Compositions and methods for inhibiting factor XII gene expression

Abstract

Described is an RNA interference agent for inhibiting the expression of factor XII (FXII) gene.Also described is a pharmaceutical composition comprising one or more FXII RNAi agents and one or more excipients that can deliver said RNAi agents to hepatocytes in vivo.The in vivo delivery of FXII RNAi agents to hepatocytes provides the inhibition of FXII gene expression and the treatment of angioedema, including hereditary angioedema (HAE), venous thromboembolism (VTE) and angioedema-related diseases.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 451,868, filed on 30 January 2017, the contents of which are incorporated herein by reference in their entirety.

[0002] Disclosed herein are RNA interference (RNAi) agents for inhibiting factor XII gene expression, compositions comprising FXII RNAi agents, and methods of using them. [Background technology]

[0003] Factor XII (also known as FXII, F12, or Hageman factor) is a serine protease primarily expressed in the liver and found in the blood. It has a dual function in both the endogenous coagulation pathway and the kinin-kallikrein system. The kinin-kallikrein system plays a role in inflammation, blood pressure regulation, coagulation, and pain. The active form of factor XII binds to and cleaves both factor XI in the coagulation cascade and prekallikrein in the kinin-kininogen system, producing active FXI and kallikrein, respectively.

[0004] Patients who completely lose FXII do not exhibit bleeding disorders. Furthermore, mice lacking FXII through gene knockout have been shown to be protected from thrombosis (Renne et al JEM 2005, 202:271-281). Thromboprotective effects of FXII loss have also been observed in FXII-inhibiting antibody-treated mice, rabbits, and primates (Larsson et al. Science Trans Med, 2014 6:22ra17). Current treatments for thromboembolic events target downstream enzymes in the coagulation pathway crucial for controlling blood loss associated with fibrin formation; therefore, treatment with these drugs has the drawback of potentially causing life-threatening bleeding. In particular, when factor Xa inhibitors are contraindicated, the administration of current anticoagulants increases the risk of major bleeding events.

[0005] Hereditary angioedema (HAE) is a rare disease characterized by frequent episodes of severe swelling. The most common body parts affected are the limbs, face, intestines, and airways. Episodes can occur spontaneously or be triggered by physical trauma or stress. Laryngeal (airway) edema can be life-threatening, as it can lead to death by suffocation. The main treatment options for HAE involve administration during attacks, focusing on either C1INH replacement, kallikrein inhibition, or bradykinin 2 receptor-mediated signaling. Currently, the only long-term preventive treatment is C1INH replacement therapy.

[0006] Previously discovered RNAi agents targeting FXII are, in particular, described in international patent application publication number WO2016 / 149331A2, which is incorporated herein by reference in its entirety as if fully described herein. Furthermore, FXII iRNA compositions are disclosed in international patent applications publication numbers WO2016 / 179342 and WO2017 / 120397. However, the sequences and modifications of the FXII RNAi agents disclosed herein differ from those previously disclosed or known in the art. The FXII RNAi agents disclosed herein potently and efficiently inhibit the expression of the FXII gene. [Overview of the Initiative]

[0007] There is a need for novel FXII RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) that can selectively and efficiently inhibit FXII expression. Furthermore, there is a need for novel FXII-specific RNAi agent compositions. Since both thrombosis (including venous thromboembolism, VTE) and angioedema are thought to be caused by hyperactive signaling in their respective pathways, inhibition of FXII gene expression would be particularly useful as a prophylactic treatment for thrombosis and / or angioedema.

[0008] In general, the disclosure herein features FXII RNA interference (RNAi) agents, compositions comprising FXII RNAi agents, and in vitro and / or in vivo methods for inhibiting the expression of the FXII gene using FXII RNAi agents and compositions comprising FXII RNAi agents. The FXII RNAi agents described herein can be used to treat conditions or diseases resulting from kinin kallikrein hyperactivation or intrinsic coagulation pathways, such as thrombosis and / or HAE.

[0009] The FXII gene-specific RNAi agents described herein can selectively and efficiently reduce FXII expression. The FXII RNAi agents described herein can be used in methods for the therapeutic treatment (including prophylactic treatment) of diseases and conditions associated with angioedema, including but not limited to hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor-associated angioedema, allergic angioedema, nonhistamine angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombotic occlusive diseases, and perioperative venous occlusive disease prevention. The use of the FXII RNAi agents described herein provides methods for the treatment and prevention of venous occlusive diseases such as deep vein thrombosis or pulmonary embolism, and for the treatment and prevention of arterial thromboembolic diseases. Such methods include administering the FXII RNAi agents described herein to a human or animal subject by any suitable means known in the art, such as subcutaneous injection or intravenous administration.

[0010] In one embodiment, the disclosure features an RNAi agent for inhibiting the expression of the human FXII gene, wherein the RNAi agent comprises a sense strand and an antisense strand. Also described herein is a composition comprising an RNAi agent capable of inhibiting the expression of the FXII gene, wherein the RNAi agent comprises a sense strand and an antisense strand, and further comprises at least one pharmaceutically acceptable excipient.

[0011] Each FXII RNAi agent described herein comprises a sense strand and an antisense strand. The sense strand and antisense strand may be partially, substantially, or completely complementary to each other. The length of the sense and antisense strands of the RNAi agents described herein may be 16 to 30 nucleotides, each. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides long. The sense and antisense strands may be the same length or of different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides long. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides long. In some embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. The RNAi agents described herein, whose sense and antisense strands may be of the same or different lengths, inhibit the expression of one or more FXII genes in vivo or in vitro when delivered to cells expressing FXII.

[0012] An FXII RNAi agent comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand of an FXII RNAi agent described herein comprises a nucleotide sequence having at least 85% identity with respect to the sequence in FXII mRNA over a core stretch of at least 16 consecutive nucleotides. In some embodiments, the sense strand core stretch having at least 85% identity with respect to the sequence in FXII mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long. In some embodiments, the sense strand core stretch having at least 85% identity with respect to the sequence in FXII mRNA is 19 nucleotides long. The antisense strand of an FXII RNAi agent comprises a nucleotide sequence having at least 85% complementarity with respect to the sequences in FXII mRNA and the corresponding sense strand over a core stretch of at least 16 consecutive nucleotides. In some embodiments, the antisense strand core stretch having at least 85% complementarity to the FXII mRNA sequence or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long.

[0013] In some embodiments, the FXII RNAi agents disclosed herein target a portion of the FXII gene having one of the sequences disclosed in Table 1.

[0014] Examples of sense and antisense strands of FXII RNAi agents that can be used are shown in Tables 2, 3, 4, and 6. Examples of double-stranded sequences containing FXII RNAi agents are shown in Tables 5 and 6. Examples of 19-nucleotide core stretch sequences consisting of or containing the sense and antisense strands of specific FXII RNAi agents disclosed herein are shown in Table 2.

[0015] In another embodiment, the disclosure features a method for delivering FXII RNAi agents in vivo to liver cells in a target such as a mammal. In some embodiments, one or more FXII RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. Nucleic acid delivery methods include encapsulation in liposomes, iontophoresis, or / or hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, protein vectors, or dynamic polyconjugates. TM Examples include, but are not limited to, incorporation into other vehicles such as (DPCs) (see, for example, WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, each incorporated herein by reference). In some embodiments, a delivery vehicle, such as a polymer, amphiphilic polymer, membrane-active polymer, peptide, such as melittin or melittin-like peptide, a reversibly modified polymer or peptide, or lipid, can be used with the FXII RNAi agents disclosed herein.

[0016] In some embodiments, the FXII RNAi agent is delivered to target cells or tissues by covalently binding or conjugating the RNAi agent to a target group such as an asialoclycoprotein receptor ligand. In some embodiments, the asialoclycoprotein receptor ligand comprises, or essentially comprises, a cluster of galactose or a galactose derivative cluster. In some embodiments, the FXII RNAi agent is conjugated to a target ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. Examples of target groups useful for delivering RNAi agents are disclosed, for example, in US Patent Application No. 15 / 452,324 and International Patent Application Publication No. WO2017 / 156012, which are incorporated herein by reference in their entirety.

[0017] The target group can be bound to the 3' or 5' end of the sense or antisense strand of the FXII RNAi agent. In some embodiments, the target group is bound to the 3' or 5' end of the sense strand. In some embodiments, the target group is bound to the 5' end of the sense strand. In some embodiments, the target group is bound to the nucleotides of the sense and / or antisense strands of the RNAi agent. In some embodiments, the target group is bound to the RNAi agent via a linker.

[0018] Target groups with or without linkers can link to either the 5' or 3' end of the sense and / or antisense chains described in Tables 2, 3, 4, and 6. Target groups with or without linkers can attach to either the 5' or 3' end of the sense and / or antisense chains described in Tables 2, 3, 4, and 6.

[0019] In another embodiment, the present disclosure features a composition comprising one or more FXII RNAi agents having the double-stranded structures disclosed in Table 5.

[0020] In another embodiment, the present disclosure features a composition comprising one or more FXII RNAi agents having the double-stranded structures disclosed in Table 6.

[0021] In some embodiments, this specification describes compositions comprising a combination or cocktail of at least two FXII RNAi agents having different nucleotide sequences. In some embodiments, two or more different FXII RNAi agents are each bound separately and independently to a target group. In some embodiments, two or more different FXII RNAi agents are each bound to a target group comprising or consisting of a target ligand containing one or more moieties that target an asialoclycoprotein receptor. In some embodiments, two or more different FXII RNAi agents are each bound to a target group comprising or consisting of a target ligand containing one or more galactose derivatives. In some embodiments, two or more different FXII RNAi agents are each bound to a target group comprising or consisting of a target ligand containing one or more N-acetyl-galactosamines. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent independently binds to the same target group. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent independently binds to a different target group, such as a target group having a different chemical structure.

[0022] In some embodiments, the target moiety is bound to the FXII RNAi agent without using an additional linker. In some embodiments, the target moiety is designed such that a linker is likely to be present to facilitate binding to the FXII RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents may be bound to their respective target moieties using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents are bound to their respective target moieties using different linkers respectively.

[0023] In another aspect, the present disclosure provides a method of inhibiting FXII gene expression in a subject, the method comprising administering to the subject an amount of an FXII RNAi agent capable of inhibiting the expression of the FXII gene, wherein the FXII RNAi agent comprises a sense strand and an antisense strand.

[0024] In some embodiments, there is provided a composition for in vivo delivery of an FXII RNAi agent to liver cells, particularly hepatocytes, the composition comprising an FXII RNAi agent conjugated to a target moiety. In some embodiments, the target moiety is an asialoglycoprotein ligand.

[0025] In some embodiments, there is provided a pharmaceutical composition comprising one or more FXII RNAi agents. In some embodiments, the FXII RNAi agent may be combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The additional therapeutic agent may be another FXII RNAi agent (e.g., an FXII RNAi agent targeting a different sequence within the FXII target). The additional therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, an aptamer, and / or a vaccine. The FXII RNAi agent with or without one or more additional therapeutic agents can form a pharmaceutical composition in combination with one or more excipients.

[0026] Also described is a method of treating a human subject having or at risk of developing a pathological condition (e.g., a condition or disease) in which the expression of FXII is at least partially involved, comprising administering to the subject a therapeutically effective amount of an FXII RNAi agent and / or a composition comprising an FXII RNAi agent. The method of treating a subject with an FXII RNAi agent and / or a composition comprising an FXII RNAi agent can optionally combine one or more additional (i.e., second) therapeutic agents or therapeutic steps. The FXII RNAi agent and the additional therapeutic agent can be administered alone or separately.

[0027] In some embodiments, disclosed herein is a method of treating (including prophylactic treatment) a pathological condition in which the expression of FXII is at least partially involved, comprising administering to the subject a therapeutically effective amount of an FXII RNAi agent comprising an antisense strand comprising any of the sequences of Table 2 or 3.

[0028] In some embodiments, disclosed herein is a method for inhibiting the expression of the FXII gene, comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences of Table 2 or 3.

[0029] In some embodiments, disclosed herein is a method of treating (including prophylactic treatment) a pathological condition (e.g., a condition or disease) in which the expression of FXII is at least partially involved, comprising administering to the subject a therapeutically effective amount of an FXII RNAi agent comprising a sense strand comprising any of the sequences of Table 2 or 4.

