Bacterial host strain

Engineered E. coli strains with SbcC and SbcD knockouts and specific mutations stabilize palindromic sequences, enhancing plasmid yield and stability, addressing the limitations of existing strains in producing AAV and other vectors.

JP7833134B2Active Publication Date: 2026-03-19ALDEVRON LLC
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-03-11
Publication Date
2026-03-19

Smart Images

  • Figure 0007833134000025
    Figure 0007833134000025
  • Figure 0007833134000026
    Figure 0007833134000026
  • Figure 0007833134000027
    Figure 0007833134000027
Patent Text Reader

Abstract

The present disclosure provides engineered E. coli host cells that combine knockout of SbcC, SbcD, or both, without specific other mutations that can be used to propagate vectors. Methods for improved vector production using such engineered E. coli host cells are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 988,223, entitled “Bacterial Host Strains,” filed on 11 March 2020, the entire contents of which are incorporated herein by reference.

[0002] Sequence List This application includes a sequence listing, which is submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on March 11, 2021, is named 85535-334987_SL.txt and has a size of 112,796 bytes.

[0003] Embedding by reference WO2008 / 153733, WO2014 / 035457, and WO2019 / 183248 are incorporated herein by reference in their entirety. Furthermore, all publications, patents, and patent application publications referenced herein are incorporated herein by reference in their entirety. [Background technology]

[0004] Escherichia coli (E. coli) plasmids have long been a vital source of recombinant DNA molecules used by researchers and industry. Today, plasmid DNA is becoming increasingly important as next-generation biotechnology products (e.g., gene therapies and DNA vaccines) progress to clinical trials and eventually enter the pharmaceutical market. Plasmid DNA vaccines can be applied as preventive vaccines for viral, bacterial, or parasitic diseases, as immunizers for the preparation of high-titer immunoglobulin products, as therapeutic vaccines for infectious diseases, or as cancer vaccines. Plasmids are also used in gene therapy or gene replacement applications, where the desired gene product is expressed from the plasmid after administration to the patient. Plasmids are also used in non-viral transposon vectors (e.g., Sleeping Beauty, PiggyBac, TCBuster, etc.) for gene therapy or gene replacement applications, where the desired gene product is expressed from the genome after transposition and integration from the plasmid. Plasmids are also used in gene editing (e.g., homologous recombination repair (HDR) / CRISPR-Cas9) and as non-viral vectors for gene therapy or gene replacement applications, where the desired gene product is expressed from the genome after excision from the plasmid and genome integration. Plasmids are also used in viral vectors (e.g., AAV, lentivirus, retroviral vectors) for gene therapy or gene replacement applications, where the desired gene product is packaged into transduction virus particles after transfection of the producing cell line and then expressed from the virus in target cells after viral introduction.

[0005] Non-viral and viral vector plasmids typically contain origins of replication derived from pMB1, ColE1, or pBR322. Common high-copy-number derivatives have mutations that affect copy number regulation, such as ROP (primer gene repressor) deletions and second-site mutations that increase copy number (e.g., a G-to-A point mutation in pMB1 pUC, or ColE1 pMM1). Selective plasmid amplification with pUC and pMM1 origins of replication can be induced using higher temperatures (42°C).

[0006] WO2014 / 035457 discloses a miniaturized vector (Nanoplasmid®) that utilizes RNA-OUT antibiotic-free selection to replace a large 1000 bp pUC origin with a novel 300 bp R6K origin. Reducing the spacer region by linking the 5' and 3' ends of the transgene expression cassette to <500 bp with the R6K origin-RNA-OUT backbone improves expression levels compared to conventional minicircle DNA vectors.

[0007] U.S. Patent No. 7,943,377, which is incorporated herein by reference in its entirety, describes a method for fed-batch fermentation in which plasmid-containing E. coli cells are grown at a reduced temperature during a portion of the fed-batch phase, during which the growth rate is limited, followed by a temperature increase shift, during which the cells are continuously grown at a high temperature to accumulate plasmids. The temperature shift at a limited growth rate improved plasmid yield and purity. This fermentation process is referred herein to as the HyperGRO fermentation process. Other fermentation processes for plasmid production are described in Carnes AE2005 BioProcess Intl 3:36-44, which is incorporated herein by reference in its entirety.

[0008] WO2014 / 035457 also discloses a host strain for R6K origin vector production in the HyperGRO fermentation process.

[0009] Along with Schnodt et al., (2016) Mol Ther-Nucleic Acids 5 e355, Chadeuf et al., (2005) Molecular Therapy 12:744-53 and Gray, 2017. WO2017 / 066579 teach that AAV helper plasmid antibiotic resistance markers are packaged on viral particles, indicating the need to remove antibiotic markers from AAV helper plasmids and AAV vectors. Antibiotic-free Nanoplasmid® vectors disclosed in WO2014 / 035457 do not have antibiotic marker transcription.

[0010] Viral vectors such as AAV contain palindromic inverted terminal repeat (ITR) DNA sequences at their ends.

[0011] Paraindrome and reverse repeats are inherently unstable in high-yield E. coli production hosts such as DH1, DH5α, JM107, JM108, JM109, and XL1Blue.

[0012] Growth of AAV ITR-containing vectors is recommended in the multiply mutant sbcC knockout cell line SURE (a recB derivative of SRB) or SURE2.

[0013] The SURE cell line has the following genotype: F'[proAB + lacI q lacZΔM15 Tn10(Tet R ]endA1 glnV44 thi-1 gyrA96 relA1 lac recB recJ sbcC umuC::Tn5 Kan R uvrC e14 - (mcrA - )Δ(mcrCB-hsdSMR-mrr)171(where the SURE stabilizing mutations are recB recJ umuC uvrC - (mcrA - (Includes sbcC in combination with mcrBC-hsd-mrr).

[0014] The SRB cell line has the following genotype: F’[proAB + lacI q lacZΔM15 endA1 glnV44 thi-1 gyrA96 relA1 lac recJ sbcC umuC::Tn5(Kan R uvrC e14 - (mcrA - )Δ(mcrCB-hsdSMR-mrr)171 (where the SRB stabilizing mutations are recJ umuC uvrC - (mcrA - )mcrBC-hsd-mrr and include sbcC in combination).<00%0251>

[0015] The SURE2 cell line has the following genotype: endA1 glnV44 thi-1 gyrA96 relA1 lac recB recJ sbcC umuC::Tn5 Kan R uvrC e14-Δ(mcrCB-hsdSMR-mrr)171 F’[proAB + lacI q lacZΔM15 Tn10(Tet R )Amy Cm R (where the SURE2 stabilizing mutations are recB recJ uvrC - (mcrA - )mcrBC-hsd-mrr and include sbcC in combination).

[0016] SbcCD is a nuclease that cleaves palindromic DNA sequences and contributes to palindromic instability in E. coli (Chalker AF, Leach DR, Lloyd RG. 1988 Gene 71:201-5). Palindromes such as shRNA or AAV ITR are more stable in SbcC knockout strains such as SURE cells than DH5α, as indicated in Gray SJ, Choi, VW, Asokan, A, Haberman RA, McCown TJ, Samulski RJ (2011) Curr Protoc Neurosci Chapter 4: Unit 4.17, which states that "AAV ITR is unstable in E. coli, and plasmids that lose ITR have a replication advantage in transformed cells." For these reasons, bacteria containing ITR plasmids should not be grown for more than 12-14 hours, and any recovered plasmids should be evaluated for ITR retention…DH10B competent cells (or other equivalent high-efficiency strains) can be used to transform the ligation reaction for ITR-containing plasmid cloning. After screening clones positive for ITR integrity, good clones should be transformed into SURE or SURE2 cells (Agilent Technologies) for plasmid and glycerol stock production. SURE cells are engineered to maintain an irregular DNA structure but have lower transformation efficiency compared to DH10B. Furthermore, Siew SM, 2014, describes a recombinant AAV-mediated gene therapy approach for treating progressive familial intrahepatic cholestasis type 3. The University of Sydney paper, uploaded on December 3, 2014, teaches that "SURE2 cells are a commonly used sbcC mutant strain for propagating plasmids containing the palindromic AAV ITR." Therefore, it is generally understood that SURE or SURE2 sbcC mutant strains are preferred for propagating plasmids containing the palindrom AAV ITR.

[0017] However, SURE and SURE2 cell lines have limitations. For example, SURE and SURE2 are kan R Therefore, it cannot be used to generate kanamycin-resistant plasmids (as opposed to ampicillin-resistant plasmids) which are typically used in cGMP production. Furthermore, the art teaches that sbcC knockout stabilization of palindromic sequences requires further mutations in other genes such as recB, recJ, uvrC, mcrA, or mcrBC-hsd-mrr. Doherty JP, Lindeman R, Trent RJ, Graham MW, Woodcock DM. 1993. Gene 124:29-35 reports that not all palindromic sequences are stabilized in SURE (or related SRB cell lines). They recommended that an additional mutation (recC) is necessary for palindromic sequence stabilization, stating: "However, while palindromic sequence-containing phages were plated with reasonable efficiency on SURE(recB sbcC recJ umuC uvrC) and SRB(sbcC recJ umuC uvrC), the majority of phages recovered from these strains no longer required the sbcC host for subsequent plating." These two strains also resulted in poorer titers in low-yield phage clones from the human Prader-Willi chromosome region. The optimal phage host appears to be a combination of mcrA delta (mcrBC-hsd-mrr) and sbcC plus a recBC or recD mutation."

[0018] In line with this, other SbcC host strains also exhibit similar behavior, for example, PMC103:mcrA Δ(mcrBC-hsdRMS-mrr)102 recD sbcC (where the PMC103 stabilizing mutation is recD(mcrA-)mcrBC-hsd - (including sbcC combined with mrr), and PMC107:mcrAΔ(mcrBC-hsdRMS-mrr)102 recB21 recC22 recJ154 sbcB15 sbcC201 (where PMC107 stabilizing mutations are recB recJ sbcB(mcrA- (Including sbcC combined with mcrBC-hsd-mrr.)

[0019] Therefore, the art teaches that sbcC knockout stabilization of the palindrom requires mutations in sbcB, recB, recD, and recJ, and possibly further mutations in uvrC, mcrA, and / or mcrBC-hsd-mrr. This teaches, apart from the application of sbcC knockout, to improve palindromic stability in standard E. coli plasmid-producing strains such as DH1, DH5α, JM107, JM108, JM109, and XL1Blue that do not contain these additional mutations.

[0020] For example, the genotypes of some standard E. coli plasmid-producing strains are as follows: DH1:F - λ - endA1 recA1 relA1 gyrA96 thi-1 glnV44 hsdR17(r K - m K - ) DH5α:F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k +)gal-phoA supE44 λ-thi-1 gyrA96 relA1 JM107:endA1 glnV44 thi-1 relA1 gyrA96 Δ(lac-proAB)[F' traD36 proAB + lacI q lacZΔM15]hsdR17(R K - m K + )λ - JM108:endA1 recA1 gyrA96 thi-1 relA1 glnV44 Δ(lac-proAB)hsdR17(r K - mK + ) JM109:endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB + Δ(lac-proAB)e14-[F' traD36 proAB + lacI q lacZΔM15]hsdR17(r K - m K + ) MG1655 K-12 F - λ - ilvG - RFB-50 RPH-1 XL1Blue:endA1 gyrA96(nal R )thi-1 recA1 relA1 lac glnV44 F'[::Tn10 proAB + lacI q Δ(lacZ)M15]hsdR17(r K - m K + )

[0021] Standard E. coli plasmid-producing strains are endA, recA. However, standard producing strains do not contain any of the necessary mutations in sbcB, recB recD, and recJ, and in some cases, they do not contain uvrC, mcrA, or mcrBC-hsd-mrr. Therefore, knockout of sbcC is not expected to effectively stabilize palindromes or reverse repeats in the absence of these additional mutations.

[0022] However, the presence of multiple mutations in the SURE and SURE2 cell lines reduces cell line viability and productivity in the E. coli fermentation plasmid production process. For example, Table 1 summarizes the HyperGRO fermentation plasmid yield and quality in SURE2 or XL1Blue (exemplary high-yield E. coli production hosts). All three plasmids were prone to multimerization and produced in low yields in SURE2, but were produced in high yields (2-4x) and of high quality (low multimerization) in XL1Blue. [Table 1]

[0023] Reduced viability and productivity are common characteristics of polymutant "stabilized hosts," such as Stbl2, Stbl3, and Stbl4, which are used to stabilize vectors containing direct repeats, such as lentiviral vectors, but do not contain SbcC knockouts. The genotypes of Stbl2, Stbl3, and Stbl4 are shown below. Stbl2:F-endA1 glnV44 thi-1 recA1 gyrA96 relA1 Δ(lac-proAB)mcrA Δ(mcrBC-hsdRMS-mrr)λ - Stbl2 stabilizing mutation = mcrA Δ(mcrBC-hsdRMS-mrr) (Trinh, T., Jessee, J., Bloom, FR, and Hirsch, V. (1994) FOCUS 16,78.) Stbl3:F-mcrB mrr hsdS20(rB-,mB-)recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20(Strr)xyl-5 -leu mtl-1 Stbl3 stabilizing mutation = mcrBC - mrr Stbl4:endA1 glnV44 thi-1 recA1 gyrA96 relA1 Δ(lac-proAB)mcrA Δ(mcrBC-hsdRMS-mrr)λ - gal F'[proAB + lackIq [lacZΔM15 Tn10] Stbl4 stabilizing mutation = mcrA Δ(mcrBC-hsdRMS-mrr)

[0024] Therefore, there is a need for high-yield E. coli strains for the high-yield production of palindrome and reverse repeat-containing vectors without ITR deletions or rearrangements that are not plagued by low stability or low viability. [Overview of the Initiative]

[0025] This disclosure relates to host bacterial strains, methods for producing such host bacterial strains, and methods for improving plasmid production using such host bacterial strains.

[0026] In some embodiments, engineered E. coli host cells are provided that have SbcC, SbcD, or both knockouts, but do not have specific additional mutations.

[0027] In some embodiments, methods for preparing manipulated E. coli host cells are provided.

[0028] In some embodiments, methods for replicating a vector in manipulated E. coli host cells of the present disclosure are provided. [Brief explanation of the drawing]

[0029] For a more complete understanding of the present invention and its advantages, refer to the following description in conjunction with the accompanying drawings.

[0030] [Figure 1A] Display pKD4 SbcCD targeting PCR fragments. [Figure 1B] Display the SbcCD gene locus. [Figure 1C] Display the integrated pKD4 PCR product that knocks out SbcCD. [Figure 1D] Displaying scars after FRT-mediated excision with pKD4 kanR markers. [Modes for carrying out the invention]

[0031] This disclosure provides a bacterial host strain, a method for modifying a bacterial host strain, and a manufacturing method that can improve the yield and quality of plasmids.

[0032] The bacterial host strains and methods of this disclosure can enable the improved production of vectors such as nonviral transposon vectors (transposase vectors, Sleeping Beauty transposase vectors, Sleeping Beauty transposase vectors, PiggyBac transposase vectors, PiggyBac transposase vectors, expression vectors, etc.) or nonviral gene editing (e.g., homologous recombination repair (HDR) / CRISPR-Cas9) vectors, as well as viral vectors (e.g., AAV vectors, AAV rep cap vectors, AAV helper vectors, Ad helper vectors, lentiviral vectors, lentiviral envelope vectors, lentiviral packaging vectors, retroviral vectors, retroviral envelope vectors, retroviral packaging vectors, etc.) for cell therapy, gene therapy, or gene replacement applications.

[0033] Improved plasmid production may include improved plasmid stability (e.g., reduced plasmid deletion, reversed, or other recombination products), and / or improved plasmid quality (e.g., reduced cleaved, linear, or dimerized products), and / or improved plasmid supercoiling (e.g., reduced supercoiled topological isoforms), compared to plasmid production using alternative host strains known in the art. All references cited herein should be understood to be incorporated by reference in their entirety.

[0034] definition As used herein, the singular forms "a," "an," and "the" include plural referents unless otherwise specified by the context.

[0035] The use of the term “or” in the claims and this disclosure shall mean “and / or” unless expressly indicated to refer only to the alternatives, or unless the alternatives are mutually exclusive.

[0036] The use of the term "approximately" when used with a number is intended to include a + / - 10% range. For example, if the number of amino acids is specified as approximately 200, this would include 180 to 220 (plus or minus 10%).

[0037] As used herein, “AAV vector” refers to an adeno-associated virus vector or an episomal virus vector. Examples of “AAV vectors” include, but are not limited to, self-complementary adeno-associated virus vectors (scAAV) and single-stranded adeno-associated virus vectors (ssAAV).

[0038] As used herein, "amp" refers to ampicillin.

[0039] As used herein, "ampR" refers to the ampicillin resistance gene.

[0040] As used herein, “bacterial region” refers to the region of a vector, such as a plasmid, required for prorogation and selection in a bacterial host.

