VA-RNA-producing cells with low levels

By inactivating the PKR activation sequence in AAV capsid protein host cells using modified promoters and introns, the challenges of scalability and robustness in AAV production are addressed, achieving stable and efficient AAV vector production without high VA RNA levels.

JP7834758B2Active Publication Date: 2026-03-24CEVEC PHARMA GMBH
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-12-20
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Current AAV-based production systems face limitations in scalability, reproducibility, and robustness, requiring transient transfection and helper viruses, which necessitate thorough purification and costly verification, and lack stable cell lines with high levels of VA RNA expression.

Method used

A host cell with an inactivated protein kinase R (PKR) activation sequence surrounding the start codon of the AAV capsid protein VP1, using a modified promoter and intron structure to maintain functional expression of VP1, VP2, and VP3, allowing for stable integration and low VA RNA expression.

Benefits of technology

Enables scalable, reproducible, and cost-effective production of AAV vectors without helper viruses, ensuring uniform product quality and large-scale batch production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007834758000005
    Figure 0007834758000005
  • Figure 0007834758000006
    Figure 0007834758000006
  • Figure 0007834758000007
    Figure 0007834758000007
Patent Text Reader

Abstract

The present invention relates to a host cell comprising a nucleic acid encoding an adeno-associated virus (AAV) capsid protein, wherein the protein kinase R (PKR) activation sequence surrounding the start codon of the AAV capsid protein VP1 is inactivated, while maintaining functional expression of the AAV capsid proteins VP1, VP2, and VP3.The present invention further relates to a method of producing an adeno-associated virus (AAV), comprising expressing the AAV in a host cell of the invention.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a host cell containing nucleic acid encoding an adeno-associated virus (AAV) capsid protein, wherein the protein kinase R (PKR) activation sequence surrounding the start codon of the AAV capsid protein VP1 is inactivated, while simultaneously maintaining the functional expression of AAV capsid proteins VP1, VP2, and VP3. The present invention further relates to a method for producing adeno-associated virus (AAV), comprising the step of expressing the AAV in the host cell of the present invention. [Background technology]

[0002] Adeno-associated viruses (AAVs) are small viruses that infect humans and some other primate species. They belong to the genus Dependoparvovirus, which in turn belongs to the family Parvoviridae. Adeno-associated viruses are small (20 nm) non-enveloped, replication-deficient viruses.

[0003] AAV is currently known to induce only a very mild immune response without causing any disease. Due to several further characteristics, AAV is an attractive candidate for creating viral vectors for gene therapy and for creating isogeneic human disease models. Gene therapy vectors using AAV can infect both dividing and quiescent cells and can persist extrachromosomally without being integrated into the host cell genome, whereas in natural viruses, the integration of the genes contained in the virus into the host genome occurs.

[0004] In recent years, the number of approved products and clinical trials of gene therapy based on AAV-derived vectors has been rapidly increasing. The advantages of AAV vectors in gene therapy include their excellent safety profile, non-pathogenicity as mentioned above, stable expression of the transgene, and the ability to transduce into both dividing and non-dividing cells.

[0005] Currently, recombinant AAV production requires numerous components. Recombinant virus production requires replicase (Rep) and capsid (Cap) proteins, which are typically encoded by the AAV genome and supplied in trans form. Helper genes can originate from different helper viruses, the most common being the adenovirus genes E1A, E1B, E2A, E4orf6, and VA RNA (virus-associated RNA). In addition, a transvestment vector containing the target gene (GOI) flanked by inverted terminal repeats (ITRs) is required.

[0006] Current AAV-based production systems primarily rely on the following technologies, but these have several drawbacks. Transient transfusion typically requires two or three plasmid systems (a transvestite containing the target gene; a pHelper with adenovirus helper function; and pAAV-Rep2CapX (CapX = capsid function for different AAV serotypes) supplying capsid and replicase functions). However, such technologies lack sufficient scalability, robustness, and reproducibility, and the plasmid DNA is expensive. So-called production cell lines, in which the target gene is already stably incorporated, are mainly based on HEK or HeLa cells. However, these cells require additional infection with a helper virus, such as an adenovirus. This addition of a helper virus in AAV production necessitates thorough purification of the produced AAV vector after the initial production of the corresponding helper virus to remove the helper virus from the final product, and requires costly verification of the helper virus's absence. The same applies to herpes simplex virus (HSV)-based and baculovirus-based systems, with the latter lacking sufficient scalability and robustness.

[0007] Creating a completely stable AAV-based producing cell line in which all the components necessary for AAV production are stably incorporated into the cell is hindered by various difficulties. Incorporating all helper functions into the cell is difficult. In CAP or HEK293 cells, E1A and E1B are already constitutively expressed. Helper functions E2A and E4orf6 are toxic to cells. However, these helper functions can be expressed from inducible promoters. Expression from inducible promoters is more difficult for non-coding VA RNAs in which their PolIII promoter is present within their own coding sequence. Therefore, there are currently no stable cell lines in which high levels of VA RNA expression have been demonstrated.

[0008] VA RNA is a non-coding RNA found in adenoviruses. It plays a role in regulating translation. Two copies of this RNA exist, designated VAI or VA RNAI and VAII or VA RNAII. These two VA RNA genes are distinct genes within the adenovirus genome. VA RNAI is the dominant species, while VA RNAII is expressed at low levels. VAI promotes the translation of both early and late adenovirus genes, including E3 and hexon. Transient translocation assays have shown that VAI increases the stability of ribosome-bound transcripts. Furthermore, VAI is processed intracellularly to produce 22-nucleotide RNAs that can act as siRNA or miRNAs. In addition, VAI functions as a decoy RNA for double-stranded RNA-activated protein kinase R, which would normally phosphorylate eukaryotic initiation factor 2 (eIF2).

[0009] In relation to AAV, VA RNA is important for high-titer AAV production. The most well-described function of VA RNA in AAV production is the phosphorylation / activation of PKR and the subsequent repression of eIF2α phosphorylation, which leads to a decrease in viral protein expression. eIF2α is a subunit of the trimer eukaryotic initiation factor 2 (eIF2), which regulates overall translation by binding to Met-tRNA and the 40S ribosome to form a pre-initiation complex. Phosphorylation of serine 51 inhibits the exchange of GDP bound to eIF2 to GTP by the guanine nucleotide exchange factor (GEF) eIF2B, thereby inhibiting protein synthesis. PKR has been shown to be activated by a short region of the leader sequence of the capsid gene RNA surrounding AUG in VP1. This sequence is part of the intron between the p40 promoter, which is integrated into the upstream rep gene, and the capsid gene. Inhibition of PKR activity is a common mechanism that occurs during infection with a number of different viruses, such as hepatitis C virus.

[0010] In this context, Non-Patent Literature 1 describes how important VA RNA is to capsid expression in the AAV infection cycle, specifically how much the capsid premRNA activates PKR, how much PKR phosphorylates eIF2α, and how this, in turn, leads to low expression of the capsid protein. Furthermore, the aforementioned document attempts to identify the PKR activation sequence through deletion experiments, narrowing it down to approximately 200 nucleotides around the AUG sequence of VP1.

[0011] In summary, current AAV-based production systems have limitations in terms of reproducibility, scalability, and robustness. Furthermore, the requirement for helper viruses necessitates thorough purification and costly verification of the absence of helper viruses. [Prior art documents] [Non-patent literature]

[0012] [Non-Patent Document 1] Nayak and Pintel (Nayak, R. and Pintel, DJ; Journal of Virology, 81(21); 2007; pp. 11908-11916) [Overview of the project] [Problems that the invention aims to solve]

[0013] Therefore, the technical problem underlying the present invention is to provide a scalable system for the stable production of AAV vectors that does not require transient translocation or helper viruses, thereby enabling the industrial and scalable production of AAV gene therapy vectors in the absence of high levels of VA RNA. [Means for solving the problem]

[0014] The above technical problems are solved by embodiments characterized by the claims.