[0030] In some embodiments, disclosed herein is a method for inhibiting the expression of the FXII gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences of Table 2 or 4.

[0031] In some embodiments, the methods disclosed herein include methods for treating (including prophylactic treatment) pathological conditions mediated at least partially by FXII expression, comprising administering a therapeutically effective amount of an FXII RNAi agent to the target, comprising a sense strand containing a sequence of any of the sequences in Table 4 and an antisense strand containing a sequence of any of the sequences in Table 3.

[0032] In some embodiments, the methods disclosed herein for inhibiting the expression of the FXII gene include administering an FXII RNAi agent to cells comprising a sense strand containing one of the sequences in Table 4 and an antisense strand containing one of the sequences in Table 3.

[0033] In some embodiments, the methods disclosed herein for inhibiting the expression of the FXII gene include administering an FXII RNAi agent comprising a sense strand consisting of one of the nucleic acid base sequences in Table 4 and an antisense strand consisting of one of the nucleic acid base sequences in Table 3 to a target. In another embodiment, the methods disclosed herein for inhibiting the expression of the FXII gene include administering an FXII RNAi agent comprising a sense strand consisting of one of the modified sequences in Table 4 and an antisense strand consisting of one of the modified sequences in Table 3 to a target.

[0034] In some embodiments, the methods disclosed herein for inhibiting the expression of the FXII gene include administering one or more FXII RNAi agents having the double-stranded structure described in Table 5 to cells.

[0035] In some embodiments, the methods disclosed herein for inhibiting the expression of the FXII gene include administering one or more FXII RNAi agents having the double-stranded structure described in Table 6 to cells.

[0036] The FXII RNAi agents disclosed herein are designed to target a specific location (SEQ ID NO: 1) on the FXII gene. An antisense sequence is designed to target the FXII gene at a given location on the FXII gene if, as defined herein, the 5' terminal nucleic acid base of the antisense strand aligns with a position 19 nucleotides downstream (towards the 3' end) from that location on the gene when base-pairing with the gene. For example, as shown in Tables 1 and 2 herein, an antisense sequence designed to target the FXII gene at position 127 requires that the 5' terminal nucleic acid base of the antisense strand aligns with position 145 on the FXII gene when base-pairing with the gene. As provided herein, if the antisense strand and the gene spanning a core stretch sequence of at least 16 consecutive nucleotides are at least 85% complementary (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary), the FXII RNAi agent does not require the nucleic acid base at position 1 (5'→3') of the antisense strand to be complementary to the gene. For example, in the case of an FXII RNAi agent disclosed herein designed to target position 127 of the FXII gene, the 5' terminal nucleic acid sequence of the antisense strand of the FXII RNAi agent must align with position 145 of the gene, provided that the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides have at least 85% complementarity (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity), although the 5' terminal nucleic acid sequence of the antisense strand of the FXII RNAi agent must align with position 145 of the gene, although the 5' terminal nucleic acid sequence of the antisense strand may, though not required, be complementary to position 145 of the FXII gene. In particular, as seen in the various examples disclosed herein, the specific site of gene binding by the antisense strand of the FXII RNAi agent (e.g., whether the FXII RNAi agent is designed to target the FXII gene at position 127, 91, 321, or other positions) is very important to the degree of inhibition achieved by the FXII RNAi agent.

[0037] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where at least one or more nucleotides are modified nucleotides.

[0038] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where at least one or more nucleotides are modified nucleotides.

[0039] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where at least one or more nucleotides are modified nucleotides.

[0040] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), where at least one or more nucleotides are modified nucleotides.

[0041] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), where one or more nucleotides are modified nucleotides.

[0042] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where one or more nucleotides are modified nucleotides.

[0043] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where one or more nucleotides are modified nucleotides.

[0044] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), where one or more nucleotides are modified nucleotides.

[0045] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), where one or more nucleotides are modified nucleotides.

[0046] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), where one or more nucleotides are modified nucleotides.

[0047] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), where one or more nucleotides are modified nucleotides.

[0048] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), where one or more nucleotides are modified nucleotides.

[0049] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), where one or more nucleotides are modified nucleotides.

[0050] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence CCAAGGAGCAUAAGUACAAUU (Sequence ID 866), where one or more nucleotides are modified nucleotides.

[0051] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where one or more nucleotides are modified nucleotides.

[0052] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where one or more nucleotides are modified nucleotides.

[0053] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where one or more nucleotides are modified nucleotides.

[0054] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), where one or more nucleotides are modified nucleotides.

[0055] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), where one or more nucleotides are modified nucleotides.

[0056] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where one or more nucleotides are modified nucleotides.

[0057] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), where one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where one or more nucleotides are modified nucleotides.

[0058] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where all or substantially all nucleotides are modified nucleotides.

[0059] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where all or substantially all nucleotides are modified nucleotides.

[0060] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where all or substantially all nucleotides are modified nucleotides.

[0061] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), where all or substantially all nucleotides are modified nucleotides.

[0062] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), where all or substantially all nucleotides are modified nucleotides.

[0063] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where all or substantially all nucleotides are modified nucleotides.

[0064] In some embodiments, the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), where all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where all or substantially all nucleotides are modified nucleotides.

[0065] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896).

[0066] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827).

[0067] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855).

[0068] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846).

[0069] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829).

[0070] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868).

[0071] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866).

[0072] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD05333.

[0073] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD04131.

[0074] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD04157.

[0075] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD04254.

[0076] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD04623.

[0077] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD04625.

[0078] In some embodiments, the FXII RNAi agent contains, comprises, or essentially comprises a double-stranded structure of AD04627.

[0079] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUG (SEQ ID NO: 23), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 23 is located at positions 1 to 19 (5'→3') of the antisense strand.

[0080] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UGGUCUUUCACUUUCUUGG (Sequence ID 51), where one or more nucleotides are modified nucleotides, and Sequence ID 51 is located at positions 1 to 19 (5'→3') of the antisense strand.

[0081] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 87 is located at positions 1 to 19 (5'→3') of the antisense strand.

[0082] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 90 is located at positions 1 to 19 (5'→3') of the antisense strand.

[0083] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 93 is located at positions 1 to 19 (5'→3') of the antisense strand.

[0084] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 37 is located at positions 1 to 19 (5'→3') of the antisense strand.

[0085] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 804 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0086] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 751 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0087] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 673 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0088] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 793 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0089] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 767 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0090] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 805 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0091] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 787 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0092] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804) and a sequence that is 0, 1, 2, or 3 nucleotides different, where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 804 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896).

[0093] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751) and 0, 1, 2, or 3 nucleotides different therefrom, where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 751 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827).

[0094] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673) and a sequence that is 0, 1, 2, or 3 nucleotides different, where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 673 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855).

[0095] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793) and 0, 1, 2, or 3 nucleotides different therefrom, where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 793 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of the nucleic acid sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846).

[0096] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 767 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829).

[0097] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 805 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868).

[0098] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where at least one or more nucleotides are modified nucleotides, SEQ ID NO: 787 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent contains or consists of a sequence that is 0, 1, 2, or 3 nucleotides different from the nucleic acid sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866).

[0099] The FXII RNAi agents described herein may contain one or more modified nucleotides. Furthermore, the FXII RNAi agents described herein may also contain one or more phosphorothioate nucleoside bonds.

[0100] The FXII RNAi agents described herein may also include one or more target groups or conjugate groups. In some embodiments, the FXII RNAi agents disclosed herein include one or more target groups. In some embodiments, the target group comprises an asialoclycoprotein receptor ligand. In some embodiments, the asialoclycoprotein receptor ligand comprises galactose or a galactose-derivative cluster. In some embodiments, the galactose-derivative cluster comprises N-acetyl-galactosamine. In some embodiments, the target ligand comprises an N-acetyl-galactosamine trimer. In some embodiments, the target group is conjugated to the sense strand of the FXII RNAi agent disclosed herein.

[0101] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (5'→3') (SEQ ID NO: 404), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0102] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usGfsgucuuUfcAfcUfuUfcuuggsusu (5'→3') (SEQ ID NO: 289), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0103] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (5'→3') (SEQ ID NO: 300), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0104] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (5'→3') (SEQ ID NO: 319), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0105] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (5'→3') (SEQ ID NO: 304), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0106] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (5'→3') (SEQ ID NO: 375), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0107] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (5'→3') (SEQ ID NO: 377), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0108] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence (5'→3') of usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3') (SEQ ID NO: 643) of (NAG37)gsccaaggaGfCfAfuaaguacaaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is inverse debased deoxyribose (invAb); and (NAG37) is a target ligand containing N-acetylgalactosamine having the structure shown in Table 7 of this specification.

[0109] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usGfsgucuuUfcAfcUfuUfcuuggsusu (SEQ ID NO: 289) (5'→3'), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3')(SEQ ID NO: 1277) of (NAG25)sasaccaagaAfAfGfugaaagacc(invdA), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invdA) is inverted deoxyriboadenosine (invdA); and (NAG25) is a target ligand containing N-acetyl-galactosamine having the structure shown in Table 7 of this specification.

[0110] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence (5'→3') of usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (SEQ ID NO: 300), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3')(SEQ ID NO: 519) of (NAG25)sasggaacucAfAfUfaaagugcuuas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is inverse debased deoxyribose (invAb); and (NAG25) is a target ligand containing N-acetylgalactosamine having the structure shown in Table 7 of this specification.

[0111] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence (5'→3') of usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (SEQ ID NO: 319), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3')(SEQ ID NO: 526) of (NAG25)sascucaauaAfAfGfugcuuugaaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is inverse debased deoxyribose (invAb); and (NAG25) is a target ligand containing N-acetylgalactosamine having the structure shown in Table 7 of this specification.

[0112] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence (5'→3') of usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (SEQ ID NO: 304), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3')(SEQ ID NO: 610) of (NAG37)sasacucaauAfAfAfgugcuuugaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is inverse debased deoxyribose (invAb); and (NAG37) is a target ligand containing N-acetylgalactosamine having the structure shown in Table 7 of this specification.

[0113] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375) (5'→3'), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3') (SEQ ID NO: 611) of (NAG37)scsccaaggaGfCfAfuaaguacaaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is inverse debased deoxyribose (invAb); and (NAG37) is a target ligand containing N-acetylgalactosamine having the structure shown in Table 7 of this specification.

[0114] In some embodiments, the antisense strand of the FXII RNAi agent contains or consists of the sequence (5'→3') of usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (SEQ ID NO: 377), and FXII The sense strand of the RNAi agent contains or consists of the sequence (5'→3')(SEQ ID NO: 613) of (NAG37)s(invAb)sccaaggAfGfCfauaaguacaauus(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is inverse debased deoxyribose (invAb); and (NAG37) is a target ligand containing N-acetylgalactosamine having the structure shown in Table 7 of this specification.

[0115] In some embodiments, the FXII described herein The RNAi agent contains one or more target groups having the structures of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s as listed in Table 7.

[0116] In some embodiments, the FXII RNAi agents described herein have (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), listed in Table 7, at the 5' end of the sense strand. It contains one target group having the structure (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0117] The FXII RNAi agents disclosed herein can be incorporated into a composition comprising one or more disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient. In some embodiments, the composition disclosed herein comprising one or more FXII RNAi agents and at least one pharmaceutically acceptable excipient is a pharmaceutical composition.

[0118] A pharmaceutical composition comprising one or more FXII RNAi agents can be administered in a variety of ways, depending on whether topical or systemic treatment is desired. Administration can be carried out by any method commonly known in the art, but is not limited to intravenous, intra-arterial, subcutaneous, intraperitoneal, subcutaneous (e.g., via an implantable device), and intraparenchymal. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0119] In some embodiments, a composition comprising one or more disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient may further comprise one or more additional therapeutic or therapeutic agents.

[0120] In some embodiments, the compositions described herein, comprising one or more FXII RNAi agents, are packaged in kits, containers, packs, dispensers, pre-filled syringes, or vials. In some embodiments, the compositions described herein are administered parenterally.

