Phagemide vector

The PAAV vector system addresses inefficiencies in rAAV production by eliminating most of the bacteriophage genome, enhancing production yield and safety, and facilitating efficient gene delivery for commercial-scale applications.

JP7854334B2Active Publication Date: 2026-05-01IMPERIAL COLLEGE INNVOATIONS LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
IMPERIAL COLLEGE INNVOATIONS LTD
Filing Date
2022-04-28
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Current methods for large-scale production of recombinant adeno-associated virus (rAAV) vectors face inefficiencies, high costs, and safety concerns due to the use of infectious eukaryotic viruses, limiting their commercial viability and purity.

Method used

Development of a hybrid phagemide vector system, known as PAAV, which eliminates at least 50% of the bacteriophage genome, allowing for efficient production of recombinant viral vectors like rAAV or lentiviruses by using a separate helper virus to provide structural genes, reducing particle size and enhancing gene delivery and production yield.

Benefits of technology

The PAAV system improves production yield, gene transfer efficiency, and flexibility for commercial-scale virus production, while minimizing safety risks and costs, enabling broader applications in gene therapy and vaccine delivery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007854334000001
    Figure 0007854334000001
  • Figure 0007854334000002
    Figure 0007854334000002
  • Figure 0007854334000003
    Figure 0007854334000003
Patent Text Reader

Abstract

Hybrid and recombinant phagemid vectors are provided for expressing transgenes in target cells transduced with the vector. [Solution] Recombinant phagemid particles contain at least one transgene expression cassette encoding an agent that exerts a biological effect on a target cell, characterized in that the phagemid particle contains a genome lacking at least 50% of its bacteriophage genome. The invention extends to the use of such phagemid expression systems as research tools, and to transgene delivery in various gene therapy applications, DNA and / or peptide vaccine delivery, and imaging techniques. The invention extends to in vitro, in vivo, or in situ methods for producing viral vectors, such as recombinant adeno-associated virus (rAAV) or lentiviral vectors (rLV), and genetic constructs for use in such methods.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to phagemide vectors and related phagemide particles, particularly hybrid and recombinant phagemide vectors, particles, and expression systems. The present invention extends to the use of such phagemide particles and expression systems as research tools and for the delivery of transgenes, DNA and / or peptide vaccines, and imaging techniques in various gene therapy applications. The present invention extends to methods for producing viral vectors such as recombinant adeno-associated virus (rAAV) or lentiviral vector (rLV) in vitro, in vivo, or in situ, and gene constructs used in such methods. [Background technology]

[0002] Over the past decade, numerous viral and nonviral vectors have emerged as potential delivery vectors for industrial and therapeutic applications. A key characteristic of vectors is that, in addition to being effective in delivering genes, they must be easily produced and commercially viable. Despite the vast amount of basic research required to support vector design and purification, vector production remains an area that must be addressed for successful commercialization. Adeno-associated virus (AAV)-mediated gene therapy is a prime example where vector production has hindered its clinical transition. Recombinant AAV (rAAV) is an attractive vector for gene therapy; however, efficient vector production on a commercial scale remains impractical. Various expression systems for rAAV production have been developed. Transfection-based protocols, while the gold standard for high-purity, laboratory-scale production, cannot be efficiently translated to commercial-scale protocols. Current methods for commercial-scale production rely on the use of eukaryotic viruses to rescue AAV vectors from producer cell lines. Despite being more efficient, the use of infectious eukaryotic viruses presents major concerns, not only regarding the purification of viral particles but also concerning safety for in vivo use.

[0003] AAV is a non-enveloped virus with a 4.7Kb wild-type genome flanked by a terminal inverted repeat (ITR). The genome contains two open reading frames, rep and cap, which provide proteins necessary for viral genome replication and capsid formation. Essentially, wild-type AAV is found in the presence of adenovirus (Ad) because it provides adenohelper proteins essential for packaging the AAV genome into icosahedral virions. Therefore, AAV production depends on three key elements: the genome flanked by the ITR, rep and cap, and the adenohelper genes.

[0004] Currently, laboratory-scale production of rAAV involves introducing all three genetic elements into human embryonic kidney HEK293 cells, which are suitable mammalian producer cells because they express the adenohelper protein derived from immortalization, using DNA transfection. While laboratory-scale production provides high-purity rAAV, the transfection method is not suitable for mass production and faces significant limitations, including inefficiency, resulting in low rAAV yields and high costs. Furthermore, live viruses such as adenoviruses or herpes simplex viruses are often used to efficiently supply helper function, raising significant health and safety concerns for in vivo use.

[0005] While large-scale commercial production of rAAV is possible, it is extremely costly and results in the production of low-purity rAAV. In addition to cell factory systems, including large-scale adherent cultures of HEK293 cells, baculovirus expression vectors (BEVS) and Sf9 insect cell lines have served as the most promising candidate systems for large-scale rAAV production. Recent studies have shown that this system is suitable for genetic modification and that transcriptional regulation can be used to modulate the expression of rep genes toxic to producer cells. Nevertheless, despite its advantageous capabilities, the BEVS / Sf9 paradigm is expensive, unrefined, and baculovirus contamination of rAAV preparations is almost inevitable, posing a high risk of immunogenicity.

[0006] In 2006, Hajitou et al. attempted to satisfy the vector need by creating a hybrid between recombinant adeno-associated virus (rAAV) and a filamentous bacteriophage (i.e., phage), called adeno-associated virus / phage (AAVP) (Nature protocols 2, 523-531 (2007), Cell 125, 385-398 (2006)). AAVP is a hybrid phage vector in which gene expression is adjacent to the internal terminal repeat (ITR) of AAV2 and under the control of a eukaryotic transgene cassette inserted into the intergenetic region of the bacteriophage. This vector combines the specificity of the bacteriophage vector with the genetic characteristics of AAV to produce a virus that replicates only in prokaryotic hosts and can transform mammalian cells with an expression profile similar to rAAV. Importantly, rAAV can be rescued from HEK293 cells transduced with AAVP after transfection with rep- and cap-expression plasmids and subsequent infection with wild-type adenovirus type 5. Therefore, the AAVP vector possesses desirable characteristics of mammalian and prokaryotic viruses and does not suffer the disadvantages typically associated with these individual vectors.

[0007] However, AAVP still has certain inherent limitations of bacteriophages, and therefore leaves room for general improvement of AAVP or phage vectors, thus requiring the design of novel and superior phage-based vectors. For example, AAVP is a hybrid between two viral species (i.e., bacteriophage and AAV), and AAVP vectors contain genomes of both eukaryotic and prokaryotic viruses. The prokaryotic cell genome is functionally or therapeutically irrelevant, despite being essential for viral replication. The inclusion of the phage virus genome has detrimental effects on vector efficiency and production methods, resulting in the relatively low gene transfer efficiency of AAVP compared to mammalian viruses. Therefore, there is a need to provide novel modified bacteriophage systems that can be used for both gene therapy technologies and the large-scale production of recombinant viral vectors such as adeno-associated viruses (AAV) or lentiviruses.

[0008] The research described herein has developed a so-called "hybrid phagemide virus vector system" having a novel phagemide particle called a phagemide / adeno-associated virion (i.e., PAAV). Another name used by the inventors for the novel vector created by the inventors is "plasmid." Unlike the prior art AAVP genome, which consists of an rAAV cassette inserted into a linear phage genome, the PAAV genome of the present invention does not contain any structural bacteriophage genes and therefore requires a prokaryotic helper virus to facilitate vector assembly in the host. [Overview of the project]

[0009] Accordingly, according to a first aspect of the present invention, recombinant phagemide particles are provided for expressing an introduced gene in a transduced target cell, wherein the phagemide particles include at least one introduced gene expression cassette encoding an action factor that exerts a biological effect on the target cell, and the phagemide particles include a genome lacking at least 50% of its bacteriophage genome.

[0010] Advantageously, the redesign of a hybrid viral vector (e.g., AAV or lentivirus) to phagemide particles according to the first embodiment substantially eliminates the phage genome from which the phagemide particles originate, dramatically enhancing the functional properties of the resulting vector (i.e., phagemide particles). Modification of the viral expression system to a phagemide-based system according to the present invention expands the potential for application of phagemide viral vectors in a broader sense. By removing at least 50% of the bacteriophage genome, exceeding 50% of the genome size, from the genome of these particles, the particle size of the resulting phagemide particles is dramatically reduced.

[0011] The term “phagemide particle” can refer to a hybrid phagemide genome encapsulated by a phage-derived coat protein. A hybrid phagemide genome is a “phagemide genome” (i.e., a gene construct containing two origins of replication, one from a bacteriophage (e.g., F1) and the other from a bacterium (e.g., pUC1)). In one embodiment, the phagemide genome may contain an incorporated “recombinant transgene cassette from AAV” (rAAV), and is therefore hybrid and not a normal phagemide genome having a normal (i.e., typical nonviral) recombinant transgene expression cassette. A phagemide particle can refer to a hybrid phagemide genome (i.e., the present invention) encapsulated by a phage protein derived from a transactive agent (e.g., a helper phage).

[0012] While enabling the addition of very large or multiple transgene cassettes, these smaller phagemide particles also exhibit additional advantages in enhancing gene delivery, production yield, in vivo distribution, and evasion from eukaryotic cell barriers. Another important advantage of using the phagemide particles of the present invention is their ability to accommodate extremely large and numerous transgene cassettes or gene insertions, such as the genes of three plasmids used for the production of recombinant viruses (e.g., rAAV or lentivirus) by transfection, as will be discussed later. Thus, by combining genetic components for virus production in single or multiple phagemide vectors, efficient, commercial-scale virus-producing gene delivery systems have been designed.

[0013] Preferably, the phagemid particles contain virions.

[0014] One preferred embodiment of the recombinant phagemid particle genome is shown in Figure 3, and preferred components are shown in Figures 4-6.

[0015] Preferably, the genome of the recombinant phagemide particle includes a packaging signal to enable replication of the phagemide genome to single-stranded DNA, which can then be packaged into the phagemide particle within a prokaryotic host. The packaging signal preferably includes an origin of replication. For example, the origin of replication preferably includes an F1 ori, more preferably an F1 bacteriophage. The DNA sequence of one embodiment of the F1 ori is represented herein as Sequence ID No. 1, as follows. ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTT CACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTT [Sequence ID 1]

[0016] Preferably, the genome of the recombinant phagemide particle includes an origin of replication to enable the replication of the double-stranded vector within a prokaryotic host. Preferably, the origin of replication enables high copy number replication of the vector within the host. Preferably, the origin of replication includes a pUC ori. The DNA sequence of one embodiment of the pUC ori is represented herein as Sequence ID No. 2, as follows. TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGT CCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA [Sequence ID 2]

[0017] Alternatively, in another embodiment, the phagemide particle may be designed to be incorporated into the genome of a host cell. In this case, nucleic acid sequences favorable for targeted integration of the particle's genome (e.g., by homologous recombination) are assumed. Thus, the genome of the recombinant phagemide particle may contain one or more DNA sequences favorable for targeted integration into the host genome.

[0018] In one embodiment, phagemid particles can be used as experimental research tools and may be used ex vivo or in vitro.

[0019] In another embodiment, preferably, the phagemid particles can be used as a recombinant vector for the delivery of a transgene to a tissue-specific target, regardless of whether the vector is administered systemically or locally to a subject in vivo, applied to a mixture of cells in vitro, or applied to an organ ex vivo. Preferably, at least one transgene expression cassette comprises a viral transgene expression cassette, more preferably a mammalian viral transgene expression cassette. For example, in one preferred embodiment, at least one transgene expression cassette can comprise a lentiviral transgene expression cassette. At least one transgene expression cassette is preferably an adeno-associated virus (AAV) transgene expression cassette.

[0020] The transgene expression cassette can comprise any nucleic acid encoding an agent that can have therapeutic or industrial utility in a target cell or tissue. In one embodiment of the invention, the nucleic acid can be DNA, which can be genomic DNA or cDNA. In some embodiments, non-naturally occurring cDNA may be preferred. In another embodiment, the nucleic acid can be RNA, such as antisense RNA or shRNA.