[0015] In particular, in a first embodiment, the present invention relates to a host cell comprising a nucleic acid encoding an adeno-associated virus (AAV) capsid protein, wherein the protein kinase R (PKR) activating sequence surrounding the start codon of the AAV capsid protein VP1 is inactivated, while simultaneously maintaining the functional expression of AAV capsid proteins VP1, VP2, and VP3.

[0016] The AAV in this invention is not limited to a specific AAV serotype. Therefore, the AAV may be selected from adeno-associated virus serotype 1 (AAV1), AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, AAVDJ8, and AAVrh10. Furthermore, the AAV may be a synthetic serotype, for example, a hybrid of two or more different serotypes from the above, or one of the above serotypes having a significant mutation that alters the AAV serotype orientation. However, in certain embodiments, the AAV is AAV2, AAV5, AAV6, AAV8, or AAV9, preferably AAV8.

[0017] The AAV capsid protein comprises three capsid proteins, VP1, VP2, and VP3, which are spontaneously expressed from a single promoter named p40 and encoded by the cap gene. The molecular weights of these proteins are 87 kDa, 72 kDa, and 62 kDa, respectively. The AAV capsid consists of a mixture of VP1, VP2, and VP3 in a 1:1:10 ratio, with a total of 60 monomers arranged in icosahedral symmetry, and has an estimated size of 3.9 MDa.

[0018] All three VP proteins are translated from a single mRNA molecule. After synthesis, the premRNA can be spliced ​​in two different ways due to alternative splicing at two acceptor sites (Figure 1). Typically, especially in the presence of adenovirus, the second splice acceptor site is preferred, resulting in the so-called "major splice." In this mode, the initial AUG codon, which initiates VP1 protein synthesis, is removed, leading to a reduction in the overall level of VP1 protein synthesis. The initial AUG codon remaining in the major splice is the start codon for the VP3 protein. However, upstream of that codon within the same open reading frame, there is an ACG sequence (encoding threonine) surrounded by an optimal Kozak context. This results in a low level of VP2 protein synthesis, consisting of a VP3 protein with an additional N-terminal residue.

[0019] Because larger introns are preferentially excised by splicing and because the ACG codon is a very weak translation start signal in the major splice, the ratio of AAV structural proteins synthesized in vivo is about 1:1:10, which is the same as the ratio in mature virus particles.

[0020] In the pre-mRNA of the capsid protein, the short sequence surrounding the AUG of VP1 present in the intron transcribed by the p40 promoter activates PKR. Active PKR then phosphorylates eIF2α, where phosphorylated eIF2α then suppresses the expression of the capsid protein, and the whole system constitutes a negative regulatory feedback loop. VA RNA suppresses PKR, which explains the need for high levels of VA RNA when attempting to express large amounts of AAV.

[0021] Non-patent document 1 showed that the need for VA RNA can be eliminated by removing the sequence surrounding the first AUG. However, this also results in the loss of expression of the VP1 protein. Non-patent document 1 did not propose a solution for expressing all three capsid proteins in the correct ratio. Nor did they propose using this finding to create a stable cell line for AAV production without VA RNA.

[0022] To eliminate the need for high levels of VA RNA without abolishing the expression of VP1, advantageously, the present invention has found that by partially replacing the sequence encoding the intron of the capsid pre-mRNA, particularly by replacing the splice donor site and splice acceptor site 1 of the intron with introns of different origins, it is possible to maintain the functional expression of VP1, VP2, and VP3 while inactivating the PKR activation sequence surrounding the AUG of VP1. <000009​In a preferred embodiment, the PKR activation sequence is inactivated by replacing the p40, which is a natural AAV capsid protein promoter, with a different promoter and replacing a part of the p40 intron containing the splice donor site and splice acceptor site 1 outside the capsid coding sequence with an intron of a different origin. Preferably, the p40, which is a natural AAV capsid protein promoter, is replaced with a constitutive promoter or an inducible promoter, and the intron of the p40, which is a natural AAV capsid protein promoter, is partially replaced, that is, the outside of the capsid coding sequence is replaced with the SV40 intron that serves as an alternative to the splice donor site and splice acceptor site 1 (Figure 1). However, in addition to the SV40 intron, any intron that supplies appropriate splice donor and splice acceptor sites (the minimal consensus sequence GT / AG) can function as a replacement intron. Each intron, for example, a synthetic CAG promoter intron or a (human) β-globin intron, is known in the art.

[0024] In a preferred embodiment, each modified AAV capsid sequence is stably integrated into the host cell genome.

[0025] In a preferred embodiment, the host cell of the present invention further comprises a nucleic acid encoding an AAV replicase (Rep) protein under the control of a constitutive promoter or an inducible promoter.

[0026] In a more preferred embodiment, the host cell of the present invention further comprises a nucleic acid encoding adenovirus E1A and E1B proteins.

[0027] In this context, the E1A and E1B proteins are preferably constitutively expressed. Furthermore, suitable host cells for the present invention are not particularly limited and are known in the art. However, in preferred embodiments, the host cells exhibit constitutive expression of E1A and E1B. In preferred embodiments, the host cells are CAP cells, HEK293 cells, or Per.C6 cells, i.e., derived from the above cell lines, all of which are characterized by constitutive expression of E1A and E1B.

[0028] In a preferred embodiment, the host cell of the present invention further comprises nucleic acids encoding adenovirus E2A and E4orf6 proteins under the control of a constitutive promoter or an inducible promoter.

[0029] Furthermore, the host cell of the present invention preferably further comprises a nucleic acid encoding an introduction vector containing one or more target genes (GOIs), wherein the one or more target genes are preferably flanked by AAV inverted terminal repeat sequences (ITRs).

[0030] The GOIs used in the context of the present invention are not particularly limited and include, for example, eye diseases, blindness diseases, muscle diseases, Duchenne muscular dystrophy, GM2 gangliosidosis and spinocerebellar ataxia, ALS, Huntington's disease, X-linked severe combined immunodeficiency (X-SCID), adenosine deaminase deficiency (ADA-SCID), central nervous system diseases, Parkinson's disease, Alzheimer's disease, liver diseases, hepatic enzyme ornithine transcarbamylase (OTC) deficiency, Leber congenital amaurosis, hemophilia, β-saturated sarcoma This includes any gene whose transfer to the AAV vector is intended for the treatment of rare diseases, including raceemia, cancer, head and neck cancer, metastatic melanoma, heart disease, lung disease or cystic fibrosis, Wiscott-Aldrich syndrome (WAS), metachromatic leukodystrophy (MLD) and severe lipoprotein lipase deficiency (LPLD), infections, severe combined immunodeficiency syndrome, HIV infection, Niemann-Pick disease type C and ornithine transcarbamylase (OTC) deficiency.

[0031] The inductive promoters used in the context of the present invention are not particularly limited and are known in the art. However, in preferred embodiments, the inductive promoters controlling the expression of AAV capsid protein and / or AAV replicase protein and / or adenovirus E2A and E4orf6 proteins are tet-inductive promoters such as the third-generation TRE3G promoter. Other inductive promoters that may be used in the context of the present invention include cumate-inductive promoters, tamoxifen-inductive promoters, rapamycin-inductive promoters, FKCsA-inductive promoters, ABA-inductive promoters, riboswitch-controlled promoters, heat shock promoters, or photoswitchable systems. In this context, two or more or all of the above proteins may be expressed under the control of independent promoters of the same type.