[0121] The FXII RNAi agents and compositions comprising the same disclosed herein may be administered to subjects for the treatment (including prophylactic treatment) of pathological conditions (e.g., conditions or diseases) that are at least partially mediated by FXII expression. Examples of conditions or diseases that may be treated, prevented, and / or controlled by the administration of the FXII RNAi agents and compositions comprising the same disclosed herein include HAE, AAE, ACE inhibitor-associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thromboembolic diseases, and perioperative venous occlusive disease prevention.

[0122] As used herein, the terms “oligonucleotide” and “polynucleotide” mean polymers of linked nucleosides, each independently modified or unmodified.

[0123] As used herein, “RNAi agent” (also referred to as “RNAi trigger”) means a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of sequence-specific degradation or inhibition of the translation of a messenger RNA (mRNA) transcript of a target mRNA. As used herein, RNAi agents may act via an RNA interference mechanism (i.e., induction of RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. As used herein, RNAi agents are considered to act primarily via an RNA interference mechanism, but the RNAi agents disclosed herein are not constrained or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), small hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the target mRNA (e.g., FXII mRNA). RNAi agents may contain one or more modified nucleotides and / or one or more nonphosphodiester bonds.

[0124] As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” used to refer to the expression of a given gene mean that the expression of the gene, as measured by the level of RNA transcribed from the gene, or the level of polypeptides, proteins, or protein subunits translated from the mRNA of the cells, cell populations, tissues, organs, or subjects from which the gene transcribes, is lower when those cells, cell populations, tissues, organs, or subjects are treated with the RNAi agents described herein compared to cells, cell populations, tissues, organs, or subjects that are not treated in this manner.

[0125] As used herein, the terms “sequence” and “nucleotide sequence” mean a sequence or order of nucleic acid bases or nucleotides described by a sequence of letters using standard nomenclature.

[0126] As used herein, “base,” “nucleotide base,” or “nucleic acid base” are heterocyclic pyrimidines or purine compounds, which are standard building blocks of all nucleic acids and include the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). Nucleic acid bases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. As used herein, the term “nucleotide” may include modified nucleotides (e.g., nucleotide mimics, debasalized residues (Ab), or surrogate replacement moieties).

[0127] As used herein, and unless otherwise expressly stated, when describing a first nucleic acid base or sequence (e.g., an RNAi agent sense strand or targeted mRNA) in relation to a second nucleic acid base or sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide), the term “complementary” means the ability of an oligonucleotide or polynucleotide containing the first sequence to hybridize with a ligonucleotide or polynucleotide containing the second sequence (forming base-pair hydrogen bonds under mammalian physiological conditions (or in vitro analogous conditions)) and to form a double-stranded or double-helical structure under certain standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and also include natural or modified nucleotides, or nucleotide mimics, to the extent that they satisfy at least the hybridization requirements described above. Sequence identity or complementarity is independent of modification. For example, as defined herein, a and Af are complementary to U (or T) and identical to A for the purpose of determining identity or complementarity.

[0128] As used herein, “perfectly complementary” or “fully complementary” means that all (100%) nucleic acid bases or nucleotides in the sequence of the first polynucleotide hybridize with the same number of nucleic acid bases or nucleotides in the sequence of the second polynucleotide. The sequence may consist of all or part of the first or second base sequence.

[0129] As used herein, “partially complementary” means that in a hybridize pair of nucleic acid base sequences, at least 70% of, but not all, of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide.

[0130] As used herein, “substantially complementary” means that in a hybridize pair of nucleic acid base sequences, at least 85% of, but not all, of the bases in the sequence of the first polynucleotide hybridize with the same number of bases in the sequence of the second polynucleotide. The terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used herein with respect to nucleic acid bases or nucleotides that match between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of FXII mRNA.

[0131] As used herein, the terms “substantially identical” or “substantial identity,” when applied to nucleic acid sequences, mean that a nucleic acid sequence has at least about 85% sequence identity with respect to a reference sequence, e.g., at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two sequences that are optimally aligned in a comparison window. The percentage is calculated by determining the number of positions that are identical nucleic acid bases in either sequence to find the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to determine the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences that are substantially identical to those disclosed herein.

[0132] As used herein, the terms “treat,” “treatment,” etc., mean a method or process performed to alleviate or reduce the number, severity, and / or frequency of one or more symptoms of the disease in question. As used herein, “treat” and “treatment” may also include prevention, control, prophylactic treatment, and / or suppression of the number, severity, and / or frequency of one or more symptoms of the disease in question.

[0133] As used herein, when referring to RNAi agents, the phrase “introduction into cells” means functionally delivering the RNAi agent to cells. The phrase “functional delivery” means delivering the RNAi agent to cells in such a way that it can have the biological activity expected of the RNAi agent, such as sequence-specific inhibition of gene expression.

[0134] Unless otherwise specified, the following symbols used in this specification [ka] The use of means that any group may be bonded to it, insofar as it is within the scope of the invention described herein.

[0135] As used herein, the term "isomer" refers to a compound having the same molecular formula but differing in properties, arrangement of atomic bonds, or spatial arrangement of atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," while stereoisomers that are mirror images that cannot be superimposed are called "enantiomers," or sometimes called optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0136] As used herein, unless otherwise specified that a structure has a particular stereostructure, for each structure in which the presence of a chiral center results in an enantiomer, diastereomer, or other stereoisomer, each structure disclosed herein is intended to represent all possible such isomers, including optically pure and racemic forms. For example, the structures disclosed herein are intended to include not only single stereoisomers but also mixtures of diastereomers.

[0137] The expression "consisting of" as used in any claim of this application excludes elements, processes, or components not specified in that claim. The expression "consisting essentially of" as used in any claim of this application limits the scope of that claim to the specified materials or processes, and processes that do not substantially affect the basic and novel properties of the invention described in the claim.

[0138] Those skilled in the art will readily understand and recognize that the compounds and compositions disclosed herein may be in a protonated or deprotonated state with certain atoms (N, O, or S atoms) depending on the environment in which the compound or composition is located. Therefore, the structures disclosed herein as used herein assume that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. This disclosure is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art.

[0139] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art. Methods and materials similar to or equivalent to those described herein may be used in carrying out or testing the present invention, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated in their entirety by reference. In case of any conflict, this specification shall prevail, including definitions. Furthermore, materials, methods, and practices are for illustrative purposes only and are not intended to limit the scope of the invention.

[0140] Other objects, features, embodiments, and advantages of the present invention will be apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawing]

[0141] [Figure 1] Figure 1 is a graph showing the knockdown of mice treated with a single subcutaneous administration of 3 mg / kg of the FXII RNAi agent AD03632 on day 1, compared to mice treated with physiological saline. The standard error of the mean is shown as an error bar graphed above the mean.

[0142] [Figure 2] Figure 2 is a graph showing knockdown in mice treated with (i) a single subcutaneous administration of 0.6 mg / kg of the FXII RNAi agent AD03632 (dashed line with triangle), (ii) a single subcutaneous administration of 2 mg / kg of the FXII RNAi agent AD03632 (solid line with triangle), and (iii) physiological saline (solid line with circle). The standard deviation is shown as graphed error bars above the mean.

[0143] [Figure 3]Figure 3 is a graph showing knockdown in mice treated with (ii) a single subcutaneous dose of 0.6 mg / kg of the FXII RNAi agent AD03632 weekly for six consecutive weeks starting from day 1 (dashed line with a square), (ii) subcutaneous administration of 2 mg / kg of the FXII RNAi agent AD03632 once weekly for six consecutive weeks starting from day 1, and (iii) physiological saline (solid line with a circle). The standard error of the mean is shown as an error bar graphed above the mean.

[0144] [Figure 4] Figure 4 is a plot showing FXII serum levels in rats treated on day 1 by a single subcutaneous administration of (i) physiological saline, (ii) heparin (1000 U / kg, administered via intubation), (iii) 1 mg / kg of FXII RNAi agent AD03224, or (iv) 3 mg / kg of FXII RNAi agent AD03224.

[0145] [Figure 5] Figure 5 is a plot showing the weight of thrombi taken on day 14 from an arteriovenous shunt model in rats after a single subcutaneous administration on day 1 of either (i) physiological saline, (ii) heparin, (iii) 1 mg / kg of FXII RNAi agent AD03224, or (iv) 3 mg / kg of FXII RNAi agent AD03224. [Modes for carrying out the invention]

[0146] RNAi agents This specification discloses RNAi agents (also referred to herein as FXII RNAi agents or FXII RNAi triggers) for inhibiting the expression of the factor XII gene. Each FXII RNAi agent comprises a sense strand and an antisense strand. The sense strand and antisense strand may each be 16 to 30 nucleotides long. In some embodiments, the sense and antisense strands may each be 17 to 26 nucleotides long. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 21 nucleotides long. In some embodiments, the sense and antisense strands are each 21 to 26 nucleotides long. In some embodiments, the sense and antisense strands are each 21 to 24 nucleotides long. In some embodiments, the sense strand is about 19 nucleotides long and the antisense strand is about 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides long and the antisense strand is about 23 nucleotides long. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, both the sense and antisense strands are 21 nucleotides long. In some embodiments, the sense strand is 22 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense and antisense strands of the RNAi agent are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In some embodiments, the double-stranded RNAi agent has a double-stranded length of approximately 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0147] In some embodiments, the region of complete or substantial complementarity between the sense and antisense strands is 16–26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides long and is located at or near the 5' end of the antisense strand (for example, this region may be 0, 1, 2, 3, or 4 nucleotides away from the 5' end of the antisense strand that are not completely or substantially complementary).

[0148] The sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleic acid bases long. The core stretch sequence of the antisense strand is 100% (completely) complementary or at least about 85% (substantially) complementary to the base sequence present in the FXII mRNA target (e.g., also referred to as the target sequence). The core stretch sequence of the sense strand is 100% (completely) complementary or at least about 85% (substantially) complementary to the core stretch sequence of the antisense strand, and therefore the core stretch sequence of the sense strand is completely identical or at least about 85% identical to the base sequence present in the FXII mRNA target (target sequence). The core stretch sequence of the sense strand may be the same length as the corresponding antisense core sequence, or it may be a different length. In some embodiments, the core stretch sequence of the antisense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long. In some embodiments, the core stretch sequence of the sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long.

[0149] Examples of nucleotide sequences used to generate FXII RNAi agents are shown in Tables 2, 3, 4, and 6. Examples of FXII RNAi double-stranded agents containing the sense and antisense strand sequences from Tables 2, 3, and 4 are shown in Table 5.

[0150] The sense and antisense strands of the FXII RNAi agent anneal to form a double helix. The sense and antisense strands of the FXII RNAi agent may be partially, substantially, or completely complementary to each other. Within the complementary double-stranded region, the core stretch sequence of the sense strand is at least 85% or 100% complementary to the antisensor core stretch sequence. In some embodiments, the sense strand core stretch sequence includes a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisens core stretch sequences of the FXII RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that constitute at least 85% or 100% base pairs).

[0151] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from either the antisense strand sequence in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from either the sense strand sequence in Table 2 or Table 4 by 0, 1, 2, or 3 nucleotides.

[0152] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 6 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any of the sense strand sequences in Table 6 by 0, 1, 2, or 3 nucleotides.

[0153] The sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at either the 3' or 5' end of the core stretch sequence, or at both the 3' and 5' ends. If present, the additional nucleotides on the antisense strand may or may not be complementary to the sequence of the corresponding FXII mRNA. If present, the additional nucleotides on the sense strand may or may not be identical to the sequence of the corresponding FXII mRNA. If present, the additional nucleotides on the antisense strand may or may not be complementary to the additional nucleotides on the corresponding sense strand.

[0154] As used herein, the extension includes 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core stretch sequence and / or antisense strand core stretch sequence. The sense strand extension nucleotides may or may not be complementary to any of the nucleotides in the core stretch sequence or extension nucleotides of the corresponding antisense strand. Conversely, the antisense strand extension nucleotides may or may not be complementary to any of the nucleotides in the core stretch nucleotides or extension nucleotides of the corresponding sense strand. In some embodiments, both the sense strand and antisense strand of the RNAi agent include 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of one strand form base pairs with one or more 5' extension nucleotides of the other strand. In another embodiment, one or more 3' extension nucleotides of one strand do not form base pairs with one or more 5' extension nucleotides of the other strand. In some embodiments, the FXII RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension.