[0021] In one preferred embodiment, the transgene expression cassette can comprise an shRNA configured to target mTOR expression in tumor cells. As shown in Example 7, treatment with RGD4C-phagemid carrying mTOR / shRNA (RGD4C-mTOR / shRNA) can achieve down-regulation of mTOR expression in tumor cells (e.g., medulloblastoma cells).

[0022] The agent encoded by the nucleic acid can be a polypeptide or a protein. For example, in an embodiment where the phagemid particles of the first aspect are used to treat cancer, the transgene can encode the herpes simplex virus thymidine kinase gene, and subsequently, can exert a therapeutic effect on target tumor cells.

[0023] Therefore, in another preferred embodiment, the transgene expression cassette may encode TNFα for expression in tumor cells. As shown in Example 7, RGD4C-phagemide can selectively deliver TNFα to DIPG, resulting in apoptosis induction. Thus, RGD4C-phagemide-TNFα has therapeutic potential for use in targeted therapy against DIPG.

[0024] However, it is understood that the type of cell targeted by recombinant phagemid particles depends on the type of cell-targeting ligand expressed on the particle's surface.

[0025] The transgene expression cassette may contain one or more functional elements necessary for nucleic acid expression in target cells. For example, preferably, the transgene expression cassette includes a promoter such as a CMV promoter. The DNA sequence of one embodiment of the CMV promoter is represented herein as Sequence ID No. 3, as follows. ACGCGTGGAGCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACG TCAATGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGCACCAAAATCAACGGGACTTT CCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCC [Sequence ID 3]

[0026] In another preferred embodiment, the transgene expression cassette includes a grp78 promoter. The nucleic acid sequence of one embodiment of the grp78 promoter is expressed herein as Sequence ID No. 8, as follows: CCCGGGGGCCCAACGTGAGGGGAGGACCTGGACGTTACCGGCGGAAACGGTTTCCAGGTGAGAGGTCACCCGAGGGACAGGCAGCTGCTCAACCAATAGGACCAGCTCTCAGGGCGGATGCTGCCTCTCATTGGCGGCCGTTAAGAATGACCAGTAGCCAATGAGTCGGCTGGGGGGCGCGTACCAGT GACGTGAGTTGCGGAGGAGGCCGCTTCGAATCGGCAGCGGCCAGCTTGGTGGCATGAACCAACCAGCGGCCTCCAACGAGTAGCGAGTTCACCAATCGGAGGCCTCCACGACGGGGCTGCGGGGAGGATATATAAGCCGAGTCGGCGACCGGCGCGCTCGATACTGGCTGTGACTACACTGACTTGGAC [Sequence 8]

[0027] Preferably, the transgene expression cassette includes a nucleic acid encoding a poly(A) tail that can be attached to the expressed activator. The DNA sequence of one embodiment of the nucleic acid encoding the poly(A) tail is represented herein as Sequence ID No. 4, as follows. ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCT TGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTGGTAGAGA CGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTT [Sequence ID 4]

[0028] Preferably, the transgene expression cassette includes left and / or right-terminal inverted repeat sequences (ITRs). The ITRs may be specific to the serotype of the AAV or lentivirus and may be any sequence as long as they form a hairpin loop in the secondary structure. For example, the AAV serotype may be AAV1-9, but preferably AAV1, AAV2, AAV5, AAV6, or AAV8. The DNA sequence of one embodiment of the ITR (a left ITR from a commercially available AAV plasmid) is represented herein as Sequence ID No. 5, as follows. CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT [Sequence ID 5]

[0029] The DNA sequence of another embodiment of the ITR (right-hand ITR derived from a commercially available AAV plasmid) is represented herein as Sequence ID No. 6, as follows: AGGAACCCCTAGTGATGGAGTTGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG [Sequence ID 6]

[0030] Preferably, the genome of the recombinant phagemide particle includes a host cell-dependent selection marker that encapsulates the vector, for example, to confer ampicillin resistance in host cells, preferably bacteria. The marker provides selective pressure during the production of phagemide particles in the host cell.

[0031] Preferably, recombinant phagemide particles contain one or more capsid minority coat proteins. Recombinant phagemide particles may contain pIII capsid minority coat proteins configured to display cell-targeting ligands that enable delivery of the particles to target cells. Preferably, recombinant phagemide particles contain one or more capsid major coat proteins. Recombinant phagemide particles may contain at least one pVIII capsid major coat protein configured to display foreign peptides on top of it.

[0032] Recombinant phagemide particles may include, for example, therapeutic or modification of the capsid structure by chemical or biochemical bonding. A suitable example of modification may include crosslinking of peptide residues onto the phagemide particle. In another embodiment, the recombinant phagemide particle may contain one or more functional peptides attached to its capsid. For example, the functional peptide may contain a nuclear localization signal. Thus, the phagemide particles are multifunctional and can utilize the features disclosed in WO2014 / 184528.

[0033] In another embodiment, as described in WO2014 / 184529, recombinant phagemide particles can be combined with a cationic polymer to form a composite having a net positive charge. The cationic polymer may be selected from the group consisting of chitosan, poly-D-lysine (PDL), diethylaminoethyl (DEAE), diethylaminoethyl-dextran (DEAE.DEX), polyethyleneimine (PEI), polyblen, protamine sulfate, and cationic lipids. Preferably, the cationic lipid is selected from the group consisting of fugene®, lipofectamine®, and DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate). Preferably, the cationic polymer includes DEAE, more preferably DEAE.DEX.

[0034] Preferably, the phagemide particle contains a genome that substantially lacks the phage genome from which the particle originates. Preferably, the genome of the recombinant phagemide particle lacks at least 60%, more preferably at least 70%, and even more preferably at least 80% of the bacteriophage genome from which it originates. More preferably, the genome of the recombinant phagemide particle lacks at least 90%, more preferably at least 95%, and even more preferably at least 99% of the bacteriophage genome from which it originates. Preferably, the genome of the recombinant phagemide particle lacks all of the bacteriophage genome from which it originates. However, as described above, the genome of the phagemide virus particle may, in some embodiments, include a bacteriophage replication origin, i.e., an F1 bacteriophage ori, to enable the particle to replicate to single-stranded DNA.

[0035] Preferably, the phagemide particle lacks bacteriophage structural genes in its genome that are required for particle formation, packaging, or efflux from a prokaryotic host. Such structural genes encode capsid proteins, etc. Preferably, the phagemide particle contains a genome that lacks genes encoding minority or major coat proteins from which the particle originates. Preferably, the phagemide particle contains a genome that lacks either the pIII capsid minority coat protein or the pVIII capsid major coat protein. Most preferably, the phagemide particle contains a genome that lacks both the pIII capsid minority coat protein and the pVIII capsid major coat protein.

[0036] Thus, recombinant phagemide particles, despite the absence of the particle's genome which does not contain the structural genes of the bacteriophage from which they originate, preferably comprise replication-deficient virus-like particles or virions constructed and displayed from structural components including, but not limited to, proteins and other conjugate compounds derived from the bacteriophage.

[0037] Therefore, given that the genome of the recombinant phagemide particles of the first embodiment lacks a derivative phage genome containing structural genes, an alternative system is needed to provide the necessary structural (i.e., capsid) genes required to package the recombinant phagemide genome into a bacteriophage capsid in order to produce the particles of the present invention. Accordingly, the inventors have invented a novel system for producing the particles of the first embodiment, which includes the use of a separate so-called "helper virus" vector. Thus, the particles of the first embodiment are, in effect, a hybrid phagemide vector containing components of phagemide and a eukaryotic virus.

[0038] Therefore, in the second embodiment, a system for producing recombinant phagemide particles from a prokaryotic host, (i) A first vector configured to persist within a prokaryotic host, comprising at least one transgene expression cassette and a packaging signal to enable replication of the vector to single-stranded DNA, (ii) A system is provided comprising a second vector containing nucleic acids that package single-stranded DNA and encode structural proteins required to bring about the formation and efflux of recombinant phagemide particles from a prokaryotic host.

[0039] Advantageously, separating the replication elements of the phagemide particle into a first "therapeutic" vector containing the transgene and a second, distinct "helper" vector containing the viral packaging structure gene substantially reduces the genome / vector size, thereby significantly increasing the transgene's capacity. In embodiments where the phagemide particle is used therapeutically, this is a particularly useful advantage for novel gene therapy applications. Consequently, this improves production yield, gene transfer efficiency, and the flexibility of the vector system for other applications.

[0040] The novelty of the second embodiment of the system lies in its ability to package the genome of a eukaryotic virus (such as AAV or lentivirus) provided by the first vector into a prokaryotic viral capsid (i.e., bacteriophage) also provided by the first vector. Thus, while the conventional system (i.e., AAVP) is a chimera of two genomes, the system of the second embodiment (i.e., PAAV) is a chimera between a prokaryotic viral phenotype and a eukaryotic viral genotype.

[0041] Preferably, the system of the second embodiment is used to produce recombinant phagemide particles according to the first embodiment. Therefore, preferably, the first vector contains the genome of the recombinant phagemide particles. The packaging signal of the first vector may preferably include an origin or replication. Preferably, the replication origin in the first vector consists of an F1 ori, more preferably an F1 bacteriophage.

[0042] Preferably, the first vector includes a second origin of replication to enable replication of the double-stranded vector within a prokaryotic host. Preferably, this origin of replication enables high copy number replication of the vector within the host. Preferably, the origin of replication includes a pUC ori. Alternatively, the first vector may include one or more DNA sequences that facilitate targeted integration into the host genome, thus eliminating the need for any origin of replication.

[0043] The transgene expression cassette includes a viral transgene expression cassette, more preferably a mammalian viral transgene expression cassette. For example, at least one transgene expression cassette may include a lentiviral transgene expression cassette or an AAV transgene expression cassette. An AAV transgene expression cassette is preferred.

[0044] One preferred embodiment of the second vector is shown in Figure 7, and preferred components are shown in Figure 8. The second vector, or "helper phage," is preferably a bacteriophage specifically designed to rescue a phagemide particle carrying the first vector (i.e., the genome of the phagemide particle) from a prokaryotic host, an embodiment of which is shown in Figure 3. Thus, the second vector (i.e., helper phage) is provided to impart its proteins and polypeptides to the first vector (i.e., the genome of the phagemide particle), or to other DNA entities including a functional packaging signal and / or a single-strand origin or replication. The second vector is most preferably a replication defect. Preferably, the second vector contains a disrupted packaging signal that significantly reduces its ability to package itself into a phage particle. Preferably, the second vector contains a disrupted replication origin. In one embodiment, the disrupted replication origin is a medium copy number origin such as p15a. In another embodiment, the destroyed replication origin is a low copy number origin such as pMB1. Preferably, the first vector (i.e., the genome of the phagemid particle) is configured to outperform the second vector (i.e., the helper phage) in both replication and packaging.

[0045] The genome of the second vector can be manipulated to give the resulting recombinant phagemide particle targeting properties (or multifunctional properties as described in WO2014 / 184528). Thus, it provides a structural capsid protein for phagemide particle assembly. Preferably, the second vector contains nucleic acids encoding one or more capsid minority coat proteins or one or more capsid major coat proteins. All capsid proteins are wild-type or recombinant, exist in single or multiple copies, and may be modified to display chimeric or synthetic peptides. This includes displaying antigens of other viruses for peptide vaccine delivery, or displaying adjuvants when a DNA vaccine (delivered by phagemide particles of the first embodiment) is desired.

[0046] Therefore, in one embodiment, the second vector may include a first nucleic acid sequence encoding a pIII capsid minority coat protein configured to display a cell-targeting ligand to enable the delivery of recombinant phagemide particles to target cells (e.g., tumors). Thus, a 9-amino acid mutation can be induced in the pIII minority coat protein of recombinant phagemide particles to target tumor cells and α v β3 and α v It is desirable to confer specificity to angiogenic tumor-associated endothelial cells that express β5 integrin. Therefore, the genome of the second vector may contain the RGD4C-targeted peptide (CDCRGDCFC-SEQ ID NO: 7).

