Chemical sensors using chain exchange reactions

Meta-stabilized nucleic acid probes with strand exchange reactions and polycations improve chemical sensor sensitivity and stability for target detection, addressing the challenge of low concentration detection.

JP7855468B2Active Publication Date: 2026-05-08KK TOSHIBA
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
KK TOSHIBA
Filing Date
2022-09-16
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing chemical sensors face challenges in achieving high sensitivity and stability for target substance detection, particularly at concentrations below the dissociation constant, due to the difficulty in balancing high binding affinity and significant structural changes in nucleic acid probes.

Method used

The use of meta-stabilized nucleic acid probes with short complementary chains and a strand exchange reaction mechanism, enhanced by polycations, to facilitate target capture and signal detection, even at low concentrations.

Benefits of technology

The proposed solution enables high sensitivity and stability in detecting target substances by overcoming energy barriers and enhancing signal output, allowing detection at concentrations below the dissociation constant.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007855468000005
    Figure 0007855468000005
  • Figure 0007855468000006
    Figure 0007855468000006
  • Figure 0007855468000007
    Figure 0007855468000007
Patent Text Reader

Abstract

To provide a chemical sensor equipped with a nucleic acid probe which is capable of measuring at high sensitivity.SOLUTION: A chemical sensor according to an embodiment comprises: a nucleic acid probe for capturing a target substance; a sensor element on the surface of which a nucleic acid probe is immobilized; and a liquid membrane covering the sensor element. The nucleic acid probe is a double stranded nucleic acid that consists of the first nucleic acid and the second nucleic acid bonded to the first nucleic acid, and the first nucleic acid is a single-stranded nucleic acid including the first base sequence, a second base sequence consisting of a base sequence complementary with the first base sequence, and a third base sequence whose one end binds to the first base sequence and the other end binds to the second base sequence. The second nucleic acid is a single-stranded nucleic acid which includes a fourth base sequence consisting of a base sequence complementary with a part of the second base sequence of the first nucleic acid, where the fourth base sequence binds to the second base sequence of the first nucleic acid. The third base sequence includes a base sequence constituting a binding site which captures a target substance.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Embodiments of the present invention relate to a chemical sensor using a strand exchange reaction.

Background Art

[0002] There is a need for a chemical sensor equipped with a nucleic acid probe that can measure with high sensitivity.

Summary of the Invention

Problems to be Solved by the Invention

[0003] The problem to be solved by the present invention is to provide a chemical sensor equipped with a nucleic acid probe that can measure with high sensitivity.

Means for Solving the Problems

[0004] The chemical sensor according to the embodiment includes a nucleic acid probe for capturing a target substance, a sensor element having the nucleic acid probe immobilized on its surface, and a liquid film covering the sensor element. The nucleic acid probe is a double-stranded nucleic acid composed of a first nucleic acid and a second nucleic acid bound to the first nucleic acid. The first nucleic acid is a nucleic acid including a first base sequence, a second base sequence complementary to the first base sequence, and a third base sequence having one end bound to the first base sequence and the other end bound to the second base sequence. The second nucleic acid is a nucleic acid including a fourth base sequence complementary to a part of the second base sequence of the first nucleic acid, and the fourth base sequence binds to the second base sequence of the first nucleic acid. The third base sequence includes a base sequence constituting a binding site for capturing the target substance.

Brief Description of the Drawings

[0005] [Figure 1] FIG. 1 is a cross-sectional view showing an example of the chemical sensor of the first embodiment. [Figure 2]Figure 2(a) is a schematic diagram showing an example of a nucleic acid probe of the chemical sensor of the first embodiment, (b) is a diagram showing the progress of the strand exchange reaction in the nucleic acid probe, and (c) is a diagram showing the nucleic acid probe after the strand exchange reaction has been completed and a stable higher-order structure has been formed. [Figure 3] Figure 3 is an energy level diagram for the nucleic acid probe provided in the chemical sensor of the first embodiment, showing the change in free energy when the nucleic acid probe forms a double helix and when it forms a single helix. [Figure 4] Figure 4(a) shows an example of a second nucleic acid containing a polycation, which is provided in the chemical sensor of the second embodiment, and (b) is a schematic diagram showing how the second nucleic acid containing a polycation and other base sequences assemble in a strand exchange reaction. [Figure 5] Figure 5 is an energy level diagram for the nucleic acid probe of the chemical sensor of the second embodiment, showing the change in free energy due to the capture of the target substance. [Figure 6] Figure 6 is a cross-sectional view showing an example of a chemical sensor according to the third embodiment. [Figure 7] Figure 7(a) shows an example of a polycation provided by the chemical sensor of the second embodiment, and (b) is a schematic diagram showing how the polycation and other base sequences assemble in a chain exchange reaction. [Figure 8] Figure 8 is a flowchart of a fourth embodiment, which describes an analysis method using a chemical sensor. [Figure 9] Figure 9 is a flowchart relating to a fifth embodiment, which is a method for manufacturing a chemical sensor. [Figure 10] Figure 10 is a graph showing the time-dependent change in the drain current flowing through the sensor element when the concentration of the target substance is changed stepwise, as measured in Example 1. [Figure 11] Figure 11 shows the gate voltage dependence (IdVg characteristics) of the drain current of the FET sensor equipped with a graphene film for each measurement period in the measurement results of Example 1. [Modes for carrying out the invention]

[0006] The embodiments will be described below with reference to the attached drawings. In each embodiment, substantially identical components will be denoted by the same reference numerals, and their descriptions may be partially omitted. The drawings are schematic, and the relationship between the thickness of each part and its planar dimensions, the ratio of the thicknesses of each part, etc., may differ from those in reality.

[0007] (First Embodiment) Chemical sensor According to the first embodiment, a chemical sensor (hereinafter referred to as "sensor 1") is provided that includes a nucleic acid probe for detecting a target substance by a chain exchange reaction. Sensor 1 comprises a sensor element 2 and a liquid film 3 arranged to cover the sensor element 2, with a nucleic acid probe 4 immobilized on the surface of the sensor element 2.

[0008] Any type of sensor element can be selected for sensor element 2, as long as it is configured to be sensitive to changes in the secondary structure of the nucleic acid probe 4, which will be described later. Sensor element 2 may be, for example, a graphene field-effect transistor (GFET), an ion-sensitive field-effect transistor (ISFET), a surface plasmon resonance element (SPR), or a quartz crystal microbalance (QCM).