[0155] In some embodiments, the FXII RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In another embodiment, the FXII RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides complementary to the corresponding FXII mRNA sequence. In some embodiments, the 3' antisense strand extension comprises or consists of one of the following sequences, but are not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each represented from 5' to 3').

[0156] In some embodiments, the 3' end of the antisense strand may contain an additional debasing residue (Ab). The “debasing residue” or “debasing site” is a nucleotide or nucleoside lacking a nucleic acid base at position 1 of the sugar. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the debasing residue may be added as an inverse debasing residue (invAb) (see Table 7). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16).

[0157] In some embodiments, the FXII RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in the FXII mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each represented 5'→3').

[0158] In some embodiments, the 3' end of the sense strand may contain additional debasic residues. In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, one or more debasic residues added to the 3' end of the sense strand are inverse (invAb). In some embodiments, one or more inverse debasic residues or debasic sites may be inserted between the target ligand and the nucleic acid base sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverse debasic residues or debasic sites at or near one or more ends of the sense strand of the RNAi agent can enhance the activity or other desirable properties of the RNAi agent.

[0159] In some embodiments, the FXII RNAi agent includes a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides include uracil or adenosine nucleotides or nucleotides corresponding to nucleotides in the FXII mRNA sequence. In some embodiments, the sense strand 5' extension includes, but is not limited to, one of the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each denoted from 5' to 3'). The sense strand may include a 3' extension and / or a 5' extension.

[0160] In some embodiments, the 5' end of the sense strand may contain one or more additional debasic residues (e.g., (Ab) or (AbAb)). In some embodiments, the one or more debasic residues added to the 5' end of the sense strand may be inverse (e.g., invAb). In some embodiments, one or more inverse debasic residues may be inserted between the target ligand and the nucleic acid base sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverse debasic residues at or near one or both ends of the sense strand of the RNAi agent may enhance the activity or other desirable properties of the RNAi agent. In some embodiments, debasic (deoxyribose) residues may be substituted with ribitol (debasic ribose) residues.

[0161] In some embodiments, the 3'-terminal core stretch sequence of the antisense strand, or the 3'-terminal sequence of the antisense strand, may include an inverse debase residue (invAb (see Table 7)).

[0162] Examples of sequences used in forming FXII RNAi agents are listed in Tables 2, 3, 4, and 6. In some embodiments, the FXII RNAi agent antisense strand includes any sequence from Tables 2, 3, or 6. In some embodiments, the FXII RNAi agent antisense strand includes nucleotide (5'-to-3' end) sequences 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any sequence from Tables 2, 3, or 4. In certain embodiments, the FXII RNAi agent antisense strand includes or consists of any modified sequence from Table 4. In some embodiments, the FXII RNAi agent sense strand contains one of the sequences in Tables 2, 3, or 5. In some embodiments, the FXII RNAi agent sense strand contains nucleotides (5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-2 The sequence includes or consists of the sequence 1, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 2-26, 7-24, 7-25, or 7-26.

[0163] In some embodiments, the sense and antisense strands of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is a blunt end. As used herein, a blunt end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0164] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand and may form either a 3' or 5' overhang. In some embodiments, the RNAi agent includes a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends.

[0165] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can maintain the activity of these compounds within cells while simultaneously enhancing their serum stability, and minimize the potential for activating interferon activity in humans upon administration of such polynucleotide or oligonucleotide constructs.

[0166] In some embodiments, the FXII RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the FXII RNAi agent is prepared as a sodium salt. Such forms are within the scope of the invention disclosed herein.

[0167] Modified nucleotides In some embodiments, the FXII RNAi agent comprises one or more modified nucleotides. As used herein, “modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, debasalized nucleotides (represented herein as Ab), 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleic acid base-containing nucleotides, cross-linked nucleotides, peptide nucleic acids (PNAs), and 2',3'-seconucleotide mimics (unlocked nucleic acid base analogs, represented herein as N UNA (or represented as NUNA), locked nucleotide (N in this specification) LNA (or represented as NLNA), 3'-O-methoxy(2'-nucleoside bonded) nucleotide (represented herein as 3'-OMen), 2'-F-arabinonucleotide (represented herein as NfANA or Nf ANAExamples include 5'-Me, 2'-fluoronucleotides (represented herein as 5Me-Nf), morpholinonucleotides, vinylphosphonate deoxyribonucleotides (represented herein as vpdN), vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides (cPrpN). Examples of 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of a 5-membered sugar ring) include, but are not limited to, 2'-O-methylnucleotides (represented herein as a lowercase "n" in the base sequence), 2'-deoxy-2'-fluoronucleotides (represented herein as Nf, also represented as 2'-fluoronucleotide), 2'-deoxynucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (represented herein as NM or 2'-MOE), 2'-aminonucleotides, and 2'-alkylnucleotides. It is not necessary to uniformly alter all positions of a given compound. Conversely, a single FXII RNAi agent or even a single nucleotide thereof can incorporate multiple modifications. The sense and antisense strands of an FXII RNAi agent can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

[0168] Modified nucleic acid bases include synthetic and natural nucleic acid bases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C) of adenine and guanine, 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives, and 2-thiouracil. Examples include 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azouracil, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0169] In some embodiments, all or substantially all nucleotides of the RNAi agent are modified nucleotides. An RNAi agent in which substantially all present nucleotides are modified nucleotides, as used herein, is an RNAi agent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides of either the sense strand or the antisense strand are ribonucleotides (i.e., modified). A substantially all present sense strand, as used herein, is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides are ribonucleotides. A substantially all present antisense strand, as used herein, is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides are ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are ribonucleotides.

[0170] Inter-modified nucleoside bonding In some embodiments, one or more nucleotides of the FXII RNAi agent are linked by non-standard linkages or backbones (i.e., modified nucleoside linkages or modified backbones). Examples of modified nucleoside linkages or modified backbones include, but are not limited to, 5'-phosphorothioate groups (represented herein by lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphate triesters, aminoalkyl-phosphotryesters, alkylphosphonates (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3' -aminophosphoramides, aminoalkylphosphoramides, or thionophosphoramides), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino bonds, boranophosphates having a normal 3'-5' bond, 2'-5' bonded boranophosphates with inverse polarity, or analogs of boranophosphates, where adjacent pairs of nucleoside units are bonded at 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside bond or skeleton lacks a phosphorus atom. Examples of modified internucleoside bonds lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl sugar bonds, mixed heteroatom and alkyl or cycloalkyl sugar bonds, or one or more short-chain heteroatom or heterocyclic sugar bonds. In some embodiments, the modified internucleoside skeletons include, but are not limited to, siloxane skeletons, sulfide skeletons, sulfoxide skeletons, sulfone skeletons, formacetyl and thioformacetyl skeletons, methyleneformacetyl and thioformacetyl skeletons, alkene-containing skeletons, sulfamate skeletons, methyleneimino and methylenehydrazino skeletons, sulfonate and sulfonamide skeletons, amide skeletons, and other skeletons containing a mixture of N, O, S, and CH2 components.

[0171] In some embodiments, the sense strand of the FXII RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate bonds. The antisense strand of the FXII RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate bonds, or either the sense strand or the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate bonds. In some embodiments, the sense strand of the FXII RNAi agent may contain 1, 2, 3, or 4 phosphorothioate bonds, the antisense strand of the FXII RNAi agent may contain 1, 2, 3, or 4 phosphorothioate bonds, or either the sense strand or the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate bonds.

[0172] In some embodiments, the FXII RNAi agent sense strand may contain at least two phosphorothioate nucleoside bonds. In some embodiments, the at least two phosphorothioate nucleoside bonds are located between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, the at least two phosphorothioate nucleoside bonds are located between nucleotides 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, the FXII RNAi agent antisense strand contains four phosphorothioate nucleoside bonds. In some embodiments, the four phosphorothioate nucleoside bonds are located between nucleotides 1-3 from the 5' end of the antisense strand, and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, the FXII RNAi agent comprises at least two phosphorothioate nucleoside interbondings in the sense strand and three or four phosphorothioate nucleoside interbondings in the antisense strand.

[0173] In some embodiments, the FXII RNAi agent comprises one or more modified nucleotides and one or more modified nucleoside interbonds. In some embodiments, a 2'-modified nucleoside is combined with the modified nucleoside interbond.

[0174] FXII RNAi agent In some embodiments, the FXII RNAi agents disclosed herein target the FXII gene or its vicinity in the FXII sequence shown in Table 1. In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to the FXII 19-mer target sequence disclosed in Table 1.

[0175] [Table 1]

[0176] In some embodiments, the FXII RNAi agent includes an antisense strand (5'→3') whose 19th position is capable of base-pairing with position 1 of the 19-mer target sequence disclosed in Table 1.

[0177] In some embodiments, the FXII RNAi agent includes an antisense strand (5'→3') whose 2 position is capable of base-pairing with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the FXII RNAi agent includes an antisense strand (5'→3') whose 2-18 positions are capable of base-pairing with positions 18-2 of the 19-mer target sequence disclosed in Table 1.

[0178] With respect to the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' end → 3' end) may be either perfectly complementary to the FXII gene or incompletely complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end → 3' end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0179] In some embodiments, the FXII RNAi agent antisense strand contains nucleotide sequences (5' end to 3' end) 2-18 or 2-19 from any of the antisense strand sequences in Table 2, Table 3, or Table 6. In some embodiments, the FXII RNAi agent sense strand contains nucleotide sequences (5' end to 3' end) 1-17, 1-18, or 2-18 from any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0180] In some embodiments, the FXII RNAi agent comprises (i) an antisense strand containing the sequence of nucleotides (5' end to 3' end) 2-18 or 2-19 from any of the antisense strand sequences in Table 2, Table 3, or Table 6, and (ii) a sense strand containing the sequence of nucleotides (5' end to 3' end) 1-17, 1-18, or 2-18 from any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0181] In some embodiments, the FXII RNAi agent contains the core 19-mer nucleotide sequence shown in Table 2 below.

[0182] [Table 2-1] [Table 2-2] [Table 2-3] The sense and antisense strands of an FXII RNAi agent containing or consisting of the nucleotide sequences in Table 2 may be modified nucleotides or unmodified nucleotides. In some embodiments, the sense and antisense strand sequences containing or consisting of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0183] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0184] As used herein, the Ns listed in the sequences disclosed in Table 2 may be independently selected. In some embodiments, the Ns listed in the sequences disclosed in Table 2 have nucleic acid bases complementary to the N nucleotide at the corresponding position on the other chain. In some embodiments, the Ns listed in the sequences disclosed in Table 2 have nucleic acid bases that are not complementary to the N nucleotide at the corresponding position on the other chain. In some embodiments, the Ns listed in the sequences disclosed in Table 2 have nucleic acid bases identical to the N nucleotide at the corresponding position on the other chain. In some embodiments, the Ns listed in the sequences disclosed in Table 2 have nucleic acid bases different from the N nucleotide at the corresponding position on the other chain.

[0185] The sense and antisense strands of specific modified FXII RNAi agents are listed in Tables 3 and 4. The modified FXII RNAi agent antisense strands, as well as their corresponding unmodified nucleic acid sequences, are listed in Table 3. The modified FXII RNAi agent sense strands, as well as their corresponding unmodified sequences, are listed in Table 4. In the formation of FXII RNAi agents, as in Table 2, each nucleotide in the corresponding sequences listed in Tables 3 and 4 above may be a modified nucleotide.

[0186] The FXII RNAi agents described herein are formed by the annealing of a sense strand and an antisense strand. A sense strand containing the sequences listed in Table 2, Table 3, or Table 6 can hybridize an antisense strand containing the sequences listed in Table 2, Table 4, or Table 6, provided that the two sequences have at least an 85% complementary region over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0187] In some embodiments, the antisense strand of the FXII RNAi agent contains one of the nucleotide sequences shown in Table 2, Table 3, or Table 6.

[0188] In some embodiments, the FXII RNAi agent consists of a double strand having the nucleic acid base sequences of the sense strand and antisense strand of any of the sequences in Table 2, Table 3, Table 4, or Table 6.

[0189] Examples of antisense strands containing modified nucleotides are shown in Table 3. Examples of sense strands containing modified nucleotides are shown in Table 4.