[0032] In this context, in alternative embodiments, non-inducible promoters for constitutive expression may be used, as is known in the art. Examples of such promoters include the CMV, EF1α, SV40, RSV, UbC, CAG, BOS, and PGK promoters.

[0033] In a particular embodiment, the host cell of the present invention, The PKR activation sequence is inactivated by replacing the native AAV capsid protein promoter p40 with a different promoter, and by replacing a portion of the p40 intron, including the splice donor site and splice acceptor site 1 outside the capsid coding sequence, with an intron of a different origin. The natural AAV capsid protein promoter p40 is replaced with a constitutive or inducible promoter, preferably an inducible promoter, and the introns of the natural AAV capsid protein promoter p40 are partially replaced, i.e., the area outside the capsid coding sequence is replaced with introns that replace the splice donor site and splice acceptor site 1, preferably SV40 introns. Each nucleotide sequence from the inducible promoter to the start codon of the AAV capsid protein coding sequence is: Promoter-N1-Intron-N2-ATG (In the formula, The promoter is a constitutive promoter or an inducible promoter, preferably an inducible promoter. N1 is a sequence of 1 to 4000 nucleotides. An intron is an intron selected from a group consisting of introns that supply appropriate splice donor sites and splice acceptor sites having the minimal consensus sequence GT / AG. N2 is a sequence of 1 to 4000 nucleotides. ATG has the structure of the start codon of the AAV capsid protein coding sequence.

[0034] Preferably, in the above structure, the promoter is a constitutive promoter selected from the group consisting of CMV, EF1α, SV40, RSV, UbC, CAG, BOS, and PGK promoters, or an inductive promoter selected from the group consisting of a third-generation TRE3G promoter, a tet-inductive promoter, a cumate-inductive promoter, a tamoxifen-inductive promoter, a rapamycin-inductive promoter, a FKCsA-inductive promoter, an ABA-inductive promoter, a riboswitch-controlled promoter, and a heat shock promoter-driven system and a photoswitchable system, where an inductive promoter, particularly a tet-inductive promoter, is particularly preferred. Furthermore, in the above structure, the intron is preferably an intron selected from the group consisting of an SV40 intron, a synthetic CAG promoter intron, and a (human) β-globin intron. Furthermore, N1 and N2 are independently of each other, preferably a sequence of 1 to 3000 nucleotides, more preferably 1 to 2000 nucleotides, more preferably 1 to 1000 nucleotides, more preferably 1 to 500 nucleotides, and more preferably 1 to 300 nucleotides. In a further embodiment, N1 and N2 are independently of each other, preferably a sequence of 50 to 250 nucleotides or 100 to 200 nucleotides.

[0035] In a more specific embodiment, in the host cells of the present invention, The PKR activation sequence is inactivated by replacing the native AAV capsid protein promoter p40 with a different promoter, and by replacing a portion of the p40 intron, including the splice donor site and splice acceptor site 1 outside the capsid coding sequence, with an intron of a different origin. The native AAV capsid protein promoter p40 has been replaced with an inducible promoter, and the introns of the native AAV capsid protein promoter p40 have been partially replaced, that is, the area outside the capsid coding sequence has been replaced with SV40 introns that replace the splice donor site and splice acceptor site 1. Each nucleotide sequence from the inducible promoter to the start codon of the AAV capsid protein coding sequence is: (i) The nucleotide sequence described in SEQ ID NO: 4 or SEQ ID NO: 5, or (ii) A nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 5, provided that the above requirements apply to the nucleotide sequence. The last three nucleotides of SEQ ID NO: 4 or 5, ATG, are the start codon of the AAV capsid protein coding sequence.

[0036] As described above, nucleic acids having sequence identity with respect to the specific nucleotide sequence described above have at least 70% sequence identity with respect to that specific sequence. Preferably, the nucleotide sequence has at least 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.4%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity with respect to the nucleic acid described above. In a particular embodiment, such nucleic acid has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide deletions, insertions, and / or substitutions (exchanges).

[0037] Each nucleic acid having a predetermined sequence identity to the nucleic acids described above, or having a specific nucleotide deletion, insertion, and / or substitution to the nucleic acids described above, shall not include any nucleic acid having any type of frameshift mutation.

[0038] Furthermore, in the context of proteins encoded by nucleotide sequences having a certain sequence identity with respect to the specific nucleotide sequences mentioned above, the term "functional" as used above indicates that each protein has the same or at least sufficient activity or function as the protein encoded by the specific nucleotide sequence.

[0039] The nucleic acid contained in the host cell of the present invention may further include one or more elements selected from the group consisting of an inducible promoter, a poly(A) region, a selection marker, an IRES sequence, and an enhancement element. A suitable inducible promoter is not particularly limited and is known in the art, for example, a Tet inducible promoter such as the third-generation TRE3G promoter. A suitable poly(A) region is not particularly limited and is known in the art, for example, an SV40 poly(A) region. A suitable selection marker is not particularly limited and is known in the art, for example, an antibiotic resistance cassette such as a blastocydin or ampicillin resistance cassette.

[0040] Preferably, in the host cell of the present invention, the nucleic acid encoding the AAV capsid protein and / or the nucleic acid encoding the AAV replicase protein and / or the nucleic acid encoding the adenovirus E1A and E1B proteins and / or the nucleic acid encoding the adenovirus E2A and E4orf6 proteins and / or the nucleic acid encoding the introduction vector containing GOI is stably incorporated into the host cell genome.

[0041] Preferably, the host cells of the present invention do not express VA RNA or express only low levels of VA RNA, for example, the VA RNA expression level is reduced to at least one-tenth, preferably at least one-hundredth, and more preferably at least one-thousandth, compared to the VA RNA expression achieved by transient translocation.

[0042] The method for producing the host cells of the present invention, that is, the method for introducing the nucleic acid of the present invention into suitable host cells, is not particularly limited and is known in the art.

[0043] In a second embodiment, the present invention relates to a method for producing adeno-associated virus (AAV), comprising the step of expressing the AAV in a host cell according to the present invention.

[0044] In a third embodiment, the present invention relates to the use of host cells according to the present invention in the production of adeno-associated virus (AAV).

[0045] The means for producing AAV are not particularly limited and are known in the art.

[0046] Specifically, in a preferred embodiment, the method and use of the present invention include the step of (i) expressing the AAV capsid protein in a host cell of the present invention, wherein the protein kinase R (PKR) activating sequence surrounding the start codon of the AAV capsid protein VP1 is inactivated while the functional expression of AAV capsid proteins VP1, VP2, and VP3 is maintained. Preferably, the PKR activating sequence surrounding AUG of VP1 is inactivated by partially replacing an intron of the capsid's premRNA, particularly by replacing the splice donor site and splice acceptor site 1 of the intron with an intron of a different origin. In a preferred embodiment, the PKR activating sequence is inactivated by replacing the innate AAV capsid protein promoter p40 with a different promoter, and replacing a portion of the p40 intron, including the splice donor site and splice acceptor site 1 outside the capsid coding sequence, with an intron of a different origin. Preferably, the native AAV capsid protein promoter p40 is replaced with an inducible promoter, and / or the introns of the native AAV capsid protein promoter p40 are partially replaced, i.e., the area outside the capsid coding sequence is replaced with SV40 introns that replace the splice donor site and splice acceptor site 1 (Figure 1). However, in addition to the SV40 intron, any intron that provides a suitable splice donor site and splice acceptor site (the minimal consensus sequence GT / AG) may function as a replacement intron. Each of these introns is known in the art.