[0047] In another embodiment, the second vector may include a second nucleic acid sequence encoding at least one pVIII capsid major coat protein configured to display an exogenous peptide thereon. Therefore, it is desirable to induce a mutation in the wild-type pVIII major coat protein of recombinant phagemide particles to display a short peptide, for example, less than 10 amino acids in length. This short peptide may be a targeting moiety and may have intrinsic biological / chemical functionality in vivo or in vitro. For example, in vivo immunostimulation by antigen display, or in vitro binding to nanoparticles (e.g., gold) by displaying a gold-binding peptide.

[0048] The first vector may be a member of the Retroviridae or Orthoretrovirinae. The first vector may be a member of the Lentivirus genus. Preferably, the first vector is a member of the Parvoviridae or Parvovirinae. Preferably, the first vector is a member of the Dependoparvovirus or Adeno-associated virus species.

[0049] Once the first vector (i.e., the genome of the phagemide particle) and the second vector (i.e., the helper phage) are constructed, they are used together to produce recombinant phagemide particles of the first embodiment in a prokaryotic host. It is understood that the packaging signal of the first vector (e.g., the origin of replication), which enables replication of the phagemide genome into single-stranded DNA, signals the structural protein of the second vector (i.e., the helper phage) to package the phagemide genome (i.e., they act together in trans within the host) to create particles of the first embodiment.

[0050] In one preferred embodiment, the first vector (phagemid particle genome) substantially comprises the nucleic acid sequence shown in Sequence ID No. 9, or a fragment or variant thereof, where Sequence ID No. 9 is represented as follows: [Sequence ID 9]

[0051] In one preferred embodiment, the second vector (a helper phage having an RGD sequence) comprises substantially the nucleic acid sequence shown in SEQ ID NO: 10, or a fragment or variant thereof, where SEQ ID NO: 10 is represented as follows: AACGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTACATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCACCAGATTCAGCAATTAAGCTCTAAGCCA TCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCA [Sequence ID 10]

[0052] In one preferred embodiment, the second vector (a helper phage without an RGD sequence) comprises substantially the nucleic acid sequence shown in SEQ ID NO: 11, or a fragment or variant thereof, where SEQ ID NO: 11 is represented as follows: [Sequence ID 11]

[0053] As described in Example 1, the inventors have invented two alternative approaches (see Figures 9 and 10) for producing recombinant phagemide particles of the present invention in a prokaryotic host.

[0054] Therefore, in a third aspect, a method for producing recombinant phagemide particles from a prokaryotic host, the method being (i) A step of introducing a first vector configured to persist within a prokaryotic host cell, comprising at least one transgene expression cassette and a packaging signal to enable replication of the vector to single-stranded DNA, (ii) A step of introducing a helper phage containing nucleic acid encoding a bacteriophage structural protein into a host, (iii) A method is provided comprising the step of culturing a host under conditions in which single-stranded DNA packaged by structural proteins forms recombinant phagemide particles from the prokaryotic host and is expelled.

[0055] Conveniently, this embodiment (shown in Figure 9) yields particles of very high yield. The first vector (i.e., the genome of the phagemide particles) can be introduced into host cells, for example, by infection. The host cells can then be transformed with helper phages, thereby producing recombinant phagemide particles. Preferably, this method includes a purification step following a culture step. Purification may include centrifugation and / or filtration.

[0056] In a fourth aspect, a method for producing recombinant phagemide particles from a prokaryotic host, the method is: (i) Introducing into a prokaryotic host cell (a) a first vector configured to persist within the prokaryotic host, comprising at least one transgene expression cassette and a packaging signal to enable replication of the vector to single-stranded DNA, and (b) a second vector comprising nucleic acids encoding structural proteins required to package the single-stranded DNA, (ii) A method is provided comprising the step of culturing a host under conditions in which single-stranded DNA packaged by structural proteins forms recombinant phagemide particles from the prokaryotic host and is expelled.

[0057] Conveniently, this embodiment (as shown in Figure 10) provides improved safety. The second vector (i.e., helper phage) can be introduced into host cells, for example, by infection. The host cells can then be transformed with the first vector (i.e., the genome of the phagemide particle), thereby resulting in the production of recombinant phagemide particles. Preferably, this method includes a purification step following a culture step. Purification may include centrifugation and / or filtration.

[0058] A fifth aspect provides the use of a helper phage comprising a nucleic acid encoding a viral vector structural protein for producing recombinant phagemide particles according to the first aspect from a prokaryotic host.

[0059] In the sixth aspect, a host cell is provided containing a first and / or second vector as defined in the second aspect.

[0060] The host cell is preferably a prokaryote, and more preferably a bacterial cell. Examples of suitable host cells include (i) TG1 (genotype: K-12 supEthi-1Δ(lac-proAB)Δ(mcrB-hsdSM)5, (r K -m K - ), plasmid: F'[traD36 proAB + lacI q(ii) DH5αF'IQ(trademark) (genotype: F-φ80lacZΔM15Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk-,mk+)phoA supE44λ-thi-1 gyrA96 relA1, plasmid: F'proAB+lacIqZΔM15zzf Tn5[KmR], and (iii) XL1-Blue MRF' (genotype: Δ(mcrA)183Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac, plasmid: F'proAB lacIqZΔM15 Tn10(Tetr)).

[0061] In another embodiment, recombinant phagemide particles according to the first embodiment or a system according to the second embodiment are provided for use as experimental research tools.

[0062] For example, the particles or system can be used ex vivo or in vitro.

[0063] However, preferably, the particles are used therapeutically or in diagnostic methods, preferably in vivo.

[0064] Accordingly, in a seventh embodiment, recombinant phagemide particles according to the first embodiment or a system according to the second embodiment are provided for use in therapeutic or diagnostic purposes.

[0065] The present invention can be used to treat a wide variety of diseases due to the target-specific properties and improved transduction efficiency of the recombinant phagemide particles of the present invention. As a result, the therapeutic opportunities of recombinant bacteriophages used in gene therapy can be significantly increased by the present invention due to their ability to possess one or more transgene expression cassettes. The present invention can be used prophylactically to prevent disease, or to improve and / or treat disease after its onset.

[0066] Accordingly, the eighth aspect provides recombinant phagemide particles according to the first aspect or a system according to the second aspect for use in gene therapy technology.

[0067] A ninth aspect provides a method for treating, preventing or improving a disease of interest using gene therapy technology, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of recombinant phagemide particles according to the first aspect or a system according to the second aspect.

[0068] It will be understood that the present invention can be used to create a variety of different recombinant phagemide particles that can be used for the treatment and / or diagnosis of various diseases, depending on the properties of the particles and the exogenous proteins displayed. For example, in embodiments in which the recombinant phagemide particles contain a tumor-targeting ligand and / or a transgene that expresses an antitumor gene (e.g., the HSVtk gene), it can be used to treat cancer. The target cells in gene therapy techniques are preferably eukaryotes, preferably mammals.

[0069] Therefore, gene therapy technologies are preferably used to treat, prevent, or improve cancer. The tumor may be in the brain, for example, medulloblastoma or diffuse endogenous pontine glioma (DIPG). Recombinant phagemide particles can be used in combination with conventional therapies, such as chemotherapeutic agents (i.e., doxorubicin, temozolomide, lomustine), radiotherapy, or other drugs / xenobiotic compounds, including but not limited to histone deacetylase inhibitors (HDAC inhibitors), proteasome inhibitors, and anticancer agents derived from natural and dietary sources (i.e., genistein).

[0070] The inventors believe that the recombinant phagemide particles of the present invention will have significant commercial value in the delivery of peptides and / or DNA and / or adjuvant vaccines.

[0071] Therefore, the tenth embodiment provides a vaccine comprising recombinant phagemid virus particles according to the first embodiment or a system according to the second embodiment.

[0072] In the eleventh aspect, recombinant phagemide virus particles according to the first aspect or a system according to the second aspect are provided for use in vaccine delivery to a target.

[0073] Preferably, the vaccine is a peptide vaccine. Preferably, the vaccine is a DNA vaccine. Preferably, the vaccine contains a suitable adjuvant. In one embodiment, recombinant phagemide particles may be used to carry a transgene or DNA cassette encoding an antigen to stimulate the body's immune system. Recombinant phagemide particles are also used to directly display and express the antigens of interest on the major pVIII coat protein, thus providing an efficient platform for the simultaneous delivery by a single phage particle of a vaccine DNA vaccine or a number of antigens as proteins, or an adjuvant readily expressed on the phage surface. The target may be a mammal, preferably a human.

[0074] Accordingly, a twelfth aspect provides recombinant phagemide particles according to the first aspect or a system according to the second aspect for use in delivering and targeting foreign antigens to vaccinated target tumors. The animals are first vaccinated with foreign antigens or have already been vaccinated with antigens used, and then tumor-targeted phagemides are administered to the vaccinated animals to induce an immune attack against these tumors and deliver the foreign antigens to the tumors.

[0075] The inventors also believe that the recombinant phagemide particles of the present invention can be used in a variety of different gene molecular imaging techniques, such as positron emission tomography (PET), ultrasound (US), SPECT imaging, functional magnetic resonance imaging, or bioluminescence imaging.

[0076] Thus, in a thirteenth aspect, there is provided the use of a recombinant phagemid particle according to the first aspect or a system according to the second aspect in gene molecular imaging technology.

[0077] The transgene encapsulated by the phagemid particle can encode HSVtk and / or the sodium / iodide symporter (NIS), and the particle is preferably used in combination with a radiolabeled substrate. For example, the human sodium / iodide symporter (NIS) imaging gene is I for clinically applicable positron emission tomography (PET) imaging 124 or I for clinically applicable SPECT imaging 125 / 99m It is preferably used in combination with Tc-pertechnetate.

[0078] Alternatively, the HSVtk gene is preferably used in combination with a radiolabeled nucleoside analogue such as 20-[18F]-fluoro-20-deoxy-1-β-D-arabinofuranosyl-5-ethyluracil ([18F]FEAU).

[0079] It will be appreciated that the recombinant phagemid particles and systems of the present invention (i.e., hereinafter referred to as "agents") can be used in monotherapy, or as adjuvants to or in combination with known therapies for the treatment, amelioration or prevention of diseases such as cancer. For example, a combination therapy approach using the phagemid particles and systems of the present invention with existing chemotherapeutic agents such as temozolomide, doxorubicin or genistein is preferred.

[0080] In another preferred embodiment, the therapy can include a combination of the recombinant phagemid particles and systems of the present invention with an extracellular matrix degrading agent such as an enzyme or losartan. The inventors believe that the extracellular matrix degrading agent should enhance the diffusion of the phagemid within the subject being treated, particularly within solid tumors.

[0081] The active ingredients according to the present invention (i.e., recombinant phagemid particles according to the first embodiment or a system according to the second embodiment) can be combined with compositions having many different forms, in particular, depending on the manner in which the composition is used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid, or any other suitable form that can be administered to a human or animal in need of treatment. It will be understood that the vehicle of the pharmaceutical according to the present invention must be well acceptable to the target to which it is given.

[0082] A pharmaceutical product containing the active ingredient according to the present invention can be used in many ways. For example, oral administration may be required, in which case the active ingredient can be contained in a composition that can be taken orally, for example, in the form of a tablet, capsule, or liquid. A composition containing the active ingredient of the present invention can be administered by inhalation (e.g., intranasally). The composition can also be formulated for topical use. For example, a cream or ointment can be applied to the skin.

[0083] The active ingredients according to the present invention can also be incorporated into sustained-release or delayed-release devices. Such devices can be inserted, for example, above or below the skin, and the drug can be released over several weeks or months. The device may be positioned at least adjacent to the treatment site. Such devices may be particularly advantageous when long-term treatment with the active ingredients used according to the present invention is required and usually requires frequent administration (e.g., at least daily injections).