[0190] As used in Tables 3 and 4, the following notation is used to indicate modified nucleotides, target groups, and binding groups. Those skilled in the art will readily understand that, unless otherwise indicated in the sequence, monomers in oligonucleotides are linked to each other by 5'-3'-phosphodiester bonds; A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = Uridine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2’-O-methyluridine-3’-phosphorothioate Nf = Any 2’-fluoro-modified nucleotide Af = 2’-fluoroadenosine-3’-phosphate Afs = 2’-fluoroadenosine-3’-phosphorothioate Cf = 2’-fluorocytidine-3’-phosphate Cfs = 2’-fluorocytidine-3’-phosphorothioate Gf = 2’-fluoroguanosine-3’-phosphate Gfs = 2’-fluoroguanosine-3’-phosphorothioate Tf = 2’-fluoro-5’-methyluridine-3’-phosphate Tfs = 2’-fluoro-5’-methyluridine-3’-phosphorothioate Uf = 2’-fluorouridine-3’-phosphate Ufs = 2’-fluorouridine-3’-phosphorothioate dN = Any 2’-deoxyribonucleotide dT = 2’-deoxythymidine-3’-phosphate N UNA = 2’,3’-seco nucleotide mimic (unlocked nucleic acid base analog)-3’-phosphate N UNA s = 2’,3’-seco nucleotide mimic (unlocked nucleic acid base analog)-3’-phosphorothioate U UNA = 2’,3’-seco-uridine-3’-phosphate U UNA s = 2’,3’-seco-uridine-3’-phosphorothioate a_2N = See Table 7 a_2Ns = See Table 7 pu_2N = See Table 7 pu_2Ns = See Table 7 Npu = See Table 7 Nus = See Table 7 N LNA= Locked nucleotides Nf ANA = 2'-F-arabinonucleotide NM = 2'-methoxyethylnucleotide AM = 2'-Methoxyethyladenosine-3'-phosphate AMs = 2'-Methoxyethyladenosine-3'-phosphorothioate TM = 2'-methoxyethylthymidine-3'-phosphate TMs = 2'-methoxyethylthymidine-3'-phosphorothioate R = Livitol (invdN) = any inverted deoxyribonucleotide (3'-3' bond) nucleotide) (invAb) = Inverted (3'-3' bond) debasic deoxyribonucleotide, see Table 7. (invAb)s = inverted (3'-3' bond) debase deoxyribonucleotide -5'- Phosphothioates, see Table 7. (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate bond vpdN = vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me,2'-fluoronucleotide cPrp = Cyclopropylphosphonate, see Table 7. epTcPr = see Table 7 epTM = see Table 7 (Chol-TEG) ​​= See Table 7 (TEG-Biotin) = See Table 7 (PEG-C3-SS) = See Table 7 (Alk-SS-C6) = See Table 7 (C6-SS-Alk) = See Table 7 (C6-SS-Alk-Me) = See Table 7

[0191] Those skilled in the art will readily understand that, ex vivo, the 3' terminal nucleotide of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each given monomer instead of a phosphate group. Unless otherwise specified herein, this understanding of those skilled in the art applies to the description of the FXII RNAi agents and compositions of FXII RNAi agents disclosed herein.

[0192] The target groups and binding groups include the following, and their chemical structures are shown in Table 7: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG 26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30 )s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and / or antisense strand may have any of the above target groups or binding groups, as well as other target groups or binding groups conjugated to the 5' and / or 3' ends of the sequence.

[0193] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] Table 3-6 Table 3-7 Table 3-8 Table 3-9 Table 3-10 Table 3-11

[0194] Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 4-11

[0195] The FXII RNAi agents described herein are formed by the annealing of a sense strand and an antisense strand. A sense strand containing the sequences listed in Table 2, Table 4, or Table 6 can hybridize an antisense strand containing the sequences listed in Table 2, Table 3, or Table 6, provided that the two sequences have at least an 85% complementary region over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0196] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4 by 0, 1, 2, or 3 nucleotides.

[0197] In some embodiments, the antisense strand of the FXII RNAi agent contains any of the nucleotide sequences in Table 2, Table 3, or Table 6. In some embodiments, the antisense strand of the FXII RNAi agent contains the nucleotide (5' end → 3' end) sequences 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, 1-25, 2-25, 1-16, or 2-16. In certain embodiments, the antisense strand of the FXII RNAi agent contains or consists of any one of the modified sequences in Table 3. In certain embodiments, the antisense strand of the FXII RNAi agent contains or consists of any one of the modified sequences in Table 6.

[0198] In some embodiments, the sense strand of the FXII RNAi agent contains one of the nucleotide sequences shown in Table 2, Table 4, or Table 6. In some embodiments, the sense strand of the FXII RNAi agent contains the sequence of nucleotides (5' end to 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 of any of the sequences in Table 2, Table 4, or Table 6. In certain embodiments, the sense strand of the FXII RNAi agent contains or consists of one of the modified sequences listed in Table 5. In certain embodiments, the sense strand of the FXII RNAi agent contains or consists of one of the modified sequences listed in Table 6.

[0199] With respect to the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' end → 3' end) may be either perfectly complementary to the FXII gene or incompletely complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end → 3' end) is U, A, or dT (or a modified version of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0200] In some embodiments, the FXII RNAi agent antisense strand contains nucleotide sequences (5' end to 3' end) 2-18 or 2-19 from any of the antisense strand sequences in Table 2, Table 3, or Table 6. In some embodiments, the FXII RNAi agent sense strand contains nucleotide sequences (5' end to 3' end) 1-17, 1-18, or 2-18 from any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0201] In some embodiments, the FXII RNAi agent comprises (i) an antisense strand containing the sequence of nucleotides (5' end to 3' end) 2-18 or 2-19 from any of the antisense strand sequences in Table 2, Table 3, or Table 6, and (ii) a sense strand containing the sequence of nucleotides (5' end to 3' end) 1-17, 1-18, or 2-18 from any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0202] A sense strand containing sequences listed in Table 2, Table 4, or Table 6 can hybridize with an antisense strand containing sequences listed in Table 2, Table 3, or Table 6, provided that the two sequences have at least 85% complementary regions over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the FXII RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3. Specific representative sequence pairings are exemplified by the double-stranded ID numbers shown in Tables 5 and 6.

[0203] In some embodiments, the FXII RNAi agent comprises any double strand represented by one of the double-stranded ID numbers provided herein. In some embodiments, the FXII RNAi agent consists of any double strand represented by one of the double-stranded ID numbers provided herein. In some embodiments, the FXII RNAi agent comprises any double-stranded sense strand and antisense strand nucleotide sequences represented by one of the double-stranded ID numbers provided herein. In some embodiments, the FXII RNAi agent comprises any double-stranded sense strand and antisense strand nucleotide sequences represented by one of the double-stranded ID numbers provided herein, as well as a target group and / or binding group, where the target group and / or binding group are covalently linked (i.e., conjugated) to the sense strand or antisense strand. In some embodiments, the FXII RNAi agent comprises any double-stranded sense strand and antisense strand modified nucleotide sequences represented by one of the double-stranded ID numbers provided herein. In some embodiments, the FXII RNAi agent comprises any double-stranded sense-strand and antisense-strand modified nucleotide sequences represented by any of the double-stranded ID numbers provided herein, as well as a target group and / or binding group, wherein the target group and / or binding group is covalently bonded to the sense-strand or antisense-strand.

[0204] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having the antisense / sense strand double-stranded nucleotide sequences of Table 2, Table 5, or Table 6, and comprises an asialoglycoprotein receptor ligand target group.

[0205] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having the antisense / sense strand double-stranded nucleotide sequences of Table 2, Table 5, or Table 6, and further comprises a target group selected from the group consisting of: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG 28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the target group is (NAG25) or (NAG25) as defined in Table 7. In another embodiment, the target group is (NAG37) or (NAG37) as defined in Table 7.

[0206] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any double-stranded antisense strand and / or sense strand nucleotide sequence shown in Table 5.

[0207] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any double-stranded antisense strand and / or sense strand nucleotide sequence of Table 5, and comprising an asialoglycoprotein receptor ligand target group.

[0208] In some embodiments, the FXII RNAi agent comprises or is essentially composed of any double-stranded structure of any of the double-stranded structures in Table 5.

[0209] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0210] [Table 6-1] [Table 6-2]

[0211] In some embodiments, the FXII RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. When delivered to cells expressing the FXII gene, the RNAi agents described herein knock down or inhibit the expression of one or more FXII genes in vivo.

[0212] Target group, binding group, and delivery vehicle In some embodiments, the FXII RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, target groups, binding groups, delivery polymers, or delivery vehicles. The non-nucleotide groups may enhance the targeting, delivery, or binding of the RNAi agent. Examples of target groups and binding groups are listed in Table 7. The non-nucleotide groups may be covalently bonded to the 3' and / or 5' ends of the sense strand and / or the antisense strand. In some embodiments, the FXII RNAi agent includes a non-nucleotide group bonded to the 3' and / or 5' ends of the sense strand. In some embodiments, the non-nucleotide group is bonded to the 5' end of the FXII RNAi agent sense strand. The non-nucleotide group may be bonded to the RNAi agent directly or indirectly via a linker / binding group. In some embodiments, the non-nucleotide group is bonded to the RNAi agent via an unstable, cleavable, or reversible bond or linker.

[0213] In some embodiments, non-nucleotide groups enhance the pharmacokinetic or biodistribution characteristics of the RNAi agent or the conjugate to which it binds, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, non-nucleotide groups promote endocytosis of the RNAi agent.

[0214] The target group or target moiety enhances the pharmacokinetic or biodistribution characteristics of the conjugate or the RNAi agent to which it binds, thereby improving the cell-specific distribution and cell-specific uptake of the conjugate or RNAi agent. The target group may be monovalent, divalent, trivalent, or tetravalent, or may have a higher valency relative to the target to which it is directed. Typical target groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, the target group is bound to the RNAi agent using a linker, e.g., a PEG linker, or 1, 2, or 3 debased and / or ribitol (debased ribose) residues that can function as a linker in some examples. In some embodiments, the target group comprises a galactose-derivative cluster.

[0215] The FXII RNAi agents described herein may be synthesized to have a reactive group, such as an n-amine group, at the 5' end. The target group may be subsequently attached using the reactive group by methods typical in the art.

[0216] In some embodiments, the target group comprises an asialoclycoprotein receptor ligand. In some embodiments, the asialoclycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having an affinity for the asialoclycoprotein receptor equal to or greater than that of galactose. Examples of galactose derivatives, but not limited to, include: galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (see, for example: ST. Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for in vivo targeting of oligonucleotides and other molecules into the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0217] Galactose derivatives have been used for in vivo targeting of molecules to hepatocytes via binding to asialoglycoprotein receptors expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to asialoglycoprotein receptors facilitates cell-specific targeting to hepatocytes and endocytosis of molecules to hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be bound to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. Preparation of target groups, such as galactose derivative clusters, is described in U.S. Patent Application No. 15 / 452,324 and U.S. Patent Publication No. 2017 / 0253875, both of which are incorporated herein by reference in their entirety.

[0218] As used herein, a galactose derivative cluster comprises a molecule having 2 to 4 terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule via a C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a triantennae galactose derivative or trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises multiple N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraantennae galactosamine derivative or tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines.

[0219] As used herein, a galactose derivative trimer contains three galactose derivatives each bound to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives each bound to a central branch point. The galactose derivatives may be bound to the central branch point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are bound to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible, hydrophilic spacer, such as a PEG group (see, e.g., US Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows the binding of three galactose derivatives and further allows the branch point to bind to an RNAi agent. An example of the branch point group is dyridine or diglutamic acid. The branching point to the RNAi agent may be linked via a linker or spacer. In some embodiments, the linker or spacer includes a flexible hydrophilic spacer, for example, a PEG spacer, but is not limited. In some embodiments, the linker is a rigid linker, for example, one containing a cyclic group. In some embodiments, the galactose derivative includes or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster includes a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0220] Embodiments of the present disclosure include a pharmaceutical composition for in vivo delivery of an FXII RNAi agent to hepatocytes. Such pharmaceutical compositions include, for example, an FXII RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster can include, for example, a galactose derivative trimer that can be an N-acetyl-galactosamine trimer, or a galactose derivative tetramer that can be, for example, an N-acetyl-galactosamine tetramer.

