequence. In some embodiments, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each specifically bind to the same antigen. In some embodiments, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each specifically bind to the same epitope. In some embodiments, the first target binding domain, the second target binding domain, and the one or more additional target binding domains each comprise the same amino acid sequence.

[0295] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain, the second target binding domain, and one or more additional target binding domains specifically bind to different antigens. In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more) of the first target binding domain, the second target binding domain, and one or more additional target binding domains are antigen binding domains. In some embodiments, the first target binding domain, the second target binding domain, and one or more additional target binding domains are each antigen binding domains (e.g., scFvs or single-domain antibodies).

[0296] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or more of a first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), a second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) (e.g. 2, 3, 4, 5, 6, 7, 8, 9, or 10) CD16a, CD28, CD3, CD33, CD20, CD19, CD22, CD123, IL-1R, IL-1, VEGF, IL-6R, IL-4, IL-10, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2 , HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKP30 ligand, scMHCII ligand, scTCR ligand, I The antibody specifically binds to a target selected from the group consisting of IL-1 receptor, IL-2 receptor, IL-3 receptor, IL-7 receptor, IL-8 receptor, IL-10 receptor, IL-12 receptor, IL-15 receptor, IL-17 receptor, IL-18 receptor, IL-21 receptor, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, CD122 receptor, and CD28 receptor.

[0297] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or more of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine proteins. Non-limiting examples of soluble interleukin and soluble cytokine proteins include IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0298] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or more of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional target binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine receptors. Non-limiting examples of soluble interleukin receptors and soluble cytokine receptors include soluble TGF-β receptor II (TGF-βRII), soluble TGF-βRIII, soluble NKG2D, soluble NKP30, soluble NKp44, soluble NKp46, soluble DNAM1, scMHCI, scMHCII, scTCR, soluble CD155, soluble CD122, soluble CD3, or soluble CD28.

[0299] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the target binding domains described herein), the second target binding domain (e.g., any of the target binding domains described herein), and the one or more target binding domains (e.g., any of the target binding domains described herein) are each independently selected from the group consisting of CD16a, CD33, CD20, CD19, CD22, CD123, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, The antibody can specifically bind to a target selected from the group consisting of CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACAM5, UL16 binding protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHCI ligand, scMHCII ligand, scTCR ligand, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, and CD122 receptor.

[0300] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or both of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art), and one or more additional binding domains (e.g., any of the exemplary target binding domains described herein or known in the art) are soluble interleukin or cytokine proteins. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the soluble interleukin or cytokine protein is selected from the group of IL-1, IL-2, IL-3, IL-7, IL-8, IL-10, IL-12, IL-15, IL-17, IL-18, IL-21, PDGF-DD, and SCF.

[0301] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or both of the first target binding domain and the second target binding domain is a soluble interleukin or cytokine receptor. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the soluble receptor is a soluble TGF-β receptor II (TGF-βRII), a soluble TGF-βRIII, a soluble TNFα receptor, a soluble IL-4 receptor, or a soluble IL-10 receptor.

[0302] Multi-chain chimeric polypeptide - Type B A non-limiting example of an NK cell activator is a multi-chain chimeric polypeptide comprising: (a) a first and a second chimeric polypeptide, each comprising (i) a first target binding domain, (ii) an Fc domain, and (iii) a first domain of a pair of affinity domains; and (b) a third and a fourth chimeric polypeptide, each comprising (i) a second domain of the pair of affinity domains and (ii) a second target binding domain, wherein the first and second chimeric polypeptides and the third and fourth chimeric polypeptides are associated via the binding of the first and second domains of the pair of affinity domains, and the first and second chimeric polypeptides are associated via their Fc domains.

[0303] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain (e.g., any of the first target binding domains described herein) and the Fc domain (e.g., any of the exemplary Fc domains described herein) are immediately adjacent to each other in the first and second chimeric polypeptides. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first and second chimeric polypeptides further comprise a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the first target binding domain (e.g., any of the exemplary first target binding domains described herein) and the Fc domain (e.g., any of the exemplary Fc domains described herein) in the first and second chimeric polypeptides.

[0304] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the Fc domain (e.g., any of the exemplary Fc domains described herein) and the first domain of the paired affinity domain (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein) are immediately adjacent to each other in the first and second chimeric polypeptides. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first and second chimeric polypeptides further comprise a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the Fc domain (e.g., any of the exemplary Fc domains described herein) and the first domain of the paired affinity domain (e.g., any of the exemplary first domains of any of the exemplary pairs of affinity domains described herein) in the first and second chimeric polypeptides.