[0084] In preferred embodiments, the active ingredients and compositions according to the present invention may be administered to a target by injection into the bloodstream or directly to the site requiring treatment. The injection may be intravenous (bolus or infusion), subcutaneous (bolus or infusion), intradermal (bolus or infusion), or may be enhanced by conventional methods (convection-enhanced delivery related to local injection at the site of disease).

[0085] It will be understood that the required amount of the active ingredient is determined sequentially by the mode of administration, the physicochemical properties of the active ingredient (i.e., recombinant phagemid virus particles or system), and its biological activity and bioavailability, which depend on whether it is used as monotherapy or in combination therapy. The frequency of administration is also influenced by the half-life of the active ingredient in the subject being treated. The optimal dosage to be administered can be determined by those skilled in the art and varies depending on the specific active ingredient used, the strength of the pharmaceutical composition, the mode of administration, and the progression of the disease. Further factors specific to the subject being treated, including the age, weight, sex, diet, and timing of administration, may necessitate adjustments to the dosage.

[0086] Generally, the active ingredient of the present invention can be used in a daily dose of 0.01 μg / kg body weight to 500 mg / kg body weight. More preferably, the daily dose is 0.01 mg / kg body weight to 400 mg / kg body weight, and more preferably 0.1 mg / kg to 200 mg / kg body weight.

[0087] As discussed in the examples, the active ingredient can be administered before, during, or after the onset of the disease. For example, the active ingredient may be administered immediately after the subject develops the disease. The daily dose may be administered systemically as a single dose (e.g., once daily injection). Alternatively, the active ingredient may need to be administered two or more times a day. As an example, the active ingredient may be administered in two daily doses (or more, depending on the severity of the disease being treated) between 25 mg and 7000 mg (i.e., assuming a body weight of 70 kg). The patient receiving treatment may take the first dose upon waking, and then the second dose in the evening (in the case of a two-dose plan) or at a 3 or 4-hour interval thereafter. Alternatively, an extended-release device can be used to provide the patient with the optimal dose of the active ingredient according to the present invention without the need for repeated administration.

[0088] Using known procedures such as those conventionally used in the pharmaceutical industry (e.g., in vivo experiments, clinical trials, etc.), specific formulations containing particles or systems according to the present invention and precise treatment plans (e.g., daily dose and frequency of administration of the active ingredient) can be formed.

[0089] Accordingly, a fourteenth aspect of the present invention provides a pharmaceutical composition comprising recombinant phagemid virus particles according to the first aspect or a system according to the second aspect and a pharmaceutically acceptable vehicle.

[0090] This composition can be used to improve, prevent, or treat any disease in targets treatable by gene therapy, such as cancer.

[0091] In a fifteenth aspect of the present invention, the present invention also provides a method for producing a pharmaceutical composition according to a twelfth aspect, the method comprising contacting a therapeutically effective amount of recombinant phagemid particles according to a first aspect or a system according to a second aspect with a pharmaceutically acceptable vehicle.

[0092] The "subject" may be a vertebrate, mammal, or livestock. Therefore, the active ingredients, compositions, and pharmaceuticals according to the present invention may be used to treat any mammal, such as livestock (e.g., horses), pets, or for other veterinary purposes. However, most preferably, the subject is human.

[0093] The "therapeutic effective dose" of the active agent (i.e., recombinant phagemid virus particles) is any amount of the drug that, when administered to a subject, is necessary to treat the target disease or produce a desired effect, such as resulting in the effective delivery of a transgene to a target cell or tissue, including causing tumor death.

[0094] For example, the therapeutically effective dose of the active ingredient used may be approximately 0.01 mg to approximately 800 mg, preferably approximately 0.01 mg to approximately 500 mg.

[0095] As used herein, “pharmaceutically acceptable vehicle” is any known compound or combination of known compounds that is known to those skilled in the art to be useful in formulating a pharmaceutical composition.

[0096] In one embodiment, the pharmaceutically acceptable vehicle may be a solid, and the composition may be in the form of a powder or a tablet. A solid pharmaceutically acceptable vehicle may contain one or more substances that can also act as flavoring agents, lubricants, solubilizers, suspending agents, dyes, fillers, flow enhancers, compression aids, inert binders, sweeteners, preservatives, dyes, coatings, or tablet disintegrants. The vehicle may also be an encapsulating material. In a powder, the vehicle is a finely divided solid mixed with the finely divided active agent according to the present invention. In a tablet, the active agent (e.g., particles or systems of the present invention) can be mixed in an appropriate proportion with a vehicle having the required compressibility and compressed to the desired shape and size. Powders and tablets preferably contain up to 99% of the active agent. Suitable solid vehicles include, for example, calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low-melting-point waxes, and ion-exchange resins. In another embodiment, the pharmaceutical vehicle may be a gel, and the composition may be in the form of a cream or the like.

[0097] However, the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition may be in the form of a solution. Liquid vehicles are used in the preparation of solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The particles or systems according to the present invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle, such as water, an organic solvent, a mixture thereof, or a pharmaceutically acceptable oil or fat. The liquid vehicle may contain other suitable pharmaceutical additives such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavorings, suspending agents, thickeners, colorants, viscosity modifiers, stabilizers, or osmotic pressure modifiers. Preferred examples of liquid vehicles for oral and parenteral administration include water (partially containing the above-mentioned additives, e.g., cellulose derivatives, preferably sodium carboxymethylcellulose solution), alcohols (monohydric and polyhydric alcohols, e.g., glycols) and their derivatives, and oils (e.g., fractionally distilled coconut oil and peanut oil). For parenteral administration, the vehicle may also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles are useful in compositions in sterile liquid form for parenteral administration. For pressurized compositions, the liquid vehicle may be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.

[0098] Liquid pharmaceutical compositions, which are sterile solutions or suspensions, can be administered, for example, by intramuscular, intrathecal, epidural, intraperitoneal, intravenous, and especially subcutaneous injection. Particles or systems (i.e., hybrid vectors) can be prepared as sterile solid compositions that can be dissolved or suspended at administration using sterile water, saline, or other suitable sterile injection media.

[0099] The recombinant phagemid particles, systems, and pharmaceutical compositions of the present invention can be administered orally in the form of a sterile solution or suspension containing other solutes or suspensions (e.g., saline or glucose sufficient to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monooleate, polysorbate 80 (oleic acid ester of sorbitol and its anhydrous copolymerized with ethylene oxide), etc. The particles and systems according to the present invention can also be administered orally in the form of either a liquid or solid composition. Compositions suitable for oral administration include solid forms such as tablets, capsules, granules, tablets and powders, and liquid forms such as solutions, syrups, elixirs and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions and suspensions.

[0100] Adeno-associated viruses (AAVs) are often understood to be the vector of choice for gene therapy. As gene delivery vectors, lentiviral vectors also have several significant advantages over other systems. Firstly, they have a large packaging capacity for at least 8Kb of DNA, which is a key feature when packaging tissue-specific promoters and substantial expression cassettes of transgenes. Secondly, unlike simpler retroviruses, they can transduce non-dividing cells as well as genomic tissues, which is a very useful quality when considering their application as gene therapy vectors to non-proliferating tissues such as muscle, neurons, and hematopoietic stem cells. Furthermore, lentivirals have reduced immunogenicity compared to adenoviral vectors, allowing for the exploration of systemic delivery pathways. However, barriers to using AAVs or lentiviruses in laboratory and clinical research include very high production costs and low yields.

[0101] In addition to demonstrating useful applications in gene therapy, imaging, and vaccine delivery, the recombinant phagemide particles of the present invention can also be used to produce recombinant viral vectors such as AAV or lentivirus in vitro or in vivo (including in situ). Phage-induced AAV production utilizes the ability of phagemide particles to package large amounts of single-stranded ssDNA. A typical AAV production system consists of three main components: rAAV, rep-cap, and adeno helper genes, which work together to produce rAAV particles.

[0102] Accordingly, the sixteenth aspect provides the use of a phagemide particle according to the first aspect or a system according to the second aspect for producing a recombinant viral vector containing or derived from a viral genome within the genome of the phagemide particle.

[0103] In the 17th aspect, a method for producing a recombinant viral vector is provided, which includes introducing recombinant phagemide particles according to the first aspect or a system according to the second aspect into a eukaryotic host cell to cause the host cell to produce a recombinant viral vector.

[0104] Preferably, the recombinant virus product is a recombinant mammalian virus, such as AAV or lentivirus. Preferably, the viral vector product is rAAV. Preferably, the phagemide virus particle according to the first embodiment, or the system according to the second embodiment, is used in cis and / or trans within a eukaryotic host cell, along with the delivery and / or presence of other genetic elements required for the production of a mammalian virus, as determined by the genome of the phagemide particle. The genome of the phagemide particle is present inside the eukaryotic host cell. Methods used to assist or enhance gene delivery into a host cell by the phagemide particle include the methods described in WO2014 / 184528 (i.e., multifunctional) and WO2014 / 184529 (i.e., combination with a cationic polymer to form a complex having a net positive charge).

[0105] The eukaryotic host cells may be mammalian. Host cells may include, or be derived from, human fetal kidney cells (HEK293), Spodoptera fulgiperda pupal ovarian tissue (Sf9), or Chinese hamster ovaries (CHO). Insect cells are also conceivable.

[0106] In one embodiment, host cells may be transformed with one or more phagemide particle genomes possessing genes selected from the group consisting of rAAV, lentivirus, capsid, replication, helper protein-coding genes, and any other genes necessary for the expression and packaging of mammalian viruses.

[0107] For example, in hybrid phagemide particle-induced rAAV production, as shown in Figure 3, the rAAV gene may be embodied in the recombinant phagemide virus particle according to the first embodiment, and the adenohelper and rep-cap genes may be embodied on separate vectors or integrated into the eukaryotic host genome. For example, Figure 12 shows the adenohelper gene on one vector, and Figure 13 shows the rep-cap on separate vectors. Any combination of rAAV, rep-cap, and adenohelper genes may be embodied in one or more vectors, i.e., in cis or trans configuration. The rep-cap or adenohelper protein may be integrated into or introduced into the eukaryotic host as stably expressed accessory DNA (e.g., plasmid) under the circumstances of rAAV production, thereby supplying the hybrid phagemide particle with a recombinant viral genome for packaging into the recombinant virus, determined by the transgene cassette within the phagemide particle's genome.

[0108] In one preferred embodiment, the rAAV, rep-cap, and adeno helper genes are encapsulated on a single vector, as shown in Figures 14 and 15. We believe this is the first time that all three gene sets have been encapsulated on the same vector.

[0109] Therefore, the 18th embodiment provides a recombinant vector containing rAAV, rep-cap, and adeno helper genes.

[0110] In the 19th embodiment, recombinant phagemid particles comprising the vector of the 18th embodiment are provided.

[0111] In the 20th aspect, the use of a vector according to the 18th aspect or a particle according to the 19th aspect is provided for producing a recombinant AAV viral vector containing or derived from the viral genome of a phagemid particle.

[0112] In the 21st aspect, a method for producing a recombinant AAV virus vector is provided, the method comprising introducing a vector according to the 18th aspect or particles according to the 19th aspect into a eukaryotic host cell, thereby causing the host cell to produce a recombinant virus vector.

[0113] When introduced into the same eukaryotic host cell (see Figures 11 and 14), the rep-cap and adenohelp genes on the vector behave either as trans- or cis-acting, or as a combination of both elements that facilitate the packaging of the rAAV genome in the AAV virus capsid, in the context of rAAV production. This manufacturing process is comparable to transient simultaneous transfection of multiple plasmids, typically involving three plasmids. However, in this embodiment, the plasmids are replaced with recombinant phagemide particles of the present invention that target eukaryotic cells (preferably mammalian cells) that also possess the same elements.

[0114] The method can be carried out in vivo, in vitro, exo vivo, or in situ. For in situ production, the recombinant phagemide particle preferably contains a targeting portion for a target eukaryotic cell, which is a specified eukaryotic host. Preferably, in the context of in situ, exo vivo, and in vivo virus production, the specified eukaryotic host cell type is a disease cell. Preferably, the disease cell is a malignant or benign tumor. In the context of in vitro virus production, preferably, the eukaryotic host is a derivative of any of the above eukaryotic hosts. The application of the recombinant phagemide particle and genetic elements necessary for the production of recombinant virus (determined by the transgene cassette in the hybrid phagemide particle) can be in any manner as previously described, either in a cis or trans combination, within the eukaryotic host cell.