[0041] When used herein, "Cat R This refers to the chloramphenicol resistance gene.

[0042] As used herein, “ccc” or “CCC” means “covalently closed circular” unless used in relation to a nucleotide or amino acid sequence.

[0043] As used herein, "cI" means lambda repressor.

[0044] As used herein, "cITs857" refers to a lambda repressor that further incorporates a C-to-T (Ala-to-Thr) mutation that confers temperature sensitivity. cITs857 is a functional repressor at 28–30°C but is nearly inactive at 37–42°C. It is also known as cI857 or cI857ts.

[0045] As used herein, "cmv" or "CMV" refers to cytomegalovirus.

[0046] As used herein, “copy cutter host strain” refers to an R6K origin-producing strain containing a phage φ80 attachment site chromosome-integrated copy of the arabinose-inducible CI857ts gene. Addition of arabinose to a plate or culture medium (e.g., up to a final concentration of 0.2–0.4%) induces pARA-mediated CI857ts repressor expression that reduces the copy number at 30°C through CI857ts-mediated downregulation of the R6K Rep protein expressing the pL promoter [i.e., additional CI857ts mediating a more effective downregulation of the pL(OL1-G~T) promoter at 30°C]. Copy number induction after a temperature shift to 37–42°C is not impaired because the CI857ts repressor is inactivated at these high temperatures. The copy cutter host strain increases the R6K vector temperature upshift copy number induction ratio by reducing the copy number at 30°C. This is advantageous for the production of large, toxic, or easily dimerizable R6K-based vectors.

[0047] As used herein, "dcm methylation" refers to methylation by E. coli methyltransferase that methylates the sequence CC(A / T)GG at the C5 position of the second cytosine.

[0048] As used herein, "derived from" means that the cells are descendants of a particular cell line. For example, "derived from DH5α" means that the cells are made from DH5α or its descendants. Thus, derivative cells may include polymorphisms and other changes that occur in the cell line as it is cultured.

[0049] As used herein, "EGFP" refers to highly sensitive green fluorescent protein.

[0050] As used herein, “manipulated E. coli strain” should be understood to mean the E. coli strain of this disclosure having a gene knockout (or knockdown) in SbcC, SbcD, or both, produced by human intervention.

[0051] As used herein, “manipulated mutation” should be understood as a mutation that does not occur naturally but is instead the product of direct human intervention.

[0052] As used herein, “eukaryotic expression vector” refers to a vector for expressing mRNA, protein antigens, protein therapeutics, shRNA, RNA, or microRNA genes in a target eukaryote using RNA polymerase I, II, or III promoters.

[0053] As used herein, “eukaryotic region” refers to the region of a plasmid that codes for eukaryotic sequences and / or sequences necessary for plasmid function in the target organism. This includes regions of plasmid vectors necessary for the expression of one or more transgenes in the target organism, including RNA PolII enhancers, promoters, transgenes, and polyA sequences. This also includes regions of plasmid vectors necessary for the expression of one or more transgenes in the target organism using RNA PolI or RNA PolIII promoters, RNA PolI or RNA PolIII expressing transgenes, or RNA. The eukaryotic region may optionally include other functional sequences such as eukaryotic transcription termination factors, supercoil-induced DNA double-strand destabilization (SIDD) structures, S / MARs, and boundary elements. In lentiviral or retroviral vectors, the eukaryotic region contains adjacent direct repeats (LTRs); in AAV vectors, the eukaryotic region contains adjacent reverse-terminus repeats; and in transposon vectors, the eukaryotic region contains adjacent transposon reverse-terminus repeats or IR / DR termins (e.g., Sleeping Beauty). In genome integration vectors, the eukaryotic region can encode homology arms to direct targeted integration.

[0054] As used herein, “expression vector” refers to a vector for the expression of mRNA, protein antigens, protein therapeutics, shRNA, RNA, or microRNA genes in a target organism.

[0055] As used herein, “target gene” refers to a gene expressed in a target organism. This includes mRNA genes encoding protein or peptide antigens, mRNA, shRNA, RNA, or microRNA encoding protein or peptide therapeutics, and mRNA, shRNA, RNA, or microRNA encoding RNA therapeutics, as well as mRNA, shRNA, RNA, or microRNA encoding RNA vaccines.

[0056] As used herein, “genome” in relation to Rep proteins and promoters refers to the nucleic acid sequence into which RNA-IN, including RNA-IN-regulated selectable markers, antibiotic resistance markers, and lambda repressors, is incorporated into a bacterial host strain.

[0057] As used herein, “high-yield plasmid-producing host” refers to sbcB, recB, recD, and recJ, as well as recA-, endA- cell lines that do not contain viability or yield-reducing mutations in uvrC, mcrA, and / or mcrBC-hsd-mrr, e.g., DH1, DH5α, JM107, JM108, JM109, MG1655, and XL1Blue.

[0058] As used herein, “HyperGRO fermentation process” refers to fed-batch fermentation, in which plasmid-containing E. coli cells are grown at a reduced temperature during a portion of the fed-batch phase, during which the growth rate is limited, followed by a temperature increase shift, during which the cells are continuously grown at a high temperature to accumulate plasmids. The temperature shift at a limited growth rate improved plasmid yield and purity.

[0059] As used herein, a “reverse repeat” refers to a single-stranded sequence of nucleotides followed downstream by its reverse complement. The intervening nucleotide sequence between the initial sequence and the reverse complement can be of any length, including zero. When the intervening length is zero, the composite sequence is a palindrome. It should be understood that reverse repeats can occur within double-stranded DNA, while other reverse repeats can occur within intervening sequences.

[0060] As used herein, "IR / DR" refers to a reverse repeat that is directly repeated twice. For example, the Sleeping Beauty transposon IR / DR repeat.

[0061] As used herein, “iteron” refers to a DNA sequence that is directly repeated at the origin of replication and is necessary for replication initiation. R6K origin iteron repeats are 22 bp long, such as sequence numbers 19-23 of WO2019 / 183248 (aaacatgaga gcttagtacg tg, aaacatgaga gcttagtacg tt, agccatgaga gcttagtacg tt, agccatgagg gtttagttcg tt, and aaacatgaga gcttagtacg ta, respectively).

[0062] As used herein, "ITR" refers to an inverted terminal repeat.

[0063] As used herein, "kan" refers to kanamycin.

[0064] As used herein, "kanR" refers to the kanamycin resistance gene.

[0065] As used herein, “knockdown” refers to the disruption of a gene that results in a decrease in the expression of the gene product and / or a decrease in the activity of the gene product.

[0066] As used herein, “knockout” refers to the disruption of a gene resulting in ablation of gene expression from that gene, and / or that the expressed gene product is non-functional.

[0067] As used herein, “Kozak sequence” refers to the optimized consensus DNA sequence gccRccATG (R=G or A) immediately upstream of the ATG start codon, which ensures efficient translation initiation. The SalI site (GTCGAC) immediately upstream of the ATG start codon (GTCGACATG) is a valid Kozak sequence.

[0068] As used herein, “lentiviral vector” refers to an embedded viral vector capable of infecting both dividing and non-dividing cells. It is also called a lentiviral transfer plasmid. The plasmid encodes a lentiviral LTR flanking expression unit. The transfer plasmid, along with the lentiviral envelope and packaging plasmids necessary for producing viral particles, is transfected into producing cells.

[0069] As used herein, “lentiviral envelope vector” refers to a plasmid encoding an envelope glycoprotein.

[0070] As used herein, “lentiviral packaging vector” refers to one or two plasmids that express the gag, pol, and Rev gene functions required for a lentiviral packaging vector.

[0071] As used herein, “minicircle” refers to a covalently bound closed cyclic plasmid derivative in which the bacterial region has been removed from the parent plasmid by in vivo or in vitro site-specific recombination or in vitro restriction digestion / ligation. Minicircle vectors are incapable of replicating in bacterial cells.

[0072] As used herein, "mSEAP" refers to mouse-secreted alkaline phosphatase.

[0073] As used herein, “Nanoplasmid® vector” refers to a vector that combines an RNA-selectable marker with R6K, ColE2, or a ColE2-associated origin of replication. Examples include the NTC9385C, NTC9685C, NTC9385R, NTC9685R vectors, and the modified versions described in WO2014 / 035457.

[0074] As used herein, “mutation” may refer to any type of mutation, such as substitution, addition, or deletion.

[0075] As used herein, "non-functional" with respect to the SbcCD complex refers to an SbcCD complex that is unable to cleave palindromic sequences.

[0076] As used herein, the “NTC8 series” refers to vectors such as the NTC8385, NTC8485, and NTC8685 plasmids, which are antibiotic-free pUC-derived vectors containing short RNA (RNA-OUT) selectable markers instead of antibiotic resistance markers such as kanR. The preparation and application of these RNA-OUT-based antibiotic-free vectors are described in WO2008 / 153733.

[0077] As used herein, “NTC9385R” refers to the NTC9385R Nanoplasmid® vector described in WO2014 / 035457, which has a spacer region encoding an NheI-trpA terminator-R6K origin RNA-OUT-KpnI bacterial region and is linked to a eukaryotic region via adjacent NheI and KpnI sites.

[0078] When used herein, "OD 600 " refers to the optical density at 600 nm.

[0079] As used herein, PCR refers to "polymerase chain reaction."

[0080] As used herein, “pDNA” refers to plasmid DNA.

[0081] As used herein, “piggyback transposon” refers to a transposon system that incorporates an ITR-adjacent PB transposon into the genome via a simple cleavage and paste mechanism mediated by a PB transposase. Transposon vectors typically contain a promoter-transgene-polyA expression cassette between PB ITRs that is excised and incorporated into the genome.

[0082] As used herein, "pINT pR pL vector" means "pINT pR pL att HK022 This refers to an integrated expression vector, which is described in Luke et al., 2011 Mol Biotechnol 47:43 and is incorporated herein by reference. The target gene to be expressed is cloned downstream of the pL promoter. The vector encodes a temperature-inducible cI857 repressor, enabling heat-inducible target gene expression.

[0083] When used in this specification, "P L "Promoter" refers to the lambda promoter on the left. L This is a potent promoter that is suppressed by cI repressor binding to the OL1, OL2, and OL3 repressor binding sites. The temperature-sensitive cI857 repressor is functional at 30°C, suppressing gene expression, but is inactivated at 37-42°C, allowing gene expression to occur, thus enabling heat-induced control of gene expression.

[0084] When used in this specification, "P L The term "(OL1G~T) promoter" refers to the left-hand lambda promoter that has a mutation from OL1G to T. L This is a potent promoter that is repressed by cI repressor binding to the OL1, OL2, and OL3 repressor binding sites. The temperature-sensitive cI857 repressor is functional at 30°C, repressing gene expression, but is inactivated at 37–42°C, allowing gene expression to occur, thus enabling heat-induced control of gene expression. cI repressor binding to OL1 is reduced by the OL1G to T mutation, as described in WO2014 / 035457, resulting in increased promoter activity at 30°C and 37–42°C.

[0085] As used herein, “plasmid” refers to an extra chromosomal DNA molecule isolated from chromosomal DNA that can replicate independently of chromosomal DNA.

[0086] As used herein, “plasmid copy number” refers to the number of plasmid copies per cell. An increase in plasmid copy number indicates an increase in plasmid production yield.

[0087] As used herein, "Pol" refers to polymerase.

[0088] As used herein, "PolI" refers to E. coli DNA polymerase I.

[0089] As used herein, "PolIII" refers to E. coli DNA polymerase III.

[0090] As used herein, “PolIII-dependent origin of replication” refers to an origin of replication that does not require PolI, such as the rep protein-dependent R6K gamma origin of replication. Many additional PolIII-dependent origins of replication are known in the art, many of which are summarized in del Solar et al., 1998, which is incorporated herein by reference.

[0091] As used herein, "poly(A)" refers to a polyadenylation signal or site. Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Polyadenylation signals contain a sequence motif recognized by RNA cleavage complexes. Most human polyadenylation signals contain the AAUAAA motif and its conserved 5' and 3' sequences. Commonly used poly(A) signals are derived from rabbit β-globin, bovine growth hormone, early SV40, or late SV40 poly(A) signals.

[0092] As used herein, “poly-A repeat” refers to a sequence of adenine nucleotides as a direct repeat. Similarly, “poly-G repeat” refers to a sequence of guanine nucleotides as a direct repeat, “poly-C repeat” refers to a sequence of cytosine nucleotides as a direct repeat, and “poly-T repeat” refers to a sequence of thymine nucleotides as a direct repeat. “mRNA vector” contains poly-A repeats.

[0093] As used herein, “pUC origin” refers to a replication origin derived from pBR322 that has a G-to-A transposition that increases in copy number at elevated temperatures and deletes a ROP-negative regulator.

[0094] As used herein, "pUC-free" refers to a plasmid that does not contain a pUC origin.

[0095] As used herein, "pUC plasmid" refers to a plasmid containing a pUC origin.

[0096] As used herein, “R6K plasmid” refers to plasmids having an origin of replication of R6K or an origin of replication of R6K, such as the NTC9385R, NTC9685R, NTC9385R2-O1, NTC9385R2-O2, NTC9385R2a-O1, NTC9385R2a-O2, NTC9385R2b-O1, NTC9385R2b-O2, NTC9385Ra-O1, NTC9385Ra-O2, NTC9385RaF, and NTC9385RbF vectors, as well as modified and surrogate vectors containing an R6K origin of replication as described in WO2014 / 035457 and WO2019 / 183248. Known alternative R6K vectors in this field include, but are not limited to, the pCOR vector (Gencell), the pCpG-free vector (Invivogen), and the Oxford University CpG-free vector, including pGM169.

[0097] As used herein, “R6K replication origin” refers to a region specifically recognized by the R6K Rep protein to initiate DNA replication, including, but not limited to, the R6K gamma replication origin sequences disclosed in WO2019 / 183248 as SEQ ID NOs. 1, 2, 4, and 18 (SEQ ID NOs. 43-44, 46, and 60, respectively). It also includes the CpG-free variant described in Drocourt et al., U.S. Patent No. 7244609 (SEQ ID NO: 3), which is incorporated herein by reference (SEQ ID NO: 63).

[0098] As used herein, “R6K replication origin-RNA-OUT bacterial origin” comprises an R6K replication origin for propagation and RNA-OUT selectable markers disclosed in WO2019 / 183248 (SEQ ID NOs. 50-59, respectively) (e.g., SEQ ID NOs. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17).

[0099] As used herein, “Rep protein-dependent plasmid” refers to a plasmid whose replication depends on a replication (Rep) protein provided in trans. Examples include the R6K origin of replication, the ColE2-P9 origin of replication, and ColE2-associated origin of replication plasmids from which the Rep protein is expressed from the host strain genome. Numerous additional Rep protein-dependent plasmids are known in the art, many of which are summarized in del Solar et al., 1998, Mol. Biol. Rev. 62:44-464, which are incorporated herein by reference.

[0100] As used herein, “retroviral vector” refers to an embedded viral vector capable of infecting dividing cells. It is also called a transfer plasmid. The plasmid encodes a retroviral LTR flanking expression unit. The transfer plasmid, along with the envelope and packaging plasmids necessary to produce the viral particle, is transfected into the producing cell.

[0101] As used herein, “retroviral envelope vector” refers to a plasmid encoding an envelope glycoprotein.

[0102] As used herein, “retroviral packaging vector” refers to plasmids encoding retroviral gag and pol genes necessary for packaging a retroviral transfer vector.

[0103] As used herein, “RNA-IN” refers to an insertion sequence 10 (IS10) that codes for RNA-IN, which is RNA-complementary and antisense to a portion of RNA's RNA-OUT. When RNA-IN is cloned into the untranslated reader of mRNA, the annealing of RNA-IN to RNA-OUT reduces the translation of the gene encoded downstream of RNA-IN.

[0104] As used herein, “RNA-IN regulated selective marker” refers to a genome-expressed RNA-IN regulated selective marker. In the presence of plasmid-borne RNA-OUT antisense repressor RNA (e.g., SEQ ID NO: 6 disclosed in WO2019 / 183248 (SEQ ID NO: 48)), the expression of a protein encoded downstream of RNA-IN (e.g., having the sequence gccaaaaatcaataatcagacaacaagatg) is repressed. RNA-IN regulated selective markers are configured such that RNA-IN regulates either the protein itself or a toxic substance (e.g., SacB) that is lethal or toxic to the cell, or 2) the transcription of a gene essential for the proliferation of the bacterial cell (e.g., the murA essential gene regulated by the RNA-IN tetR repressor gene) that is lethal or toxic to the cell. For example, a genome-expressing RNA-IN-SacB cell line for RNA-OUT plasmid selection / propagation is described in WO2008 / 153733. Alternative selection markers described in the art may be replaced with SacB.