[0047] Preferably, the host cells used in the methods and applications of the present invention further have an introduction vector containing one or more GOIs flanked by AAV ITRs, which are stably incorporated into the host cell genome. Preferably, the host cells do not express VA RNA or express only low levels of VA RNA as described above during the process of the methods and applications of the present invention.

[0048] Specifically, in preferred embodiments, the method and use of the present invention involve adhering host cells to a serum-containing medium or serum-free medium in either a roller bottle, cell stack, or fixed-bed bioreactor, or suspending host cells in a stirred-tank bioreactor, WAVE, or bag culture system to produce the AAV particles described above. The scale of production can vary from small amounts in the milliliter range to medium-sized amounts and even large amounts of 2000 L or 20000 L per production run. The form of the process may be batch culture, meaning no additional feed material is added, or fed-batch culture with bolus or continuous addition of feed material.

[0049] To achieve maximum titer, process parameters such as viable cell density, temperature, stirring speed, rate, pH, and osmotic pressure may be modified during the production process. In addition, supplementing the cell culture with deficient components to avoid deficiencies in certain amino acids, sugars, organic acids, cofactors, vitamins, minerals, or other elements may be part of the production process.

[0050] The means for expressing each protein in the host cells of the present invention are not particularly limited and are known in the art. Examples of such means include induction of an inducible promoter by adding a suitable inducible factor.

[0051] All definitions and limitations defined in the first aspect of the present invention also apply to the second and third aspects of the present invention.

[0052] As used herein, the term “comprising” or “comprises” explicitly includes the terms “consisting essentially of” or “consists essentially of” and “consisting of” or “consists of,” meaning that all of the above terms are interchangeable.

[0053] In this invention, modification of the AAV capsid sequence makes it possible to create stable AAV-producing cell lines with very low VA RNA expression levels or no VA RNA expression at all. These stable AAV-producing cell lines must fully express replicase, helper, and capsid functions. Protein function can be made inducible under the control of an inducible promoter.

[0054] In particular, the present invention advantageously identifies a method for modifying a 200-nucleotide region containing a PKR activation sequence to simultaneously maintain the precise expression pattern of the VP protein, for example, by separating rep and cap and introducing different introns. Thus, the modified sequence can be used to enable stable cell lines expressing low levels of VA RNA to produce high-titer rAAV.

[0055] To avoid the need for high levels of VA RNA, the endogenous p40 promoter is replaced with a different promoter in a manner that maintains the correct ratio of VP proteins while simultaneously not activating PKR. The intron region containing the protein kinase R (PKR) activating sequence is replaced with other introns, such as SV40, β-globin, or chimeric introns, thus requiring less VA RNA, or no VA RNA at all, for high-level AAV vector production.

[0056] This has the advantage of enabling reproducible and uniform product quality, excellent scalability, cost-effective manufacturing, eliminating the need for helper viruses, and allowing for larger-scale batch production. [Brief explanation of the drawing]