[0009] For example, if sensor 1 is a type of FET sensor, as shown in Figure 1, the sensor element 2 is arranged such that the gate electrode 5 is in contact via a liquid film 3, and a source electrode 6 is electrically connected to one end and a drain electrode 7 is electrically connected to the other end. A circuit for applying voltage (i.e., gate voltage) is also connected to the gate electrode 5. A circuit for applying voltage is also formed between the source electrode 6 and the drain electrode 7, and an ammeter (not shown) for measuring the drain current flowing through this circuit is placed there. The source electrode 6 and the drain electrode 7 may be covered with an insulating protective film 8.

[0010] The liquid film 3 is positioned so that its surface 3a is in contact with the sample containing the target substance, and it covers the sensor element 2, immersing the immobilized nucleic acid probe 4 on the surface 2a of the sensor element 2. The liquid film 3 is composed of a measurement solution capable of dissolving the target substance. As the solvent of the measurement solution, for example, water can be selected, and the solute may include any reagents necessary for the measurement or storage of the sensor 1 (e.g., stabilizers, pH adjusters, ions, etc.).

[0011] The nucleic acid probe 4 is a double-stranded nucleic acid consisting of a first nucleic acid and a second nucleic acid complementaryly bound to the first nucleic acid, and has a binding site for capturing a target substance. Here, the first nucleic acid is a nucleic acid comprising a first base sequence; a second base sequence consisting of a base sequence complementary to the first base sequence; and a third base sequence having one end bound to the first base sequence and the other end bound to the second base sequence. The second nucleic acid is a nucleic acid comprising a fourth base sequence consisting of a base sequence complementary to a part of the second base sequence of the first nucleic acid, and the portion of the fourth base sequence binds to the second base sequence of the first nucleic acid. Here, the third base sequence includes a base sequence that constitutes a binding site for capturing a target substance.

[0012] The nucleic acid probe 4 is immobilized on the surface 2a of the sensor element 2 by immobilizing either the first nucleic acid or the second nucleic acid on the surface of the sensor element. The immobilization of the nucleic acid probe 4 can be achieved by making the material constituting the surface 2a of the sensor element 2 a material that can bind to the first or second nucleic acid of the nucleic acid probe 4. For example, if the sensor element 2 is graphene or gold, the nucleic acid probe 4 will be immobilized because it will non-specifically adsorb to the nucleic acid. More preferably, the nucleic acid probe 4 may be modified with a functional group that binds to or adsorbs to the material constituting the surface 2a of the sensor element 2, and the nucleic acid probe 4 may be immobilized by the binding or adsorption of the functional group to the sensor element surface 2a. For example, if the sensor element 2 is graphene, modifying it with a polycyclic aromatic compound, such as pyrene, as the functional group will cause the nucleic acid probe 4 to be strongly immobilized on the graphene sensor element surface 2a due to the π-π interaction between the polycyclic aromatic compound and graphene. Alternatively, if the sensor element 2 is made of gold, modifying it with a thiol group as the functional group will cause the thiol group to strongly bond to the gold, resulting in the nucleic acid probe 4 being strongly immobilized on the gold surface 2a of the sensor element 2. Functional group modification of nucleic acids can be performed by nucleic acid synthesis using the phosphoramidite method with an amidite reagent possessing the desired functional group. Since the nucleic acid probe 4 is immobilized on the surface 2a of the sensor element 2, any structural changes or liberation of the nucleic acid probe 4 are detected as a change in the signal of the sensor element 2. For example, if the sensor element is a GFET or ISFET, the proximity or separation of the nucleic acid probe 4, which has a negative charge on the phosphate ester main skeleton, is applied as a gate voltage to the FET, and is detected as a change in drain current. Alternatively, if the sensor element is an SPR, the SPR detects the change in dielectric constant on the sensor element surface due to the dissociation of the first and second nucleic acids of the nucleic acid probe 4 and the liberation of the nucleic acid that is not immobilized on the sensor element surface, as a change in the resonance effect with surface plasmons. Alternatively, if the sensor element is a QCM, the QCM detects a change in the amount of nucleic acid immobilized on the sensor element surface as a change in the resonant frequency of the quartz crystal oscillator, due to the dissociation of the first and second nucleic acids of the nucleic acid probe 4, and the release of the nucleic acid that is not immobilized on the sensor element surface.

[0013] As described above, nucleic acid probe 4 is a double-stranded nucleic acid composed of a first nucleic acid and a second nucleic acid, and can be denatured so that the first nucleic acid and the second nucleic acid dissociate through a strand exchange reaction described later.

[0014] The first nucleic acid constituting nucleic acid probe 4 autonomously changes its secondary structure in a direction that increases thermodynamic stability after dissociating from the second nucleic acid. Since the first nucleic acid has complementary first and second base sequences within its molecule, after dissociating from the second nucleic acid, it autonomously forms a secondary structure having a stem portion formed by the pairing of the first and second base sequences, and a loop portion or bulge structure containing a third base sequence. Examples of secondary structures autonomously formed by the first nucleic acid after dissociating from the second nucleic acid include hairpin loops, internal loops, bulges, pseudoknots, 3-way junctions (3WJ), or 4-way junctions (4WJ).

[0015] The first nucleic acid that forms a secondary structure is preferably more stable. That is, the melting temperature Tm of the first nucleic acid having a stem portion formed by the pairing of the first base sequence and the second base sequence is preferably higher. The melting temperature Tm can be calculated by any calculation method such as the basic calculation method or the nearest nearest base pair method. The melting temperature Tm1 of a double-stranded nucleic acid formed by the pairing of a nucleic acid having a first base sequence and a nucleic acid having a second base sequence is higher than the melting temperature Tm2 of a double-stranded nucleic acid formed by the pairing of a nucleic acid having a first base sequence and a nucleic acid having a fourth base sequence. Tm1 and Tm2 do not take into account the melting of the secondary structure formed by the third base. The first base sequence and the second base sequence are complementary, for example, 4 to 12 bases in length. The first base sequence and the second base sequence have, for example, 4 to 12 bases in length.

[0016] The second nucleic acid that constitutes the nucleic acid probe 4 is a nucleic acid having the fourth base sequence in its full length or a part thereof. When the second nucleic acid has the fourth base sequence as a part of its sequence, the fourth base sequence does not necessarily have to be completely complementary to the second base sequence of the first nucleic acid. For example, the fourth base sequence may have a base sequence mismatched with the second base sequence, or may have a base sequence portion that does not pair with the second base sequence and forms a bulge structure. Conversely, the second base sequence of the first nucleic acid may not pair with the fourth base sequence and may have a base sequence portion that forms a bulge structure. The 4th base sequence is, for example, shorter in base length than the 2nd base sequence.