[0305] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the second domain of the pair of affinity domains (e.g., any of the exemplary second domains of any of the exemplary pairs of affinity domains described herein) and the second target binding domain (e.g., any of the exemplary second target binding domains described herein) are immediately adjacent to each other in the third and fourth chimeric polypeptides. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the third and fourth chimeric polypeptides further comprise a linker sequence (e.g., any of the exemplary linker sequences described herein or known in the art) between the second domain of the pair of affinity domains (e.g., any of the exemplary second domains of any of the exemplary pairs of affinity domains described herein) and the second target binding domain (e.g., any of the exemplary second target binding domains described herein) in the third and fourth chimeric polypeptides.

[0306] In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain and the second target binding domain specifically bind to the same antigen. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain and the second target binding domain specifically bind to the same epitope. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain and the second target binding domain comprise the same amino acid sequence. In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain and the second target binding domain specifically bind to different antigens. In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or both of the first target binding domain and the second target binding domain are antigen binding domains (e.g., any of the exemplary second target binding domains described herein). In some embodiments of any of the multi-chain chimeric polypeptides described herein, the first target binding domain and the second target binding domain are each antigen binding domains (e.g., any of the exemplary second target binding domains described herein). In some embodiments of any of the multi-chain chimeric polypeptides described herein, the antigen binding domain (e.g., any of the exemplary second target binding domains described herein) comprises an scFv or a single domain antibody.

[0307] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or both of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the second target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) are selected from the group consisting of CD16a, CD28, CD3, CD33, CD20, CD19, CD22, CD1 23, IL-1R, IL-1, VEGF, IL-6R, IL-4, IL-10, PDL-1, TIGIT, PD-1, TIM3, CTLA4, MICA, MICB, IL-6, IL-8, TNFα, CD26, CD36, ULBP 2, CD30, CD200, IGF-1R, MUC4AC, MUC5AC, Trop-2, CMET, EGFR, HER1, HER2, HER3, PSMA, CEA, B7H3, EPCAM, BCMA, P-cadherin, CEACA The antibody specifically binds to a target selected from the group consisting of M5, UL16 binding protein, HLA-DR, DLL4, TYRO3, AXL, MER, CD122, CD155, PDGF-DD, TGF-β receptor II (TGF-βRII) ligand, TGF-βRIII ligand, DNAM-1 ligand, NKp46 ligand, NKp44 ligand, NKG2D ligand, NKp30 ligand, scMHCI ligand, scMHCII ligand, scTCR ligand, IL-1 receptor, IL-2 receptor, IL-3 receptor, IL-7 receptor, IL-8 receptor, IL-10 receptor, IL-12 receptor, IL-15 receptor, IL-17 receptor, IL-18 receptor, IL-21 receptor, PDGF-DD receptor, stem cell factor (SCF) receptor, stem cell-like tyrosine kinase 3 ligand (FLT3L) receptor, MICA receptor, MICB receptor, ULP16 binding protein receptor, CD155 receptor, CD122 receptor, and CD28 receptor.

[0308] In some embodiments of any of the multi-chain chimeric polypeptides described herein, one or both of the first target binding domain (e.g., any of the exemplary target binding domains described herein or known in the art) and the second target binding domain (e.g., any of...

Claims

1. 1. A pharmaceutical composition for use in a method of treating liver fibrosis in a subject, comprising a multi-chain chimeric polypeptide, The method comprises administering to the subject a therapeutically effective amount of a multi-chain chimeric polypeptide; the multi-chain chimeric polypeptide (a) a first chimeric polypeptide, (i) a first target binding domain comprising a sequence at least 90% identical to SEQ ID NO: 188; (ii) a soluble tissue factor domain comprising a sequence at least 90% identical to SEQ ID NO: 93; and (iii) a first domain of a pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 115; a first chimeric polypeptide comprising: (b) a second chimeric polypeptide, (i) a second domain of the pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 113; and (ii) a second target binding domain comprising a sequence at least 90% identical to SEQ ID NO:

188. and a second chimeric polypeptide comprising: Including, A pharmaceutical composition, wherein the first chimeric polypeptide and the second chimeric polypeptide are associated via binding between the first domain and the second domain of the pair of affinity domains.