[0105] As used herein, “RNA-OUT” refers to the RNA-OUT encoded in insertion sequence 10 (IS10), which is an antisense RNA that hybridizes to a transposon gene expressed downstream of RNA-IN and reduces translation. The RNA-OUT RNA (SEQ ID NO: 6) disclosed in WO2019 / 183248 (SEQ ID NO: 48) and the sequences of the RNA-IN-SacB cell line expressed genomically in complementary RNA-IN SacB may be modified to incorporate alternative functional RNA-IN / RNA-OUT binding pairs, such as those described in Mutalik et al., 2012 Nat Chem Biol 8:447, including the RNA-OUT A08 / RNA-IN S49 pair, the RNA-OUT A08 / RNA-IN S08 pair, and RNA-OUT

[0106] This includes, but is not limited to, CpG-free modifications of RNA-OUT A08 that modify the CG in the TIFF0007833134000002.tif930 sequence to a non-CpG sequence. CpG-free RNA-OUTs may also be constructed using a number of alternative substitutions to remove two CpG motifs (mutating each CpG to either CpA, CpC, CpT, ApG, GpG, or TpG).

[0107] As used herein, “RNA-OUT selectable marker” refers to an RNA-OUT selectable marker DNA fragment containing an E. coli transcription promoter and terminator sequence adjacent to an RNA-OUT RNA. RNA-OUT selectable markers utilizing RNA-OUT promoter and terminator sequences adjacent to DraIII and KpnI restriction enzyme sites, as well as designer RNA-IN-SacB cell lines expressed genome-wise for RNA-OUT plasmid propagation, are described in WO2008 / 153733 and are incorporated herein by reference. The RNA-OUT promoter and terminator sequences adjacent to the RNA-OUT RNA may be replaced with heterologous promoter and terminator sequences. For example, the RNA-OUT promoter may be replaced with a CpG-free promoter known in the art, such as the I-EC2K promoter, or the P5 / 6 5 / 6 or P5 / 6 6 / 6 promoter described in WO2008 / 153733 and incorporated herein by reference. A 2CpG RNA-OUT selectable marker, in which two CpG motifs within the RNA-OUT promoter were removed, was given as Sequence ID 7 of WO2019 / 183248 (SEQ ID NO: 49). Vectors incorporating the CpG-free RNA-OUT selectable marker can be selected for sucrose tolerance using the RNA-IN-SacB cell line described in WO2008 / 153733, or any cell line having RNA-IN-SacB as described in WO2008 / 153733. Alternatively, the RNA-IN sequence in these cell lines may be modified to incorporate a 1 bp change necessary to perfectly match the CpG-free RNA-OUT region complementary to RNA-IN.

[0108] As used herein, “RNA-selectable marker” refers to plasmid-retained non-coding RNA that modulates a chromosomally expressed target gene to result in selection. This may be a nonsense repressor tRNA that modulates a nonsense-repressible selectable chromosomal target, as described in U.S. Patent No. 6,977,174, 2005 by Crouzet J and Soubrier F, included herein by reference. This may also be plasmid-borne antisense repressor RNAs, and an unspecified list included herein by reference includes RNA-OUT (WO2008 / 153733), which represses the RNA-IN regulatory target; pMB1 plasmid originating code RNAI (Grabherr R, Pfaffenzeller I. 2006 U.S. Patent Application No. 2006 / 0063232; Cranenburgh RM. 2009; U.S. Patent No. 7,611,883), IncB plasmid originating code pMU720, which represses the RNA-II regulatory target (Wilson IW, Siemering KR, Prazkier J, Pittard AJ. 1997. J Bacteriol 179:742-53); ParB locus Sok of plasmid R1, which represses the Hok regulatory target; and FlmB of F plasmid, which represses the flmA regulatory target (Morsey Examples include MA, 1999 (U.S. Patent No. 5922583). RNA-selectable markers may also be other natural antisense repressor RNAs known in the art, such as those described in Wagner EGH, Altuvia S, Romby P. 2002. Avd Genet 46:361-98 and Franch T, and Gerdes K. 2000. Current Opin Microbiol 3:159-64. RNA-selectable markers may also be engineered repressor RNAs, such as synthetic small RNAs expressed in SgrS, MicC, or MicF scaffolds, as described in Na D, Yoo SM, Chung H, Park H, Park JH, Lee SY. 2013. Nat Biotechnol 31:170-4.RNA-selectable markers may also be engineered repressor RNAs as part of a selectable marker that represses target RNA fused to a regulated target gene such as SacB, as described in US2015 / 0275221.

[0109] As used herein, "SacB" refers to the structural gene encoding Bacillus subtilus levansucase. Expression of SacB in Gram-negative bacteria is toxic in the presence of sucrose.

[0110] As used herein, "SEAP" refers to secreted alkaline phosphatase.

[0111] As used herein, “selectable marker” or “selection marker” refers to a selectable marker, such as a kanamycin resistance gene or an RNA selectable marker.

[0112] As used herein, the term “sequence identity” refers to the degree of identity between any given query sequence and subject sequence. A subject sequence may have, for example, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with a given query sequence. To determine the sequence identity percentage, the query sequence (e.g., a nucleic acid sequence) is aligned to one or more subject sequences (global alignment) using any suitable sequence alignment program known in the art, for example, the computer program ClustalW (version 1.83, default parameters), which allows the alignment of nucleic acid sequences to be performed over their entire length. Chema et al., 2003 Nucleic Acids Res., 31:3497-500. In a preferred method, a sequence alignment program (e.g., ClustalW) calculates the best match between a query sequence and one or more subject sequences and aligns them so that identity, similarity, and difference can be determined. One or more nucleotide gaps can be inserted into the query sequence, subject sequences, or both to maximize the sequence alignment. For fast pairwise alignment of nucleic acid sequences, preferred default parameters suitable for a particular alignment program can be selected. The output is a sequence alignment reflecting the relationships between sequences. To further determine the identity percentage of the subject nucleic acid sequence to the query sequence, align the sequences using the alignment program, divide the number of identical matches in the alignment by the length of the query sequence, and multiply the result by 100. Note that the identity percentage value can be rounded to two decimal places. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.

[0113] As used herein, "shRNA" refers to short hairpin RNA.

[0114] As used herein, “S / MAR” refers to a scaffold / matrix attachment region containing a eukaryotic sequence that mediates DNA attachment to the nuclear matrix.

[0115] As used herein, “Sleeping Beauty transposon” refers to a transposon system that incorporates IR / DR-adjacent SB transposons into the genome via a simple cleavage and paste mechanism mediated by SB transposases. Transposon vectors typically contain a promoter-transgene-polyA expression cassette between IR / DR that is excised and incorporated into the genome.

[0116] As used herein, the “spacer region” refers to the region connecting the 5' and 3' ends of a eukaryotic region sequence. Since the 5' and 3' ends of the eukaryotic region are typically separated by the bacterial origin of replication and bacterial selectable marker in the plasmid vector (bacterial region), many spacer regions consist of the bacterial region. In the PolIII-dependent origin of replication vector of the present invention, this spacer region is preferably less than 1000 bp.

[0117] As used herein, “structured DNA sequence” refers to a DNA sequence capable of forming a replication-inhibiting secondary structure (Mirkin and Mirkin, 2007. Microbiology and Molecular Biology Reviews 71:13-35). This includes, but is not limited to, reverse repeats, palindromes, direct repeats, IR / DR, homopolymer repeats containing eukaryotic promoter enhancers or repeats containing eukaryotic promoter enhancers, or repeats containing eukaryotic origins of replication.

[0118] As used herein, “SV40 origin” refers to Simian virus 40 genomic DNA containing the origin of replication.

[0119] As used herein, “SV40 enhancer” refers to Simian virus 40 genomic DNA containing 72 bp and optionally 21 bp enhancer repeats.

[0120] As used herein, "TE buffer" refers to a solution containing approximately 10 mM Tris pH 8 and 1 mM EDTA.

[0121] As used herein, "TetR" refers to the tetracycline resistance gene.

[0122] As used herein, “transcriptional terminator” means (1) in the context of bacteria, a DNA sequence that marks the end of a gene or operon for transcription. This may be an intrinsic transcription termination factor or a Rho-dependent transcription termination factor. In the case of an intrinsic terminator, such as the trpA terminator, a hairpin structure is formed within the transcript that disrupts the mRNA-DNA-RNA polymerase ternary complex. Alternatively, a Rho-dependent transcriptional terminator disrupts the Rho factor, RNA helicase protein complex, or (2) in the context of eukaryotes, the polyA signal is not a “terminator,” but rather an internal cleavage at the polyA site leaves the untapped 5' end on the 3'UTR RNA for nuclease digestion. The nuclease catches up with RNA PolII, causing termination. Termination may be facilitated within a short region of the polyA site by the introduction of an RNA PolII pause site (eukaryotic transcriptional terminator). The pause of RNA PolII allows nucleases introduced into 3'UTR mRNA after PolyA cleavage to catch up with RNA PolII at the pause site. A non-exclusive list of eukaryotic transcriptional terminators known in the art includes C2x4 and gastrin terminators. Eukaryotic transcriptional terminators can increase mRNA levels by enhancing proper 3' end processing of mRNA.

[0123] As used herein, “transfection” means methods for delivering nucleic acids to cells, as known in the art and included herein by reference [e.g., poly(lactide-coglycolide) (PLGA), ISCOM, liposomes, niosomes, viromosomes, block copolymers, pluronic block copolymers, chitosan, and other biodegradable polymers, microparticles, microspheres, calcium phosphate nanoparticles, nanoparticles, nanocapsules, nanospheres, poloxamine nanospheres, electroporation, nucleofection, piezoelectric permeabilization, sonoporation, iontophoresis, ultrasound, SQZ fast cell deformation-mediated membrane disruption, corona plasma, plasma-assisted delivery, tissue-resistant plasma, laser microporation, shock wave energy, magnetic field, non-contact magnetic permeabilization, gene cancer, microneedles, microdermabrasion, hydrodynamic delivery, high-pressure tail vein injection, etc.]. The transfection of DNA into E. coli, commonly referred to as transformation, is typically carried out using chemically competent or electrocompetent E. coli cells, employing standard methodologies known in the art and incorporated herein by reference.

[0124] As used herein, “transgene” refers to the gene of interest that is cloned into a vector for expression in a target organism.

[0125] As used herein, “transposase vector” refers to a vector that encodes a transposase.

[0126] As used herein, “transposon vector” refers to a vector encoding a transposon, which is a substrate for transposase-mediated gene integration.

[0127] As used herein, "ts" means temperature sensitivity.

[0128] As used herein, “UTR” refers to the untranslated region of mRNA (5' or 3' relative to the coding region).

[0129] As used herein, “vector” refers to gene delivery vehicles including viral (e.g., alphaviruses, poxviruses, lentiviruses, retroviruses, adenoviruses, adenovirus-associated viruses, etc.) and non-viral (e.g., plasmids, MIDGE, transcriptionally active PCR fragments, minicircles, bacteriophages, Nanoplasmid®, etc.) vectors. These are well known in the art and are incorporated herein by reference.

[0130] As used herein, “vector skeleton” refers to the eukaryotic and bacterial regions of a vector that do not contain the transgene or target antigen coding region.

[0131] In some embodiments, the engineered Escherichia coli (E.coli) host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and the engineered E.coli host cells do not contain any engineered viability or yield reduction mutations in any of sbcB, recB, recD, and recJ, and optionally, at least one of uvrC, mcrA, mcrBC-hsd-mrr and their combinations. In some embodiments, the engineered E.coli host cells do not contain any engineered mutations in any of sbcB, recB, recD, and recJ, and optionally, at least one of uvrC, mcrA, mcrBC-hsd-mrr and their combinations. In some embodiments, the manipulated E. coli host cells are free from any mutations in sbcB, recB, recD, and recJ, and optionally, in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof.

[0132] It should be understood that engineered E. coli host cells comprising gene knockout (or knockdown) of at least one gene selected from the group consisting of SbcC and SbcD are within the scope of this disclosure, and that engineered E. coli host cells do not contain engineered viability or yield reduction mutations in at least one of sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr, or in some embodiments, do not contain engineered mutations or any mutations at all. It should also be understood that engineered E. coli host cells comprising gene knockout of at least one gene selected from the group consisting of SbcC and SbcD are within the scope of this disclosure, and that engineered E. coli host cells do not contain engineered viability or yield reduction mutations in at least one of sbcB, recB, recD, and recJ, or in some embodiments, do not contain engineered mutations or any mutations at all. In some embodiments, the manipulated E. coli host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, but in mcrA, they do not contain a survival or yield reduction mutation, or in some embodiments, they do not contain a manipulated mutation or any mutation at all. In some embodiments, the manipulated E. coli host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and the manipulated E. coli host cells do not contain a manipulated survival or yield reduction mutation in any of sbcB, recB, recD, and recJ, or in some embodiments, they do not contain a manipulated mutation or any mutation at all.

[0133] In other embodiments, the manipulated E. coli host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and do not contain any manipulated viability or yield reduction mutations in at least one of sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr. In other embodiments, the manipulated E. coli host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and do not contain any manipulated mutations in at least one of sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr. In other embodiments, the manipulated E. coli host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and do not contain any mutations in at least one of sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr. In some embodiments, the manipulated E. coli host cells contain a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and are free from any mutations in sbcB, recB, recD, recJ, and uvrC. In some embodiments, the manipulated E. coli host cells contain a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and are free from any mutations in mcrA.

[0134] In some embodiments, engineered E. coli host cells are provided that include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, wherein the engineered E. coli host cells do not contain any engineered viability or yield reduction mutations in any of sbcB, recB, recD, and recJ. In any of the embodiments described above, the engineered E. coli host cells cannot contain any engineered mutations in sbcB, recB, recD, and recJ. In any of the embodiments described above, the engineered E. coli host cells cannot contain any mutations in any of sbcB, recB, recD, and recJ. In some embodiments, engineered E. coli host cells are provided, comprising a gene knockout of at least one gene selected from the group consisting of SbC and SbcD, wherein the E. coli host cells are isogenic to the strain from which they originate, which is selected from the group consisting of DH5α, DH1, JM107, JM108, JM109, MG1655, and XL1Blue. In some embodiments, engineered E. coli host cells are provided, comprising a gene knockout of at least one gene selected from the group consisting of SbC and SbcD, wherein the E. coli host cells are isogenic to the strain from which they originate, which is selected from the group consisting of DH5α(dcm-), NTC4862, NTC4862-HF, NTC1050811, NTC1050811-HF, NTC1050811-HF(dcm-), HB101, TG1, and NEB Turbo.

[0135] To the extent that is not inconsistent with any of the embodiments described above, the manipulated E. coli cells may further be free from manipulated viability or yield reduction mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. In any of the embodiments described above, the manipulated E. coli host cells may further be free from any manipulated mutations in at least one of uvrC, mcrA, mrBC-hsd-mrr, and combinations thereof. In any of the embodiments described above, the manipulated E. coli host cells may further be free from any mutations in at least one of uvrC, mcrA, mrBC-hsd-mrr, and combinations thereof. Therefore, in some embodiments, the manipulated E. coli host cells may further be free from manipulated viability or yield reduction mutations, manipulated mutations, or any mutations in uvrC. In other embodiments, the manipulated E. coli host cells may further be free of manipulated viability or yield reduction mutations, manipulated mutations, or any mutations in mcrA. Furthermore, in other embodiments, the manipulated E. coli host cells may further be free of manipulated viability or yield reduction mutations, manipulated mutations, or any mutations in mcrBC-hsd-mrr. In yet another embodiment, the manipulated E. coli host cells may further be free of manipulated viability or yield reduction mutations, manipulated mutations, or any mutations in mcrA and mrBC-hsd-mrr. Throughout this disclosure, it should be understood that mrBC-hsd-mrr refers to sequences including sequences 16-21.

[0136] In any of the embodiments described above, the manipulated E. coli host cells may contain non-functional SbcCD complexes, or in other words, may not contain functional SbcCD complexes. Alternatively, in some embodiments, the manipulated E. coli host cells may not contain SbcCD complexes.

[0137] In any of the embodiments described above, the gene knockout of the manipulated E. coli host cells may be a knockout of SbcC. Alternatively, in some embodiments, the gene knockout of the manipulated E. coli host cells may be a knockout of SbcD. In any of the embodiments described above, the gene knockout of the manipulated E. coli host cells may be a knockout of both SbcC and SbcD.