[0017] The denaturation of the nucleic acid probe 4 can be caused by a strand exchange reaction that dissociates the first nucleic acid and the second nucleic acid. The strand exchange reaction in the nucleic acid probe 4 of the present embodiment is, as described later, a reaction in which the binding between the fourth base sequence of the second nucleic acid and the second base sequence of the first nucleic acid is gradually replaced by the binding between the first base sequence of the first nucleic acid and the second base sequence of the first nucleic acid. Such a strand exchange reaction can be induced and enhanced by capturing a target substance at the binding site constituted by the third base sequence of the first nucleic acid of the nucleic acid probe 4.

[0018] Also, as described later, it is preferable that the base length of the base sequence existing between the first base sequence or the second base sequence and the base sequence constituting the binding site among the third base sequences is shorter. However, between the second base sequence and the base sequence constituting the binding site among the third base sequences, a spacer consisting of 1 base, or a spacer sequence consisting of 2 or 3 bases may be included. Also, between the first base sequence and the base sequence constituting the binding site among the third base sequences, a spacer consisting of 1 base may be included.

[0019] The first nucleic acid that dissociates from the second nucleic acid and forms an autonomously stable secondary structure may be, for example, MN4 (SEQ ID NO: 1: GGCGACAAGGAAAATCCTTCAACGAAGTGGGTCGCC). MN4 is an anti-cocaine aptamer that can capture cocaine as a target substance, but can also capture methyl benzoate, which is an impurity in the cocaine manufacturing process and also an odor component of cocaine, and has a secondary structure as shown in the following formula 1-02. The dissociation constant of MN4 for cocaine is 7 ± 1 μM, and the dissociation constant for methyl benzoate is 87.7 ± 12.5 μM.

[0020]

Chemical formula

[0021] When the first nucleic acid is MN4, the first base sequence constituting the first nucleic acid is a sequence arranged in the order of GGCGAC from the 5'-end of MN4 in the 5'→3' direction, the second base sequence is a sequence arranged in the order of CCGCTG from the 3'-end of MN4 in the 3'→5' direction, and the third base sequence is a sequence arranged in the order of AAGGAAAATCCTTCAACGAAGTGG (SEQ ID NO: 2) in the 5'→3' direction.

[0022] In the above case, the fourth base sequence and thus the second nucleic acid may be, for example, a sequence arranged in the order of GCGA from the 5'-end in the 5'→3' direction, a sequence arranged in the order of GCGAC, or a sequence arranged in the order of GGCG.

[0023] On the other hand, as other nucleic acid constructs having the function of an anti-cocaine aptamer, MN6 (SEQ ID NO: 3: GACAAGGAAAATCCTTCAATGAAGTGGGTC) and MN19 (SEQ ID NO: 4: GACAAGGAAAATCCTTCAACGAAGTGGGTC) are known. MN6 and MN19 each have a secondary structure shown in the following formulas 1-02 and 1-03.

[0024]

Chemical formula

[0025] [ka]

[0026] MN6 and MN19 are unstable nucleic acid constructs that exhibit an equilibrium between a state in which the base sequences corresponding to the first and second base sequences autonomously bind to form a secondary structure, and a state in which the base sequences corresponding to the first and second base sequences do not bind and therefore have no secondary structure. Furthermore, the dissociation constant of MN6 with cocaine is 45.3 ± 0.5 μM, and the dissociation constant of MN19 is 26.7 ± 0.7 μM, indicating a low ability to bind to and capture target substances. Therefore, compared to MN4, MN6 and MN19 are unstable and difficult to handle when used as aptamers. Moreover, the dissociation constant with methyl benzoate, a cocaine odor component, cannot be detected by isothermal titration calorimetry (ITC). Therefore, MN6 and MN19 cannot be used as methyl benzoate aptamers in ITC.

[0027] However, MN6 and MN19 have the characteristic of undergoing a change in secondary structure triggered by the capture of their ligand, cocaine. Since nucleic acids have a negatively charged main skeleton, such a change in secondary structure can be detected as a relatively large signal from the sensor element, representing the proximity or separation of negative charges. Therefore, MN6 and MN19 have excellent functionality as nucleic acid probes for chemical sensors.

[0028] On the other hand, as mentioned above, MN4 has a high affinity for target substances as an anti-cocaine aptamer, but it forms a stable secondary structure even without capturing the target substance. The challenge has been that the changes in higher-order structure and, consequently, the changes in sensor signals caused by MN4 capturing the target substance are small.

[0029] Therefore, a challenge was the difficulty in achieving both high binding ability and a stable structure (desirable as an aptamer for target substances) and high signal output due to significant changes in higher-order structure (desirable as a nucleic acid probe). Furthermore, there was a fundamental problem that detection was difficult at concentrations lower than the dissociation constant due to the low binding frequency.

[0030] However, recently, the inventors have discovered that this problem can be solved by using nucleic acids, which have been formed by attaching short complementary chains to create a meta-stabilized structure, as probes to capture target substances, as described later. The meta-stabilized structure of nucleic acid probe 4 will be explained below with reference to Figures 2-4.

[0031] Figure 2(a) shows the secondary structure of the nucleic acid probe 4 of this embodiment before the strand exchange reaction occurs. That is, the secondary structure of the double-stranded nucleic acid formed by the binding of the short complementary strand, as shown in Figure 2(a), is the quasi-stabilized structure. In this embodiment, MN4 is used as an example of the nucleic acid probe 4 (see Figure 2) for explanation, but the same mechanism of action can be expected even with base sequences other than MN4. For example, the first base sequence and the second base sequence only need to be complementary, and their sequences do not need to be different from those of MN4. If the first base sequence is changed, the fourth base sequence must also be a corresponding complementary sequence.

[0032] The change in free energy due to the formation of the meta-stable structure shown in Figure 2(a) is calculated as the free energy during double-strand formation of the first and fourth base sequences, and is approximately -8.33 kcal / mol, indicating that the chemical stability of the meta-stable nucleic acid probe 4 is relatively good (however, the free energy value of the meta-stable structure may change depending on the base length, binding position, GC ratio, and mismatch ratio of the complementary strand formed by the second base sequence of the first nucleic acid and the fourth base sequence of the second nucleic acid). When a target substance is captured by such a meta-stable nucleic acid probe 4 with relatively good chemical stability, the strand exchange reaction described below can occur.