[0221] Target groups include, but are not limited to, the following: those defined in Table 7, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other target groups containing galactose cluster target ligands are known in the art.

[0222] In some embodiments, the linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment to a target group of the agent or to a delivery polymer or delivery vehicle. The linking group can bind to the 3' or 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group binds to the RNAi agent sense strand. In some embodiments, the linking group conjugates to the 5' or 3' end of the RNAi agent sense strand. In some embodiments, it conjugates to the 5' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0223] A linker or linking group is a connection between two atoms that attaches one chemical group (such as an RNAi agent) or segment to another chemical group (such as a target group or delivery polymer) or segment through one or more covalent bonds. Labile linkages include labile bonds. The linkage optionally includes a spacer that increases the distance between the two joined atoms. The spacer can further provide flexibility and / or increase the length of the linkage. Examples of spacers include, but are not limited to: alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, where each of these groups can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the description.

[0224] Regardless of whether any of the FXII RNAi agent base sequences described in Tables 2, 3, 4, or 6 are modified or unmodified, they may contain a 3' or 5' target group or linking group. Alternatively, any of the FXII RNAi agent base sequences described in Table 3 or 4 that contain a 3' or 5' target group or linking group may not contain a 3' or 5' target group or linking group, or may contain different 3' or 5' target groups or linking groups including, but not limited to, those shown in Table 7. Any of the FXII RNAi agent double strands described in Table 2, Table 5, or Table 6, regardless of whether they are modified or unmodified, may contain additional target groups or linking groups including, but not limited to, those shown in Table 7, and this target group or linking group may be attached to the 3' or 5' end of either the sense strand or the antisense strand of the FXII RNAi agent double strand.

[0225] Examples of target groups and linking groups are described in Table 7. Table 4 provides some embodiments of FXII RNAi agent sense strands having a target group or linking group linked to the 5' or 3' end.

[0226] Table 7-1 Table 7-2 Table 7-3 Table 7-4 Table 7-5 Table 7-6 Table 7-7 Table 7-8 Table 7-9 Table 7-10 Table 7-11 Table 7-12 Table 7-13 Table 7-14 Table 7-15 Table 7-16 Table 7-17

[0227] As will be understood by those skilled in the art in light of the above structures and the descriptions provided herein, in each of the above structures in Table 7, the NAG comprises N-acetyl-galactosamine or other asialoglycoprotein receptor ligand. For example, in some embodiments, the NAG of the structures shown in Table 7 is represented by the following structure: [ka]

[0228] Each (NAGx) can bind to an FXII RNAi agent via a phosphate group or a phosphorothioate group (such as (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or via other binding groups (such as those shown in (NAG25), (NAG30), and (NAG31)).

[0229] [ka] Other bonding groups known in the field may be used.

[0230] In some embodiments, the delivery vehicle may be used for the delivery of RNAi agents to cells or tissues. The delivery vehicle is a compound that improves the delivery of RNAi agents to cells or tissues. The delivery vehicle may include, but is not limited to, polymers, e.g., amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, the RNAi agent may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to target groups, lipids (including but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, respectively, incorporated herein by reference), or other delivery systems available in the art.

[0231] Pharmaceutical compositions and formulations The FXII RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, the pharmaceutical compositions comprise at least one FXII RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNA in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects with diseases or disorders that would benefit from a reduction in the level of target mRNA or inhibition of the expression of a target gene. The pharmaceutical compositions can be used to treat subjects at risk of developing diseases, disorders, or conditions that would benefit from a reduction in the level of target mRNA or inhibition of the expression of a target gene. In one embodiment, the method comprises administering an FXII RNAi agent conjugated to a target ligand as described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the FXII RNAi agent to form a pharmaceutical formulation suitable for delivery to subjects, including humans.

[0232] The pharmaceutical compositions and methods comprising FXII RNAi agents disclosed herein reduce the level of target mRNA in cells, cell populations, groups of cells, tissues, or subjects. For example, this includes inhibiting FXII mRNA expression in a subject by administering a therapeutically effective dose of the FXII RNAi agent described herein to the subject.

[0233] In some embodiments, the pharmaceutical compositions comprising FXII RNAi agents are used to treat or manage clinical symptoms in subjects having a disease or disorder (e.g., HAE, AAE, ACE inhibitor-associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thromboembolic disease, and perioperative venous occlusive disease prevention) that would benefit from inhibition of FXII mRNA expression. In some embodiments, a therapeutic or prophylactic effective dose of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed FXII RNAi agents can be used to reduce the number, severity, and / or frequency of symptoms of the disease in the subject.

[0234] The pharmaceutical compositions comprising FXII RNAi agents can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from a reduction or inhibition of FXII mRNA expression. In some embodiments, the subject is administered a therapeutically effective dose of one or more pharmaceutical compositions comprising FXII RNAi agents to treat the symptom. In other embodiments, the subject is administered a prophylactically effective dose of one or more FXII RNAi agents to prevent at least one symptom.

[0235] The route of administration is the route through which the FXII RNAi agent comes into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The FXII RNAi agents disclosed herein can be administered via appropriate routes by formulations appropriately prepared for specific routes. Therefore, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intra-articularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0236] Pharmaceutical compositions comprising the FXII RNAi agents described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery may be topical (e.g., direct injection, transplantation, topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal administration, or parenteral routes including: intracranial (e.g., intraventricular, intraparenchymal, and subarachnoid), intramuscular, transdermal, transairal (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the composition is administered by subcutaneous or intravenous infusion or injection.

[0237] Accordingly, in some embodiments, the pharmaceutical compositions described herein include one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0238] As used herein, a pharmaceutical composition or agent comprises a pharmacologically effective amount of at least one FXII RNAi agent described herein and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., FXII RNAi agent) and is intentionally included in the drug delivery system. Excipients do not exert, or are not intended to exert, a therapeutic effect at the intended dose. Excipients may act to a) assist in the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) assist in product identification, and / or d) enhance the overall safety, efficacy, or delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0239] Excipients are not particularly limited, but include absorption enhancers, anti-adhesion agents, defoamers, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, flow enhancers, humectants, lubricants, oils, polymers, preservatives, saline solutions, salts, solvents, sugars, suspending agents, sustained-release matrices, sweeteners, thickeners, isotonic agents, vehicles, water repellents, and wetting agents.

[0240] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water-soluble) or dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremofor® ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). They must be stable under manufacturing and storage conditions and protected from contamination by microorganisms such as bacteria and fungi. Carriers may be solvents or dispersion media containing, for example, water, ethanol, polyols (glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Appropriate fluidity can be maintained by using coatings such as lecithin, maintaining the required particle size in the case of dispersions, and using surfactants. Often, it is preferable to include sugars, polyalcohols such as mannitol, isotonic agents such as sorbitol and sodium chloride in the composition. Sustained absorption of injection compositions can be achieved by including absorption-delaying agents, such as aluminum monostearate or gelatin.

[0241] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent along with one or a combination of the components listed above as needed, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other necessary components from those listed above. In the case of sterile powders for preparing sterile injectable solutions, the preparation method involves vacuum drying or freeze-drying to obtain a powder of the active ingredient and any additional desired components from the solution that has been previously sterile filtered.

[0242] Formulations suitable for intra-articular administration may be sterile aqueous formulations of drugs that can be in microcrystalline form, such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems can also be used to present drugs for both intra-articular and ophthalmic administration.

[0243] The active compound may be prepared using a carrier that protects the compound from rapid elimination from the body, such as a sustained-release formulation including an implant or a microencapsulated delivery system. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyacid anhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Methods for preparing such formulations will be obvious to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared by methods known to those skilled in the art, such as those described, for example, in U.S. Patent No. 4,522,811.

[0244] FXII RNAi agents may be formulated in dose-unit formulations for ease of administration and uniformity of volume. A dose-unit formulation refers to a physically distinct unit appropriate as a unit dose for a patient being treated, each unit containing a predetermined amount of the active compound calculated to produce the desired therapeutic effect associated with the necessary pharmaceutically acceptable carrier. The specifications of the dose-unit formulations in this disclosure are determined and directly depended on the inherent properties of the active compound, the therapeutic effect to be achieved, and the limitations inherent in the techniques for formulating such active compounds for the treatment of an individual.

[0245] A pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, topical anesthetics, or anti-inflammatory agents (such as antihistamines and diphenhydramines). It is also conceivable that cells, tissues, or isolated organs expressing or containing the RNAi agents as defined herein may be used as a “pharmaceutical composition.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or prophylactic effect.

[0246] In some embodiments, the method disclosed herein further includes the step of administering a second therapeutic agent or treatment agent in addition to administering the RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another FXII RNAi agent (e.g., an FXII RNAi agent targeting a different sequence within the FXII target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, an aptamer, and / or a vaccine.

[0247] Generally, the effective dose of the active compound will be, for example, in the range of about 1.0 to about 50 mg / kg body weight / day. In some embodiments, the effective dose of the active compound will be in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, the effective dose of the active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight per dose. The dosage is often dependent on variables such as the patient's overall health, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. Also, in order to rapidly achieve the desired blood or tissue level, the initial dose may be increased beyond the upper limit levels mentioned above, or the initial dose may be lower than the optimal dose.

[0248] For the treatment of a disease, or for the formation of a pharmaceutical or composition for the treatment of a disease, the pharmaceutical composition described herein, comprising an FXII RNAi agent, may be used in combination with a second therapeutic or therapeutic agent, which includes, but is not limited to, an excipient or a second or another RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0249] The FXII RNAi agents described herein may be packaged in kits, containers, packs, or dispensers when added to pharmaceutically acceptable excipients or adjuvants. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.

[0250] Treatment methods and inhibition of expression The FXII RNAi agents disclosed herein can be used to treat subjects (e.g., humans and other mammals) who have a disease or disorder that would benefit from administration of the compounds. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduced and / or inhibition of FXII gene expression, for example, subjects diagnosed with or at risk of developing conditions related to hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor-associated angioedema, allergic angioedema, nonhistamine angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombotic occlusive disease, and / or perioperative venous occlusive disease prevention. Treatment of the subject may include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective dose of one or more of the FXII RNAi agents described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child, or infant. The administration of the pharmaceutical compositions described herein may be to humans or animals.

[0251] In some embodiments, the FXII RNAi agents described herein are used in subjects who would benefit from reduced and / or inhibited FXII gene expression. In some embodiments, the FXII RNAi agents are used to treat (including prophylactic treatment) at least one symptom or condition mediated at least partially by FXII expression. The subject is administered a therapeutically effective dose of one or more of the RNAi agents described herein. In some embodiments, the subject is administered a prophylactically effective dose of one or more of the RNAi agents described herein, thereby preventing at least one symptom.

[0252] In certain embodiments, the present invention provides a method for treating diseases, disorders, conditions s, or pathological conditions s in patients requiring such treatment, wherein the method comprises administering to the patient one of the FXII RNAi agents described herein.

[0253] In some embodiments, FXII RNAi agents are used to treat or manage pathological conditions (e.g., conditions or diseases) of subjects in which FXII expression is at least partially mediated. Subjects are administered one or more therapeutically effective doses of the FXII RNAi agents or compositions containing FXII RNAi agents described herein. In some embodiments, this method includes administering a composition containing the FXII RNAi agents described herein to a patient under treatment.

[0254] In some embodiments, the gene expression levels and / or mRNA levels in subjects administered with the described FXII RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to subjects before administration of the FXII RNAi agent or subjects not administered with FXII RNAi. The gene expression levels and / or mRNA levels in the subjects are reduced in the cells, cell populations, and / or tissues of the subjects.

[0255] In some embodiments, the protein levels of FXII in subjects administered with the described FXII RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to subjects before administration of the FXII RNAi agent or subjects not administered with FXII RNAi. The protein levels in the subjects are reduced in the subjects' cells, cell populations, tissues, blood, and / or other bodily fluids.