[0057] [Figure 1]This is a schematic diagram of the capsid locus showing the p40 promoter region along with the p40 intron (SD: splice donor site, SA1: splice acceptor site 1, SA2: splice acceptor site 2). The top diagram shows the wild-type structure. The bottom diagram shows the modified version with the substituted sequence. In this case, SD and SA1 are provided by the SV40 intron, and the promoter can be a constitutive promoter such as CMV or an inducible promoter such as TRE3G. [Figure 2] This graph shows the VA RNA levels in CAP prepackaged stable cell line Z3081, which possesses stably integrated nucleic acids including VA RNA, compared to a transient method in which VA RNA encoded by plasmids was introduced via transient translocation. Cells with stably integrated VA RNA show up to a 3log decrease in VA RNA compared to the transient method. [Figure 3] This image shows the expression of the AAV8 capsid protein in CAP prepackaging stable SCCs (single-cell clones) after translocation using a capsid construct with a p40 promoter or a modified promoter with an SV40 intron (TRE3G / SV40 intron) in combination with an empty vector or additional VA RNA. Five hours after translocation, cells were treated with 1 mg / L doxycycline to induce the expression of rep, E2A, and E4orf6 proteins. Three days after translocation, protein levels in cell lysates of transiently translocated prepackaging cells were detected using an anti-VP1 / VP2 / VP3 antibody (Progen). [Figure 4]This image shows PKR activation and eIF2α phosphorylation in CAP prepackaged stable SCCs upon translocation using an AAV8 capsid construct with a p40 promoter or an AAV8 capsid construct with a modified TRE3G promoter containing an SV40 intron, in combination with an empty vector (eV) or additional VA RNA. Five hours after translocation, cells were treated with 1 mg / L doxycycline to induce the expression of stably incorporated replicases, E2A, and E4ORF6 proteins. Three days after translocation, protein levels in cell lysates of transiently translocated CAP prepackaged cells were detected using anti-VP1 / VP2 / VP3 antibody (Progen), anti-phosphorylated PKR antibody (Abcam), anti-eIF2α (Cell Signaling), and anti-histone H3 antibody (Abcam) as a loading control. Cell lysates of cells translocated with an empty vector were included as a control. [Figure 5] This graph shows the ELISA results for assembled capsids (AAV8). HEK293-based prepackaged single-cell clones were transfused with either a modified AAV8 capsid construct (TRE3G / SV40 intron) or an AAV8 p40 intron (AAV8 or AAV2) capsid construct (TRE3G / p40 intron), and an AAV GOI construct (GFP) flanked by ITRs. For the p40 intron construct, additional transfusion was performed in combination with a VA RNA construct. Five hours after transfusion, cells were induced with 1 mg / L doxycycline. Three days after transfusion, cell suspension samples were collected and analyzed for capsid expression using Progen's AAV8 capsid ELISA according to the manufacturer's instructions. This ELISA detected only fully assembled viral particles. High levels of assembled capsids (slightly less than 10¹² particles / mL) were detected in the TRE3G / SV40 intron construct in the absence of additional VA-RNA, but in the TRE3G / p40 intron construct, they were only detected upon simultaneous translocation of additional VA-RNA. [Figure 6]This graph shows the ELISA results for assembled capsids (AAV8). CAP-based prepackaged single-cell clones were transfused with either a modified AAV8 capsid construct (TRE3G / SV40 intron) or an AAV8 p40 intron (AAV8) capsid construct (TRE3G / p40 intron), and an AAV GOI construct (GFP) flanked by ITRs. For the p40 intron construct, additional transfusion was performed in combination with a VA RNA construct. Five hours after transfusion, cells were induced with 1 mg / L doxycycline. Three days after transfusion, cell suspension samples were collected and analyzed for capsid expression using Progen's AAV8 capsid ELISA according to the manufacturer's instructions. This ELISA detected only fully assembled viral particles. High levels of assembled capsids (slightly less than 10¹² particles / mL) were detected in the TRE3G / SV40 intron construct in the absence of additional VA-RNA, but in the TRE3G / p40 intron construct, they were only detected upon simultaneous translocation of additional VA-RNA. [Figure 7] This graph shows the qPCR analysis of rAAV8-GFP production in HEK293-based prepackaged SCCs using modified TRE3G / SV40 intron and TRE3G / p40 intron (AAV2 and AAV8) capsid constructs. HEK293-based prepackaged SCCs were transfected with either a modified capsid construct (TRE3G / SV40 intron) or a p40 intron (p40 intron derived from TRE3G / AAV8 or AAV2), and a GOI construct (GFP) sandwiched between AAV2 ITRs. For the p40 intron (TRE3G / p40 intron) capsid construct, two transfects were performed—one with VA-RNA and one without—to analyze the effect on VA-RNA production capacity. Five hours after translocation, the expression of stably incorporated replicase and helper functions was induced by 1 mg / L doxycycline. Three days after translocation, cell suspension samples were collected, and the packaged viral genome was analyzed by qPCR using primers / probes targeted to SV40 polyA. [Figure 8] This graph shows the qPCR analysis of rAAV8-GFP production in CAP-based prepackaged SCCs using modified TRE3G / SV40 intron and TRE3G / p40 intron (AAV8) capsid constructs. CAP-based prepackaged SCCs were transfused with either a modified capsid construct (TRE3G / SV40 intron) or a p40 intron (TRE3G / p40 intron) capsid construct, and a GOI construct (GFP) sandwiched between AAV2 ITRs. For the p40 intron (TRE3G / p40 intron) capsid construct, two transfusions were performed—one with VA-RNA and one without—to analyze the effect on VA-RNA production. Five hours after transfusion, the expression of stably incorporated replicase and helper functions was induced by 1 mg / L doxycycline. Three days after translocation, cell suspension samples were collected, and the packaged viral genome was analyzed by qPCR using primers / probes targeted to GFP. [Figure 9] This image shows the expression of AAV8 capsid protein in CAP-prepackaged stable SCCs using a modified CMV / SV40 intron construct. Prepackaged SCC #1 was transfused with a combination of a modified CMV / SV40 intron capsid construct and an transfused construct containing GFP as the GoI, and induced with doxycycline 5 hours after transfusion. Four days after transfusion, protein levels in the cell lysates (P=pellet) and supernatant (SN) of transiently transfused CAP-prepackaged cells were detected using anti-VP1 / VP2 / VP3 antibody (Progen). [Figure 10]This graph shows the ELISA results for assembled capsids (AAV8). Three different prepackaged CAP single-cell clones (SCC#1, SCC#2, SCC#3) were transfused with a modified AAV8 capsid construct (CMV / SV40 intron) and an AAV GOI construct (GFP) flanked by ITRs. Five hours after transfusion, the cells were induced with 1 mg / L doxycycline. Three days after transfusion, cell suspension samples were collected and capsid expression was analyzed using Progen's AAV8 capsid ELISA according to the manufacturer's instructions. This ELISA detected only fully assembled viral particles. High levels of assembled capsids exceeding 10¹¹ particles / mL were detected. [Figure 11] This graph shows the qPCR analysis of rAAV8-GFP production in prepackaged SCCs (SCC#1, SCC#2, SCC#3) using a modified CMV / SV40 intron capsid construct. Three different prepackaged SCCs were transfused with the modified capsid construct (CMV / SV40 intron) and the GOI construct (GFP) flanked by AAV2 ITRs. Five hours after transfusion, the expression of stably integrated replicase and helper functions was induced with 1 mg / L doxycycline. Three days after transfusion, cell suspension samples were collected, and the packaged viral genome was analyzed by qPCR using primers / probes targeted to SV40 poly(A). [Figure 12] This graph shows a transduction assay using material derived from prepackaged SCC#1. In summary, a cell suspension of transfused prepackaged SCC#1 was thawed by a freeze-thaw cycle and used for transduction of HEK293T cells. Transduction was monitored 48 hours after transduction by measuring GFP-positive HEK293T cells. [Figure 13]This image shows a Western blot illustrating doxycycline-induced capsid expression (AAV8) in cell lysates from stable packaging pool Z3189 containing a capsid construct with stably integrated inducible replicase, helper function, and a modified inducible promoter and SV40 intron. Despite very low levels of VA RNA in the packaging pool cells, capsid proteins are produced in the correct stoichiometric ratio of approximately 1:1:10 for VP1:VP2:VP3. [Figure 14] This graph shows the viral genome production of selected rAAV8-GFP-producing CAP single-cell clones. AAV production in rAAV8-GFP-producing CAP SCCs containing stably incorporated replicase, E2A, E4ORF6, VA RNA, a modified capsid construct (inducible promoter / SV40 intron), and GOI flanked by ITRs was induced by doxycycline addition. Seven days after induction, cell suspension samples were collected, and the packaged viral genome was analyzed by qPCR using primers / probes directed against SV40 polyA. [Figure 15] This graph shows the AAV8-ELISA analysis of selected rAAV8-GFP-producing CAP single-cell clones. AAV production was induced in rAAV8-GFP-producing CAP SCCs containing stably incorporated replicase, E2A, E4ORF6, VA RNA, a modified capsid construct, and GOI flanked by ITRs by the addition of doxycycline. Seven days after induction, cell suspension samples were collected, and the assembled capsids were analyzed using AAV8-ELISA (Progen) according to the manufacturer's instructions. [Modes for carrying out the invention]

[0058] The present invention relates to the following amino acid and nucleotide sequences: Sequence ID 1 SV40 Poly A Forward Primer AGCAATAGCATCACAAATTTCACAA Sequence ID 2 SV40 Poly A Reverse Primer CCAGACATGATAAGATACATTGATGAGTT Sequence ID 3 SV40 Poly-A probe AGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTC Sequence ID 4 TRE3G-SV40 Intron-Capsid ATG gagtttactccctatcagtgatagagaacgtatgaagagtttactccctatcagtgatagagaacgtatgcagactttactccctatcagtgatagagaacgtataaggagtttactccctatcagtgatagagaac gtatgaccagtttactccctatcagtgatagagaacgtatctacagtttactccctatcagtgatagagaacgtatatccagtttactccctatcagtgatagagaacgtataagctttaggcgtgtacggtgggcg cctataaaagcagagctcgtttagtgaaccgtcagatcgcctggagcaattccacaacacttttgtcttataccaactttccgtaccacttcctaccctcgtaaagactctagaggatccggtactcgaggaactga aaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacggaagtgttactt atg promoter Intron Start codon Sequence ID 5 CMV-SV40 Intron-Capsid ATG aattcgagcttgcatgcctgcaggtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttc ccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccc tattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattac catggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcac caaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtg aaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagaggatccggtactcgaggaactga aaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgccttta cttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccgcggccgcttaattaaatcgataccggtttcgaaacgcgtgataaatgccacc atg promoter Intron Start codon Sequence ID 6 TRE3G-p40 Intron (AAV2) - Capsid ATG gagtttactccctatcagtgatagagaacgtatgaagagtttactccctatcagtgatagagaacgtatgcagactttactccctatcagtgatagagaacgtataaggagtttactccctatcagtgatagagaacgtatgaccagtttactccctatcagtgatagagaacgtatctaca gtttactccctatcagtgatagagaacgtatatccagtttactccctatcagtgatagagaacgtataagctttaggcgtgtacggtgggcgcctataaaagcagagctcgtttagtgaaccgtcagatcgcctggagcaattccacaacacttttgtcttataccaactttccgtaccactt cctaccctcgtaaaccgttgcgcagccatcgacgtcagacgcggaagcttcgatcaactacgcagacaggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagagaatgaatcagaattcaaatatctgcttcactcacggacagaaag actgtttagagtgctttcccgtgtcagaatctcaacccgttttctgtcgtcaaaaaggcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccagacgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatctttgaacaataaatgatttaaatcaggt atg promoter Intron Start codon Sequence ID 7 TRE3G-p40 Intron (AAV8) - Capsid ATG gagtttactccctatcagtgatagagaacgtatgaagagtttactccctatcagtgatagagaacgtatgcagactttactccctatcagtgatagagaacgtataaggagtttactccctatcagtgatagagaacgtatgaccagtttactccctatcagtgatagagaacgtatctacagtttactcc ctatcagtgatagagaacgtatatccagtttactccctatcagtgatagagaacgtataagctttaggcgtgtacggtgggcgcctataaaagcagagctcgtttagtgaaccgtcagatcgcctggagcaattccacaacacttttgtcttataccaactttccgtaccacttcctaccctcgtaaacctc gaggaactgaaaaaccagaaagttaacagtcgcggatccatcgacgtcagacgcggaaggagctccggtggactttgccgacaggtaccaaaaca aatgttctcgtcacgcgggcatgcttcagatgctgtttccctgcaaaacgtgcgagagaatgaatcagaatttcaacatttgcttcacacacgggg tcagagactgctcagagtgtttccccggcgtgtcagaatctcaaccggtcgtcagaaagaggacgtatcggaaactctgtgcgattcatcatctgc tggggcgggctcccgagattgcttgctcggcctgcgatctggtcaacgtggacctggatgactgtgtttctgagcaataaatgacttaaaccaggt atg promoter Intron Start codon