[0138] In any of the embodiments described above, the manipulated E. coli host cells may be derived from cell lines selected from the group consisting of DH5α, DH1, JM107, JM108, JM109, MG1655, and XL1Blue. In any of the embodiments described above, the manipulated E. coli host cells may be derived from DH5α(dcm-), NTC4862, NTC4862-HF, NTC1050811, NTC1050811-HF, or NTC1050811-HF(dcm-). In any of the embodiments described above, the manipulated E. coli host cells may be derived from cell lines selected from the group consisting of HB101, TG1, and NEB Turbo. The genotypes of these cell lines are as follows: DH5α(dcm-):DH5α dcm- NTC4862:DH5α att λ ::P c -RNA-IN-SacB,catR NTC4862-HF:DH5α att λ ::P c -RNA-IN-SacB,catR;att φ80 ::pARA-CI857ts P c -RNA-IN-SacB,tetR NTC1050811:DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 ::pARA-CI857ts,tetR NTC1050811-HF:DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 ::pARA-CI857ts P c -RNA-IN-SacB,tetR NTC1050811-HF(dcm-):DH5α dcm-att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 ::pARA-CI857ts P c -RNA-IN-SacB,tetR HB101:F - mcrB expression of hsdS20(r B - m B - )recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(Sm R )glnV44 λ - TG1:K-12 glnV44 thi-1 Δ(lac-proAB)Δ(mcrB-hsdSM)5(r K - m K - )F′[traD36 proAB + lacI q lacZΔM15] NEB Turbo:F' proA + B + lacI q ΔlacZM15 / fhuA2 Δ(lac-proAB)glnV galK16 galE15 R(zgb-210::Tn10)Tet S endA1 thi-1 Δ(hsdS-mcrB)5

[0139] In any of the embodiments described above, the manipulated E. coli host cells may further include a genomic antibiotic resistance marker. For example, but not limited to, the genomic antibiotic resistance marker may be a kanR containing a sequence having at least 90%, at least 95%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 23 (kanR, 795 bp). As a further example, but not limited to, the genomic antibiotic resistance marker may be a kanR containing a sequence encoding a protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 36 (kanR). As yet another example, the genomic antibiotic resistance marker may be a chloramphenicol resistance marker, a gentamicin resistance marker, a kanamycin resistance marker, a spectinomycin and streptomycin resistance marker, a trimethoprim resistance marker, or a tetracycline resistance marker. Alternatively, in any of the embodiments described above, the E. coli host cells may not contain a genomic antibiotic resistance marker.

[0140] In any of the embodiments described above, the manipulated E. coli host cells may further contain Rep proteins suitable for culturing Rep protein-dependent plasmids. For example, but not limited to, the manipulated E. coli host cells may contain genomic nucleic acid sequences having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with sequences selected from the group consisting of SEQ ID NO: 26 (P42L-P106I-F107S-P113S, 918bp), SEQ ID NO: 27 (P42L-Δ106-107-P113S, 912bp), SEQ ID NO: 28 (P42L-P106L-F107S, 918bp), and SEQ ID NO: 29 (P42L-P113S, 918bp). As a further example, but not limited to, engineered E. coli host cells may contain genomic nucleic acid sequences encoding Rep proteins that have at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with amino acid sequences selected from the group consisting of SEQ ID NO: 39 (P42L-P106I-F107S-P113S), SEQ ID NO: 40 (P42L-Δ106-107-P113S), SEQ ID NO: 42 (P42L-P106L-F107S), SEQ ID NO: 41 (P42L-P113S), SEQ ID NO: 34 (ColE2 wild-type), and SEQ ID NO: 35 (ColE2 mutant G194D). For example, but not limited to, manipulated E. coli host cells may contain Rep proteins having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with amino acid sequences selected from the group consisting of SEQ ID NO: 39 (P42L-P106I-F107S-P113S), SEQ ID NO: 40 (P42L-Δ106-107-P113S), SEQ ID NO: 42 (P42L-P106L-F107S, 305aa), SEQ ID NO: 41 (P42L-P113S, 305aa), SEQ ID NO: 34 (ColE2 wild-type), and SEQ ID NO: 35 (ColE2 mutant G194D). L It may be under the control of the promoter, and such P LIt should be understood that if the promoter has a genomically present lambda repressor such as cITs857, it may enable temperature-sensitive expression of the Rep protein. For example, but not limited to, P L The promoter is ttgacataaa taccactggc ggtgatact(P L promoter(-35~-10)),ttgacataaa taccactggc gtgatact(P L Promoter OL1-G(-35~-10)), or ttgacataaa taccactggc gttgatact(P L The sequence may have at least 95%, at least 98%, at least 99%, or 100% sequence identity with the promoter OL1-G~T(-35~-10). It should be further understood that if the Rep protein is an R6K Rep protein such as SEQ ID NOs. 39~42, the vector transfected into engineered E. coli host cells may contain an R6K origin of replication, or if the Rep protein is a ColE2 Rep protein, the vector transfected into engineered E. coli host cells may contain a ColE2 origin of replication.

[0141] In any of the embodiments described above, the engineered E. coli host cell may further include a genomic nucleic acid sequence encoding a genome-expressed RNA-IN-regulated selectable marker. For example, but not limited to, the engineered E. coli host cell may include a genomic nucleic acid sequence (encoding a selectable marker) having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 25 (SacB, 1422 bp). For example, but not limited to, the engineered E. coli host cell may include a genomic nucleic acid sequence encoding a selectable marker having an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 38 (SacB). As a further example, but not limited to, engineered E. coli host cells may include RNA-IN-modified selectable markers having an amino acid sequence with at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 38 (SacB). In any of the embodiments described above, the RNA-IN-modified selectable marker may be downstream of the RNA-IN having the sequence gccaaaaatcaataatcagacaacaagatg, and in embodiments using this RNA-IN, the corresponding RNA-OUT in the vector may be SEQ ID NO: 6 of WO2019 / 183248 (SEQ ID NO: 48). Therefore, with respect to SacB, the RNA-IN SacB sequence is,

[0142] This could be TIFF0007833134000003.tif110150. Any suitable RNA-IN-modulated selection marker and RNA-IN can be used, and it should be understood that these are known in the art.

[0143] In any of the embodiments described above, the manipulated E. coli host cell may further contain a genomic nucleic acid sequence encoding a temperature-sensitive lambda repressor. For example, the temperature-sensitive lambda repressor may be cITs857. For example, but not limited to, engineered E. coli host cells may contain a genomic nucleic acid sequence (encoding a temperature-sensitive lambda repressor) having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 24 (cITs857, 714 bp). For further example, but not limited to, engineered E. coli host cells may further contain a genomic nucleic acid sequence encoding cITs857 having an amino acid sequence with at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 37 (cITs857). As a further example, but not limited to, the engineered E. coli host cell may further include a temperature-sensitive lambda repressor having an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 37 (cITs857). In any of the embodiments described above, if the engineered E. coli host cell further includes a genomic nucleic acid sequence encoding a temperature-sensitive lambda repressor, the temperature-sensitive lambda repressor may be a phage φ80 binding site chromosomal integration copy of the arabinose-inducible CITs857 gene. As an example, but not limited to, the cITs857 gene is under the control of the pBAD promoter and is arabinose-inducible (pBAD promoter,

[0144] We can provide TIFF0007833134000004.tif98148).

[0145] In some embodiments, the following genotype is used: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k Manipulated E. coli host cells having +)gal-phoA supE44 λ-thi-1 gyrA96 relA1 ΔSbcDC::kanR are provided.

[0146] In some embodiments, the following genotype is used: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k Manipulated E. coli host cells are provided, having +)gal-phoA supE44 λ-thi-1 gyrA96 relA1 ΔSbcDC.

[0147] In some embodiments, the following genotype: DH5α att HK022 Manipulated E. coli host cells are provided, possessing ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;ΔSbcDC::kanR.

[0148] In some embodiments, the following genotype: DH5α att HK022 Manipulated E. coli host cells are provided, possessing ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;ΔSbcDC.

[0149] In some embodiments, the following genotype is used: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k Manipulated E. coli host cells having +)gal-phoA supE44 λ-thi-1 gyrA96 relA1;ΔSbcDC::kanR are provided.

[0150] In some embodiments, manipulated E. coli host cells having the following genotype:DH5α dcm-;ΔSbcDC are provided.

[0151] In some embodiments, manipulated E. coli host cells having the following genotype:DH5α dcm-;ΔSbcDC::kanR are provided.

[0152] In some embodiments, the following genotype: DH5α att λ ::P c Engineered E. coli host cells having RNA-IN-SacB,catR;ΔSbcDC are provided.

[0153] In some embodiments, the following genotype: DH5α att λ ::P c Manipulated E. coli host cells having -RNA-IN-SacB,catR;ΔSbcDC::kanR are provided.

[0154] In some embodiments, the following genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att φ80 ::pARA-CI857ts P c Engineered E. coli host cells having RNA-IN-SacB,tetR;ΔSbcDC are provided.

[0155] In some embodiments, the following genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att φ80 ::pARA-CI857ts P c Manipulated E. coli host cells having -RNA-IN-SacB,tetR;ΔSbcDC::kanR are provided.

[0156] In some embodiments, the following genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pLOL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 Manipulated E. coli host cells having ::pARA-CI857ts,tetR;ΔSbcDC are provided.

[0157] In some embodiments, the following genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 Manipulated E. coli host cells having ::pARA-CI857ts,tetR;ΔSbcDC::kanR are provided.

[0158] In some embodiments, the following genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 ::pARA-CI857ts P c Engineered E. coli host cells having RNA-IN-SacB,tetR;ΔSbcDC are provided.

[0159] In some embodiments, the following genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 ::pARA-CI857ts P c Manipulated E. coli host cells having -RNA-IN-SacB,tetR;ΔSbcDC::kanR are provided.

[0160] In some embodiments, the following genotype is used: DH5α dcm-att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80::pARA-CI857ts P c Engineered E. coli host cells having RNA-IN-SacB,tetR;ΔSbcDC are provided.

[0161] In some embodiments, the following genotype is used: DH5α dcm-att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 ::pARA-CI857ts P c Manipulated E. coli host cells having -RNA-IN-SacB,tetR;ΔSbcDC::kanR are provided.

[0162] In any of the embodiments described above, the SbcC gene may include a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9. In any of the embodiments described above, the SbcD gene may include a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 10. It should be understood that this can be applied before or after knockout or knockdown, i.e., to genes in manipulated E. coli host cells. For reference, the wild-type sequence of SbcC from NCBI for E. coli K12 (reference sequence: WP_206061808.1) is:

[0163] The SbcD wild-type sequence (AAB18122.1) for E. coli K12, given by TIFF0007833134000005.tif80150, is from GenBank.

[0164] These are given by TIFF0007833134000006.tif36164. These amino acid sequences are illustrative, and those skilled in the art should understand that, based on homology, SbcC and SbcD genes, as well as proteins containing the complex, can be identified in other strains and cell lines.

[0165] In any of the embodiments described above, the sbcB gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11. In any of the embodiments described above, the recB gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12. In any of the embodiments described above, the recD gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 13. In any of the embodiments described above, the recJ gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 65.

[0166] In any of the embodiments described above, the uvrC gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 14. In any of the embodiments described above, the mcrA gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15. In any of the embodiments described above, the mcrBC-hsd-mrr gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NOs: 16-21.

[0167] In any of the embodiments described above, the manipulated E. coli host cells may further contain a vector. For example, but not limited to, the vector may be a nonviral transposon vector, e.g., a transposase vector, Sleeping Beauty transposon vector, Sleeping Beauty transposase vector, PiggyBac transposon vector, PiggyBac transposase vector, expression vector, etc.; a nonviral gene editing vector, e.g., a homologous recombination repair (HDR) / CRISPR-Cas9 vector, etc.; or a viral vector, e.g., an AAV vector, AAV rep cap vector, AAV helper vector, Ad helper vector, lentiviral vector, lentiviral envelope vector, lentiviral packaging vector, retroviral vector, retroviral envelope vector, retroviral packaging vector, mRNA vector, etc.

[0168] In any of the above embodiments, in which E. coli host cells further include a vector, the vector may include a palindrome-containing nucleic acid sequence. A palindrome sequence can be understood as a nucleic acid sequence within a double-stranded DNA molecule in which a reading in a particular direction on the single strand coincides with a sequence reading in the opposite direction on the complementary strand, thereby creating complementary regions along the single strand with no intervening sequences between the complementary regions. For example, and not limited to, the complementary sequences of palindromes are approximately 10-200 base pairs, 15-200 base pairs, 20-200 base pairs, 25-200 base pairs, 30-200 base pairs, 40-200 base pairs, 50-200 base pairs, 75-200 base pairs, 100-200 base pairs, 15-200 base pairs, 10-150 base pairs, 15-150 base pairs, 20-150 base pairs, 25-150 base pairs, 30-150 base pairs, 30-150 base pairs, 40-150 base pairs, 50-150 base pairs, 100-150 base pairs, and 10-140 base pairs. Base pairs, approximately 15 to approximately 140 base pairs, approximately 20 to approximately 140 base pairs, approximately 25 to approximately 140 base pairs, approximately 30 to approximately 140 base pairs, approximately 30 to approximately 140 base pairs, approximately 40 to approximately 140 base pairs, approximately 50 to approximately 140 base pairs, approximately 100 to approximately 140 base pairs, approximately 10 to approximately 100 base pairs, approximately 15 to approximately 100 base pairs, approximately 20 to approximately 100 base pairs, approximately It may contain 25 to approximately 100 base pairs, approximately 30 to approximately 100 base pairs, approximately 40 to approximately 100 base pairs, approximately 50 to approximately 100 base pairs, or approximately 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 base pairs.

[0169] In any of the above embodiments in which an E. coli host cell further comprises a vector, the vector may comprise a nucleic acid sequence having at least one direct repeat. For example, but not limited to, the at least one direct repeat may comprise about 40 to 150 nucleotides, about 60 to about 120 nucleotides, or about 90 nucleotides. For example, but not limited to, the at least one direct repeat may be a simple repeat comprising a short sequence of DNA consisting of multiple repeats of a single base, such as a poly-A repeat, poly-T repeat, poly-C repeat, or poly-G repeat, and the simple repeat comprises about 40 to about 150 consecutive repeats of the same base, about 60 to about 120 consecutive repeats of the same base, or about 90 consecutive repeats of the same base. For example, but not limited to, the poly-A repeat may comprise 40 to 150 consecutive adenine nucleotides, 60 to 120 consecutive adenine nucleotides, or about 90 adenine nucleotides.

[0170] In any of the above embodiments in which E. coli host cells further comprise the vector, the vector may comprise a reverse repeat sequence, a direct repeat sequence, a homopolymer repeat sequence, a eukaryotic origin of replication, and a eukaryotic promoter-enhancer sequence. As a further example, the vector may comprise a sequence selected from the group consisting of polyA repeats, SV40 origin of replication, viral LTRs, lentiviral LTRs, retroviral LTRs, transposon IR / DR repeats, Sleeping Beauty transposon IR / DR repeats, AAV ITRs, CMV enhancers, and SV40 enhancers. For example, but not limited to, an AAV vector may comprise an AAV ITR. In some embodiments in which E. coli host cells further comprise the vector, the vector may comprise a nucleic acid sequence having at least one reverse repeat sequence, which may also be a reverse terminal repeat such as an AAV ITR, for example, but not limited to. Thus, in any of the above embodiments, the vector may comprise an AAV ITR. It should be understood that a reverse repeat sequence is a single-stranded sequence of nucleotides followed downstream by its reverse complement. It should be further understood that the single-stranded sequence may be part of a double-stranded vector. The nucleotide intervening sequence between the initial sequence and the reverse complement can be of any length, including zero. If the intervening length is zero, the composite sequence is a palindrome. If the intervening length is greater than zero, the composite sequence is a reverse repeat. In any of the embodiments described above, the intervening sequence may be 1 to about 2000 base pairs long.For example, although not limited to them, possible reverse repeats are approximately 1 to 2000 base pairs, 5 to 2000 base pairs, 10 to 2000 base pairs, 25 to 2000 base pairs, 50 to 2000 base pairs, 100 to 2000 base pairs, 250 to 2000 base pairs, 500 to 2000 base pairs, 750 to 2000 base pairs, 1000 to 2000 base pairs, 1250 to 2000 base pairs, 1500 to 2000 base pairs, 1750 to 2000 base pairs, and approximately 1 to 2000 base pairs. They can be separated by intervening sequences containing 100 base pairs, approximately 1 to 50 base pairs, approximately 1 to 25 base pairs, approximately 1 to 20 base pairs, approximately 1 to 10 base pairs, approximately 1 to 5 base pairs, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 base pairs. For example, though not limited to, the complementary parts of reverse repeats are approximately 10-200 base pairs, 15-200 base pairs, 20-200 base pairs, 25-200 base pairs, 30-200 base pairs, 40-200 base pairs, 50-200 base pairs, 75-200 base pairs, 100-200 base pairs, 15-200 base pairs, 10-150 base pairs, 15-150 base pairs, 20-150 base pairs, 25-150 base pairs, 30-150 base pairs, 30-150 base pairs, 40-150 base pairs, 50-150 base pairs, 100-150 base pairs, and 10-140 base pairs. Pairs, approximately 15-140 base pairs, approximately 20-140 base pairs, approximately 25-140 base pairs, approximately 30-140 base pairs, approximately 30-140 base pairs, approximately 40-140 base pairs, approximately 50-140 base pairs, approximately 100-140 base pairs, approximately 10-100 base pairs, approximately 15-100 base pairs, approximately 20-100 base pairs, approximately It may contain 25 to approximately 100 base pairs, approximately 30 to approximately 100 base pairs, approximately 40 to approximately 100 base pairs, approximately 50 to approximately 100 base pairs, or approximately 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 base pairs.For example, though not limited to, at least one reverse iteration is ttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcct cagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct(5'AAV ITR) and aggaacccctagtgatggagttggccactccctctgcgcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgccc gggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa(3'AAV AAV iterators may include iterator repeats containing sequences that have at least 95%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with the iterator repeat.