[0256] A decrease in FXII gene expression levels, FXII mRNA levels, or FXII protein levels can be evaluated and quantified by common methods known in the art. Examples disclosed herein include commonly known methods for evaluating inhibition of FXII gene expression and a decrease in FXII protein levels. Herein, a decrease or reduction in FXII mRNA levels and / or protein levels are collectively referred to as a decrease or reduction in FXII, or inhibition or reduction in FXII expression.

[0257] Cells, tissues, and non-human organisms Cells, tissues, and non-human organisms comprising at least one of the FXII RNAi agents described herein are envisioned. Cells, tissues, or non-human organisms are created by delivering the RNAi agent to the cells, tissues, or non-human organisms. [Examples]

[0258] The embodiments and items provided above are illustrated by the following non-limiting embodiments.

[0259] Examples Example 1. Identification of the sequence of the FXII RNAi agent and synthesis of the FXII RNAi agent. The selection process for identifying read sequences targeting FXII was initiated using an in silico method to identify sequences conserved across variants of the FXII gene (SEQ ID NO: 1). FXII sequences were initially screened using bioinformatics for 19 nucleotide sequences with complementary sequences exhibiting cross-reactivity in human and non-human primates. Sequences with known manufacturing challenges and those predicted to have low RNAi activity based on known parameters were excluded. Sequences were also evaluated for specificity to avoid nonspecific effects on human and cynomolgus monkey genomes. A family of 17(17) sequences of 19 nucleotide lengths was initially selected as promising candidates. Additional sequences were identified by modifying the nucleotide at position 1 (5'→3') of the antisense strand and the corresponding base pair of the sense strand to form a U:A base pair. After selecting modification patterns, the sense and antisense strands of modified RNAi agents were synthesized as oligonucleotides using solid-phase phosphoramidite techniques with methods known in the art. The double-stranded materials in Tables 5 and 6 of this specification were synthesized, for example, by the following method.

[0260] synthesis The sense and antisense strands of the FXII RNAi agent were synthesized using solid-phase phosphoramidite technology, which is used in oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or an equivalent commercially available synthesizer was used. Synthesis was performed on solid supports consisting of controlled-pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N2-(iso The 2'-O-methylphosphoramidites of (butyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and (5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite were used. The 2'-deoxy-2'-fluoro-phosphoramidite possessed a protecting group similar to that of 2'-O-methylRNA amidite.The following are 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-( UNA phosphoramidites were used, consisting of 4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0261] The phosphoramidite containing the targeted ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) were used as activator solutions. Binding times were 10 minutes (RNA), 15 minutes (targeted ligand), 90 seconds (2'OMe), and 60 seconds (2'F). To introduce phosphorothioate binding, a 100 mM solution of 3-phenyl1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0262] Cleavage and deprotection of support-bound oligomers

[0263] After the completion of solid-phase synthesis, the dried solid support was treated with a 1:1 solution of 40 wt% methylamine in water and 28-31% ammonium hydroxide (Aldrich) at 30°C for 1.5 hours. The solution was evaporated and the solid residue was restored in water (see below).

[0264] purification Crude oligomers were purified by anion exchange HPLC using a TKSgel SuperQ-5PW 13u column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM MEDTA, pH 9.0, containing 20% ​​acetonitrile, and Buffer B was the same as Buffer A but with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were pooled and then run by size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 medium, with a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water.

[0265] annealing RNAi preparations were formed by mixing complementary RNA strands (sense and antisense) in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). Some of the RNAi preparations were lyophilized and stored at -15 to -25°C. Double-stranded concentrations were determined by measuring the absorbance of the solution in 1x PBS using a UV-Vis spectrometer. The double-stranded concentration was then determined by multiplying the absorbance at 260 nm by the conversion factor and dilution ratio. Unless otherwise noted, all conversion factors were 0.037 mg / (mL·cm). In some experiments, the conversion factor was calculated from experimentally determined extinction coefficients.

[0266] Example 2. In vitro testing of RNAi agent candidates To test in vitro modified FXII RNAi constructs, a human FXII cDNA sequence (acceptance number NM_000505.3 (SEQ ID NO: 1)) was synthesized and cloned into a commercially available reporter-based screening plasmid psiCHECK2 (Promega, Madison, WI) (which produced Renilla luciferase / FXII fusion mRNA). For the efficacy of siRNA in a human background, Huh7 cells (human hepatocellular carcinoma lineage) were seeded in a 96-well format at approximately 7,500 cells / well. Each of the FXII siRNAs selected for in vitro testing was co-transfected at three concentrations of 10 nM, 1 nM, and 0.1 nM using 25 ng of FXII-psiCHECK2 plasmid DNA per well and 0.2 μL of lipofectamine 2000 per well. Gene knockdown was determined by measuring the level of Renilla luciferase, standardized against the level of constitutively expressed firefly luciferase (also present on the psiCHECK2 plasmid), using a double luciferase reporter assay (Promega, Madison, WI). Candidate double-stranded sequences listed in Table 6 were tested in vitro. The data are reported in Table 8 below.

[0267] [Table 8-1] [Table 8-2]

[0268] Example 3. FXII knockdown in wild-type mice after delivery of FXII RNAi agent. As described above, NAG-conjugated FXII RNAi agents were prepared for subcutaneous (SQ) injection and combined in pharmaceutically acceptable buffer. On day 1, three mice (n=3) in each group were injected with either physiological saline or 3 mg / kg of AD03632 (see Tables 3-5 and 7 for the modified FXII RNAi agent and NAG ligand structures). Blood samples were collected on days 8, 15, 22, 29, and 36, and FXII protein levels were analyzed. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes an internally developed, commercially available antibody (Molecular Innovations). While this offers high throughput, commercially available mF12 ELISA kits may be used instead. For standardization, the FXII level of each animal at each time point was divided by the pre-treatment expression level in that animal (in this case, day 1) to determine the "standardized" expression ratio relative to day 1. FXII knockdown is reported in Figure 1.

[0269] Example 4. Factor XII (FXII) in wild-type mice after delivery of FXII RNAi agent. As described above, NAG-conjugated FXII RNAi agents were prepared for subcutaneous (SQ) injection and combined in pharmaceutically acceptable buffer. On day 1, four mice in each group were injected with either (i) 0.6 mg / kg of AD03632, (ii) 2 mg / kg of AD03632, or (iii) physiological saline (see Tables 3-5 and 7 for the modified FXII RNAi agent and NAG ligand structures). Blood samples were collected on days 7, 14, 21, 28, 35, 42, 49, 56, and 63, and FXII protein levels were analyzed. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes an internally developed, commercially available antibody (Molecular Innovations). While this offers high throughput, commercially available mF12 ELISA kits may be used instead. For standardization, the FXII level of each animal at each time point was divided by the pre-treatment expression level in that animal (in this case, day 1) to determine the "standardized" expression ratio relative to day 1. FXII knockdown is reported in Figure 2.

[0270] Example 5. Dose response of factor XII (FXII) in mice after delivery of FXII RNAi agent. As described above, NAG-bound FXII RNAi agents were prepared for subcutaneous (SQ) injection and combined in pharmaceutically acceptable buffer. On day 1, six mice in each group were injected with either (i) 0.6 mg / kg of AD03632, (ii) 2 mg / kg of AD03632, or (iii) physiological saline (see Tables 3-5 and 7 for the modified FXII RNAi agent and NAG ligand structures). These mice were then injected once a week for the next six weeks with either AD03632 or physiological saline at the same dose administered on day 1. Blood samples were collected the day before the next injection (i.e., blood samples were taken on days 7, 14, 21, 28, 35, 42, 49, 56, and 63) and FXII protein levels were analyzed. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes a commercially available antibody developed internally (Molecular Innovations). While this offers high throughput, a commercially available mF12 ELISA kit may be used instead. For standardization, the FXII level of each animal at each time point was divided by the pre-treatment expression level in that animal (in this case, day 1) to determine the "standardized" expression ratio relative to day 1. FXII knockdown is reported in Figure 3.

[0271] Example 6. Factor XII (FXII) serum protein levels and blood clot weight in a rat arteriovenous shunt model after FXII RNAi agent delivery. As described above, NAG-bound FXII RNAi agents were prepared for subcutaneous (SQ) injection and mixed in pharmaceutically acceptable buffer. On day 1, five mice in each group were injected with either (i) physiological saline, (ii) physiological saline on day 1, followed by 1000 U / kg heparin via intubation on day 7, 8, or 9, (iii) 1 mg / kg of FXII RNAi agent AD03224, or (iv) 3 mg / kg of FXII RNAi agent AD03224 (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). Blood samples were collected on the day of surgery (i.e., day 7, 8, or 9). For standardization, the FXII level of each animal at each time point was divided by the pre-treatment serum level in that animal (in this case, day 1) to determine the "standardized" expression ratio relative to day 1. FXII serum protein levels are reported in Figure 4. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes commercially available antibodies developed internally (Molecular Innovations). While this method offers high throughput, commercially available mF12 ELISA kits may be used instead.

[0272] Furthermore, an arteriovenous shunt model was performed on these mice and measured. On the day of the shunt experiment (i.e., day 7, day 8, or day 9), a polyurethane tube (along with silk thread) was implanted to connect the carotid artery to the jugular vein (cannulation). After 15 minutes, the shunt was removed and the net weight of the thrombus was measured. The weight of the blood clot (in mg) is reported in Figure 5.

[0273] Example 7. Administration of NAG-binding FXII RNAi agent to cynomolgus monkeys. NAG-conjugated FXII RNAi agents were prepared for subcutaneous (SQ) injection as known in the art and combined in pharmaceutically acceptable buffers. On day 1, cynomolgus macaque (Macaca fascicularis) primates (hereinafter referred to as "cynos" or "monkeys") were subcutaneously injected at a dose of 3 mg / kg of AD03635, AD04131, AD04157, AD04162, AD04254, or AD04443 (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). Three monkeys from each group were tested with the AD03635, AD04131, AD04157, AD04162, or AD04254 group (n=3). Only two monkeys were tested with the AD04443 group (n=2). On day 29, two (2) monkeys from each group were administered the same subsequent dose of FXII RNAi drug that had been administered on day 1 at 1.5 mg / kg.

[0274] Serum samples were collected from treated cynomolgus monkeys on day -29, day -7, and day 1 (pre-treatment), as well as on days 8, 15, 22, 29, 36, 43, 50, 57, 64, and 78. Blood samples were collected at the indicated time points, and serum was analyzed for FXII protein levels. FXII protein levels were measured using a commercially available human F12 ELISA (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine, was also evaluated using an automated chemical analyzer according to the manufacturer's recommendations. Activated partial thromboplastin time (aPTT) was also measured using STA Compact MAX® (Stago). Functional readout of F12 knockdown can be observed by an extension of activated partial thromboplastin time (aPTT) compared to pre-treatment. The FXII activity of the samples was also evaluated using an FXII activity assay. The FXII activity assay was performed using the aPTT method (a known standard technique in the art) and a factor-deficient substrate. The target plasma was cultured with an FXII-deficient substrate (normal plasma in which FXII was depleted by immunoadsorption) and the aPTT reagent. After a specific culture time, calcium was added to trigger the coagulation process and thrombus formation was measured. The results were then compared to those of a normal human (100%) and the % activity was calculated.

[0275] The FXII protein level of each animal at each time point was divided by the pre-treatment expression level in that animal (average of -29 days, -7 days, and 1 day (pre-treatment)) to determine the "normalized" expression ratio relative to pre-treatment. Furthermore, the mean knockdown levels of both FXII protein and FXII activity at their respective lowest points (i.e., the average lowest expression level on the day serum was collected) were calculated.

[0276] [Table 9]

[0277] [Table 10]

[0278] [Table 11]

[0279] [Table 12]

[0280] Each of the FXII RNAi agents tested in Example 7 showed significant knockdown of FXII in the cynos. Furthermore, administration of a second dose of the FXII RNAi agent was shown to further improve the knockdown of FXII protein and FXII activity in the cynos, as well as the prolongation of aPTT. For example, AD04162, which contains an antisense strand with a sequence at least partially complementary to positions 127-145 of the FXII gene (SEQ ID NO: 1), was shown to inhibit FXII protein expression by 93.5% at the lowest point after the second dose.