[0059] The present invention will be further illustrated by the following embodiments, but the invention is not limited thereto. [Examples]

[0060] Experimental Procedure Cell culture: CAP cells and their derived prepackaging cell lines, packaging cell lines, or producing cell lines were cultured in a general manner at 120 rpm to 185 rpm (5 cm orbit), 5% CO2, and 37°C in a shaking flask (125 mL; Corning) on ​​a shaking incubator, using animal-free chemically synthesized PEM medium (Thermo Fisher Scientific) supplemented with 4 mM GlutaMAX (Gibco).

[0061] During general culture, the cells are replaced with fresh medium every 72 to 96 hours, 0.5 × 10⁶ times. 6 cells / ml~1×10 6 The cells were diluted to a viable cell density of cells / ml. Viable cell density and survival rate were determined by trypan blue exclusion method using a CEDEX XS cell counter (Innovatis, Roche Applied Science) or ViCell Blu (Beckman Coulter).

[0062] Nucleofection and stable pool preparation: A stable pool was prepared using Lonza's Nucleofector according to the manufacturer's instructions.

[0063] For each nucleofection reaction, 1 × 10 7 Cells were isolated by centrifugation (500 × g, 5 min). The cells were resuspended in 100 μL of Complete Nucleofector Solution V (Lonza) and mixed with 5 μg of linearized expression vector. The DNA / cell suspension was transferred to a cuvette and nucleofection was performed using the X001 program. Transplanted cells were transferred to 12.5 mL of growth medium and cultured at 37°C, 5% CO2, and 185 rpm as described above.

[0064] To create a stable pool, the cells were cultured in a shaking incubator for 72 to 96 hours after translocation as described above, then pelletized by centrifugation and resuspended in selective medium.

[0065] [Table 1]

[0066] Western blotting for testing transient translocation, capsid protein expression, and PKR and EIF2a phosphorylation: Transient translocation: Transient translocation was performed using PEImax (PolySciences) in FreeStyle 293 medium (Thermo Fisher Scientific). Five hours after translocation, cells were supplied with PEM complete medium (Thermo Fisher Scientific), and the expression of stably incorporated replicase and helper functions was induced by the addition of 1 μg / mL doxycycline. Unless otherwise specified, protein expression analysis was performed 72 hours after translocation.

[0067] Western blot: Collected 72 hours after translocation, 1 × 10⁶ samples were lysed using RIPA buffer supplemented with protease and phosphatase inhibitors. 5 Western blot analysis was performed using cell lysates from individual transmuted cells. The following antibodies were used for Western blot analysis: mouse anti-VP1 / VP2 / VP3 antibody (Progen, Germany), anti-phosphorylated PKR antibody (Abcam), anti-phosphorylated eIF2α antibody (Cell Signaling), and horseradish peroxidase-labeled anti-mouse and anti-rabbit antibodies (Cell Signaling). Proteins were detected using a chemiluminescence detector (INTAS) with the Pierce ECL WB Substrate Kit.

[0068] Virus production from prepackaging cells, packaging cells, or producing cells using modified capsid constructs: To test viral production using modified capsid constructs in the presence of only a limited amount of VA RNA, resulting from the stable integration of helper functions, missing components necessary for AAV production were introduced into cells via transient translocation (Table 2). AAV production was initiated by inducing the expression of replicase and helper proteins with doxycycline.

[0069] Three days after translocation, cell suspension samples were collected and dissolved by adding Triton X to a final concentration of 0.5%.

[0070] [Table 2]

[0071] qPCR for determining viral titer: Viral titers were measured using the following primer / dual-labeled probe combinations for SV40 polyA (MWG, Eurofins; Table 3).

[0072] [Table 3]

[0073] As a standard, a linear transgene plasmid with a defined copy number was used. The qPCR reaction consisted of the following components: 2× Brilliant Multiplex qPCR Master Mix (Agilent), nuclease-free H2O (Thermo Fisher Scientific), primer / probe mixture, and sample / standard material. qPCR was performed on an Agilent Mx3005P according to the manufacturer's instructions for use.

[0074] ELISA for assembled capsids: Specific ELISA for the assembled capsid was performed using a commercially available ELISA kit (Progen) according to the manufacturer's instructions for use.

[0075] VA RNA expression assay: To test VA RNA expression, RNA was isolated using the NucleoSpin miRNA kit according to the manufacturer's instructions. After reverse transcription, VA RNA expression was analyzed using VA RNA-specific primer / probe combinations. The analysis was performed using an Agilent Mx3005P according to the manufacturer's instructions.

[0076] Transduction assay: In summary, cell lysates were prepared by four freeze-thaw cycles. Adherent HEK293T cells were seeded and AAV particles were added. 48 hours after transduction, transduced cells were quantified by GFP measurement.

[0077] Example 1: The effect of VA RNA on capsid expression Introduction: CAP cells are human amniotic cell-derived suspension cells immortalized by stable transfusion using constructs encoding E1A / E1B. The prepackaging cells are based on parental CAP cells and stably express (i) tet activator, (ii) tet-inducible promoter-regulated replicases (AAV2) and adenovirus helper functions (E2A, E4orf6), and (iii) adenovirus VA RNA. However, stable integration of adenovirus VA RNA and its Poll II RNA promoter into the genome of the prepackaging stable cell line results in very low levels of VA RNA (Figure 2), and the RNA level is approximately 3 log lower compared to transient transfusion methods in which VA RNA on a pHelper plasmid is introduced into cells.

[0078] VA RNA is important for high-titer AAV production. The function of VA RNA in AAV production is phosphorylation / activation of PKR and the subsequent suppression of eIF2α phosphorylation, which leads to a decrease in the protein expression of viral replicases and capsid proteins. PKR has been shown to be activated by a sequence within the RNA reader sequence of the capsid protein surrounding AUG in VP1.

[0079] In the examples described herein, the AAV8 capsid construct contained either a modified capsid construct (Tet3G / intron) containing the SV40 intron along with the Tet3G promoter, or a P40 promoter construct (p5 / p40 / intron) containing the AAV2 p5 mini-promoter and the AAV2 capsid p40 promoter and its intron. These were co-transferred with either VA RNA (a construct expressing only VA RNA) or an empty vector functioning as a control (Table 4). After induction of stably incorporated rep and helper genes by doxycycline addition, cell lysates were prepared and capsid expression was analyzed.