2. 1. A pharmaceutical composition for use in a method for killing or reducing the number of senescent cells in a subject with liver fibrosis, comprising a multi-chain chimeric polypeptide, The method comprises administering to the subject a therapeutically effective amount of a multi-chain chimeric polypeptide; the multi-chain chimeric polypeptide (a) a first chimeric polypeptide, (i) a first target binding domain comprising a sequence at least 90% identical to SEQ ID NO: 188; (ii) a soluble tissue factor domain comprising a sequence at least 90% identical to SEQ ID NO: 93; and (iii) a first domain of a pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 115; a first chimeric polypeptide comprising: (b) a second chimeric polypeptide, (i) a second domain of the pair of affinity domains comprising a sequence at least 90% identical to SEQ ID NO: 113; and (ii) a second target binding domain comprising a sequence at least 90% identical to SEQ ID NO:

188. and a second chimeric polypeptide comprising: Including, A pharmaceutical composition, wherein the first chimeric polypeptide and the second chimeric polypeptide are associated via binding between the first domain and the second domain of the pair of affinity domains.

3. 3. The pharmaceutical composition of claim 1 or 2, wherein the subject has been identified or diagnosed as having liver fibrosis.

4. The pharmaceutical composition of any one of claims 1 to 3, wherein the multi-chain chimeric polypeptide results in a decrease in activation of tumor growth factor receptor β.

5. The pharmaceutical composition of any one of claims 1 to 4, wherein the first target binding domain and the soluble tissue factor domain are immediately adjacent to each other in the first chimeric polypeptide.

6. The pharmaceutical composition of any one of claims 1 to 4, wherein the first chimeric polypeptide further comprises a linker sequence between the first target binding domain and the soluble tissue factor domain within the first chimeric polypeptide.

7. 7. The pharmaceutical composition of claim 1, wherein the soluble tissue factor domain and the first domain of the pair of affinity domains are immediately adjacent to each other within the first chimeric polypeptide.

8. The pharmaceutical composition of any one of claims 1 to 6, wherein the first chimeric polypeptide further comprises a linker sequence between the soluble tissue factor domain in the first chimeric polypeptide and the first domain of the pair of affinity domains.

9. The pharmaceutical composition of any one of claims 1 to 8, wherein the second domain of the pair of affinity domains and the second target binding domain are immediately adjacent to each other within the second chimeric polypeptide.

10. The pharmaceutical composition of any one of claims 1 to 8, wherein the second chimeric polypeptide further comprises a linker sequence between the second domain of the pair of affinity domains in the second chimeric polypeptide and the second target binding domain.

11. The pharmaceutical composition of any one of claims 1 to 10, wherein the soluble tissue factor domain does not stimulate blood clotting.

12. The pharmaceutical composition of any one of claims 1 to 11, wherein the soluble tissue factor domain comprises or consists of a sequence derived from wild-type soluble human tissue factor.

13. the first target binding domain comprises a sequence at least 95% identical to SEQ ID NO: 188; the soluble tissue factor domain comprises a sequence at least 95% identical to SEQ ID NO: 93; The first domain of the pair of affinity domains comprises a sequence at least 95% identical to SEQ ID NO: 115; the second domain of the pair of affinity domains comprises a sequence at least 95% identical to SEQ ID NO: 113; and the second target binding domain comprises a sequence at least 95% identical to SEQ ID NO: 188; The pharmaceutical composition according to any one of claims 1 to 12.

14. the first target binding domain comprises SEQ ID NO: 188; the soluble tissue factor domain comprises SEQ ID NO: 93; The first domain of the pair of affinity domains comprises SEQ ID NO: 115; the second domain of the pair of affinity domains comprises SEQ ID NO: 113; and the second target binding domain comprises SEQ ID NO: 188; The pharmaceutical composition of claim 13.

15. the first chimeric polypeptide comprises a sequence at least 90% identical to SEQ ID NO: 236; and the second chimeric polypeptide comprises a sequence at least 90% identical to SEQ ID NO: 193; The pharmaceutical composition according to any one of claims 1 to 4.

16. the first chimeric polypeptide comprises a sequence at least 95% identical to SEQ ID NO: 236; and the second chimeric polypeptide comprises a sequence at least 95% identical to SEQ ID NO: 193; 16. The pharmaceutical composition of claim 15.

17. the first chimeric polypeptide comprises SEQ ID NO: 236, and the second chimeric polypeptide comprises SEQ ID NO:

193.

17. The pharmaceutical composition of claim 16.

Citation Information

Patent Citations

  • JPP4361133B