[0171] Alternatively, in any of the above embodiments in which E. coli host cells further include a vector, the vector may not contain a nucleic acid sequence having a palindromic, direct repeat, or reverse repeat.

[0172] In any of the embodiments described above, the vector may be an AAV vector. In some embodiments where the vector is an AAV vector, the AAV vector includes an AAV ITR. In other embodiments, the vector may be a lentiviral vector, a lentiviral envelope vector, or a lentiviral packaging vector. In yet another embodiment, the vector may be a retroviral vector, a retroviral envelope vector, or a retroviral packaging vector. In yet another embodiment, the vector may be a transposase vector or a transposon vector. In yet another embodiment, the vector may be an mRNA vector. For example, but not limited to, the mRNA vector may include the poly-A repeats described herein.

[0173] In any of the embodiments described above, the vector may be a plasmid. In any of the embodiments described above, the vector may be a Rep protein-dependent plasmid.

[0174] In any of the embodiments described above, the vector may further include an RNA-selectable marker. For example, but not limited to, the RNA-selectable marker may be RNA-OUT. As further examples, though not limited to them, RNA-OUT includes sequence numbers 5 (gtagaattgg taaagagagt cgtgtaaaat atcgagttcg cacatcttgt tgtctgatta ttgatttttg gcgaaaccat ttgatcatat gacaagatgt gtatctacct taacttaatg attttgataa aaatcatta) and 7 (gtagaattgg taaagagagt tgtgtaaaat attgagttcg cacatcttgt tgtctgatta ttgatttttg gcgaaaccat ttgatcatat gacaagatgt gtatctacct taacttaatg attttgataa) in WO2019 / 183248 (sequence numbers 47 and 49, respectively). Sequences selected from the group consisting of aaatcatta) can have at least 95%, at least 98%, at least 99%, or 100% sequence identity. In some embodiments, the manipulated E. coli host cells may contain corresponding RNA-IN sequences to enable the regulation of downstream markers by RNA-OUT, where the RNA-OUT sequence corresponds to the RNA-IN.

[0175] In any of the embodiments described above, the vector may further include RNA-OUT antisense repressor RNA. For example, but not limited to, the RNA-OUT antisense repressor RNA may have a sequence that has at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with sequence number 6 of WO2019 / 183248 (sequence number 48).

[0176] In any of the embodiments described above, the vector may further include a bacterial origin of replication. For example, but not limited to, recent origins of replication may be selected from the group consisting of R6K, pUC, and ColE2. As further examples, though not limited to them, bacterial replication origins include sequence number 1 (ggcttgttgt ccacaaccgt taaaccttaa aagctttaaa agccttatat attctttttt ttcttataaa acttaaaacc ttagaggcta tttaagttgc tgatttatat taattttatt gttcaaacat gagagcttag tacgtgaaac atgagagctt agtacgttag ccatgagagc ttagtacgtt agccatgagg gtttagttcg ttaaacatga gagcttagta cgttaaacat gagagcttag tacgtactat caacaggttg aactgctgat c) and sequence number 2 (ggcttgttgt ccacaaccat taaaccttaa aagctttaaa agccttatat attctttttt ttcttataaa acttaaaacc ttagaggcta tttaagttgc tgatttatat taattttatt gttcaaacat gagagcttag tacgtgaaac atgagagctt agtacattag ccatgagagc ttagtacatt agccatgagg gtttagttca ttaaacatga gagcttagta cattaaacat gagagcttag tacatactat caacaggttg aactgctgat c), sequence number 3 (aaaccttaaa acctttaaaa gccttatata ttcttttttt tcttataaaa cttaaaacct tagaggctat ttaagttgct gatttatatt aattttattg ttcaaacatg agagcttagt acatgaaaca tgagagctta gtacattagc catgagagct tagtacatta gccatgagggtttagttcat taaacatgag agcttagtac attaaacatg agagcttagt acatactatc aacaggttga actgctgatc), SEQ ID NO: 4 (tgtcagccgt taagtgttcc tgtgtcactg aaaattgctt tgagaggctc taagggcttc tcagtgcgtt acatccctgg cttgttgtcc acaaccgtta aaccttaaaa gctttaaaag ccttatatat tctttttttt cttataaaac ttaaaacctt agaggctatt taagttgctg atttatatta attttattgt tcaaacatga gagcttagta cgtgaaacat gagagcttag tacgttagcc atgagagctt agtacgttag ccatgagggt ttagttcgtt aaacatgaga gcttagtacg ttaaacatga gagcttagta cgtgaaacat gagagcttag tacgtactat caacaggttg aactgctgat cttcagatc), and SEQ ID NO: 18 (ggcttgttgt ccacaaccgt taaaccttaa aagctttaaa agccttatat attctttttt ttcttataaa acttaaaacc ttagaggcta tttaagttgc tgatttatat taattttatt gttcaaacat gagagcttag tacgtgaaac atgagagctt agtacgttag ccatgagagc ttagtacgtt agccatgagg gtttagttcg ttaaacatga gagcttagta cgttaaacat gagagcttag tacgttaaac atgagagctt agtacgtact atcaacaggt tgaactgctgThis could be an R6K gamma replication origin having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with atc), such as SEQ ID NO: 30 (ColE2 origin (+7), 45 bp), SEQ ID NO: 31 (ColE2 origin (+7, CpG-free), 45 bp), SEQ ID NO: 32 (ColE2 origin (Min), 38 bp), SEQ ID NO: 33 (ColE2 origin (+16), 60 bp), and SEQ ID NO: 22 (pUC, 784 bp).

[0177] In any of the embodiments described above, the engineered E. coli host cell may further include a eukaryotic pUC-free minicircle expression vector comprising: (i) a eukaryotic region sequence encoding the gene of interest and having 5' and 3' ends; and (ii) a spacer region having less than 1000, preferably less than 500, base pairs in length, ligating the 5' and 3' ends of the eukaryotic region sequence and containing an R6K bacterial origin and RNA-OUT selectable marker. For example, but not limited to, the R6K bacterial origin and RNA-OUT selectable marker may have sequences described in this disclosure and known in the art. Alternatively, in any of the embodiments described above, the engineered E. coli cell may further include a covalently bound closed circular plasmid having a backbone comprising a backbone containing a PolIII-dependent R6K origin and RNA-OUT selectable marker, having a backbone less than 1000 bp, preferably less than 500 bp, and an insert containing a structured DNA sequence. For example, but not limited to, structured DNA sequences may include sequences selected from the group consisting of reversed repeat sequences, direct repeat sequences, homopolymer repeat sequences, eukaryotic origins of replication, and eukaryotic promoter-enhancer sequences. Further examples may include sequences selected from the group consisting of polyA repeats, SV40 origins of replication, viral LTRs, lentiviral LTRs, retroviral LTRs, transposon IR / DR repeats, Sleeping Beauty transposon IR / DR repeats, AAV ITRs, CMV enhancers, and SV40 enhancers. For example, but not limited to, inserts may be transposase vectors, AAV vectors, or lentiviral vectors. For example, but not limited to, polIII-dependent R6K replication origins may have sequences that have at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NOs. 43, 44, 45, 46, and 60 (from SEQ ID NOs. 1-4 and 18 of WO2019 / 183248).As an example, but not limited to, an RNA-OUT selectable marker may be an RNA-IN regulated RNA-OUT functional variant having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 47 or SEQ ID NO: 49 (from SEQ ID NOs: 5 and 7 of WO2019 / 183248). As a further example, an RNA-OUT selectable marker may be an RNA-OUT antisense repressor RNA. As an example, but not limited to, an RNA-OUT antisense repressor RNA may have a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6 of WO2019 / 183248 (SEQ ID NO: 48).

[0178] It should be understood that a viability or yield reduction mutation refers to a mutation that reduces the viability or yield of the cell line from which the mutated cell line originates, under the same culture conditions. It should also be understood that such mutations can be manipulated or occur spontaneously.

[0179] Methods for knocking out or knocking down genes, as disclosed herein, are known in the art and include, but are not limited to, the methods disclosed in the examples herein (recombinant), as well as P1 phage transduction, genomic material transfer, and CRISPR / Cas9. It should be understood that gene knockout can result in either the cessation of protein expression or the expression of a non-functional protein. Thus, the SbcCD complex may or may not be present in the bacterial host strains of this disclosure, but if present, it will be non-functional in the case of knockout, or its activity as a nuclease will be reduced in the case of knockdown. It should be understood that embodiments of this disclosure may include knockout or knockdown of SbcC, SbcD, or both.

[0180] While not theoretically bound, knockout of SbcC or SbcD alone is expected to be sufficient to achieve the desired effects of the present invention, since both proteins are essential subunits of the SbcCD nuclease (Connelly JC and Leach DR, Genes Cells 1:285, 1996). The sbcC and sbcD genes of E. coli encode nucleases involved in palindromic inactivation and recombination (Connelly JC and Leach DR, Genes Cells 1:285, 1996).

[0181] Within this disclosure, it should be understood that manipulated E. coli host cells may contain vectors such as those described herein. The vectors may include any suitable vectors, including those described in the references incorporated herein by reference. For example, in some cases, the vector may contain a structured DNA sequence. In other cases, the vector may not contain a structured DNA sequence.

[0182] In some embodiments, the engineered E. coli host cells may further include vectors as understood herein. Such vectors may occur spontaneously or be engineered. The vectors included in the engineered E. coli host cells of this disclosure may include any of the features considered herein and in documents incorporated by reference. The vectors included in the engineered E. coli host cells of this disclosure may not include, for example, at least one reversed repeat, direct repeat, or any of the aforementioned structured DNA sequences, such as reversed terminal repeats or palindromes.

[0183] Method for producing manipulated E. coli host cells In some embodiments, a method for producing engineered E.coli host cells is provided, comprising the step of obtaining engineered E.coli cells by knocking out at least one gene selected from the group consisting of SbcC and SbcD in starting E.coli cells that do not contain any engineered viability or yield reduction mutations in any of sbcB, recB, recD, and recJ. In some embodiments, a method for producing engineered E.coli host cells is provided, comprising the step of obtaining engineered E.coli host cells by knocking out at least one gene selected from the group consisting of SbcC and SbcD in starting E.coli cells that do not contain any engineered mutations in any of sbcB, recB, recD, and recJ. In some embodiments, a method for producing engineered E.coli host cells is provided, comprising the step of obtaining engineered E.coli host cells by knocking out at least one gene selected from the group consisting of SbcC and SbcD in starting E.coli cells that do not contain any mutations in any of sbcB, recB, recD, and recJ.

[0184] In any of the embodiments described above, the starting E. coli cells may further be free of any manipulated viability or yield reduction mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. In any of the embodiments described above, the starting E. coli cells may further be free of any mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. In any of the embodiments described above, the starting E. coli cells may further be free of any mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof.

[0185] In any of the embodiments described above, the step of knocking out at least one gene does not result in any mutations in sbcB, recB, recD, and recJ. In any of the embodiments described above, the step of knocking out at least one gene does not result in any mutations in at least one of uvrC, mcRA, mcrBC-hsd-mrr, and any combination thereof.

[0186] In any of the embodiments described above, the manipulated E. coli cells may further be free from the manipulated viability or yield reduction mutation in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. In any of the embodiments described above, the manipulated E. coli host cells may further be free from the manipulated mutation in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. In any of the embodiments described above, the manipulated E. coli host cells may be free from any mutation in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof.

[0187] In any of the embodiments described above, the manipulated E. coli host cells cannot contain the manipulated viability or yield reduction mutations in sbcB, recB, recD, and recJ. In any of the embodiments described above, the manipulated E. coli host cells cannot contain the manipulated mutations in sbcB, recB, recD, and recJ. In any of the embodiments described above, the manipulated E. coli host cells cannot contain any mutations in sbcB, recB, recD, and recJ.

[0188] In any of the embodiments described above, the manipulated E. coli host cells do not contain the functional SbcCD complex. In any of the embodiments described above, the manipulated E. coli host cells do not produce the SbcCD complex. Alternatively, in some embodiments, the manipulated E. coli host cells produce the non-functional SbcCD complex.

[0189] It should be understood that in any embodiment of the method described above, the manipulated E. coli host cell may be any of the E. coli host cells described herein.

[0190] In any of the embodiments described above, the SbcC gene may include a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9. In any of the embodiments described above, the SbcD gene may include a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 10. It should be understood that this can be applied before or after knockout or knockdown, i.e., to genes in manipulated E. coli host cells.

[0191] In any of the embodiments described above, the sbcB gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11. In any of the embodiments described above, the recB gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12. In any of the embodiments described above, the recD gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 13. In any of the embodiments described above, the recJ gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 65.

[0192] In any of the embodiments described above, the uvrC gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 14. In any of the embodiments described above, the mcrA gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15. In any of the embodiments described above, the mcrBC-hsd-mrr gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NOs: 16-21.

[0193] Methods for vector production In some embodiments, an improved method for vector production is provided, comprising the steps of transfecting engineered E. coli host cells with a vector to obtain transfected host cells, and incubating the transfected host cells under conditions sufficient to replicate the vector, wherein the E. coli host cells do not contain any engineered viability or yield reduction mutations in any of sbcB, recB, recD, and recJ. It should be understood that the vector used to transfect the engineered E. coli host cells may be any vector described in this disclosure, including embodiments disclosed in which the engineered E. coli host cells include the vector.

[0194] In some embodiments, a method for improved vector production is provided, comprising the steps of: incubating transfected host cells which are engineered E. coli host cells that include a vector and do not contain engineered viability or yield reduction mutations in any of sbcB, recB, recD, and recJ which include a vector; and incubating the transfected host cells under conditions sufficient to replicate the vector.

[0195] It should be understood that in any of the embodiments described above, the manipulated E. coli host cell may be any of the manipulated E. coli host cells of this disclosure.

[0196] In any of the embodiments described above, the method may further include isolating the vector from the transfected host cells.

[0197] In any of the embodiments described above, the step of incubating the transfected host cells is carried out by fed-batch fermentation, which is performed by feeding the transfected cells or by feeding the vector after transfection, and the fed-batch fermentation includes growing the engineered E. coli host cells by growing them at a reduced temperature (which may be under growth-limiting conditions) during a first part of the fed-batch phase, and then increasing the temperature to a higher temperature during a second part of the fed-batch phase. For example, the reduced temperature may be about 28–30°C, and the higher temperature may be about 37–42°C. For example, the first part may be about 12 hours, and the second part may be about 8 hours. When fed-batch fermentation with temperature increase is used, the engineered E. coli host cells may be regulated by a temperature-sensitive lambda repressor. L It should be understood that lambda repressors and Rep proteins can be present under the control of the promoter.

[0198] In any of the embodiments described above, the plasmid yield after incubation of host cells transfected under conditions sufficient to replicate the vector can be higher than that of cell lines derived from manipulated E. coli cells treated under the same conditions.

[0199] In any of the embodiments described above, the SbcC gene may include a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9. In any of the embodiments described above, the SbcD gene may include a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 10. It should be understood that this can be applied before or after knockout or knockdown, i.e., to genes in manipulated E. coli host cells.

[0200] In any of the embodiments described above, the sbcB gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11. In any of the embodiments described above, the recB gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12. In any of the embodiments described above, the recD gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 13. In any of the embodiments described above, the recJ gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 65.

[0201] In any of the embodiments described above, the uvrC gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 14. In any of the embodiments described above, the mcrA gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15. In any of the embodiments described above, the mcrBC-hsd-mrr gene may include a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NOs: 16-21.

[0202] In any of the embodiments described above, it should be understood that the vector transfected into the manipulated E. coli host cells may be any of the vectors described herein.

[0203] It should be understood that in any of the embodiments described above, the manipulated E. coli host cells may include knockdown of SbcC, SbcD, or both, rather than knockout. Knockdown may result in reduced expression and / or activity of the SbcCD complex. The reduction may be at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more.

[0204] The bacterial host strains and methods of this disclosure are described here with reference to the following non-limiting examples. [Examples]

[0205] Most therapeutic plasmids utilize pUC origins (closely related to ColE1 origins), which are high-copy derivatives of pMB1 origins. For pMB1 replication, plasmid DNA synthesis is unidirectional and does not require plasmid-retaining initiator proteins. pUC origins are copy-up derivatives of pMB1 origins that delete accessory ROP(rom) proteins and possess additional temperature-sensitive mutations that destabilize RNAI / RNAII interactions. Plasmid copy number increases by shifting cultures containing these origins from 30°C to 42°C. pUC plasmids can be produced in a wide variety of E. coli cell lines.