[0115] The present invention extends to any nucleic acid or peptide substantially comprising any amino acid or nucleic acid sequence of any of the sequences referred to herein, or to any variant, derivative or analog thereof, and is understood to include any functional variant or functional fragment thereof. The terms “substantially amino acid / polynucleotide / polypeptide sequence,” “functional variant,” and “functional fragment” may be sequences having at least 40% sequence identity with any one of the amino acid / polynucleotide / polypeptide sequences referred to herein, and may be sequences having 40% identity with, for example, the nucleic acids identified herein.

[0116] Amino acid / polynucleotide / polypeptide sequences having sequence identity with any of the mentioned sequences of more than 65%, more preferably more than 70%, even more preferably more than 75%, and even more preferably more than 80% are also conceivable. Preferably, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity with any of the sequences referred to herein, more preferably at least 90% identity with any of the sequences referred to herein, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity, and most preferably at least 99% identity.

[0117] Those skilled in the art will understand how to calculate the percentage of identity between two amino acid / polynucleotide / polypeptide sequences. To calculate the percentage of identity between two amino acid / polynucleotide / polypeptide sequences, one must first prepare an alignment of the two sequences and then calculate the sequence identity value. The percentage of identity between two sequences can take different values ​​depending on (i) the method used to align the sequences, such as structural alignment from ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or 3D comparison, and (ii) the parameters used by the alignment method, such as local versus global alignment, the pair score matrix used (e.g., BLOSUM62, PAM250, Gonnet, etc.), and the gap penalty, such as functional morphology and a constant.

[0118] After alignment, there are many different ways to calculate the percentage of identity between two sequences. For example, the number of identities can be divided by (i) the length of the shortest sequence, (ii) the length of the alignment, (iii) the average length of the sequences, (iv) the number of gapless positions, or (iv) the number of equivalent positions excluding overhangs. Furthermore, it will be understood that the percentage of identity also depends considerably on length. Thus, the shorter the pair of sequences, the higher the sequence identity that can be expected to occur by chance.

[0119] Therefore, it will be understood that the precise alignment of protein or DNA sequences is a complex process. The common multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is a preferred method for generating multiple alignments of protein or DNA according to the present invention. Suitable parameters for ClustalW are as follows: For DNA alignment: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, and Matrix = Identity. For protein alignment: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, and Matrix = Gonnet. For DNA and protein alignment, ENDGAP = -1 and GAPDIST = 4. Those skilled in the art will recognize that these and other parameters may need to be modified for optimal sequence alignment.

[0120] Preferably, the percentage of identity between two amino acid / polynucleotide / polypeptide sequences is calculated from an alignment such as (N / T) × 100 (where N is the number of positions in which the sequences share identical residues, and T is the total number of compared positions including gaps but excluding overhangs). Therefore, the most preferred method for calculating the relative percentage of identity between two sequences includes (i) preparing a sequence alignment using the ClustalW program with a suitable set of parameters, for example, as described above, and (ii) inserting the values ​​of N and T into the following formula: Sequence Identity = (N / T) × 100.

[0121] Another method for identifying similar sequences will be known to those skilled in the art. For example, substantially similar nucleotide sequences are encoded by sequences that hybridize under stringent conditions to the nucleic acid sequences described herein or their complements. Stringent conditions mean that the nucleotides hybridize to filter-bound DNA or RNA in 3x sodium chloride / sodium citrate (SSC) at about 45°C, followed by at least one wash in 0.2x SSC / 0.1% SDS at about 20–65°C. Alternatively, substantially similar polypeptides may differ from the sequences shown herein by at least one, five, ten, twenty, fifty, or fewer than 100 amino acids.

[0122] Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence can be altered without substantially affecting the sequence of the protein it encodes, thereby providing functional variants. A suitable nucleotide variant is one in which the sequence is altered by the substitution of a different codon encoding the same amino acid in the sequence, thus resulting in a silent change. Other suitable variants include all or part of a sequence that has a homologous nucleotide sequence but is modified by the substitution of a different codon encoding an amino acid having a side chain with similar biophysical properties to the amino acid it substitutes for, resulting in a conserved change. For example, small nonpolar hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large nonpolar hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Therefore, those skilled in the art will know which amino acids may be replaced by amino acids with similar biophysical properties, and they will know the nucleotide sequences encoding these amino acids.

[0123] All features described herein (including the attached claims, abstract and drawings) and / or all steps of the methods or processes disclosed herein may be combined with any of the above embodiments in any combination, except for any combination in which at least some of such features and / or steps are mutually exclusive. [Brief explanation of the drawing]

[0124] To better understand the present invention and to illustrate how embodiments of the invention can be carried out, the accompanying figures are referenced hereby as examples.

[0125] [Figure 1] This table shows the characteristics of the phagemide-AAV (PAAV) virus particles according to the present invention, compared with conventional AAVP virus particles. [Figure 2] A schematic diagram shows embodiments of the helper phage and phagemide genome (PAAV) and phagemide-AAV (PAAV) particles produced by the helper and phagemide according to the present invention. Structural genes are essential for packaging DNA into viral particles and are supplied by replication-deficient helper phages. The phagemide genome is highly parasitic to the helper phage. Ultimately, PAAV particles are produced in yields far exceeding those of prior art systems. [Figure 3] This is a schematic representation of one embodiment of the phagemid genome (PAAV). [Figure 4] Figure 3 shows the locations of the f1 ori and pUC ori on the phagemid genome. [Figure 5] Figure 3 shows the location of the selection marker gene (AmpR) on the recombinant adeno-associated virus (rAAV) transgene cassette on the phagemide genome. [Figure 6]Figure 3 shows an rAAV transgene cassette on a phagemide genome containing a target gene (e.g., GFP) whose expression is driven by a CMV promoter and / or enhancer sequence and tailed with a polyA signal. The entire transgene cassette is flanked by terminal inverted repeat sequences (ITRs) from AAV. [Figure 7] Figure 3 shows one embodiment of a helper phage, a bacteriophage engineered to rescue phagemid particles from a prokaryotic host possessing a phagemid genome. [Figure 8] Figure 5 shows a portion of the genome of a helper phage containing the RGD4C-targeted peptide in the pIII minority coat protein. [Figure 9] A first embodiment of a method for producing phagemid-AAV (PAAV) particles is shown. [Figure 10] A second embodiment of a method for producing phagemid-AAV (PAAV) particles is shown. [Figure 11] This document presents one embodiment of a phage-based approach for in vitro AAV production, showing three vectors: (i) phagemide-AAV (PAAV), (ii) Rep-Cap phagemide, and (iii) adenohelper phagemide. [Figure 12] Figure 11 shows a genome map of one embodiment of the adenohelper phagemide vector. [Figure 13] Figure 11 shows a genome map of one embodiment of the Rep-Cap phagemide vector. [Figure 14] One embodiment of an integrated adenohelper-Rep-cap phagemide-AAV (PAAV) vector is shown. [Figure 15] Figure 11 shows a genome map of one embodiment of the integrated adenohelper-Rep-Cap phagemide vector. [Figure 16]The following describes embodiments of in situ AAV production using either the three phagemide vectors shown in Figures 11-13, or the integrated adenohelper-Rep-Cap-AAV phagemide vector shown in Figures 14 and 15. [Figure 17] Transmission electron microscopy (TEM) images of known AAVP vectors and the PAAV vector according to the present invention are shown. (A) RGD.AAVP.GFP filaments (pink) are typically 1455.02 nm long. (B) RGD.PAAV.GFP filaments (blue) are typically 729.96 nm long, and helper phages present in the viral sample (green) are typically 1186.03 nm long. [Figure 18] (A) Internalization of known AAVP vectors and the PAAV vector according to the present invention in 293AAV and (B) U87 cells after 2 and 4 hours. Flow cytometry analysis was performed using a gate threshold set for 20,000 events in the whole cell population. (n=3) *=p<0.05, **=p<0.01. [Figure 19] This shows the quantification of GFP-positive cells 9 days after transduction in (A) 293AAV, (B) 293AAV with DEAE.DEXTRAN, (C) U87, and (D) U87 with DEAE.DEXTRAN. Flow cytometry analysis was performed using a gate threshold set for 20,000 events of the total cell population. (n=3) *=p<0.05, **=p<0.01. [Figure 20] This shows the quantification of genomic copy number of rAAV-GFP derived from cell lysates after phagemid-induced gene transfer (A) or transfection with rAAV expression elements (B). (Experiment A: n=1, Experiment B: n=3). [Figure 21]This image shows immunofluorescence staining of UW228 and DAOY human medulloblastoma cells demonstrating the expression of αV, β3, and β5 integrin subunits and receptors for RGD4C-phagemide. Tumor cells were stained with primary rabbit anti-αV, β3, or β5 antibody (diluted 1:50 in PBS-1% BSA), followed by goat anti-rabbit AlexaFluor-488 secondary antibody (shown in green), and counterstained with 0.05 μg / ml DAPI (blue). Images were acquired using a confocal microscope. [Figure 22] This study demonstrates targeted gene delivery to pediatric medulloblastoma cells using RGD4C phagemide. Medulloblastoma cells (UW228) were grown in 96-well plates and then transduced with an RGD4C-phagemide vector containing the luciferase gene (RGD). Untreated cells or cells treated with a non-targeted vector (M13) were used as negative controls. Luciferase expression was monitored over time from day 2 to day 4 after transduction. [Figure 23] This report presents Western blot analysis showing the downregulation of mTOR expression in pediatric UW228 and DAOY medulloblastoma cells after treatment with RGD4C-phagemide containing mTOR / shRNA (RGD4C-mTOR / shRNA). Cell lysates were collected 4 days after vector treatment, and total protein was measured by BCA assay. Western blots were probed with a monoclonal antibody against human mTOR (cellular signaling). Untreated cells (control) and cells treated with RGD4C-phagemide (RGD4C) lacking mTOR / shRNA were used as negative controls. [Figure 24] This study describes the combined treatment of temozolomide (TMZ) and RGD4C-phagemide containing mTOR-targeting shRNA in medulloblastoma cells. Medulloblastoma cells (UW228 and DAOY) were transduced with either RGD4C-phagemide (RGD4C) or RGD4C-phagemide containing mTOR / shRNA (RGD4C-mTOR / shRNA). Untreated cells were also used as a control. Seven days after vector treatment, temozolomide (TMZ, 100 μM) was added to a small number of wells to evaluate the combined effect of the vector and chemotherapy. Images were taken eight days after vector treatment. [Figure 25] This shows the treatment of medulloblastoma cells with a TNFα vector. UW228 cells were treated with RGD4C-phagemide-TNFα (RGD4C / TNFα) and untargeted (ctr: control). A) TNFα expression in the culture medium of vector-treated cells, measured using human TNFα ELISA Max. B) Cell viability after TNFα expression, measured using the MTT assay. Error bars: mean ± standard error of the mean. [Figure 26] This image shows immunofluorescence staining of DIPG cells to demonstrate the expression of αV, β3, and β5 integrin subunits, which are receptors for RGD4C-phagemide. Cells were stained with primary rabbit antibody, followed by secondary goat anti-rabbit AlexaFluor-488 antibody. Control cells received only the secondary antibody. Images were acquired using a confocal microscope. [Figure 27] This study demonstrates the selective and dose-dependent delivery of gene expression to DIPG cells by RGD4C-phagemide / AAV. DIPG cells were treated with increased vector doses of RGD4C-phagemide-Luc (RGD4C), which contains the reporter Luc (luciferase) gene, at 1 × 10⁶ or 2 × 10⁶ TU / cell. Luc expression was measured daily. A non-targeted vector lacking RGD4C (control) was used as a negative control for targeting. Error bars: mean ± standard error of the mean. [Figure 28] Treatment with RGD4C-phagemide-TNFα is shown. DIPG cells were transduced with 2 x 10⁶ TU / cell RGD4C-phagemide-TNFα (RGD4C) and a non-targeted vector as a negative control. Apoptotic activity was measured 9 days after vector treatment using a caspase-Glo assay (caspase 3 / 7, caspase 8, and caspase 9). Error bars: mean ± standard error of the mean. *P≦0.05, **P≦0.01, ***P≦0.001. [Figure 29] This shows luciferase expression after transduction by RGD.PAAV at various concentrations of transduction units. [Figure 30] This shows luciferase expression after transduction by NT.PAAV at various concentrations of transduction units. [Figure 31] The percentage of PAAV vectors bound to the cell surface of 293 AAV cells is shown. Compared to each control, the RGD.PAAV vector had a binding efficiency of 58.2%, while the M13.PAAV vector had a binding efficiency of 7.1%. [Modes for carrying out the invention]