[0033] In this embodiment, the strand exchange reaction in nucleic acid probe 4 is a reaction in which the binding of the fourth base sequence of the second nucleic acid to the second base sequence of the first nucleic acid is gradually replaced by the binding of the first base sequence of the first nucleic acid to the second base sequence of the first nucleic acid. The target is captured in the base sequence portion of the third base sequence that constitutes the binding site, thereby forming the shape of the binding site, and as a result, the 3' side of the first base sequence and the 5' side of the second base sequence come into close proximity. Subsequently, starting from this point, strand exchange proceeds to the double strands of the first and second base sequences. Figure 2(b) shows the strand exchange reaction progressing after the target substance 9 has been captured at the binding site.

[0034] The free energy of nucleic acid probe 4 in the state where the strand exchange reaction is underway is higher than the free energy of the metastable structure. Calculating the free energy of nucleic acid probe 4 in the state where the strand exchange reaction is underway is complex and difficult, but it is clear that the metastable state, where the negatively charged second and fourth base sequences are separated from each other, is more stable because it is necessary to bring the negatively charged first base sequence into close proximity against Coulomb repulsion.

[0035] While it is difficult to calculate the free energy of nucleic acid probe 4 while a strand exchange reaction is underway, the change in free energy when forming the state that initiates the strand exchange reaction can be calculated as follows. In order for a strand exchange reaction to occur, as shown in Figure 2(a), the 5' end of the second base sequence needs to be close to the target binding site sequence. If the 5' end of the second base sequence is close to the target binding site sequence, the 3' end of the first base sequence will come into contact with it when the three-dimensional structure of the binding site is formed by the capture of the target, and the strand exchange reaction will begin. Here, the state in which the 5' end of the second base sequence is close to the target binding site sequence, which is the stage prior to the formation of the binding site by the capture of the target, is the state in which the base sequence 3' end of the third base sequence relative to the target binding site sequence forms a stem-loop structure.

[0036] When the free energy change during the formation of the stem-loop was calculated, it was found to be -2.92 kcal / mol, a value extremely close to zero. Here, the free energy at the start of the chain exchange and the free energy in the meta-stabilized structure are calculated using different base sequence sites, so they cannot be simply treated as a change in free energy. However, this at least means that creating the state in which chain exchange begins is not as stable as creating the meta-stabilized structure.

[0037] Therefore, this suggests that the instability of the chain exchange initiation state can act as a barrier to stabilizing the metastabilized structure. For convenience, we defined ΔE1 as the difference between the free energy of the metastabilized structure and the free energy of the chain exchange reaction initiation state.

[0038] However, as mentioned above, ΔE1 is not an energy barrier for the strand exchange reaction to occur. More precisely, it corresponds to the energy barrier required to completely dissociate the fourth base sequence from the double strand of the metastable structure and initiate the formation of a double strand with the first sequence. In actual strand exchange, the dissociation of the initial complementary strand and the binding with the new complementary strand occur simultaneously, resulting in a slightly smaller energy barrier. Nevertheless, as mentioned earlier, it is necessary to overcome a state that opposes Coulomb repulsion, i.e., a state with high free energy, thus inhibiting nucleic acid probe 4 from autonomously initiating the strand exchange reaction.

[0039] When a target molecule is captured, the three-dimensional structure of the binding site is formed, forcing the 5' end of the second base sequence and the 3' end of the first base sequence to come into close proximity. This assists in the work of bringing them closer together against the Coulomb repulsion, thus lowering the energy barrier compared to when there is no target. In other words, capture of the target substance makes chain exchange more likely. Furthermore, the capture of the target substance only needs to act as a trigger to initiate chain exchange, so it is not necessary to maintain the captured state indefinitely. Therefore, even if the concentration of the target substance is lower than the dissociation constant, it can still act as a trigger for chain exchange.

[0040] Here, the meta-stabilizing structure is formed to inhibit the autonomous stem formation of the first nucleic acid between the first and second base sequences. As mentioned above, the binding of the first and second base sequences begins with the proximity of the 3' side of the first base sequence and the 5' side of the second base sequence. Therefore, if the 5' side of the second base sequence to which the fourth base sequence binds as a double strand is shifted significantly towards the 3' side compared to the 5' side of the second base sequence to which the first base sequence binds as a double strand, the inhibitory effect of the meta-stabilizing structure on stem formation between the first and second base sequences will not be achieved.

[0041] However, as will be described later in the examples, the inventors have confirmed that the 5' base to which the fourth base sequence of the second base sequence binds may be shifted 1, 2, or 3 bases to the 3' side from the 5' base to which the first base sequence of the second base sequence binds. Furthermore, since the chain exchange reaction enhanced by the target substance is initiated by the proximity of the 3' side of the first base sequence and the 5' side of the second base sequence as the binding site is formed, it is preferable that at least one of the 3' side of the first base sequence and the 5' side of the second base sequence is close to the binding site. In this regard, the inventors have confirmed that a spacer consisting of one base may be included between the first base sequence and the base sequence constituting the binding site among the third base sequences.

[0042] After the strand exchange reaction has completely proceeded, nucleic acid probe 4, as shown in Figure 2(c), has a stem portion formed by the pairing of the first and second base sequences within the first nucleic acid, and exhibits a chemically very stable structure. The change in free energy when the first and second base sequences form a stem is -12.74 kcal / mol.

[0043] The free energy of nucleic acid probe 4 after the chain exchange reaction has completely proceeded is less than the free energy of nucleic acid probe 4 in the metastable structure. Here, if we let ΔE2 be the difference between the free energy of nucleic acid probe 4 in the state where the chain exchange reaction is proceeding and the free energy of nucleic acid probe 4 after the chain exchange reaction has completely proceeded, the free energy of nucleic acid probe 4 after the chain exchange reaction has completely proceeded is at the level shown in Figure 3(c), and ΔE1 < ΔE2. Therefore, nucleic acid probe 4 in the chain exchange state proceeds more preferentially in the direction of forming the first and second stems than in the direction of forming the first and fourth stems. As a result, once chain exchange occurs and the first and second stems are formed, it becomes an irreversible reaction and it is difficult to return to the metastable structure.

[0044] Since the nucleic acid probe 4 exists stably with its first and second base sequences forming a stem, it has a relatively strong binding affinity for capturing the target substance. However, as mentioned above, the capture of the target substance is a reversible reaction and detachment may occur. Nevertheless, as previously stated, after the strand exchange reaction is complete, the nucleic acid probe 4 is stable with its first and second base sequences forming a stem. Therefore, even if the captured target substance detaches from the binding site of the nucleic acid probe 4, the secondary structure of the nucleic acid probe 4 is unlikely to change. On the other hand, the detached target substance can bind to the unreacted nucleic acid probe 4, causing further strand exchange reactions in the nucleic acid probe 4, and the number of nucleic acid probes 4 that have undergone strand exchange reactions accumulates within the chemical sensor. For this reason, the chemical sensor according to this embodiment is preferable because it can detect the target substance at a concentration lower than the dissociation constant between the nucleic acid probe 4 and the target substance, and has excellent detection sensitivity.