[0080] [Table 4]

[0081] result: Prepackaged cell lines exhibited VA RNA levels that were up to 3 log lower compared to transient methods (Figure 2). Interestingly, the capsid construct containing the AAV p40 promoter and its intron region did not show expression without additional VA RNA constructs, but increased with simultaneous transduction of additional VA RNA function. Even in the absence of additional VA RNA, AAV8 capsid expression could be detected in prepackaged SCCs using modified promoter constructs containing the TRE3G promoter and SV40 intron. In addition, splicing of the SV40 intron construct may occur, allowing for the achievement of the correct ratio between the three different capsid proteins (VP1:VP2:VP3) (~1:1:10). The correct ratio between the different VPs is important for the transduction efficiency of AAV, the potency of the generated viral vector, and therefore its potential use as a gene therapy product for therapeutic purposes (Figure 3).

[0082] Example 2: Effects of capsid modification on PKR activation and expression levels Introduction: In prepackaged cells, capsid expression with the original p40 promoter results in significantly lower expression levels compared to the use of a modified capsid construct with the TRE3G promoter and SV40 intron. However, additional expression of VA RNA increases titer (see Example 1). To investigate the hypothesis that PKR activation is attenuated by substitution of the PKR activation sequence in the RNA reader sequence of the capsid protein, the following experiment was performed.

[0083] A modified capsid construct containing the SV40 intron along with the TRE3G promoter, or an AAV p40 promoter construct containing the p5 mini-promoter, p40 promoter, and its intron, was co-transferred into prepackaging cells in or without an additional plasmid encoding VA RNA (Table 4). After induction of stably incorporated rep and helper genes, cell lysates were prepared and analyzed for capsid expression, PKR, and eIF2α phosphorylation.

[0084] result: The AAV prepackaging cell lines described herein have significantly lower VA RNA levels compared to transient methods (Figure 2), which leads to a decrease in capsid protein titer in cells using the AAV p5 / p40 / intron construct containing a PKR activating sequence. However, the use of the TRE3G / SV40 intron construct, which involves the substitution of the PKR activating sequence of the native AAV promoter with another promoter, results in higher titer. Phosphorylation levels of PKR and its downstream target, eIF2α, which have been described as reducing capsid expression, were indeed increased by transposition of the capsid construct containing the p40 promoter and its intron, but not when the modified construct was used (Figure 4).

[0085] Therefore, the substitution of the p40 promoter and its intron combination with the modified TRE3G promoter and SV40 intron combination not only results in the correct ratio of capsid proteins (VP1:VP2:VP3), but also leads to increased protein expression due to decreased PKR activation and the resulting decrease in eIF2α phosphorylation.

[0086] Example 3: Comparison of AAV production in modified capsid constructs versus p40 intron constructs, and the effects of additional VA-RNA in prepackaging cell lines of different origins. Introduction: The production of rAAV8-GFP in one type of CAP cell-based prepackaging SCC and one type of HEK293 cell-based prepackaging SCC was evaluated by transposing them with a combination of a modified capsid construct (TRE3G promoter with SV40 introns) or a p40 intron capsid construct (TRE3G promoter with p40 introns derived from AAV2 (SEQ ID NO: 6) or AAV8 (SEQ ID NO: 7)) and a construct containing GFP as a GOI flanked by AAV2 ITRs. In addition, either an empty vector or a vector expressing VA-RNA was simultaneously transposed. Transposition was performed on prepackaging single-cell clones expressing inducible rep and helper functions with very low VA RNA levels. AAV production was initiated by doxycycline induction 5 hours after transposition.

[0087] The titer of assembled intact AAV virus particles (vp) was analyzed by ELISA, and the titer of the viral genome (vg) was analyzed by qPCR using primers and probes targeted to SV40pA or GFP.

[0088] result: The ELISA used in these studies recognizes the three-dimensional epitope of the assembled capsid. Therefore, the detection of 1E11 particles / ml described above using the modified TRE3G / SV40 intron capsid construct in combination with prepackaging SCCs from both cell lines indicates that high-titer, fully assembled, functional AAV particles are produced from this construct. In comparison, the titer of the capsid produced when transfecting with a p40 intron construct having a capsid under the control of the same TRE3G promoter was significantly lower (less than one-tenth) for both cell line-based prepackaging clones. The titer can be restored by adding VA-RNA to the level achieved using the TRE3G / SV40 intron construct in cells with very low VA-RNA levels (Figures 5 and 6). The effect of intron configuration and VA-RNA addition on the formation of complete viral particles was analyzed by viral genome titer measured by qPCR. Differences in capsid expression between intron configurations also resulted in differences in viral genome titers, as demonstrated by qPCR. Here again, the addition of VA RNA to the p40 intron construct restored titer to levels achieved by the TRE3G / SV40 intron construct without additional VA RNA (Figures 7 and 8). In summary, these data indicate that the TRE3G / SV40 intron construct enables efficient AAV production in the absence of VA RNA, thereby reaching levels that can only be achieved in the presence of VA RNA with the unmodified p40 intron.

[0089] Example 4: AAV production using modified capsid constructs Introduction: The production of rAAV8-GFP in three different prepackaging SCCs was evaluated by transposing them with a modified capsid construct (CMV promoter with SV40 intron) and a construct containing GFP as a GOI flanked by AAV2 ITRs. Transposition was performed on prepackaging single-cell clones that had previously been shown to already express inducible rep and helper functions but at very low levels of VA RNA. AAV production was initiated by doxycycline induction 5 hours after transposition.

[0090] The titer of assembled intact AAV virus particles was analyzed by ELISA, and the vg / mL titer was analyzed by qPCR using primers and probes directed to SV40pA. Infectivity was determined by transduction assay.

[0091] result: The ELISA used in these studies recognizes the three-dimensional epitopes of assembled capsids. Therefore, the detection of 1E11 particles / ml using the combination of modified CMV / SV40 intronic capsid constructs and prepackaging SCCs indicates that fully assembled functional AAV particles are produced from them (Figure 10). These AAV particles are efficiently packaged together with the viral genome, as shown by qPCR. For three different prepackaging cells evaluated, we were able to detect viral genome titers of approximately 1E10 / mL (Figure 11).

[0092] VP1 is important for the infectivity of AAV particles because phospholipase A2 (PLA2) activity is required for the release of AAV particles from late endosomes, while VP2 and VP3 are important for the accurate assembly of viral particles.

[0093] Western blotting analysis of the produced AAV particles revealed the expression of all three proteins, VP1, VP2, and VP3, in the expected ratios (Figure 9). Transduction assay analysis of the produced AAV particles yielded reporter cells transduced by approximately 34% AAV, thus demonstrating the infectivity of the AAV particles produced using the modified capsid construct (Figure 12). It also shows the production of capsid particles that achieved the correct stoichiometric ratio of VP1:VP2:VP3.

[0094] In conclusion, fully functional AAVs can be generated by the method described herein, despite very low levels of VA-RNA in different prepackaging SCCs.

[0095] Example 5: Creation of packaging-stable cell lines using modified capsid promoter regions Introduction: Modified capsid constructs under the control of an inducible promoter combined with SV40 introns were introduced into prepackaged SCCs. A stable pool was created by selection. After pool creation, cells were divided into 1 × 10⁶ cells. 6 Cells were seeded at a density of [number] cells / mL, and capsid production was induced by the addition of 1 μg / mL doxycycline. In addition, an uninduced control was included. Three days after induction, cell lysates were prepared, and capsid production at the correct stoichiometric ratio was analyzed by Western blotting.