[0281] Example 8. Administration of NAG-binding FXII RNAi agent to cynomolgus monkeys NAG-conjugated FXII RNAi agents were prepared for subcutaneous (SQ) injection as known in the art and combined in pharmaceutically acceptable saline buffer. On day 1, cynomolgus macaque (Macaca fascicularis) primates (hereinafter referred to as "cynos" or "monkeys") were subcutaneously injected at a dose of 3 mg / kg of AD04623, AD04624, AD04625, AD04626, AD04627, or AD04628 (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). Two monkeys from each group, one male and one female from each group, were tested (n=2). On day 24, each cyno received a single subcutaneous dose of 3 mg / kg of the same FXII RNAi agent administered to each animal on day 1 (i.e., a second dose).

[0282] Serum samples were collected from treated cynomolgus monkeys on days 6-6 and 1 (pre-treatment), and on days 8, 15, 24, 29, 36, and 43. Blood samples were collected at the indicated time points, and serum was analyzed for FXII protein levels. FXII protein levels were measured using a commercially available human F12 ELISA (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine, was also evaluated using an automated chemical analyzer according to the manufacturer's recommendations. FXII activity in the samples was also evaluated using an FXII activity assay. The FXII activity assay was performed using the aPTT method (a known standard technique in the art) and a factor-deficient substrate. The plasma of the subjects was cultured with an FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and the aPTT reagent. After specific culture times, calcium was added to trigger the coagulation process, and thrombus formation was measured. Next, the results were compared to those of a normal human (100%) to calculate the percentage activity.

[0283] The FXII protein level of each animal at each time point was divided by the pre-treatment expression level in that animal (average of -6 days and 1 day (pre-treatment)) to determine the "normalized" expression ratio relative to pre-treatment. Furthermore, the mean knockdown level at the lowest point for both FXII protein and FXII activity (i.e., the average lowest expression level on the day serum was collected) was calculated. [Table 13]

[0284] [Table 14]

[0285] [Table 15]

[0286] Each of the FXII RNAi agents administered in Example 8 showed significant inhibition of FXII expression in cynos. For example, AD04625, which contains an antisense strand designed to target positions 127-145 of the FXII gene (SEQ ID NO: 1), was shown to cause a mean normalized knockdown of 91.0% of the FXII protein on day 29 (0.090+ / -0.007) (see Group 3 in Table 14).

[0287] Example 9. Administration of NAG-binding FXII RNAi agent to cynomolgus monkeys. NAG-conjugated FXII RNAi agents were prepared for subcutaneous (SQ) injection as known in the art and combined in pharmaceutically acceptable saline buffer. On day 1, cynomolgus macaque (Macaca fascicularis) primates (hereinafter referred to as "cynos" or "monkeys") were subcutaneously injected at a dose of 4.0 mg / kg of AD04623, AD04625, AD04753, or AD04757 (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). On day 29, a second subcutaneous injection of the same FXII RNAi agent at a dose of 4.0 mg / kg was administered. Two female monkeys from each group were tested (n=2).

[0288] Serum samples were collected from treated cynomolgus monkeys on days -14, -7, and 1 (pre-treatment), as well as on days 8, 15, 22, 29, 30, 36, and 43. Blood samples were collected at the indicated time points, and serum was analyzed for FXII protein levels. FXII protein levels were measured using a commercially available human F12 ELISA (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine, was also evaluated using an automated chemical analyzer according to the manufacturer's recommendations. Activated partial thromboplastin time (aPTT) was also measured using STA®-PTT Automate 5 (Stago). Functional readout of F12 knockdown can be observed by an extension of activated partial thromboplastin time (aPTT) compared to pre-treatment. FXII activity in samples was also evaluated using an FXII activity assay. An FXII activity assay was performed using the aPTT method (a known standard technique in the art) and a factor-deficient substrate. The target plasma was cultured with an FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and the aPTT reagent. After a specific culture time, calcium was added to trigger the coagulation process, and thrombus formation was measured. The results were then compared to those of a normal human (100%), and the % activity was calculated.

[0289] The FXII protein level of each animal at each time point was divided by the pre-treatment expression level in that animal (average of -6 days and 1 day (pre-treatment)) to determine the "normalized to pre-treatment" expression ratio. Furthermore, the mean knockdown level at the lowest point for both FXII protein and FXII activity (i.e., the mean lowest expression level on the day serum was collected) was calculated.

[0290] [Table 16]

[0291] [Table 17]

[0292] [Table 18]

[0293] [Table 19]

[0294] In Example 9, each of the FXII RNAi agents showed significant knockdown of the FXII gene. For example, AD04625 showed the greatest knockdown of the FXII protein after administration of the RNAi agent at both the first and second doses (91% knockdown after the first dose, and 94.5% knockdown after the second dose). AD04625 also showed the greatest knockdown in FXII activity and the greatest extension of aPTT above baseline (above baseline by 2.02 after the first dose, and above baseline at the peak after the second dose by 2.435).

[0295] Example 10. Factor XII (FXII)-SEAP mouse model Female C57BL / 6 albino mice aged 6-8 weeks were transiently transfected in vivo with the plasmid by hydrodynamic tail vein injection and administered at least 15 days before administration of the FXII RNAi agent or control. The plasmid contained a human FXII cDNA sequence (GenBank GenBank NM_000505.3 (SEQ ID NO: 1)) inserted into the 3'UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. FXII-SEAP model mice were created by injecting 50 μg of the FXII cDNA sequence-containing plasmid in Ringer's solution into mice via the tail vein, in a total volume of 10% of the animal's body weight. The solution was injected from 27 standard needles for 5-7 seconds as described above (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, p1735-1737). When FXII expression is inhibited by an FXII RNAi agent, SEAP expression is also inhibited, which is measured using the Phospha-Light® SEAP reporter gene assay system (Invitrogen). Prior to treatment, serum SEAP expression levels were measured, and mice were grouped according to their mean SEAP levels.

[0296] Analysis: SEAP levels can be measured at various times, both before and after administration of the FXII RNAi agent.

[0297] i) Serum collection: Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). The blood was allowed to coagulate at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C.

[0298] ii) Serum SEAP levels: Serum was collected and measured using the Phospha-Light® SEAP reporter gene assay system (Invitrogen) according to the manufacturer's instructions. To account for the untreated-related decrease in FXII expression in this model, the serum SEAP levels of each animal were standardized against a control group of mice injected with normal saline. First, to determine the "standardized relative to pre-treatment" expression ratio, the SEAP level of each animal at a given time point was divided by the pre-treatment expression level in that animal (pre-treatment). Next, the expression at a specific time point was standardized against the control group by dividing the "standardized relative to pre-treatment" ratio of each animal by the average "standardized relative to pre-treatment" ratio of all mice in the normal saline control group.

[0299] Example 11. FXII RNAi agent in an FXII-SEAP mouse model The FXII-SEAP mouse model described in Example 10 above was used. On day 1, each mouse was subcutaneously injected once with either 200 μl of physiological saline without the FXII RNAi agent or 200 μl containing the amount of the FXII RNAi agent according to Table 20 below, to be used as a control.

[0300] [Table 20]

[0301] Each FXII RNAi agent contained an N-acetyl-galactosamine target ligand fused to the 5' end of the sense strand, as shown in Tables 4 and 5. Injections were administered between the skin and muscle (i.e., subcutaneously) in loose skin over the neck and shoulder region. Three (3) mice were tested in each group (n=3). Serum was collected on days 3, 8, 15, 22, and 29, and SEAP expression levels were measured according to the procedure described in Example 10 above. Data from the experiment are shown in Table 21 below, where mean SEAP reflects the standardized mean value of SEAP.

[0302] [Table 21]

[0303] Each of the FXII RNAi agents tested in Example 11 showed significant inhibition of FXII expression in the SEAP mouse model compared to the control.

[0304] Example 12. FXII RNAi agent in FXII-SEAP mouse model The FXII-SEAP mouse model described in Example 10 above was used. On day 1, each mouse was subcutaneously injected once with either 200 μl of physiological saline without the FXII RNAi agent or 200 μl containing 1.0 mg / kg of the FXII RNAi agent according to Table 22 below, to be used as a control.

[0305] [Table 22]

[0306] Each FXII RNAi agent contained an N-acetyl-galactosamine target ligand fused to the 5' end of the sense strand, as shown in Tables 4 and 5. Injections were administered between the skin and muscle (i.e., subcutaneously) in loose skin over the neck and shoulder region. Three (3) mice were tested in each group (n=3). Serum was collected on days 2, 8, 15, 22, 29, and 36, and SEAP expression levels were measured according to the procedure described in Example 10 above. Data from the experiment are shown in Table 23 below, where mean SEAP reflects the standardized (pre-treatment only) mean of SEAP.

[0307] [Table 23]

[0308] As shown in Table 23, almost all of the FXII RNAi agents tested showed significant inhibition of FXII expression in the SEAP mouse model compared to the control. For example, at day 15, AD04625, AD05330, and AD05331 each showed approximately 95% knockdown compared to pre-treatment expression levels.

[0309] Example 13. FXII RNAi agent in an FXII-SEAP mouse model The FXII-SEAP mouse model described in Example 10 above was used. On day 1, each mouse was subcutaneously injected once with either 200 μl of physiological saline without the FXII RNAi agent or 200 μl containing the amount of the FXII RNAi agent according to Table 24 below, to be used as a control.

[0310] [Table 24]

[0311] Each FXII RNAi agent contained an N-acetyl-galactosamine target ligand fused to the 5' end of the sense strand, as shown in Tables 3 and 4. Injections were administered between the skin and muscle (i.e., subcutaneously) into loose skin on the neck and shoulder region. Three (3) mice were tested in each group (n=3). Serum was collected on days 3, 8, 15, 22, and 29, and SEAP expression levels were measured according to the procedure described in Example 10 above. Data from the experiment are shown in Table 25 below, where mean SEAP reflects the standardized mean value of SEAP.

[0312] [Table 25]

[0313] Other Embodiments Although the present invention has been described in conjunction with the detailed description, the foregoing description is intended to be illustrative and does not limit the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are also within the scope of the claims described below.

Claims

1. An RNAi agent for inhibiting the expression of the factor XII (FXII) gene, The RNAi agent comprises a sense strand and an antisense strand. (i) AD05333 (SEQ ID NOs. 404 and 643) has a double-stranded structure in which the antisense strand is AM07041-AS usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404), and the sense strand is AM07044-SS (NAG37)gsccaaggaGfCfAfuaaguacaaaas(invAb) (SEQ ID NO: 643), which is at least partially complementary to the antisense strand; or (ii) The antisense strand is AM05903-AS usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375), and the sense strand is AM05912-SS (NAG37)sscsccaaggaGfCfAfuaaguacaaaas(invAb) (SEQ ID NO: 611), which is at least partially complementary to the antisense strand. AD04625 (SEQ ID NOs: 375 and 611) has a double-stranded structure; It is selected from, Here, unless otherwise indicated in the sequence, when present in an oligonucleotide, monomers are linked to each other by a 5'-3'-phosphodiester bond, where a is 2'-O-methyladenosine-3'-phosphate; c is 2'-O-methylcytidine-3'-phosphate; g is 2'-O-methylguanosine-3'-phosphate; u is 2'-O-methyluridine-3'-phosphate; Af is 2'-fluoroadenosine-3'-phosphate; Cf is 2'-fluorocytidine-3'-phosphate; Gf is 2'-fluoroguanosine-3'-phosphate; Uf is 2'-fluorouridine-3'-phosphate; s is a phosphorothioate bond; (invAb) is an inverted debased deoxyribose residue; (NAG37) is 【Chemistry 1】 It has the structure of; and, (NAG37)s is, 【Chemistry 2】 It has the structure of; RNAi agent.

2. A pharmaceutical composition for use in the treatment of a pathological condition (including a state or disease) at least partially mediated by FXII expression, comprising the RNAi agent described in claim 1 and at least one pharmaceutically acceptable excipient, The aforementioned pathological condition is selected from hereditary angioedema (HAE), acquired angioedema (AAE), angioedema associated with ACE inhibitors, allergic angioedema, nonhistamine angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), or thrombotic occlusive disease, and is a pharmaceutical composition.

3. The pharmaceutical composition according to claim 2, further comprising a second therapeutic agent or therapeutic agent.

4. The pharmaceutical composition according to claim 3, wherein the pharmaceutical composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.

Images