[0045] In a further embodiment, a donor fluorescent dye and an acceptor may be bound to any two of the first, second, and third base sequences. Here, the acceptor is a substance having an absorption wavelength that overlaps with the emission wavelength of the donor fluorescent dye. When the base sequence to which the donor fluorescent dye is bound and the base sequence to which the acceptor is bound are in close proximity, fluorescence resonance energy transfer (FRET) occurs between them, and the emission of the donor dye is attenuated when irradiated with the excitation wavelength of the donor fluorescent dye. If a fluorescent dye with an emission wavelength in the visible light range is used as the acceptor, the emission of the acceptor dye can be observed when irradiated with the excitation wavelength of the donor fluorescent dye.

[0046] For example, if a donor fluorescent dye is bound to the first base sequence and an acceptor is bound to the second base sequence, fluorescence from the donor fluorescent dye is observed before the nucleic acid probe 4 captures the target substance. However, as the nucleic acid probe 4 captures the target substance and the chain exchange reaction proceeds, the emission intensity of the donor fluorescent dye decreases as the binding between the first and second base sequences gradually forms. Therefore, by binding a donor fluorescent dye to the first base sequence and an acceptor to the second base sequence and detecting the decrease in fluorescence intensity, it is possible to detect whether a chain exchange reaction is occurring, whether the target substance has been captured, and ultimately whether the target substance is present in the sample. Similarly, an acceptor may be bound to the first base sequence and a donor fluorescent dye to the second base sequence. Furthermore, if a fluorescent dye with an emission wavelength in the visible light range is used as the acceptor, the emission intensity of the acceptor dye may be measured.

[0047] Furthermore, the distance between the first and third base sequences increases after the strand exchange because the third base sequence is released. When a donor fluorescent dye is bound to the first base sequence and an acceptor is bound to the third base sequence, it is possible to detect whether a strand exchange reaction has occurred, whether the target substance has been captured, and ultimately whether the target substance is present in the sample, by detecting changes in fluorescence intensity.

[0048] (Second Embodiment) The chemical sensor according to the second embodiment will be described below. Note that similar components to those of the chemical sensor described in the first embodiment will not be described further.

[0049] The chemical sensor according to the second embodiment differs from the chemical sensor of the first embodiment in that, in addition to the fourth base sequence, a polycation amino acid sequence is bound to the second nucleic acid.

[0050] In this specification, "polycation" refers to a compound in which, for example, the number of cations per molecule in liquid is equal to or greater than the base length of the double-stranded portion formed by the pairing of the second base sequence of the first nucleic acid and the fourth base sequence of the second nucleic acid. For example, if the double-stranded portion formed by the second base sequence and the fourth base sequence has 4 bases, the polycation may have 4 or more cations per molecule.

[0051] The amino acid sequence of the polycation in the second nucleic acid is a sequence composed of basic amino acid residues, lysine (Lys), arginine (Arg), and histidine (His), linked to each other in any combination and order.

[0052] In the second nucleic acid, the amino acid sequence of the polycation and the fourth base sequence may be directly bonded. For example, as shown in Figure 4(a), the second nucleic acid 20 may have a GGCG base sequence from its 5' to 3' direction, and the amino acid sequence of a lysine hexamer may be bonded to the 5' end to form a Lys-Lys-Lys-Lys-Lys-Lys-GGCG conjugate. Here, if the second nucleic acid is DNA or RNA, the polycation and base sequence can be bonded using a linker molecule, and if the second nucleic acid is peptide nucleic acid (PNA), a copolymer can be formed using a peptide bond. Furthermore, a spacer sequence of several base lengths may be included between the polycation sequence and the fourth base sequence.

[0053] Furthermore, in the second nucleic acid, the amino acid sequence of the polycation may be indirectly bound to the fourth base sequence. For example, the amino acid sequence of the polycation may be bound to a PNA having a fifth base sequence, and a sixth base sequence complementary to the base sequence of the PNA may be bound to the fourth base sequence, and the polycation may be bound to the fourth base sequence by the double strands of the fifth and sixth base sequences.

[0054] Polycation 31 may be bound to a base sequence that can form a double helix with a second nucleic acid. For example, as shown in Figure 7(a), polycation 31 may be PNA, which is formed by the binding of the amino acid sequence KKKKKK and the base sequence TCTCTC. Alternatively, polycation 31 may be a peptide consisting of the amino acid sequence KKKK from the amino group side to the carboxyl group side (SEQ ID NO: 5: KKKK), or a peptide consisting of the amino acid sequence KKKKK (SEQ ID NO: 6: KKKKK).

[0055] For example, as shown in Figure 7(b), when using PNA with the sequence KKKKKKTCTCTC, the second nucleic acid 30 is a sequence consisting of GAGAGATGGCG (sequence number 7) from the 5' end. The second nucleic acid 30 of sequence number 9 is a base sequence formed by the combination of a base sequence 32 that binds complementary to the base sequence TCTCTC (5'→3' direction) of the polycation 31 and a fourth base sequence 23 consisting of the sequence GGCG (5'→3' direction). Therefore, the second nucleic acid 30 and the polycation 31 are in close proximity because they have complementary base sequences.

[0056] In the first embodiment, it was explained that when the target substance is captured at the binding site of the nucleic acid probe 4, the binding between the fourth base sequence of the second nucleic acid and the second base sequence of the first nucleic acid is gradually replaced by a chain exchange reaction, resulting in the binding between the first base sequence of the first nucleic acid and the second base sequence of the first nucleic acid. Referring to Figure 2(b), it can be seen that in the chain exchange reaction, it is necessary to maintain a state in which the three base sequences (i.e., the first base sequence, the second base sequence, and the fourth base sequence) are in close proximity.

[0057] Generally, since base sequences are negatively charged, an electrical repulsion occurs between multiple nucleic acids, acting as an inhibitor to bring them closer together. Therefore, the strand exchange reaction explained in Figure 2(b) is thought to be strongly inhibited by such repulsion between negative charges.

[0058] Therefore, as shown in Figure 4(b), by further providing the second nucleic acid 20 with a polycation amino acid sequence 24, the chain exchange reaction is initiated by the capture of the target substance, and when the first base sequence 21, the second base sequence 22, and the fourth base sequence 23 approach each other, the polycation amino acid sequence 24 can be brought close to those base sequences. This weakens the repulsive force between negative charges and enhances the chain exchange reaction.