[0126] background The development of gene delivery technologies is beneficial for translating basic research into societal success. Over the past decade, numerous viral and non-viral vectors have emerged as potential delivery vectors for industrial and therapeutic applications. A key characteristic of vectors is that, in addition to being effective in delivering genes, they must be easily produced and commercially viable. In 2006, Hajitou et al. attempted to meet the need for such a vector by creating a hybrid between recombinant adeno-associated virus (rAAV) and filamentous bacteriophage (phage) called adeno-associated virus / phage (AAVP) (Nature protocols 2, 523-531 (2007); Cell). 125, 385-398 (2006). The resulting AAVP vectors possess desirable properties of mammalian and prokaryotic viruses, but without the drawbacks typically associated with their individual vectors. However, there are certain aspects of AAVP vectors where significant improvement is still possible. Among other things, this includes the genetic design of the vector, which affects its production and therapeutic properties. Ultimately, this results in the relatively low gene transfer efficiency of AAVP compared to mammalian viruses.

[0127] The research described herein concerns the design of the most advanced version of a phage gene delivery vector by using a so-called phagemide system, which employs a novel phagemide vector called phagemide / adeno-associated virion phagemide (i.e., PAAV), and their superiority over known and existing phage vectors, AAVP. Unlike the AAVP genome, which consists of an rAAV cassette inserted into a filamentous phage genome, the PAAV genome does not contain phage genes of arbitrary structure—a prokaryotic helper virus is required to facilitate vector assembly (Mol Ther 3, 476-484; Pharmaceutical Research 27, 400-420 (2010)). By separating the reproductive and therapeutic elements of the virus into a therapeutic vector containing the transgene and a separate helper virus containing the structural gene, the genome / vector size is substantially reduced, thereby significantly increasing the capacity of the transgene, which is a useful advantage for the application of the novel system to gene therapy. As a result, this leads to the capsid formation of eukaryotic viral genomes onto prokaryotic viral capsids, resulting in vectors as hybrids between eukaryotic genomes and prokaryotic capsids, which have enhanced production yields, gene transfer efficiency, and vector system flexibility for other applications.

[0128] As described in the following examples, the inventors have found that 1. Design and construct a hybrid phagemid-AAV vector (PAAV) particle expression system. 2. Characterize and determine whether phagemide / AAV vectors (PAAVs) are more efficient in gene transfer than known AAVP systems at various stages, including but not limited to the following: a. Binding to the cell surface, b. Internalization of vectors from the cell surface, c. Translocation of the vector genome to the host nucleus, and d. Recombinant transgene expression, 3. We determined whether the hybrid phagemide PAAV vector system could produce rAAV from mammalian producer cell lines.

[0129] Referring first to Figure 1, a table shows the characteristics of the phagemide-AAV (PAAV) particles (i.e., virions) according to the present invention compared with those of prior art AAVP virus particles. As can be seen from the figure, the PAAV particles of the present invention (6kb) are much smaller than known AAVP particles (14kb), meaning they have 42% less DNA and 50% shorter virus particles, and the PAAV particles are produced in a yield far exceeding that of prior art systems, AAVP (100 times). As a result, the PAAV particles of the present invention can hold a larger payload, which is very useful for delivering multiple transgenes in gene therapy approaches. Thus, we have demonstrated that the modified bacteriophage expression system (PAAV) can be used as a highly viral vector for gene therapy or large-scale production of viral vectors.

[0130] Example 1 - Phagemid-AAV vector (PAAV) construction Referring to Figure 2, embodiments of the helper phage genome and phagemide genome (PAAV DNA) of the present invention are shown, which, as also shown in Figure 1, are expressed together in prokaryotes to produce phagemide-AAV (PAAV) particles. The structural gene is essential for packaging the DNA into the viral particle and is supplied by the replication-deficient helper phage, which is detailed below. The phagemide genome is highly parasitic to the helper phage, meaning that it outperforms the replication-deficient helper phage in both replication and packaging.

[0131] A) Phagemid / AAV vector Referring here to Figure 3, one embodiment of a phagemide genome is shown, which is a plasmid containing two origins of replication and two other genetic elements. The phagemide genome requires two origins of replication to facilitate both its replication within a prokaryotic (e.g., bacterial) host and its packaging into phagemide particles when rescued by a helper virus.

[0132] Referring to Figure 4, the first origin of replication (ori) is a high copy number origin of replication (pUC ori) that enables the replication of a large number of double-stranded phagemids (dsDNA) within the prokaryotic host. The second origin of replication is a phage origin of replication (f1 ori) that enables replication to single-stranded DNA in plasmids, which can then be packaged into phagemid vector particles (PAAVs).

[0133] Referring to Figure 5, the phagemide genome contains selection marker genes. To ensure efficient replication of the phagemide genome within a prokaryotic host, selection markers (e.g., ampicillin resistance) are used to guarantee expression and exert selective pressure to prevent loss of the phagemide genome in the form of antibiotic resistance genes (which have their own promoters). This ensures the expression (and replication) of the phagemide genome when the prokaryotic host is cultured in the presence of the antibiotic to which the selection marker confers resistance.

[0134] Referring to Figure 6, the phagemide genome further contains a recombinant (adeno-associated virus, AAV) transgene cassette containing the transgene of interest. This may include, but is not limited to, polypeptides / proteins, short hairpin / small interference / short inducer RNA, or a combination of both. As just one example, the transgenes shown in Figure 6 encode GFP and human β-globin. Transgene expression is driven by a viral promoter (e.g., CMV) and / or enhancer sequence and tailed with a poly(A) signal to prevent degradation. The promoter may also be a mammalian and tumor-specific promoter in oncogene therapy applications (i.e., the promoter of glucose regulatory protein [grp78]). The entire transgene cassette is flanked by a terminal inverted repeat sequence (ITR) derived from AAV, which forms a protective hairpin structure that allows for the stable maintenance of the transgene cassette as concatemetic episomal (extrachromosomal) DNA within the nucleus of mammalian cells transduced by the phagemide particle. The ITR allows for the stable expression of the AAV transgene cassette over long periods.

[0135] Despite having a small genome, phagemids lack structural phage genes and therefore cannot package themselves into particles. Consequently, they require "rescue" by a helper virus, as shown in Figure 7, to provide the structural (i.e., capsid) proteins necessary for particle formation and efflux from the prokaryotic host. In conventional thinking, genetic elements within vectors are common and widely used in genetic engineering.

[0136] B) Helper phage Referring to Figure 7, the helper phage (referred to herein as M13KO7) is a bacteriophage specifically designed to rescue phagemide particles (i.e., PAAVs) from a prokaryotic host possessing and / or containing the phagemide genome shown in Figure 3. The helper phage contains a disrupted replication origin (p15a, moderate copy number) and a packaging signal that significantly reduces its ability to package itself into phage particles. As a result, the phagemide genome will outperform the helper phage in both replication and packaging.

[0137] To confer phagemide targeting properties (or multifunctional properties as described in the pamphlet in WO2014 / 184528), the helper phage genome must be engineered to do so, since the helper phage genome provides a structural capsid protein for phagemide particle assembly. For example, the helper genome may encode a pIII capsid minority coat protein configured to display a cell-targeting ligand that enables the delivery of the resulting PAAVP particles to desired target cells (e.g., tumors). It may also encode at least one pVIII capsid major coat protein configured to display an exogenous peptide on the resulting PAAV particles. Thus, in one embodiment, α V β3 and α VTo confer specificity to angiogenic tumor cells and tumor endothelial cells expressing β5 integrin, it is desirable to induce nine amino acid mutations in the pIII minority coat protein. Therefore, referring to Figure 8, the helper phage genome contains the RGD4C-targeted peptide (CDCRGDCFC-SEQ ID NO: 7).

[0138] Once the PAAVP phagemide genome and helper phage are constructed, they are used together to produce phagemide-AAV vector (PAAV) particles in a prokaryotic host, as will be discussed below.

[0139] Example 2 - Phagemid-AAV vector (PAAV) production The inventors have invented two different methods (Methods 1 and 2) for producing phagemide-AAV vector (PAAV) particles, which are shown in Figures 9 and 10.

[0140] Note: -TG1: An E. coli strain possessing a reproductive factor (F' pili). -2xYT:TG1 Liquid broth used for culturing E. coli. - Kanamycin: An antibiotic resistance selection marker present on helper phages. - Ampicillin: An antibiotic resistance selection marker present on phagemide vectors. -TYE Top Agar: A solid medium used for culturing TG1 E. coli, adapted from 2xTY by adding 1.25% bacterial agar.

[0141] Phagemid / AAV vector (PAAV) manufacturing method 1: Infectious rescue Referring to Figure 9, Add 4-5 ml of pre-cultured (overnight) TG1 E. coli containing the PAAV genome to 60 ml of 2xYT (100 μg / mL ampicillin) supplemented with 1.1% glucose. 2. Incubate the culture in a shaker (250 RPM) at 37°C. 3.OD 600As soon as it reaches the range of 0.5 to 0.8 (logarithmic period), at least 1 × 10 10 The transduction unit of the helper phage (M13KO7) is added to the culture. 4. Invert to mix. Incubate at 37°C for 30 minutes. 5. Pour the infected starter culture from Step 3 into a 2L flask containing 2xYT (100 μg / mL ampicillin + 25 μg / mL kanamycin) supplemented with 1% glucose, up to a final volume of 400-450 mL. 6. Incubate overnight in an orbital shaker at 37°C and 250 rpm for 16-20 hours. 7. Purify the phagemid (PAAV) particles from the culture supernatant.

[0142] The advantage of Method 1 is its very high yield.

[0143] Method 2 for producing phagemid / AAV vectors (PAAV): Stable producer cell lines Referring to Figure 10, Part 1: Production of Competent Producer Cell Lines 1. TG1-competent E. coli (Zymo Research, USA) was transformed with ssDNA genome derived from Helper Hedge M13KO7, and seeded on TYE top agar (50 μg / mL kanamycin). 1. Select individual colonies and inoculate them into 5 mL of 2xYT medium (50 μg / mL kanamycin) supplemented with 1% glucose. 2. Incubate overnight in an orbital shaker at 37°C and 250 rpm for 16-20 hours. 3. DNA is extracted from 5 mL of overnight culture using a commercially available extraction kit (QIAGEN, Netherlands), and true positive transformants are confirmed by electrophoresis on a 1% agarose gel (100 volts, 2.5 mA) against a DNA ladder. 4. Prepare chemically competent cells from the exact transformants identified in step 4 using a published protocol (conform to the one published by Krantz et al., UC Berkeley).

[0144] Part 2: PAAV Phagemid Particle Production 1. Transform the competent cell line created in Part 1 with a phagemid / AAV genome and seed it on TYE top agar (100 μg / mL ampicillin + 50 μg / mL kanamycin). 2. Select colonies and inoculate them into 5 mL 2xYT (100 μg / mL ampicillin + 50 μg / mL kanamycin) supplemented with 1% glucose. 3. Incubate in an orbital shaker at 37°C and 250 rpm for 4 hours. 4. Pour the infected starter culture from Step 3 into a 2L flask containing 2xYT (100 μg / mL ampicillin + 25 μg / mL kanamycin) supplemented with 1% glucose, up to a final volume of 400-450 mL. 5. Incubate overnight (16-20 hours) in an orbital shaker at 37°C and 250 rpm. 6. Purify the phagemid particles from the culture supernatant.