[0206] In the following examples, a proprietary plasmid + shaking culture medium was used for shaking flask production. Seed cultures were started from glycerol stocks or colonies and streaked onto LB agar plates containing 50 μg / mL of antibiotic (ampR or kanR selective plasmid) or 6% sucrose (RNA-OUT selective plasmid). The plates were grown at 30–32°C, and the cells were resuspended in medium at approximately 2.5 OD. 600 The inoculum was used to prepare a 500 mL plasmid-shaking flask. This flask contained 50 μg / mL of antibiotic for ampR or kanR selection plasmids, or 0.5% sucrose for selection for RNA-OUT plasmids. The flask was grown with shaking until saturated at the growth temperature as shown.

[0207] In the following examples, HyperGRO fermentation was performed in a New Brunswick BioFlo 110 bioreactor using proprietary fed-batch medium (NTC3019, HyperGRO medium) as described (the entire text is incorporated herein by reference, U.S. Patent No. 7,943,377). Seed cultures were started from glycerol stocks or colonies and streaked onto LB agar plates containing 50 μg / mL of antibiotic (ampR or kanR selective plasmid) or 6% sucrose (RNA-OUT selective plasmid). Plates were grown at 30–32°C, and cells were resuspended in medium and used to provide approximately 0.1% inoculum for fermentation, which contained 50 μg / mL of antibiotic for ampR or kanR selective plasmids, or 0.5% sucrose for RNA-OUT plasmids. HyperGRO temperature shifts were as shown.

[0208] In the following examples, culture samples were taken at key points and regular intervals throughout all fermentation. The samples were immediately converted to biomass (OD). 600The plasmid yield was analyzed. When plasmid yield was determined, the analysis was performed by quantifying plasmids obtained from Qiagen Spin Miniprep Kit preparations, as described in U.S. Patent No. 7,943,377. In short, cells were alkaline lysed, clarified, the plasmids were column-purified, eluted, and then quantified. Plasmid quality was determined by agarose gel electrophoresis (AGE), performed on 0.8–1% Tris / acetate / EDTA (TAE) gels, as described in U.S. Patent No. 7,943,377.

[0209] The strains used in the following examples included the following:

[0210] Background of RNA-QUT antibiotic-free selectable markers: Antibiotic-free selection is performed in E. coli strains containing phage-lambda binding site chromosome-integrated pCAH63-CAT RNA-IN-SacB(P5 / 6 6 / 6), such as NTC4862, as described, for example, in WO2008 / 153733. SacB (Bacillus subtilis levans sucrase) is a reverse-selectable marker that is lethal to E. coli cells in the presence of sucrose. Translation of SacB from RNA-IN-SacB transcripts is inhibited by plasmid-coding RNA-OUT. This promotes plasmid selection by inhibiting SacB-mediated lethality in the presence of sucrose.

[0211] Background of R6K origin vector replication: The R6K gamma plasmid replication origin requires a single plasmid replication protein π that binds to multiple repeat "iteron" sites (seven core repeats containing the TGAGNG consensus) as replication initiation monomers, and to the repression site (TGAGNG) and a reduced-affinity iterone as replication inhibitory dimers. Replication requires multiple host factors, including IHF, DnaA, and primosome assembly proteins DnaB, DnaC, and DnaG (Abhyankar et al., 2003 J Biol Chem 278:45476-45484). The R6K core origin contains DnaA and IHF binding sites that affect plasmid replication, as π, IHF, and DnaA interact to initiate replication.

[0212] Different versions of the R6Kγ replication origin have been utilized in various eukaryotic expression vectors, such as the pCOR vector (Soubrier et al., 1999, Gene Therapy 6:1482-88), the pCpGfree vector (Invivogen, San Diego CA), and the CpG-free version in pGM169 (University of Oxford). Six highly minimized iteron-R6Kgamma-derived replication origins containing the core sequence necessary for replication (including the DnaA box and stb1-3 sites; Wu et al., 1995, J Bacteriol 177:6338-6345), with the upstream π-dimer repressor binding site and downstream π-promoter deleted (by removing one copy of iteron), are described in WO2014 / 035457 and are incorporated herein by reference (SEQ ID NO: 1 from WO2019 / 183248 (SEQ ID NO: 43)). This R6K origin contains six tandem direct repeat iterones. The NTC9385R Nanoplasmid™ vector, containing this minimized R6K origin and an RNA-OUT AF (antibiotic-free) selectable marker in the spacer region, is described in WO2014 / 035457 and is incorporated herein by reference. R6K origins containing seven tandem direct repeat iterones and R6K origins containing six tandem direct repeat iterones and a single CpG residue are described in WO2019 / 183248 and are incorporated herein by reference. The use of conditional replication origins such as R6Kγ, which require cell lines specialized for propagation, adds a safety margin because the vector will not replicate if it migrates to the patient's endogenous microbiota.

[0213] Typical R6K-producing strains express the π protein derivative PIR116 containing the P106L substitution that increases copy number from the genome (by reducing π dimerization; the π monomer is activating while the π dimer is inhibitory). Fermentation results with pCOR (Soubrier et al. (supra) 1999) and pCpG plasmids (Hebei HL, Cai Y, Davies LA, Hyde SC, Pringle IA, Gill DR. 2008. Mol Ther 16:S110) were low, at about 100 mg / L in the PIR116 cell line.

[0214] Mutagenesis of the pir-116 replication protein and selection for increased copy number have been used to generate new producing strains. For example, the TEX2pir42 strain contains the combination of P106L and P42L. The P42L mutation prevents DNA loop replication inhibition. The TEX2pir42 cell line improved copy number and fermentation yield with the pCOR plasmid reported at a yield of 205 mg / L (see Soubrier F. 2004. International Patent Application No. W02004 / 033664).

[0215] Other combinations of π copy number variants that improve copy number include "P42L and P113S" and "P42L, P106L and F107S" (Abhyankar et al., 2004. J Biol Chem 279:6711-6719).

[0216] WO2014 / 035457 describes host strains that express a phage HK022 binding site integrated pL promoter heat-inducible πP42L, P106L and F107S high copy variant replication (Rep) protein for the selection and propagation of R6K origin Nanoplasmid™ vectors.

[0217] The propagation and fermentation of the RNA-OUT selectable marker - R6K plasmid described in WO2014 / 035457 was in the DH5α host strain NTC711772 = DH5α dcm-att λ ::Pc -RNA-IN-SacB, catR; att HK022 ::pL(OL1-G to T)P42L-P106L-F107S(P3-), SpecR StrepR, etc. were carried out using heat-inducible "P42L, P106L and F107S" pi-copy number mutant cell lines. A production yield of up to 695 mg / L was reported.

[0218] A further "copy cutter" host cell line with the R6K origin was created and disclosed in Williams 2019 VIRAL AND NON-VIRAL NANOPLASMID VECTORS WITH IMPROVED PRODUCTION International Patent Application No. WO2019 / 183248, which is NTC1050811 DH5α att λ ::P c -RNA-IN-SacB, catR; att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-), SpecR StrepR; att φ80::pARA-CI857ts,tetR=pARA-CI857ts (a derivative of NTC940211). This “copy cutter” host strain contains a chromosomal integrated copy of the arabinose-inducible CI857ts gene at the phage φ80 attachment site. Addition of arabinose to the plate or culture medium (e.g., up to a final concentration of 0.2–0.4%) induces the expression of the pL promoter. This induces pARA-mediated CI857ts repressor expression, which reduces the copy number at 30°C through CI857ts-mediated downregulation of the Rep protein [i.e., additional CI857ts mediating a more effective downregulation of the pL(OL1-G~T) promoter at 30°C]. Copy number induction after a temperature shift to 37–42°C is not impaired because the CI857ts repressor is inactivated at these high temperatures. The dcm- derivative (NTC1050811 dcm-) is used when dcm methylation is undesirable. NTC1050811-HF is a derivative of the NTC1050811 cell line containing a second copy of the RNA-IN-SacB expression cassette and does not have mutations in sbcB, recB, recD, recJ, uvrC, mcrA, or mcrBC-hsd-mrr.

[0219] In each case, both strains (NTC1050811 and NTC1050811-HF) contain a phage φ80 attachment site chromosome-integrated copy of the arabinose-inducible CI857ts gene. Addition of arabinose to the plate or culture medium (e.g., up to a final concentration of 0.2–0.4%) induces the expression of the pL promoter. This induces pARA-mediated CI857ts repressor expression, which reduces the copy number at 30°C through CI857ts-mediated downregulation of the Rep protein [i.e., additional CI857ts mediating a more effective downregulation of the pL(OL1-G~T) promoter at 30°C]. Copy number induction after a temperature shift to 37–42°C is not impaired because the CI857ts repressor is inactivated at these high temperatures. These “copy cutter host strains” increase the R6K vector temperature upshift copy number induction ratio by reducing the copy number at 30°C. This is advantageous for the production of large, toxic, or easily dimerizable R6K-based vectors.

[0220] Nanoplasmid® production yields are improved in the quadruple mutant heat-inducible pL(OL1-G to T)P42L-P106I-F107S P113S(P3-) described in WO2019 / 183248 compared to the triple mutant heat-inducible pL(OL1-G to T)P42L-P106L-F107S(P3-) described in WO2014 / 035457. Yields exceeding 2 g / L of Nanoplasmid® have been obtained in the quadruple mutant NTC1050811 cell line (WO2019 / 183248).

[0221] The use of conditional origins of replication, such as R6K origins, which require cell lines specifically designed for propagation, adds a safety margin because the vector will not replicate if it migrates to the patient's endogenous microbiome.

[0222] The RNA-OUT-producing host described in WO2019 / 183248 has been modified to create an HF host. SacB (Bacillus subtilis levans sucrase) is a reverse-selectable marker that is lethal to E. coli cells in the presence of sucrose. Translation of SacB from the RNA-IN-SacB transcript is inhibited by plasmid-coding RNA-OUT. This promotes plasmid selection by inhibiting SacB-mediated lethality in the presence of sucrose. Mutations in the chromosomal copy of the RNA-IN-SacB expression cassette that eliminate SacB expression are sucrose-resistant (in the absence of the plasmid). The presence of a second copy of the RNA-IN-SacB expression cassette dramatically reduces the number of sucrose-resistant colonies (in the absence of the plasmid), as each individual RNA-IN-SacB expression cassette copy mediates sucrose lethality in the absence of the plasmid, and both RNA-IN-SacB expression cassette chromosomal copies mediate sucrose lethality in the absence of very rare mutations in the plasmid.

[0223] NTC1011592 Stbl4 attk::P c -RNA-IN-SacB,catR(WO2019 / 183248) was also used.

[0224] The following examples include unmodified production strains: DH5α, Sure2, Stbl2, Stbl3, or Stbl4.

[0225] Example 1: Preparation of SbcCD knockout strain SbcCD knockout strains were generated using Red Gam recombinant cloning, as described in Datsenko and Wanner, PNAS USA 97:6640-6645 (2000). The pKD4 plasmid (Datsenko and Wanner, 2000) was PCR amplified with the following primers to introduce SbcC and SbcD targeting the homology arm. Sequence ID 1 (SbccR-pKD4): CCCTCTGTATTCATTATCCTGCTGAATAGTTATTTCACTGCAAACGTACTCATATGAATATCCTCCTTAG Sequence ID 2 (SbcdF-pKD4): TCTGTTTGGGTATAATCGCGCCCATGCTTTTTCGCCAGGGAACCGTTATGTGTAGGCTGGAGCTGCTTCG

[0226] 1.6kb PCR product (SEQ ID NO: 5,

[0227] TIFF0007833134000007.tif131165) (Figure 1A) was purified, and DpnI was digested (to eliminate the template plasmid). Host lines in which the SbcCD gene was knocked out were transformed with the pKD46-RecApa recombinant plasmid (WO2008 / 153731, the whole plasmid is incorporated herein by reference) and transformants selected for ampicillin resistance. Electrocompetent cells of the transformed cell lines were given an OD of approximately 0.05. 600 Cells were prepared by growth in LB medium containing 50 μg / mL ampicillin, recombinant gene expression was induced by adding 0.2% arabinose, and the cells were grown to an intermediate logarithmic phase. Electrocompetent cells were then prepared by centrifugation and resuspension in 10% glycerol at 1 / 200 of the original volume. 5 μL of DpnI digestion-purified PCR product was electroporated into 25 μL of electrocompetent cells, followed by the addition of 1 mL of SOC medium. The cells were grown at 30°C for 2 hours, plated on LB agar plates containing 20 μg kanamycin, and grown overnight at 37°C. Individual kanR colonies were screened for ΔSbcDC::kanR using SbcDF and SbcCR primers as described below. Sequence ID 3 (SbcDF primer): cgtctcgccatgatttgccctg Sequence ID 4 (SbcCR primer): cgttatgcgccagctccgtgag Host: Products of SbcDF and SbcCR primers = 4.8kb (Figure 1B) (SEQ ID NO: 6)

[0228] TIFF0007833134000008.tif102149

[0229] TIFF0007833134000009.tif219149

[0230] TIFF0007833134000010.tif168149) Host ΔSbcDC::kanR:SbcDF and SbcCR primer products = 1.9kb (Figure 1C) (SEQ ID NO: 7)

[0231] TIFF0007833134000011.tif36150

[0232] TIFF0007833134000012.tif138150)

[0233] The temperature-sensitive pKD46-recApa plasmid was cured from cell lines by growing it at 37–42°C. Ampicillin sensitivity of individual kanR colonies was also examined.

[0234] For host strains of antibiotic resistance plasmids (e.g., pUC replication origin; antibiotic selection; R6K replication origin; antibiotic selection), as described, the kanR chromosomal marker was removed from ΔSbcDC::kanR using FRT recombination (Datsenko and Wanner, (supra), 2000). Briefly, the ΔSbcDC::kanR cell strain was transformed with the pCP20 FRT plasmid (Datsenko and Wanner, (supra), 2000) and grown at 30°C, and the transformants were selected for ampicillin resistance. Individual colonies were streaked for single colonies on LB agar plates (without ampicillin) and grown at 43°C to cure the temperature-sensitive pCP20 plasmid. Single colonies on LB plates at 43°C were streaked onto LB amp and LB kan plates to verify the loss of the ampR pCP20 plasmid and kanR excision, respectively. Individual amp- and kan-sensitive colonies were screened for ΔSbcDC by PCR using SbcDF and SbcCR primers (Figure 1D). For the PCR products of the SbcDF and SbcCR primers, the size was 0.53 kb as shown in Figure 1D (SEQ ID NO: 8).

[0235] For DH5α, the starting strain had the following genotype: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k +)gal-phoA supE44 λ-thi-1 gyrA96 relA1. After knockout of SbcCD and excision of kanR, the knockout strain (DH5α[SbcCD-]) had the following genotype: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k +)gal-phoA supE44 λ-thi-1 gyrA96 relA1 ΔSbcDC.

[0236] As described in WO2014 / 035457, the heat-inducible R6K Rep protein cassette (att HK022 By incorporating ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR) into the host genome, an additional strain is produced from DH5α[SbcD-], yielding a new strain, DH5α R6K Rep[SbcCD-], which has the genotype:DH5α att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;ΔSbcDC is present. This strain can be used for plasmid production with an R6K bacterial origin.

[0237] R6K replication origins induced by RNA-OUT selection. Furthermore, the genotype DH5α att disclosed in WO2019 / 183248. λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80 NTC1050811, which has pARA-CI857ts,tetR, was treated in the same way as SbcDC knockout, but without kanR resection, DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80We obtained NTC1300441 (DH5αΔSbcDC) having the genotype ::pARA-CI857ts,tetR ΔSbcDC::kanR (SbcCD knockout copy cutter host strain derivative). NTC1050811-HF, a derivative of NTC1050811 containing a second copy of the RNA-IN-SacB expression cassette without mutations in sbcB, recB, recD, recJ, uvrC, and mcrA, was also used by the same method to generate a knockout strain, obtaining NTC1050811-HF[SbcCD-] which does not excise kanR.

[0238] pUC replication origins were determined by RNA-OUT selection. Furthermore, using NTC4862-HF, a derivative of NTC4862 disclosed in WO2008 / 153733 that contains a second copy of the RNA-IN-SacB expression cassette and has no mutations in sbcB, recB, recD, recJ, uvrC, and mcrA, a knockout strain was generated by the same method to obtain NTC4862-HF[SbcCD-] which does not excise kanR.

[0239] Example 2: Performance of SbcCD knockout strains using large palindromic vectors The performance of SbcCD knockout strains was evaluated using large palindromic vectors, including assessment of shaking flasks and HyperGRO production.