[0059] Referring to the free energy of nucleic acid probe 4, the amino acid sequence 24 of the polycation of the second nucleic acid 20 can enhance the chain exchange reaction by reducing the energy barrier required to initiate the chain exchange reaction from ΔE1 to ΔE1' (see Figure 5). However, reducing the energy barrier required to initiate the chain exchange reaction also increases the possibility of the chain exchange reaction initiating due to factors other than the target substance, so it is important to note that excessive polycations may cause false positive signals.

[0060] Therefore, when adding a substance that enhances the chain exchange reaction (for example, an amino acid sequence of a polycation), it is preferable to adjust the amount added so that the desired effect obtained by the addition outweighs any undesirable side reactions. For example, this can be done by optimizing the amount of the substance that enhances the chain exchange reaction, or by configuring the molecular structure of the substance that enhances the chain exchange reaction to contain the minimum necessary number of cations.

[0061] Furthermore, in the chemical sensor of the second embodiment, once the chain exchange reaction is complete, the second nucleic acid dissociates from the first nucleic acid, and the polycation that was bound to the second nucleic acid is released from the nucleic acid probe 4. The release of the polycation prevents the reverse chain exchange reaction from occurring, and the separation of the positive charge accompanying the release of the polycation can be obtained as a strong detection signal.

[0062] (Third embodiment) A chemical sensor 30 according to the third embodiment will be described in detail with reference to Figure 6. In Figure 6, components similar to those described in Figure 1 in the first embodiment are denoted by the same reference numerals and their descriptions are omitted.

[0063] The chemical sensor 30 according to the third embodiment differs from the chemical sensor of the first embodiment in that it further includes free polycations 31 in the liquid film 3.

[0064] In the second embodiment of the chemical sensor, the second nucleic acid 20 contained an amino acid sequence 24 which is a polycation. However, in the third embodiment of the chemical sensor 30, the free polycation 31 is included in the liquid film as a solute, thereby weakening the repulsive force between negative charges as a counterion.

[0065] Therefore, the chemical sensor 30 of the third embodiment, similar to the second embodiment, can facilitate the initiation of a strand exchange reaction by bringing the free polycation 31 into close proximity to the first base sequence 21, the second base sequence 22, and the fourth base sequence 23 of the second nucleic acid 30.

[0066] (Fourth embodiment) As a fourth embodiment, a method for detecting a target substance using the chemical sensors described in the first to third embodiments is provided. The detection method, as shown in Figure 8, includes (S1) preparing the chemical sensors described in the first to third embodiments and a sample containing the target substance; (S2) contacting the prepared sample with the chemical sensors prepared in (S1); and (S3) detecting the DNA strand exchange reaction that occurs when a nucleic acid probe binds to the target substance.

[0067] The target substance may be a substance in any state, such as a gas, liquid, or particulate matter. Furthermore, the sample containing such a target substance may be a gas or a liquid. If the sample is a gas, in step (S2) described above, it may be brought into contact with the surface of the liquid film on the chemical sensor by spraying, or by bubbling the liquid film. If the sample is a liquid, it can be brought into contact by adding it to the liquid film.

[0068] The aforementioned (S3) step can be performed by detecting the change in the secondary structure of the nucleic acid probe 4 due to the strand exchange reaction using the sensor element of the chemical sensor. When detecting, the temperature of the liquid film 3 provided by the chemical sensor 1 is adjusted to a temperature lower than the melting temperature Tm of the first nucleic acid. By adjusting to such a temperature, the state in which the first base sequence and the second base sequence are bound in the first nucleic acid after strand exchange becomes stable.

[0069] When structural changes or changes in electrical properties occur in the nucleic acid probe 4 due to liberation, these are detected as signal changes in the sensor element 2. If the sensor element is an FET element, the aforementioned (S3) step can be performed by detecting changes in the electrical properties of the FET. Changes in the electrical properties of the FET can be detected by detecting changes in drain current and changes in IdVg characteristics.

[0070] For example, when a sensor element is composed of a carbon allotrope film, the electrical properties of the carbon allotrope film, particularly graphene, exhibit a unique band structure where the conduction band and valence band intersect at a single point without a band gap (this point is called the "Dirac point"). When the Fermi level of the carbon allotrope film 2 is at the Dirac point, the carrier density is lowest, and therefore the electrical resistance of graphene is highest. If the Fermi level is lower than the Dirac point, the Fermi level is located in the valence band, and it exhibits P-type conduction with holes as carriers. If the Fermi level is lowered further, the density of holes increases, and the conductivity of graphene improves. On the other hand, if the Fermi level of the carbon allotrope film is higher than the Dirac point, the Fermi level is located in the conduction band, and it exhibits N-type conduction with electrons as carriers. If the Fermi level increases further, the density of electrons increases, and the conductivity of graphene improves even further.

[0071] In a chemical sensor 1 equipped with a carbon allotrope film having the properties described above as a sensor element 2, the magnitude of the drain current obtained by scanning the gate voltage is minimized when the gate voltage is equal to the Fermi level at the Dirac point, and tends to increase as the Fermi level moves away from the Dirac point by changing the gate voltage. The IdVg characteristic of such a carbon allotrope film can be represented by a V-shaped curve. The point on the V-shaped curve where the magnitude of the drain current is minimized is called the "charge neutral point (CNP)".

[0072] Here, when the surface of the carbon allotrope film becomes positively charged, a negative charge is induced on the carbon allotrope film, causing the Fermi level to rise. This phenomenon is applied as a bias to the gate voltage, so the V-shaped curve of the IdVg characteristic of the carbon allotrope film shifts towards the low gate voltage direction. Conversely, when the surface of the carbon allotrope film becomes negatively charged, the V-shaped curve of its IdVg characteristic shifts towards the high gate voltage direction. In other words, the shift in the V-shaped curve can also be considered as a shift in CNP. Therefore, by observing the V-shaped curve of the IdVg characteristic and the shift of CNP in the gate voltage direction described above, it is possible to detect changes in the surface charge of the carbon allotrope film. When the secondary structure of nucleic acid probe 4 changes, the proximity or separation of negatively charged nucleic acids occurs, and this can be read as a change in surface charge.

[0073] Another measurement method for detecting changes in the electrical properties of a carbon allotrope membrane is to fix the gate voltage and measure the change in drain current over time. If the gate voltage applied to the chemical sensor 1 is set to a constant value, a constant drain current value will be output if the surface charge of the carbon allotrope membrane does not change. If the secondary structure of the nucleic acid probe 4 changes from such a steady state, a change in drain current will occur due to the change in surface charge caused by the proximity or separation of the nucleic acid negative charges, similar to the above.