[0096] result: Based on prepackaging cell lines, a stable packaging pool was constructed using a modified capsid construct under the control of an inducible promoter. As shown by Western blotting (Figure 13), doxycycline induction enabled the stable cell lines to express capsid proteins efficiently and in the correct ratio, despite low levels of VA RNA.

[0097] Example 6: Producing cell lines Introduction: A fully stable producer cell line was generated by introducing a modified capsid construct under the control of an inducible promoter combined with the SV40 intron and GFP as a GOI flanked by ITRs into the packaging SCC by lentiviral transduction. This polyclonal pool served as a starting point for single cell cloning to obtain high-producing cells. After identifying the most promising SCCs in small-scale experiments in 24 deep-well plates, the selected SCCs were analyzed during culture in Ambr for rAAV8-GFP production upon induction. Briefly, cells were seeded at 1×10 6 cells / mL and induced 3 days after seeding by addition of doxycycline. Samples were taken at different time points and AAV production was measured by ELISA and qPCR.

[0098] Results: Using the modified capsid construct, a stable producer cell line was successfully generated. The best SCC-producing clones were analyzed for production capacity during culture in Ambr15. Upon induction, the fully stable producer cell line showed high-titer rAAV8-GFP production as detected by ELISA and qPCR of the capsid, despite being based on a packaging clone having only low levels of VA RNA (Figures 14 and 15). The capsid levels using the modified construct ranged from 10 10 capsids / mL to 10 13 capsids / mL depending on the SCC, and viral genome production ranged from 10 9 mid-level to 10 10 mid-level.

Claims

1. A host cell containing nucleic acid encoding adeno-associated virus (AAV) capsid protein, The protein kinase R (PKR) activation sequence surrounding the start codon of AAV capsid protein VP1 is inactivated, while the functional expression of AAV capsid proteins VP1, VP2, and VP3 is maintained. The PKR activation sequence is inactivated by replacing the innate AAV capsid protein promoter p40 with a different promoter, and by replacing a portion of the p40 intron, including the splice donor site and splice acceptor site 1 located from the promoter to the start codon of the AAV capsid protein coding sequence, with an intron of a different origin. host cell.

2. The host cell according to claim 1, wherein the natural AAV capsid protein promoter p40 is replaced with an inducible promoter, and / or the introns of the natural AAV capsid protein promoter p40 are replaced outside the capsid coding sequence with replacement introns that provide appropriate splice donor and splice acceptor sites 1 located from the promoter to the start codon of the AAV capsid protein coding sequence.

3. The host cell according to claim 2, wherein the substitution intron is selected from the group consisting of SV40 introns, synthetic CAG promoter introns, and β-globin introns.

4. Nucleic acids encoding AAV replicase (Rep) proteins under the control of an inducible promoter, and / or nucleic acids encoding adenovirus E1A protein and adenovirus E1B protein, and / or A host cell according to any one of claims 1 to 3, further comprising nucleic acids encoding adenovirus E2A protein and adenovirus E4 or f6 protein under the control of an inducible promoter.

5. A host cell according to any one of claims 1 to 4, further comprising nucleic acids encoding an introduction vector containing one or more target genes (GOIs).

6. The host cell according to any one of claims 1 to 5, wherein the inductive promoter that controls the expression of the AAV capsid protein and / or the inductive promoter that controls the expression of the AAV replicase protein and / or the inductive promoter that controls the expression of the adenovirus E2A protein and adenovirus E4orf6 protein is selected from the group consisting of a tet inductive promoter, a cumate inductive promoter, a tamoxifen inductive promoter, a rapamycin inductive promoter, a FKCsA inductive promoter, an ABA inductive promoter, a riboswitch controlled promoter, and a heat shock promoter-driven system and a light-switchable system.

7. The PKR activation sequence is inactivated by replacing the innate AAV capsid protein promoter p40 with a different promoter, and by replacing a portion of the p40 intron, including the splice donor site and splice acceptor site 1 located from the promoter to the start codon of the AAV capsid protein coding sequence, with an intron of a different origin. The native AAV capsid protein promoter p40 is replaced with a constitutive or inducible promoter, and the introns of the native AAV capsid protein promoter p40 are partially replaced, i.e., they are replaced with introns that replace the splice donor site and splice acceptor site 1 located outside the capsid coding sequence, from the promoter to the start codon of the AAV capsid protein coding sequence. Each nucleotide sequence from the promoter to the start codon of the coding sequence of the AAV capsid protein is, Promoter-N1-Intron-N2-ATG (Formula I) (In the formula, The promoter is the intrinsic promoter or the inducible promoter, N1 is a sequence of 1 to 4000 nucleotides. An intron is an intron selected from a group consisting of introns that supply appropriate splice donor sites and splice acceptor sites having the minimal consensus sequence GT / AG. N2 is a sequence of 1 to 4000 nucleotides. A host cell according to any one of claims 1 to 6, having the structure (where ATG is the start codon of the AAV capsid protein coding sequence).

8. The host cell according to claim 7, wherein the promoter in formula I is an inductive promoter selected from the group consisting of a tet-inducible promoter such as the third-generation TRE3G promoter, a cumate-inducible promoter, a tamoxifen-inducible promoter, a rapamycin-inducible promoter, a FKCsA-inducible promoter, an ABA-inducible promoter, a riboswitch-controlled promoter, and a heat shock promoter-driven system and a light-switchable system.

9. The host cell according to claim 7 or 8, wherein the intron in formula I is an intron selected from the group consisting of SV40 introns, synthetic CAG promoter introns, and β-globin introns.

10. The PKR activation sequence is inactivated by replacing the innate AAV capsid protein promoter p40 with a different promoter, and by replacing a portion of the p40 intron, including the splice donor site and splice acceptor site 1 located from the promoter to the start codon of the AAV capsid protein coding sequence, with an intron of a different origin. The natural AAV capsid protein promoter p40 has been replaced with a different promoter, and the introns of the natural AAV capsid protein promoter p40 have been partially replaced, specifically with SV40 introns that replace the splice donor site and splice acceptor site 1 located outside the capsid coding sequence, from the promoter to the start codon of the AAV capsid protein coding sequence. Each nucleotide sequence from the promoter to the start codon of the coding sequence of the AAV capsid protein is, (i) The nucleotide sequence described in Sequence ID No. 4 or Sequence ID No. 5, (ii) A nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 5, wherein the native AAV capsid protein promoter p40 is replaced with a different promoter, and the introns of the native AAV capsid protein promoter p40 are partially replaced, i.e., replaced with SV40 introns that replace splice donor sites and splice acceptor sites 1 located outside the capsid coding sequence, from the promoter to the start codon of the AAV capsid protein coding sequence. And, The host cell according to any one of claims 1 to 9, wherein the last three nucleotides of sequence number 4 or sequence number 5, ATG, is the start codon of the AAV capsid protein coding sequence.

11. A host cell according to any one of claims 1 to 10, derived from cells selected from the group consisting of CAP cells, HEK293 cells, and Per. C6 cells.

12. A method for producing adeno-associated virus (AAV), comprising the step of expressing the AAV in a host cell according to any one of claims 1 to 11.

13. Use of a host cell according to any one of claims 1 to 11 in the production of adeno-associated virus (AAV).

Citation Information

Patent Citations

  • Compositions and methods for the production of recombinant virus vectors

    EP2553105B1

  • aav split-packaging genes and cell lines containing such genes for use in producing recombinant aav vectors

    JP2001506133A

  • Generation of recombinant adeno-associated viral vectors by a complete adenovirus-mediated approach

    US20050112765A1

  • Method of preparing recombinant adeno-associated virus and recombinant baculovirus

    US20180155697A1