[0240] NTC1011641 (Genotype: Stbl4 att) λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL P42L-P106L-F107S(P3-)SpecR StrepR (disclosed in WO2019 / 183248) and NTC1300441 (genotype: DH5α att λ ::P c -RNA-IN-SacB,catR;att HK022 ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;att φ80::pARA-CI857ts,tetR ΔSbcDC::kanR) was transformed with the AAV vector pAAV-GFP Nanoplasmid® (pAAV-GFP NP), which includes a spacer region containing a palindromic AAV ITR and a pAAV-GFP mini-intron plasmid (pAAV-GFP MIP), as well as an intronic R6K bacterial origin and RNA-OUT selection, and 140 base pair reverse repeats with a 4 base pair intervening sequence.

[0241] Lu J, Williams JA, Luke J, Zhang F, Chu K, and Kay MA. 2017. Human Gene Therapy 28:125-34 discloses antibiotic-free miniintron plasmid (MIP) AAV vectors, suggesting that MIP intron AAV vectors can be modified to produce shorter AAV vectors by removing the vector skeleton. Attempts to create mini-circle-like spacer regions in miniintron plasmid AAV vectors with an intron R6K origin and an RNA-OUT selection marker (intron nanoplasmid vector) were presumed to be toxic due to the creation of long 140 bp reverse repeats by such close juxtaposition of AAV ITRs (e.g., pAAV-GFP MIP; see Table 2). In contrast, pAAV-GFP MIP was recoverable in the DH5α ΔSbcDC host strain and exhibited excellent shaking flask production yields (see Table 2). Each AAV ITR contained a 26 bp palindromic sequence separated at 43 bp. [Table 2]

[0242] This recovery of viability in the DH5α ΔSbcDC host strain is not limited to Nanoplasmid® vectors. This is demonstrated by the robust proliferation and HyperGRO plasmid production of a pUC-originating kanR-selective AAV helper plasmid containing an 85 bp reverse repeat with a 17 base pair intercalation sequence in DH5α ΔSbcDC, but not in DH5α (Table 3). [Table 3]

[0243] Example 3: Performance of SbcCD knockout strain using AAV ITR vector: ITR stability and shaking flask production The application of DH5α ΔSbcDC host lines to stabilize AAV ITR-containing vectors was evaluated by next-generation sequence verification of AAV vector-transformed cell lines and production lots.

[0244] AAV ITR allows for accurate sequencing using next-generation sequencing, compared to conventional sequencing (Doherty et al., (above), 1993) (Saveliev A Liu J, Li M, Hirata L, Latshaw C, Zhang J, Wilson JM. 2018. Accurate and rapid sequence analysis of Adeno-Associated virus plasmid by Illumina Next Generation Sequencing. Hum Gene Ther Methods 29:201-211).

[0245] To evaluate the DH5α ΔSbcDC host strain and stabilize AAV ITR, nine different AAV ITR nanoplasmid vectors ranging from 2.4 to 5.4 kb were transformed into NTC1050811-HF[SbcCD-]. Individual colonies were screened for intact ITR by Small digestion, and a single correct clone was then submitted to the Mass General Hospital (MGH) CCIB DNA Core (Cambridge MA) for complete plasmid sequencing by next-generation sequencing. The results are summarized in Table 4 below, showing ITR stability during transformation (25 / 26 colonies screened correct by Small digestion; 9 / 10 of these (one from each of the nine nanoplasmid vectors) were demonstrated to be correct by complete plasmid sequencing). ITR stability was maintained during preparation in a shaking flask (5 / 5 preparations correct by complete plasmid sequencing). This demonstrates that the DH5α ΔSbcDC host strain stabilizes AAV ITR during transformation and production. [Table 4]

[0246] Next, we evaluated the application of DH5α ΔSbcDC host strains to improve AAV ITR-containing vector production using standardized GFP AAV2 EGFP transgene vectors with different bacterial skeletons. pUC-initiated antibiotic-selective AAV vectors (Table 5); pUC-starting RNA-OUT selective AAV vector (Table 6); or R6K-starting RNA-OUT selective AAV nanoplasmid vector (Table 7) [Table 5] [Table 6] [Table 7]

[0247] An additional panel of three larger 4.8–5.2 kb AAV nanoplasmid vectors was evaluated in Stbl4 compared to the DH5α SbcCD NP host (Table 8). Dramatic improvements in yield and quality were observed using the DH5α SbcCD host. [Table 8]

[0248] Summary: DH5α SbCD hosts showed improved plasmid production and / or plasmid quality compared to Stbl4 hosts with AAV ITR vectors, particularly compared to Stbl4 hosts with larger therapeutic transgenes encoding AAV ITR vectors (Table 8).

[0249] Example 4: Performance of SbcCD knockout strain using AAV ITR vector: HyperGRO fermentation Next, the improvement in AAV ITR-containing vector production by applying the DH5α ΔSbcDC host strain was evaluated in HyperGRO fermentation using a 3.3kb AAV2 EGFP transgene R6K origin-RNA-OUT marker Nanoplasmid vector pAAV-GFP Nanoplasmid (evaluated in the shaking flask of Example 3) in the DH5α ΔSbcDC Nanoplasmid host compared to the Stbl4 Nanoplasmid host, and a 12kb pUC origin-kanR AAV vector in DH5α ΔSbcDC compared to stbl3. The results are summarized in Tables 9 and 10. [Table 9] [Table 10]

[0250] Summary: The DH5α SbcCD host showed improved plasmid production and / or plasmid quality compared to Stbl3 or Stbl4 hosts with the AAV ITR vector, particularly compared to Stbl3 or Stbl4 hosts with larger therapeutic transgenes encoding the AAV ITR vector (Table 10).

[0251] Example 5: Performance of SbcCD knockout strains using non-palindromic vectors DH5α[SbcCD-] was evaluated in comparison to DH5α in terms of the production yield of a standard vector (12kb pHelper vector, pUC origin-kanR selected). The results showed that DH5α[SbcCD-] was superior to DH5α in terms of the production of a standard plasmid. [Table 11]

[0252] This was unexpected, as while SbcCD knockout can stabilize the palindrom, it is not expected to improve the yield of standard plasmids that do not contain the palindrom.

[0253] Example 6: Improved plasmid poly(A) repeat stability in DH5α TSbcD-1 compared to Stbl4. The pUC-AmpR plasmid vector encoding A90 repeats was transformed into Stbl4 or DH5α[SbcCD-], and the stability of the A90 repeats in four individual colonies from each transformation was determined by sequencing. All four Stbl4 colonies were deleting at least 20 bps of A90 repeats (i.e., all four colonies were<A70)であったが、DH5α[SbcCD-]コロニーは、> The result was A70, with 2 / 4 having intact A90 repeats. This demonstrates that DH5α[SbcCD-] stabilizes simple sequence repeats compared to stabilizing hosts in the art. This was unexpected, as SbcCD knockout is not expected to stabilize simple repeats.

[0254] Plasmid vectors encoding A117 repeats were transformed into DH5α[SbcCD-] and NTC1050811-HF[SbcCD-], and the stability of the A117 repeats was determined by sequencing. Cells were cultured at 30°C for 12 hours, ramped to 37°C at 24 EFT until OD decreased or lysis was observed, and then held at 25°C under HyperGro conditions as in Example 4. All transformed cell lines (2DH5α[SbcCD-], 2NTC1050811-HF[SbcCD-]) had intact A117 repeats and high yields, as shown in Table 12 below. This was unexpected, as SbcCD knockout is not expected to stabilize simple repeats. [Table 12]

[0255] The same procedure was used for plasmid vectors encoding A98-100 and A99-100 repeats, with DH5α[SbcCD-], NTC4862-HF[SbcCD-], and NTC1050811-HF[SbcCD-]. All transformed cell lines had intact repeats. All transformed cell lines had intact repeats and high yields. This was unexpected, as SbcCD knockouts are not expected to stabilize simple repeats. [Table 13]

[0256] Example 7: Cell line The above-described examples may be repeated using DH1, JM107, JM108, JM109, MG1655, XL1Blue and similar cell lines, or using SURE, SURE2, Stbl2, Stbl3, Stbl4 and non-SbcC, SbcD and / or SbcCD knockout strains.

[0257] All references, including publications, patent applications, and patents, are incorporated herein by reference to the same extent that each reference is incorporated by reference, to the same extent that the whole is incorporated herein, as is indicated individually and specifically.

[0258] The terms “includes,” “have,” “contains,” and “contains” should be interpreted as open-ended terms (i.e., “includes but not limited to”) unless otherwise stated herein. The enumeration of value ranges herein is intended solely as a simplification of each individual value included within the range, unless otherwise indicated herein, and each individual value is incorporated herein as if it were individually enumerated herein. All methods described herein may be performed in any preferred order unless otherwise indicated herein or unless it is clearly inconsistent with the context. Any and all examples provided herein, or the use of exemplary language (e.g., “for example”), are intended solely to better illustrate the invention and not to limit the scope of the invention unless specifically requested otherwise. No language herein should be interpreted as indicating that any unclaimed element is essential to the practice of the invention.