[0074] Alternatively, the change in the molecular structure of the nucleic acid probe 4 may be performed by equipping the nucleic acid probe 4 with a donor fluorescent dye and an acceptor, as described in the first embodiment, and detecting the change in its fluorescence intensity with, for example, a sensor element 2 or a fluorescence detection device (not shown).

[0075] As described in the first to third embodiments, the method according to the fourth embodiment detects the target substance by inducing a chain exchange reaction, and therefore can detect the presence of the target substance with high sensitivity.

[0076] The above steps (S1) to (S3) may be performed sequentially, or any steps related to the use of sensors may be included between each step.

[0077] (Fifth embodiment) As a fifth embodiment, a method for manufacturing the chemical sensor described in the first to third embodiments is provided. As shown in Figure 9, the manufacturing method includes: (S1) preparing a sensor element having a first nucleic acid immobilized on its surface and coated with a liquid film, wherein the first nucleic acid includes a stem portion formed by the bonding of a first base sequence and a second base sequence, and a solution containing a second nucleic acid; (S2) denaturing the first nucleic acid immobilized on the surface of the sensor element prepared in (S1) so as to dissociate the bond between the first base sequence and the second base sequence; (S3) dropping a solution containing the second nucleic acid in a large excess compared to the first nucleic acid onto the surface of the sensor element equipped with the first nucleic acid; and (S4) forming a nucleic acid probe containing a double-stranded nucleic acid composed of the first nucleic acid and the second nucleic acid by bonding the first nucleic acid and the second nucleic acid.

[0078] In method (S1) according to the embodiment, a sensor element is prepared on which a first nucleic acid is immobilized on its surface. Since the first nucleic acid is a nucleic acid that autonomously forms a stable higher-order structure, the first nucleic acid immobilized on the surface of the prepared sensor element also has a stable higher-order structure.

[0079] Furthermore, the solidification of the first nucleic acid onto the sensor element surface can be carried out by making the material constituting the surface 2a of the sensor element 2 a material capable of binding to the first nucleic acid or the second nucleic acid of the nucleic acid probe 4, as described in the first embodiment. For example, if the sensor element 2 is graphene or gold, the nucleic acid probe 4 will be solidified because it will non-specifically adsorb to the nucleic acid. More preferably, the nucleic acid probe 4 may be modified with a functional group that binds to or adsorbs to the material constituting the surface 2a of the sensor element 2, and the nucleic acid probe 4 may be solidified by the binding or adsorption of the functional group to the sensor element surface 2a. For example, if the sensor element 2 is graphene, modifying it with a polycyclic aromatic compound, such as pyrene, as the functional group will cause the nucleic acid probe 4 to be strongly solidified onto the graphene sensor element surface 2a due to the ππ interaction between the polycyclic aromatic compound and graphene. Alternatively, if the sensor element 2 is gold, modifying it with a thiol group as the functional group will cause the nucleic acid probe 4 to be strongly solidified onto the gold surface 2a of the sensor element 2 due to the strong binding of the thiol group to the gold. Functional group modification of nucleic acids can be performed by using an amidite reagent containing the desired functional group and synthesizing nucleic acids by the phosphoramidite method.

[0080] In method (S2) according to the embodiment, the first nucleic acid, which has autonomously formed a stable higher-order structure, is denatured on the sensor element. Denaturation can be carried out by methods known in the art that can dissociate the complementary strand of the nucleic acid. Known methods include, for example, thermal denaturation and denaturation by reducing salt concentration.

[0081] To perform step (S2), the chemical sensor may be equipped with a heating device for thermal denaturation. The heating device should be configured to heat the liquid film to the melting temperature Tm of the first nucleic acid, and may employ a known heating mechanism such as a resistance heating element.

[0082] Furthermore, the chemical sensor may also include a device for supplying a low-salt concentration solution to the surface of the sensor element as an apparatus for performing the process in (S2). The apparatus for supplying the low-salt concentration solution includes, for example, a container for holding the low-salt concentration solution, a channel for supplying the low-salt concentration solution to the surface of the sensor element, and a pump.

[0083] In step (S3) of the method according to the embodiment, a solution containing a second nucleic acid is dropped onto the surface of a sensor element to which the first nucleic acid, denatured in step (S2), is immobilized. If the dissociation of the first and second base sequences in step (S2) is performed by heating, it is preferable to continue heating until step (S3) in order to suppress the recombination of the first and second base sequences. Furthermore, if step (S2) is performed by supplying a low-salt solution, the low-salt solution supplied in step (S2) should also contain a large excess of the second nucleic acid, and a high-salt solution containing a large excess of the second nucleic acid should be dropped into step (S3). This way, a large excess of the second nucleic acid will always be present during the process of changing salt concentration, thereby suppressing the recombination of the first and second base sequences.

[0084] Furthermore, step (S3) may be performed simultaneously with the start of step (S2), regardless of the denaturation method. In other words, the liquid film provided by the sensor element prepared in step (S1) may also contain a second nucleic acid, and the second nucleic acid may be subjected to step (S2) together with the first nucleic acid.

[0085] In method (S4) according to the embodiment, a nucleic acid probe containing a double-stranded nucleic acid composed of the first nucleic acid and the second nucleic acid is formed by binding the first nucleic acid and the second nucleic acid. The binding of the first nucleic acid and the second nucleic acid can be carried out by methods known in the art that can bind complementary strands of nucleic acids. Known methods include, for example, binding by cooling below the melting temperature and binding by increasing the salt concentration.

[0086] If a heating device is used in step (S3), the chemical sensor is equipped with a cooling device in order to perform step (S4). The cooling device only needs to be configured to lower the temperature of the liquid film below the melting temperature Tm of the first nucleic acid, and may employ known heat absorption mechanisms such as a Peltier element or known heat dissipation mechanisms such as a heat sink or heat pump.

[0087] Furthermore, if a device and flow path for supplying a low-salt concentration solution are used in step (S3), the device for performing step (S4) further includes a device for supplying a high-salt concentration solution to the sensor element surface 2a. This device may include, for example, a container for holding the high-salt concentration solution, and a flow path and pump for supplying the high-salt concentration solution to the sensor element surface.

[0088] In addition to being prepared by the method according to the embodiment, the nucleic acid probe 4 may also be formed by incorporating a double-stranded nucleic acid obtained by combining a first nucleic acid and a second nucleic acid into a liquid film, and then solidifying the double-stranded nucleic acid on the surface 2a of the sensor element 2. With such a method, although it is necessary to prepare a double-stranded nucleic acid obtained by combining a first nucleic acid and a second nucleic acid, the operation on the chemical sensor is limited to the solidification process.