[0145] PAAV Phagemid Particle Purification 1. Transfer the warm overnight culture to a centrifuge bottle and pelletize the bacteria by centrifugation at 3300G, 4°C for 30 minutes. 2. Discard the pellets and transfer the supernatant to a clean centrifuge bottle. 3. Add 30% of the supernatant volume to each bottle along with ice-cold 20% PEG-8000 / 2.5M NaCl, and stir in a vortex motion to mix. 4. Incubate on ice for 4 to 24 hours. 5. Precipitate the phagemide particles by centrifugation at 10000G and 4°C for 30 minutes. Discard the supernatant. 6. Centrifuge the phagemid particle pellet at 10,000 G and 4°C for 1 minute to dry it. 7. Remove the remaining supernatant with PEG / NaCl. 8. Resuspend the phagemid particle pellet in 0.5-2 mL of PBS. 9. Filter the resuspended phagemid particle preparation using a 0.45 micron filter. 10. Keep the preparation at 4°C. This preparation is stable at 4°C for up to 2 years. 25% glycerol stock can be stored indefinitely at -80°C.

[0146] Example 3 - Use of phagemide-AAV vector (PAAV) for gene therapy technology Examples 1 and 2 describe the components of the present invention (i.e., the phagemid genome shown in Figure 3 and the helper phage shown in Figure 7) required to produce phagemid-AAV vector (PAAV) particles and two production methods. Once manufactured and purified, PAAV particles can have applications such as gene therapy.

[0147] As an example, the PAAVP particles described herein contain a GFP transgene, which can be easily detected by known assays to confirm successful delivery to target cells. In therapeutic applications, any transgene can be selected and manipulated into the phagemid genome shown in Figure 3, and then contained in the resulting PAAV particles. For example, the transgene could be any gene encoding a protein that may have therapeutic or industrial utility. For instance, the transgene could encode dystrophin, a blood coagulation factor, insulin, or a cytokine receptor subunit. The transgene could also encode a short hairpin / small interference / short induction RNA molecule used in RNAi therapy. The transgene could encode a combination of multiple polypeptides, nucleic acids, or both fused together using an internal ribosome entry site (IRES) or a viral fusion peptide (T2A peptide for in-frame fusion).

[0148] Example 4 - Use of phagemide-AAV vector (PAAVP) for in vitro AAV production In addition to gene therapy, the PAAVP particles described herein can be used in novel methods for producing adeno-associated virus (AAV). Phage-induced AAV production utilizes the ability of phagemide particles to package large amounts of dsDNA. A typical AAV production system consists of three main components: rAAV, rep-cap, and adeno helper genes, which function together in the production of recombinant AAV particles. The inventors have devised two different strategies.

[0149] Referring to Figure 11, the first strategy used is to produce three different phagemid vectors containing rAAV production elements. These are the phagemid-AAV vector (PAAV) (see Figure 3), the adenohelper phagemid particle (see Figure 12), and the rep-cap phagemid particle (see Figure 13). The basic structure of these particles is similar, as they contain two origins of replication and selection markers, as described in the phagemid / AAV construction section. However, a key difference is the transgene cassette. As shown in Figure 3, the Phagemid-AAV (PAAV) genome contains an AAV transgene cassette, while the adenohelper and rep-cap particles contain either an adenohelper transgene or a rep-cap transgene, as shown in Figures 12 and 13, respectively.

[0150] In another embodiment, the inventors genetically engineered a so-called “integrated construct” containing all the necessary elements within a single vector genome, as shown in Figures 14 and 15.

[0151] When introduced into the same mammalian producer cells (see Figures 11 and 14) on separate vectors or the same integrated vector, the rep-cap and adeno helper genes behave as transactive elements that facilitate the packaging of the rAAV genome into phagemide / AAV vectors. This production process is comparable to transient simultaneous transfection of three plasmids, however, in this case the plasmids are replaced with phagemide vectors containing the exact same elements.

[0152] The following describes a protocol for the induction of PAAV phagemide production by adeno-associated virus (AAV).

[0153] Note: DMEM: Dulbecco's modified Eagle medium. FBS: Fetal bovine serum, a growth aid. Complete medium: DMEM+10%FBS. EDTA: Ethyl-diaminetetraacetic acid, an ion chelator used to dissociate cells by sequestrating calcium ions necessary for tight junction formation. GlutaMax: A growth stimulant, an analog of L-glutamine.

[0154] Protocol for phagemid-induced AAV production: HEK293 cells are seeded in complete medium (DMEM supplemented with 10% FBS, 20 mM GlutaMax, penicillin / streptomycin, and non-essential amino acids) in a 1.15 cm tissue culture plate and grown for at least 48 hours until 80% confluence is reached. 2. Mix phagemid / AAV, rep-cap phagemid, and adenohelper phagemid to achieve a 1:1:1 transduction unit ratio in a total volume of less than 5 mL, or isolate an integrated vector (a single vector containing all three elements in a single particle) to achieve one million transduction units per cell. 3. Add an equal volume of serum-free DMEM (supplemented with 20 mM GlutaMax) to the transduction mixture prepared in Step 3. 4. Invert to mix. Incubate at room temperature for 15 minutes. 5. Wash the HEK293 cells seeded in Step 1 with PBS and repeat three times. 6. Add the transdermal mixture and gently stir in a vortex motion to uniformly disperse the mixture. 7. Incubate the cells in a cell culture incubator at 37°C and 5% CO2 for 72 hours. a. After a 6-hour incubation with the transduction mixture, supplement with an equal volume of complete medium (DMEM supplemented with 10% FBS, 20 mM GlutaMax, penicillin / streptomycin, and non-essential amino acids). b. After 24 hours, replace the medium with complete medium (DMEM supplemented with 10% FBS, 20 mM GlutaMax, penicillin / streptomycin, and non-essential amino acids).

[0155] rAAV purification: Add 1.05M EDTA solution to the culture medium in the tissue culture plate until it reaches a final concentration of 0.010M, and incubate at room temperature for 5 minutes. 2. Aspirate the cells and culture medium, grind them, and transfer them to a 50 mL centrifuge tube. 3. Pellet the cells by centrifugation at 1500 RPM for 5 minutes at room temperature. a. Optional: Collect the supernatant for further AAV purification. Resuspend the cell pellet in 4.2-5 mL of serum-free DMEM. 5. Lyse the cells in the suspension by performing four freeze-thaw cycles in an ethanol-dry ice bath and a water bath set to 37°C. 6. Centrifuge the cell lysate at 10,000 G for 10 minutes at room temperature. a. Separate the supernatant for quantification / further purification / concentration. b. Discard the pellets (fragments).

[0156] Example 5 - Use of a phagemide-AAV vector (PAAV) for in-situ AAV production Referring to Figure 16, the inventors have invented a method for in situ production of AAV particles using PAAV.

[0157] Firstly, the optimal dose (or multiple doses) of the three phagemide vectors or a combined vector are introduced in vivo via intravenous / subcutaneous / intraperitoneal or intramuscular / subcutaneous (or any of the aforementioned administration routes). The lesion tissue is a tumor displaying the relevant integrin, and therefore the targeted portion on the phagemide PAAV particle is the RGD4C sequence. The tumor should begin producing rAAV, which contains the viral transgene encoded on the hybrid phagemide particle, rather than wild-type AAV. Because these AAV particles naturally have a high affinity for mammalian tissue, they should autoinfect nearby sites and eradicate the tumor over a predetermined period of time.

[0158] Example 6 - Engineering of pseudoviruses for large-scale targeted gene transfer and recombinant adeno-associated virus production Transmission electron microscopy In characterizing the particles, the inventors imaged PAAV particles to demonstrate that the vector size is substantially reduced when using a phagemide-based vector system. Using transmission electron microscopy, the inventors imaged and measured the lengths of the PAAV and known AAVP particles of the present invention on a mesh copper TEM grid after negative staining with uranyl acetate (see Figure 17). The average AAVP particle had a length of 1455.02 nm (Figure 17A), while a typical PAAV particle according to the present invention had a length of only 729.96 nm (Figure 17B), which was found to represent a reduction of approximately 50% in particle size. Compared to the helper phage used to produce PAAV particles (typically 1186.03 nm, Figure 17B), the relative vector size is approximately 38% shorter than that of the helper virus.

[0159] The difference in vector size forms the basis of the theory that PAAV is more efficient as a gene delivery vector than AAVP. This is true not only in terms of production yield but also in the subsequent infection process when introducing and expressing the gene in mammalian cells. Therefore, we investigated the vector efficiency at various stages of infection, including binding, internalization, and gene expression, in 293AAV (a derivative of human fetal kidney 293) and the U87 glioblastoma cell line.

[0160] Vector internalization After binding, the vector undergoes receptor-mediated endocytosis by target cells. To investigate potential differences in vector internalization, the inventors assayed the number of internalized vectors in target cells at two time points (2 hours, 2H; 4 hours, 4H) using flow cytometry (see Figure 18). Compared to AAVP in both cell lines, the PAAV vector was found to be more effectively internalized at 2 hours (median fluorescence intensity (MFI) = 1031.7, 335 higher than AAVP, p<0.05), and to a greater overall degree of internalization at 4 hours. The MFI of PAAV at 2 hours was significantly higher than AAVP by 335 in 293AAV and 207 in U87 cells (p<0.05). At 4 hours after transduction, this difference was significantly larger in 293AAV (829 MFI, p<0.05) but less significant in U87 (157 MFI, not significant). Overall, MFI peaked in PAAV1-treated cells at 2092 (293 AAV, p<0.05, Figure 18A) and 1137 (U87, Figure 18B), significantly higher than AAVP, peaking at 1063 (293 AAV) and 980 (U87), respectively. This data demonstrates that PAAV consistently performed better than AAVP in terms of the rate and extent of internalization at both time points in both cell lines.

[0161] Green fluorescent protein expression after AAVP and PAAV-mediated gene transfer To investigate whether differences in vector internalization lead to increased gene expression, the inventors performed GFP expression assays using RGD and NT PAAV.GFP and AAVP.GFP vectors (see Figure 19). In this experiment, they also tested whether the addition of the cationic polymer DEAE.DEXTRAN (Dex), as described in WO2014 / 184529, could enhance gene transduction by increasing the bioavailability and endosomal escape of the PAAV vector. Nine days after transduction, cells were trypsin-treated, counted, and analyzed using a flow cytometer. Regardless of whether Dex was used to assist vector transduction, transgene expression was generally higher in 293AAV cells than in U87 cells. When using the vector alone, the targeted RGD.PAAV.GFP vector transduced target cells with higher efficacy compared to AAVP (7.7%, p<0.01 and 1.4%, p<0.05, respectively, in GFP+ve cells in 293AAV and U87 cells), resulting in 2.44-fold and 1.56-fold increases in 293AAV and U87 cells, respectively (Figure 19A, C).

[0162] However, the addition of Dex dramatically increased the gene expression of RGD.AAVP and RGD.PAAV vectors. In 293AAV cells, GFP expression in RGD.AAVP.GFP-treated cells increased to 25% with RGD. PAAV.GFP-treated cells substantially increased to 50% (all p<0.01), and the addition of Dex resulted in a 7.9-fold increase in gene expression for RGD.AAVP and a 6.5-fold increase for RGD.PAAVP (Figure 19B, D). In U87 cells, which are thought to be highly active to transduction, Dex was able to increase the gene expression of RGD.PAAV.GFP by more than 3.6 times compared to 4.8% GFP+ve cells (p<0.01) - this was not the case for RGD.PAAV.GFP, as Dex increased gene expression by only 1.5 times compared to 1.3% GFP+ve cells (p<0.05). Interestingly, Dex enabled transduction with the NT.PAAV (non-targeted) vector in 293AAV cells (7.34%), but not in U87 cells.