[0259] Preferred embodiments of the Invention, including the best mode known to the inventors for carrying out the Invention, are described herein. Variations of these preferred embodiments may become apparent to those skilled in the art by reading the foregoing description. The inventors expect that such variations will be appropriately used by those skilled in the art, and they intend that the Invention may be carried out in ways other than those specifically described herein. Accordingly, the Invention includes all modifications and equivalents of the subject matter enumerated in the claims appended herein, as permitted by applicable law. Furthermore, unless otherwise indicated herein or unless it is clearly inconsistent with the context, any combination of the elements described above in all possible variations is encompassed by the Invention. (Note) [Note 1] Engineered Escherichia coli (E. coli) host cells, wherein the engineered E. coli host cells include a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, and the engineered E. coli host cells do not contain any engineered viability or yield reduction mutations in any of sbcB, recB, recD, and recJ. [Note 2] The manipulated E. coli host cells described in Appendix 1, wherein the manipulated E. coli host cells do not contain any manipulated mutations in any of sbcB, recB, recD, and recJ. [Note 3] The manipulated E. coli host cells described in Appendix 1, wherein the manipulated E. coli host cells do not contain any mutations in any of sbcB, recB, recD, and recJ. [Note 4] The manipulated E. coli host cells described in any one of the appendices 1 to 3, wherein the manipulated E. coli host does not contain or produce the SbcCD complex. [Note 5] The manipulated E. coli host cells described in any one of the appendices 1 to 3, wherein the manipulated E. coli host does not contain a functional SbcCD complex. [Note 6] The manipulated E. coli host cell according to any one of the appendices 1 to 3, wherein the manipulated E. coli host contains an SbcCD complex, and the SbcCD complex is non-functional. [Note 7] The gene knockout includes SbcC knockout in the modified E. coli host cells described in any one of the appendices 1 to 6. [Note 8] The gene knockout described above includes a knockout of SbcD in the modified E. coli host cells described in any one of the appendices 1 to 6. [Note 9] The gene knockout includes SbcC and SbcD knockouts in the modified E. coli host cells described in any one of the appendices 1 to 6. [Note 10] The manipulated E. coli host cells described in any one of the appendices 1 to 9, wherein the manipulated E. coli host cells are derived from a cell line selected from the group consisting of DH5α, DH1, JM107, JM108, JM109, MG1655, and XL1Blue. [Note 11] The manipulated E. coli host cells described in any one of the appendices 1 to 10, further comprising a genomic antibiotic resistance marker. [Note 12] The manipulated E. coli host cells as described in Appendix 11, wherein the genomic antibiotic resistance marker comprises a sequence having at least 90%, at least 95%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 23. [Note 13] The manipulated E. coli host cells as described in Appendix 11, wherein the genomic antibiotic resistance marker is kanR containing a sequence encoding a protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 36. [Note 14] The manipulated E. coli host cells described above are those that do not contain genomic antibiotic resistance markers, as described in any one of the appendices 1 to 10. [Note 15] The manipulated E. coli host cells described in any one of the appendices 1 to 14, further comprising Rep proteins suitable for culturing Rep protein-dependent plasmids. [Note 16] The manipulated E. coli host cell according to any one of the appendices 1 to 14, further comprising a genomic nucleic acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with a sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 29. [Note 17] The manipulated E. coli host cell according to any one of the appendices 1 to 14, further comprising a genomic nucleic acid sequence encoding a Rep protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 34, and SEQ ID NO: 35. [Note 18] The manipulated E. coli host cell according to any one of the appendices 1 to 14, further comprising a Rep protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 34, and SEQ ID NO: 35. [Note 19] A modified E. coli host cell as described in any one of the appendices 1 to 18, further comprising a genomic nucleic acid sequence encoding a temperature-sensitive lambda repressor. [Note 20] The modified E. coli host cells described in Appendix 19, wherein the temperature-sensitive lambda repressor is cITs857. [Note 21] The manipulated E. coli host cell as described in Appendix 19, wherein the genomic nucleic acid sequence encoding the temperature-sensitive lambda repressor has at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 24. [Note 22] The manipulated E. coli host cell as described in Appendix 19, wherein the genomic nucleic acid sequence encoding the temperature-sensitive lambda repressor encodes an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 37. [Note 23] The manipulated E. coli host cell according to Appendix 19, wherein the manipulated E. coli host cell comprises the temperature-sensitive lambda repressor, and the temperature-sensitive lambda repressor has an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 37. [Note 24] The modified E. coli host cell described in any one of the appendices 19 to 23, wherein the temperature-sensitive lambda repressor is a chromosomal integration copy of the phage φ80 binding site of the arabinose-inducible CITs857 gene. [Note 25] Manipulated E. coli host cells as described in any one of the appendices 1 to 24, further comprising a genomic nucleic acid sequence encoding a genome-expressed RNA-IN-regulated selectable marker. [Note 26] The manipulated E. coli host cell as described in Appendix 24, wherein the genomic nucleic acid sequence encoding the genome-expressed RNA-IN-regulated selectable marker comprises a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 25. [Note 27] The manipulated E. coli host cell as described in Appendix 24, wherein the genomic nucleic acid sequence encoding the RNA-IN-regulated selectable marker encodes a protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 38. [Note 28] The manipulated E. coli host cells as described in Appendix 24, wherein the RNA-IN-modulated selectable marker has at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 38. [Note 29] The following genotype: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k Manipulated E. coli host cells possessing +)gal-phoA supE44 λ-thi-1 gyrA96 relA1 ΔSbcDC::kanR. [Note 30] The following genotype: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(r k -,m k Engineered E. coli host cells possessing +)gal-phoA supE44 λ-thi-1 gyrA96 relA1 ΔSbcDC. [Note 31] The following genotype: DH5α att HK022 Manipulated E. coli host cells possessing ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;ΔSbcDC::kanR. [Note 32] The following genotype: DH5α att HK022 Engineered E. coli host cells possessing ::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;ΔSbcDC. [Note 33] Engineered E. coli host cells having the following genotypes: DH5α attλ::Pc-RNA-IN-SacB,catR;attHK022::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;attφ80::pARA-CI857ts Pc-RNA-IN-SacB,tetR;ΔSbcDC::kanR. [Note 34] Engineered E. coli host cells having the following genotypes: DH5α attλ::Pc-RNA-IN-SacB,catR;attHK022::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;attφ80::pARA-CI857ts Pc-RNA-IN-SacB,tetR;ΔSbcDC. [Note 35] Engineered E. coli host cells possessing the following genotypes: DH5α dcm-attλ::Pc-RNA-IN-SacB,catR;attHK022::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;attφ80::pARA-CI857ts Pc-RNA-IN-SacB,tetR;ΔSbcDC. [Note 36] Engineered E. coli host cells possessing the following genotypes: DH5α dcm-attλ::Pc-RNA-IN-SacB,catR;attHK022::pL(OL1-G to T)P42L-P106I-F107S P113S(P3-),SpecR StrepR;attφ80::pARA-CI857ts Pc-RNA-IN-SacB,tetR;ΔSbcDC::kanR. [Note 37] Engineered E. coli host cells possessing the following genotypes: DH5α attλ::Pc-RNA-IN-SacB,catR;attφ80::pARA-CI857ts Pc-RNA-IN-SacB,tetR;ΔSbcDC. [Note 38] Engineered E. coli host cells having the following genotypes: DH5α attλ::Pc-RNA-IN-SacB,catR;attφ80::pARA-CI857ts Pc-RNA-IN-SacB,tetR;ΔSbcDC::kanR. [Note 39] The manipulated E. coli host cells described in any one of the appendices 1 to 38, wherein the manipulated E. coli host cells do not contain any manipulated viability or yield reduction mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, or any combination thereof. [Note 40] The manipulated E. coli host cells described in Appendix 39, wherein the manipulated E. coli host cells do not contain any manipulated mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, or any combination thereof. [Note 41] The manipulated E. coli host cells described in Appendix 39, wherein the manipulated E. coli host cells do not contain any mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, or any combination thereof. [Note 42] An engineered E. coli host cell as described in any one of the appendices 1 to 41, wherein the sbcB gene contains a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11, the recB gene contains a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12, the recD gene contains a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 13, and the recJ gene contains a sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 65. [Note 43] An engineered E. coli host cell comprising a gene knockout of at least one gene selected from the group consisting of SbcC and SbcD, wherein the E. coli host cell is isogenic to the strain from which it is derived, and the strain from which the engineered E. coli host cell is derived is selected from the group consisting of DH5α, DH1, JM107, JM108, JM109MG1655 and XL1Blue. [Note 44] The manipulated E. coli host cell according to any one of the appendices 1 to 43, wherein the E. coli host cell is derived from a starting E. coli cell, the sbcC gene of the starting E. coli cell contains a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9, and the sbcD gene of the starting E. coli cell contains a sequence having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 10. [Note 45] Engineered E. coli host cells as described in any one of the appendices 1 to 44, further including the vector. [Note 46] The manipulated E. coli host cell described in Appendix 45, wherein the vector comprises a nucleic acid sequence having reverse repeats. [Note 47] The manipulated E. coli host cell described in Appendix 46, comprising an AAV ITR in which the reverse repeats include ttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggtc agtgagcgagcgagcgccagagagggagtggccaactccatcactaggggttcct and aggaacccctagtgatggagttggccactccctctgcgcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccg ggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa. [Note 48] The manipulated E. coli host cell according to Appendix 45, wherein the vector comprises a nucleic acid sequence having at least one direct repeat. [Note 49] The engineered E. coli host cell as described in Appendix 48, wherein the at least one direct repeat comprises a polyA, polyG, polyC, or polyT repeat of about 40 to about 150 consecutive nucleotides, about 60 to 120 consecutive nucleotides, or about 90 consecutive nucleotides. [Note 50] The manipulated E. coli host cell according to Appendix 45, wherein the vector comprises a nucleic acid sequence having at least one reverse repeat. [Note 51] The engineered E. coli host cell described in Appendix 45, wherein the vector comprises a nucleic acid sequence that does not contain palindromes, direct repeats, or reverse repeats. [Note 52] The vector is an AAV vector, and optionally, the AAV vector contains AAV ITR, wherein the manipulated E. coli host cell is one of the items described in any one of the appendices 45 to 51. [Note 53] The engineered E. coli host cell described in any one of the appendices 45 to 51, wherein the vector is a lentiviral vector, a lentiviral envelope vector, or a lentiviral packaging vector. [Note 54] The engineered E. coli host cell described in any one of the appendices 45 to 51, wherein the vector is a retroviral vector, a retroviral envelope vector, or a retroviral packaging vector. [Note 55] The manipulated E. coli host cell described in any one of the appendices 45 to 51, wherein the vector is an mRNA vector containing polyA repeats. [Note 56] The vector is a plasmid, and the cells are manipulated E. coli host cells as described in any one of the appendices 45-55. [Note 57] The vector further comprises an RNA-selectable marker in the manipulated E. coli host cells described in any one of the appendices 45 to 56. [Note 58] The manipulated E. coli host cells described in Appendix 57, wherein the RNA-selectable marker is RNA-OUT. [Note 59] The manipulated E. coli host cell as described in Appendix 58, wherein the RNA-OUT has at least 95%, at least 98%, at least 99%, or 100% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 47 and SEQ ID NOs: 49. [Note 60] The modified E. coli host cells described in Appendix 57, wherein the vector further comprises RNA-OUT antisense repressor RNA. [Note 61] The manipulated E. coli host cells as described in Appendix 60, wherein the RNA-OUT antisense repressor RNA has at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 48. [Note 62] The vector further comprises a bacterial origin of replication in an engineered E. coli host cell as described in any one of the appendices 45 to 61. [Note 63] The modified E. coli host cell described in Appendix 62, wherein the bacterial replication origin is selected from the group consisting of R6K, pUC, and ColE2. [Note 64] The manipulated E. coli host cell as described in Appendix 63, wherein the bacterial replication origin is selected from the group consisting of sequences having at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with sequences selected from the group consisting of SEQ ID NOs: 43, 44, 45, 46, 30, 31, 32, 33, and 22. [Note 65] The vector is a Rep protein-dependent plasmid, and the modified E. coli host cells are as described in any one of the appendices 45 to 64. [Note 66] The vector is a eukaryotic pUC-free minicircle expression vector, comprising (i) a eukaryotic region sequence encoding a gene of interest and having 5' and 3' ends, and (ii) a spacer region having less than 1000, preferably less than 500, base pairs in length, ligating the 5' and 3' ends of the eukaryotic region sequence and containing an R6K bacterial origin of replication and an RNA-selectable marker, as described in any one of Appendix 45 to 65 of the manipulated E. coli host cell. [Note 67] The manipulated E. coli host cell according to any one of the appendices 45 to 65, wherein the vector is a covalently bound closed circular plasmid having a backbone less than 1000 bp, comprising a PolIII-dependent R6K replication origin and an RNA-OUT selectable marker, and an insert comprising a structured DNA sequence. [Note 68] The manipulated E. coli host cell described in Appendix 67, wherein the structured DNA sequence is selected from the group consisting of inverted repetitive sequences, direct repetitive sequences, homopolymerized repetitive sequences, eukaryotic origins of replication, and eukaryotic promoter-enhancer sequences. [Note 69] The modified E. coli host cell described in Appendix 67, wherein the structured DNA sequence is selected from the group consisting of poly(A) repeats, SV40 origin of replication, viral LTRs, lentiviral LTRs, retroviral LTRs, transposon IR / DR repeats, Sleeping Beauty transposon IR / DR repeats, AAV ITRs, CMV enhancers, and SV40 enhancers. [Note 70] The manipulated E. coli host cell according to any one of the appendices 67 to 69, wherein the PolIII-dependent R6K replication origin has at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with a sequence selected from the group consisting of SEQ ID NOs. 43, SEQ ID NOs. 44, SEQ ID NOs. 45, SEQ ID NOs. 46, and SEQ ID NOs. [Note 71] The manipulated E. coli host cell according to any one of the appendices 67 to 70, wherein the RNA-OUT selectable marker is an RNA-IN regulated RNA-OUT functional variant having at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 47 or SEQ ID NO: 49. [Note 72] The manipulated E. coli host cell according to any one of the appendices 67 to 70, wherein the RNA-OUT antisense repressor RNA may have a sequence that has at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 48. [Note 73] A method for producing manipulated Escherichia coli (E. coli) cells, A method comprising obtaining the manipulated E. coli cells by knocking out at least one gene selected from the group consisting of SbcC and SbcD in starting E. coli cells, in which none of sbcB, recB, recD, and recJ contain the manipulated survival or yield reduction mutation. [Note 74] The method according to Appendix 73, wherein the starting E. coli cells do not contain any manipulated mutations in any of sbcB, recB, recD, and recJ. [Note 75] The method according to Appendix 74, wherein the starting E. coli cells do not contain any mutations in sbcB, recB, recD, and recJ. [Note 76] The method according to any one of the appendices 73 to 75, wherein the step of knocking out at least one gene does not result in any mutation in any of sbcB, recB, recD, and recJ in the manipulated E. coli cells. [Note 77] The method according to any one of the appendices 73 to 76, wherein the starting E. coli cells are free from manipulated viability or yield reduction mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. [Note 78] The method according to Appendix 77, wherein the starting E. coli cells do not contain any manipulated mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, or any combination thereof. [Note 79] The method according to Appendix 78, wherein the starting E. coli cells do not contain any mutations in at least one of uvrC, mcrA, mcrBC-hsd-mrr, or any combination thereof. [Note 80] The method according to any one of the appendices 73 to 79, wherein the step of knocking out at least one gene does not result in any mutation in at least one of uvrC, mcrA, mcrBC-hsd-mrr, and combinations thereof. [Note 81] A method for improved vector production, The process involves transfecting manipulated Escherichia coli (E. coli) host cells with a vector to obtain transfected host cells, and This includes incubating the transfected host cells under conditions sufficient to replicate the vector, A method wherein the manipulated E. coli host cells contain a gene knockout of at least one gene selected from the group consisting of SbcC, SbcD, and SbcCD, and the host cells do not contain any viability or yield reduction mutations in any of sbcB, recB, recD, and recJ. [Note 82] The method according to Appendix 81, wherein the manipulated E. coli cells are the manipulated E. coli cells described in any one of Appendix 1 to 44. [Note 83] After incubating the transfected host cells under conditions sufficient to replicate the manipulated vector, The method according to Appendix 81 or 82, further comprising isolating the vector from the manipulated E. coli cells. [Note 84] The method according to any one of the appendices 81 to 83, wherein the step of incubating the transfected host cells under conditions sufficient to replicate the manipulated vector is carried out by fed-batch fermentation, wherein the fed-batch fermentation is carried out by increasing the temperature to a lower temperature during the first part of the fed-batch phase and then to a higher temperature during the second part of the fed-batch phase to grow the manipulated E. coli cells. [Note 85] The method according to Appendix 84, wherein the reduced temperature is approximately 30°C. [Note 86] The method described in Appendix 84 or 85, wherein the higher temperature is approximately 37-42°C. [Note 87] The method described in any one of the appendices 84 to 86, wherein the first part is approximately 12 hours. [Note 88] The method described in any one of the appendices 84 to 87, wherein the second portion is approximately 8 hours. [Note 89] The method according to any one of the appendices 84 to 88, wherein the plasmid yield after incubation of the transfected host cells under conditions sufficient to replicate the manipulated vector is higher than that of the cell line from which the manipulated E. coli cells were treated under the same conditions. [Note 90] The method according to any one of the appendices 84 to 89, wherein the plasmid yield after incubation of the transfected host cells under conditions sufficient to replicate the manipulated vector is higher than that of SURE2, SURE Stbl2, Stbl3, or Stbl4 cells treated under the same conditions. [Note 91] A method for improved vector production, To provide transfected host cells containing a gene knockout of at least one gene selected from the group consisting of SbcC, SbcD, and SbcCD, wherein the transfected host cells do not contain any viability or yield reduction mutations in sbcB, recB, recD, and recJ, and the transfected host cells are engineered Escherichia coli (E. coli) host cells containing a vector. A method comprising incubating the transfected host cells under conditions sufficient to replicate the vector. [Note 92] The method according to Appendix 91, wherein the transfected, manipulated E. coli host cells are the manipulated E. coli host cells described in any one of Appendix 45 to 72. [Note 93] After incubating the transfected host cells under conditions sufficient to replicate the vector, The method according to Appendix 91 or 92, further comprising isolating the vector from the transfected host cells. [Note 94] The method according to any one of the appendices 91 to 93, wherein the step of incubating the transfected host cells under conditions sufficient to replicate the manipulated vector is carried out by fed-batch fermentation, wherein the fed-batch fermentation is carried out by increasing the temperature to a lower temperature during the first part of the fed-batch phase and then to a higher temperature during the second part of the fed-batch phase to grow the manipulated E. coli cells. [Note 95] The method according to Appendix 94, wherein the reduced temperature is approximately 30°C. [Note 96] The method according to any one of the appendices 91 to 95, wherein the temperature higher than the above is approximately 37 to 42°C. [Note 97] The method according to any one of the appendices 91 to 96, wherein the first part is approximately 12 hours. [Note 98] The method described in any one of the appendices 91 to 97, wherein the second portion is approximately 8 hours. [Note 99] The method according to any one of the appendices 91 to 98, wherein the plasmid yield after incubation of the transfected host cells under conditions sufficient to replicate the manipulated vector is higher than that of the cell line from which the manipulated E. coli cells were treated under the same conditions. [Note 100] The method according to any one of the appendices 91 to 99, wherein the plasmid yield after incubation of the transfected host cells under conditions sufficient to replicate the manipulated vector is higher than that of SURE2, SURE, Stbl2, Stbl3, or Stbl4 cells treated under the same conditions.

Claims

1. A manipulated Escherichia coli (E. coli) host cell, The aforementioned manipulated E. coli host cells contain gene knockouts for SbcC and SbcD. The manipulated E. coli host cells are isogenic to the strain from which they are derived, and the strain from which they are derived is selected from the group consisting of DH5α, DH1, JM107, JM108, JM109, MG1655, and XL1Blue. The manipulated E. coli host cells contain the sbcB gene, recB gene, recD gene, recJ gene, uvrC gene, mcrA gene, and mcrBC-hsd-mrr gene, and none of sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr have the manipulated survival or yield reduction mutations, the sbcB gene contains a sequence having at least 90% sequence identity with SEQ ID NO: 11, the recB gene contains a sequence having at least 90% sequence identity with SEQ ID NO: 12, the recD gene contains a sequence having at least 90% sequence identity with SEQ ID NO: 13, and the recJ gene contains a sequence having at least 90% sequence identity with SEQ ID NO:

65. The manipulated E. coli host cell further comprises a genomic nucleic acid sequence encoding a Rep protein, wherein the Rep protein comprises an amino acid sequence having at least 90% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 39, 40, 41, 42, 34, and 35, The manipulated E. coli host cells further contain a genomic nucleic acid sequence encoding a temperature-sensitive lambda repressor. The aforementioned manipulated E. coli host cells.

2. The manipulated E. coli host cell according to claim 1, wherein the temperature-sensitive lambda repressor is cITs857.

3. The manipulated E. coli host cell according to claim 1, wherein the temperature-sensitive lambda repressor comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

37.

4. The manipulated E. coli host cell according to claim 1, wherein the temperature-sensitive lambda repressor is a chromosomal integrated copy of the phage φ80 binding site of the arabinose-inducible CITs857 gene.

5. The manipulated E. coli host cell according to claim 1, further comprising a vector, wherein the vector comprises a nucleic acid sequence having reverse repeats, direct repeats, or palindromes.

6. The engineered E. coli host cell according to claim 1, further comprising a vector, wherein the vector is an AAV vector, a lentiviral vector, a retroviral vector, or an mRNA vector containing a polyA repeat.

7. The manipulated E. coli host cell according to claim 1, further comprising a plasmid vector.

8. The manipulated E. coli host cell according to claim 7, wherein the plasmid vector is a eukaryotic pUC-free minicircle expression vector comprising: (i) a eukaryotic region sequence encoding a gene of interest and having 5' and 3' ends; and (ii) a spacer region having less than 1000 in length, ligating the 5' and 3' ends of the eukaryotic region sequence and containing an R6K bacterial origin of replication and an RNA selectable marker.

9. The manipulated E. coli host cell according to claim 8, wherein the gene of interest comprises a structured DNA sequence selected from the group consisting of inverted repetition sequences, direct repetition sequences, homopolymer repetition sequences, eukaryotic origins of replication, polyA repeats, SV40 origins of replication, viral LTRs, lentiviral LTRs, retroviral LTRs, transposon IR / DR repeats, Sleeping Beauty transposon IR / DR repeats, and AAV ITRs.

10. A method for producing manipulated Escherichia coli (E. coli) cells, The process involves knocking out SbcC and SbcD in starting E. coli cells to obtain the manipulated E. coli cells. The aforementioned starting E. coli cells are isogenic to the strain from which they are derived, and the strain from which they are derived is selected from the group consisting of DH5α, DH1, JM107, JM108, JM109, MG1655, and XL1Blue, The starting E. coli cells contain the sbcB gene, recB gene, recD gene, recJ gene, uvrC gene, mcrA gene, and mcrBC-hsd-mrr gene, and none of the sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr genes in the manipulated E. coli cells are affected by the mutations that reduce viability or yield. The aforementioned method.

11. A method for improved vector production, To provide manipulated Escherichia coli (E. coli) host cells, and here, The aforementioned manipulated E. coli host cells contain gene knockouts for SbcC and SbcD. The manipulated E. coli host cells are isogenic to the strain from which they are derived, and the strain from which they are derived is selected from the group consisting of DH5α, DH1, JM107, JM108, JM109, MG1655, and XL1Blue. The manipulated E. coli host cells contain the sbcB gene, recB gene, recD gene, recJ gene, uvrC gene, mcrA gene, and mcrBC-hsd-mrr gene, and none of the sbcB, recB, recD, recJ, uvrC, mcrA, and mcrBC-hsd-mrr genes in the manipulated E. coli cells have mutations that reduce viability or yield. The aforementioned manipulated E. coli host cells contain the vector. The manipulated E. coli host cells are incubated under conditions sufficient to replicate the vector, The method, including the method described above.

12. The method according to claim 11, wherein the step of incubating the E. coli host cells under conditions sufficient to replicate the vector is carried out by fed-batch fermentation, wherein the fed-batch fermentation is carried out by increasing the temperature to a first temperature of about 25°C to about 32°C during a first portion of the fed-batch phase, and then to a second temperature of about 37°C to about 42°C during a second portion of the fed-batch phase, thereby growing the operated E. coli host cells.

13. The modified E. coli host cell according to claim 1, further comprising a gene knockout of the dcm gene.

Citation Information

Patent Citations

  • A novel system for the regulation of gene expression

    JP2000517176A

  • plasmid dna fermentation process

    JP2008510460A

  • DNA plasmids with improved expression

    US20150191735A1

  • Identification of essential genes in microorganisms

    WO2002077183A2

  • Viral and non-viral nanoplasmid vectors with improved production

    WO2019183248A1