[0163] Phagemid-induced recombinant adeno-associated virus production To evaluate whether PAAV and phagemide-derived vectors could be used to produce rAAV in commercially available producer cell lines, the inventors transduced 293 AAV cells with three targeted vectors that typically require transfection for gene transfer. They were able to collect rAAV particles from cell lysates and quantify the rAAV gene copy number (GC) per mL over three time points after phagemide-induced transduction (Figure 20A). Compared to conventional transfection with FuGene6 (transfection reagent, 3.99e11 GC / mL, Figure 20B), phagemide-induced rAAV production resulted in a more than 1.9-fold increase in rAAV yield over 168 hours (7.69e11 GC / mL, Figure 21A). Because phagemide-induced gene transfer requires extensive intracellular processing (unlike transfection), it takes longer to express the viral gene and package it into functional particles. However, when comparing yields at the same 72-hour point, transfection showed a value 1.76e11 GC / mL higher than phage-induced rAAV production. The rAAV yield per 1 mL of culture supernatant from transfection or phage-induced production dishes at all time points was approximately 8–9e10 GC / mL with no observable trend (data not shown).

[0164] Example 7 - Construction and use of RGD4C-phagemid Tripeptide RGD is found in extracellular matrix proteins, including fibronectin. Integrins are α V By binding to the RGD motif located in fibronectin at the cell adhesion site to β3 integrin, it acts as a fibronectin receptor, and its specificity is demonstrated by sequentially inducing a 9-amino acid mutation in the pIII minority coat protein of recombinant phagemide particles. V β3 and α V This confers β5 integrin to tumor cells and angiogenic tumor-associated endothelial cells. Therefore, the genome of the second vector contains the RGD4C target peptide (CDCRGDCFC-SEQ ID NO: 7).

[0165] Referring to Figure 21, α V Immunofluorescence staining of UW228 and DAOY human medulloblastoma cells demonstrates the expression of β3 and β5 integrin subunits and the RGD4C-phagemide receptor. These data indicate that phagemide vectors containing the RGD4C-targeted peptide can be used for targeted gene delivery and gene therapy in pediatric brain tumors and medulloblastoma.

[0166] Referring to Figure 22, targeted gene delivery to pediatric medulloblastoma cells by RGD4C phagemide is shown over a 4-day time course. This data indicates that RGD4C-phagemide mediates efficient and selective gene delivery that is increased over time in medulloblastoma.

[0167] Figure 23 shows a Western blot analysis illustrating the downregulation of mammalian target rapamycin (mTOR) expression in pediatric UW228 and DAOY medulloblastoma cells after treatment with RGD4C phagemide containing mTOR / shRNA (RGD4C-mTOR / shRNA). These data demonstrate that RGD4C-phagemide can be successfully used to deliver shRNA in tumor cells to selectively and efficiently knock down the expression of therapeutic target mTOR.

[0168] Figure 24 shows the combined treatment of medulloblastoma cells, known to be temozolomide-resistant, with temozolomide (TMZ) and shRNA-containing RGD4C-phagemide against mTOR. This data demonstrates that targeted RGD4C-mTOR / shRNA can resensitize medulloblastoma cells to TMZ, achieving complete eradication of tumor cells. Therefore, targeted knockdown of mTOR expression by RGD4C-phagemide is an efficient strategy to use in combination with temozolomide against chemotherapy-resistant tumor cells such as medulloblastoma.

[0169] Figure 25 shows the treatment of medulloblastoma cells with a TNFα vector. Therefore, RGD4C / TNFα has therapeutic potential for use in killing target tumors such as medulloblastoma. Figure 26 shows the α receptor for RGD4C phagemide. V The image shows immunofluorescence staining of DIPG cells exhibiting expression of β3 and β5 integrin subunits. These data demonstrate that phagemide vectors containing RGD4C target peptides can be used for targeted gene delivery and gene therapy in pediatric brain tumors (DIPG).

[0170] Figure 27 shows the selective and dose-dependent delivery of gene expression to DIPG cells by RGD4C-phagemide / AAV. These data demonstrate that RGD4C-phagemide can successfully deliver gene expression to DIPG cells in a dose-dependent and selective manner. Figure 28 shows treatment with RGD4C-phagemide-TNFα. These data demonstrate that RGD4C-phagemide selectively delivers TNFα to DIPG cells, resulting in apoptosis induction. Therefore, RGD4C-phagemide-TNFα has therapeutic potential for use as a targeted therapy for DIPG cells.

[0171] Example 8: Luciferase expression of RGD4C-phagemide protocol: HEK cells were seeded in 48-well plates in complete medium (DMEM, 10% FCS, 1% glutamine, 1% penicillin / streptomycin) and incubated for at least 48 hours until 70–80% confluence was reached. The cells were then washed with PBS and transduced for 12 hours with a hybrid phage / phagemide vector suspended in serum-free medium (DMEM), after which the medium was resupplied with complete medium. Luciferase expression was measured by adding 10 μL of medium to 50 μL of prepared Quanti-luc (InvivoGen, USA) reagent. Light emission was measured using a plate reader equipped with a luminometer (promega, USA).

[0172] Figure 29 shows luciferase expression after transduction with RGD.PAAV at various concentrations of transduction units, and Figure 30 shows luciferase expression after transduction with NT.PAAV at various concentrations of transduction units. The graph shows the dose-dependent exponential relationship between time and expression of luciferase after incubation with various concentrations of hybrid phage / phagemide vectors. The numbers indicate that quantifiable gene expression can be achieved by phagemide vectors via secreted luciferase assays.

[0173] Example 9 - Binding of RGD.PAAV vector to 293 AAV cells. protocol: 293AAV cells were seeded in 24-well plates in complete medium (DMEM + 10% FCS, 1% glutamine, 1% penicillin / streptomycin) and incubated for a minimum of 48 hours to reach 70-90% confluence. The cells were washed twice with 500 μL of PBS, placed on ice, and transduced with PAAV vector at a concentration of 200,000 TU / cell (transduction units / cell) suspended in 200 μL of serum-free DMEM. After incubation on ice for 1 hour, the medium was collected from the wells, and the amount of phagemid particles was titrated with TG1 E. coli and quantified by colony counting.

[0174] Referring to Figure 31, the percentage of PAAV vectors bound to the cell surface of 293 AAV cells is shown. The RGD.PAAV vector had a binding efficiency of 58.2%, and M13 had no binding efficiency. The PAAV vectors had a binding efficiency of 7.1% compared to their respective controls.

[0175] discussion There is strong evidence suggesting that targeted PAAV vectors are more efficient than AAVP vectors in gene transfer in both commercial and disease cell lines. Both internalization and gene expression data consistently show that PAAV is more efficient than AAVP. Evidence is also provided suggesting a strong synergistic effect between Dex and PAAV vectors over AAVP in gene transfer. While these data suggest that PAAV is superior to AAVP, it must also be considered that PAAV vector samples may be contaminated with helper phage. Despite efforts to optimize experimental conditions during vector production, helper phage contamination (approximately 1 / 10 in this case) is unavoidable and competitively inhibits transduction because it also displays the RGD targeting sequence on its small coat protein. Considering this, the internalization and gene expression data may be severely underestimating the "true" efficacy of RGD.PAAV. Furthermore, since the internalization assay utilizes staining of intracellular phage capsids for signal detection, the smaller overall size of PAAV (and the available capsid protein per particle) means that the proportional number of internalized particles cannot be directly compared to the proportional number of AAVP, which, using TEM, is twice as long as PAAV particles. Therefore, the method of the present invention includes a purification step (e.g., FPLC) to remove helper phages.

[0176] In addition to providing mechanistic insights, future research must include replication of all experiments using pure PAAV samples. In particular, phagemid-induced rAAV production offers significant advantages compared to conventional transfection protocols, due to reduced competitive inhibition by helper phage contamination and several-fold higher rAAV particle yields.

[0177] overview The large-scale production of recombinant adeno-associated viruses (rAAV) poses a significant obstacle to gene therapy research, development, and commercialization. Despite being well-studied, rAAV production has been limited to laboratory scale due to scalability limitations. To date, transient transfection of "producer" cells has been the most common technique for obtaining high-purity rAAV vectors free from infectious contaminants, despite being extremely expensive. Therefore, alternative methods for gene transfer in rAAV production systems are highly justified.

[0178] Highly efficient hybrid phagemide vectors for gene transfer into mammalian cells have been described. By combining an rAAV transgene cassette with a phage capsid, it is possible to create a vector system that can be easily produced on a commercial scale. These phagemide / AAV (PAAV) vectors have very high cloning capacity, target mammalian cells, and do not require transfection reagents. The inventors have developed this platform technology for large-scale rAAV production, as it is possible to clone all the genetic elements for AAV production into one or more phagemide vectors. Novel large-scale rAAV production systems using PAAV and bacteriophage vectors have been developed in both adherent cells and cell suspensions. This platform technology will enable commercial virus production for clinical translation under GMP standards and will pave the way for commercial production of other biosynthetic systems.

Claims

1. Recombinant phagemide particles, wherein the recombinant phagemide particles comprise a bacteriophage capsid protein, an adeno-associated virus (AAV) transgene expression cassette, and a genome lacking at least 95% of the bacteriophage genome. The AAV transgene expression cassette is adjacent to a terminal inverted repeat (ITR), The recombinant phagemide particle genome includes a bacterial origin of replication and a bacteriophage origin of replication. Recombinant phagemide particles in which the recombinant phagemide particle genome lacks all structural genes encoding bacteriophage capsid proteins.

2. The recombinant phagemid particle according to claim 1, wherein the ITR is an AAV serotype ITR.

3. The recombinant phagemide particle according to claim 1 or 2, wherein the recombinant phagemide particle lacks bacteriophage structural genes necessary for particle formation, packaging, or efflux from a prokaryotic host.

4. The recombinant phagemid particle according to any one of claims 1 to 3, wherein the transgene expression cassette encodes an active factor that exerts a biological effect on target cells.

5. The recombinant phagemid particle according to claim 4, wherein the activating factor is a protein activating factor.

6. The recombinant phagemid particle according to claim 4, wherein the activating factor is an RNA activating factor.

7. The recombinant phagemide particle according to any one of claims 1 to 6, wherein the bacteriophage capsid protein comprises a capsid protein configured to display a cell-targeting ligand that enables delivery of the particle to a target cell.

8. The recombinant phagemid particle according to claim 7, wherein the capsid protein configured to display the cell-targeting ligand is a pIII minority coat protein.

9. The recombinant phagemid particle according to claim 7, wherein the capsid protein configured to display the cell-targeting ligand is the pVIII capsid major coat protein.

10. Recombinant phagemide particle according to any one of claims 1 to 9, wherein the bacteriophage capsid protein comprises a capsid protein configured to display an exogenous peptide thereon.

11. The recombinant phagemid particle according to claim 10, wherein the capsid protein configured to display an exogenous peptide thereon is the pVIII capsid major coat protein.

12. The recombinant phagemid particle according to claim 10, wherein the capsid protein configured to display an exogenous peptide thereon is a pIII minority coat protein.

13. The recombinant phagemid particle according to any one of claims 1 to 12, wherein the recombinant phagemid particle is combined with a cationic polymer for forming a composite having a net positive charge.

14. The recombinant phagemide particle according to claim 13, wherein the cationic polymer is selected from the group consisting of chitosan, poly-D-lysine (PDL), diethylaminoethyl (DEAE), diethylaminoethyl-dextran (DEAE.DEX), polyethyleneimine (PEI), polyblen, protamine sulfate, and cationic lipids.

15. The recombinant phagemide particle according to any one of claims 1 to 14, wherein the recombinant phagemide particle contains a DNA sequence that is advantageous for targeted integration into the host genome.

Citation Information

Patent Citations

  • Methods and compositions for adeno-associated virus phage particles

    JP2009534314A

  • Method for generating high titer helper-free preparation of recombinant AAV vector

    JP2013143940A

  • bacteriophage

    WO2014184529A1