[0089] [example] The nucleic acid probes described in the embodiments will be explained below using experimental data.

[0090] Example 1: Measuring the change in drain current over time by gradually increasing the concentration of the target substance. • Preparation of chemical sensors A sensor 30 with a structure similar to that shown in Figure 6 was prepared. The sensor element of sensor 30 is a single-layer graphene film. A voltage application circuit is connected to sensor 30, allowing a gate voltage to be applied between the gate electrode and the source electrode, and a drain voltage to be applied between the drain electrode and the source electrode. The drain current flowing through sensor 30 due to the drain voltage exhibits FET characteristics that change in a V-shape with changes in the gate voltage. Sensor 30 is also equipped with an ammeter (not shown) for measuring the drain current.

[0091] Nucleic acid probe 4 used a double-stranded nucleic acid as shown in Figure 2(a), namely, a first nucleic acid which is MN4, and a second nucleic acid which is a short complementary strand consisting of the GCGA base sequence.

[0092] In Example 1, the target substance of nucleic acid probe 4 is methyl benzoate (hereinafter referred to as MB), a substance derived from cocaine. Four samples containing the target substance were prepared and used, each at a different concentration (specifically, a liquid sample containing 0 μM of MB, a liquid sample containing 1 μM, a liquid sample containing 10 μM, and a liquid sample containing 100 μM).

[0093] Furthermore, in Example 1, the liquid film 3 provided by the sensor 30 contained a polycation consisting of the amino acid sequence KKKKK (SEQ ID NO: 10).

[0094] • Drain current change under constant gate voltage A constant gate voltage was applied to the sensor 30 having the above configuration, and the change in drain current over time was measured as the concentration of the target substance was gradually increased. As shown in Table 1, a liquid sample with an MB concentration of 0 μM was supplied from the start of measurement until T1, a liquid sample with a concentration of 1 μM was supplied from T1 to T2, a liquid sample with a concentration of 10 μM was supplied from T2 to T3, a liquid sample with a concentration of 100 μM was supplied from T3 to T4, and a liquid sample with a concentration of 0 μM was supplied from T4 onward. Each sample was supplied by replacing the liquid film of the chemical sensor with a 3-pipette.

[0095] [Table 1]

[0096] As will be described later, the measurement of the time-dependent change in drain current was temporarily interrupted at times t1, t2, t3, t4, and t5 from the start of measurement, and the IdVg characteristics of the graphene film at each time point were measured by scanning the gate voltage. After measuring the IdVg characteristics at each time point, the gate voltage was quickly returned to its original value, and the measurement of the time-dependent change in drain current was resumed. For example, the measurement of the time-dependent change in drain current with a gate voltage of 0mV was temporarily interrupted at time T1, the IdVg characteristics were measured by scanning the gate voltage between -500mV and +500mV, and then the measurement of the time-dependent change in drain current was resumed by setting the gate voltage back to 0mV. In this case, the point at which the measurement was resumed was defined as time T1. Note that a gate voltage of 0mV does not mean that no gate voltage is applied, but rather that the source electrode and drain electrode are fixed at the same potential. Since there is a potential difference between the gate electrode and the liquid film where the electrochemical reaction is in equilibrium, this does not mean that the potential difference between the liquid film and graphene is 0mV.

[0097] • Measurement of IdVg characteristics of graphene film As described above, the measurement of the time-dependent change in drain current was temporarily interrupted at t1, t2, t3, t4, and t5 after the start of measurement, and the IdVg characteristics of the graphene film at each time point were measured by scanning the gate voltage. In the measurement of each IdVg characteristic, the gate voltage scanning was performed in the range of -500mV to +430mV, but since important information was not included below 0mV, the range of 0mV to 430mV is shown in an enlarged diagram. ·result Figure 10 shows the measurement results of the time-dependent change in drain current. The baseline of the drain current gradually decreases over time, without correlation to the timing of liquid replacement, which is a drift specific to the measurement of electrochemical phenomena. On the other hand, at time T1, when the methyl benzoate concentration was changed from 0 μM to 1 μM, a sharp decrease in the drain current, clearly different from the baseline movement, was observed. No such sharp change was observed in subsequent liquid replacements, and even when the methyl benzoate concentration was returned to 0 μM at the end, the drain current did not recover (increase).

[0098] The measurement results of the IdVg characteristics are shown in Figure 11. Referring to Figure 11, it can be seen that the V-shaped curve of the IdVg characteristics shifted towards the lower gate voltage direction, particularly in the measurement at time t2. This suggests that a negative charge was approaching the graphene film, which is the sensor element, at time t2. Furthermore, there was almost no difference in the V-shaped curves of the IdVg characteristics measured at time t3, t4, and t5.

[0099] Based on the above results, the significant decrease in drain current at time T1 is clearly attributable to the addition of 1 μM of MB solution. Furthermore, since the dissociation constant between the target substance MB and MN4 is approximately 100 μM, it has been shown that the chemical sensor according to this embodiment can detect the target substance even at concentrations more than an order of magnitude lower than the dissociation constant. This is thought to be because, as explained above, the target substance captured by the nucleic acid probe detaches from its binding site and rebinds to other unreacted nucleic acid probes.

[0100] Furthermore, the fact that the drain current value did not recover even when a sample with 0 μM MB was added after time T4 suggests that the higher-order structure after the chain exchange reaction is stable, and that the reaction from the metastable state to the stable structure via chain exchange is irreversible.

[0101] While several embodiments of the present invention have been described, these embodiments are presented as examples only and are not intended to limit the scope of the invention. These novel embodiments can be carried out in a variety of other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their variations are included in the scope and spirit of the invention, as well as in the claims of the invention and its equivalents. The invention described in the original claims of this application is listed below. [1] Nucleic acid probes for capturing target substances, A sensor element with the nucleic acid probe immobilized on its surface, A chemical sensor comprising a liquid film covering the sensor element, The nucleic acid probe comprises a first nucleic acid and a second nucleic acid bound to the first nucleic acid. It is a double-stranded nucleic acid, The first nucleic acid comprises a first base sequence and a base sequence complementary to the first base sequence. A second base sequence, one end of which is bound to the first base sequence, and the other end of which is It is a single-stranded nucleic acid containing a third base sequence that binds to a second base sequence. The second nucleic acid is a base sequence that is complementary to a part of the second base sequence of the first nucleic acid. It is a single-stranded nucleic acid containing a fourth base sequence, The base sequence constituting the binding site that captures the target substance is included in the third base sequence. A chemical sensor. [2] When the third base sequence captures the target substance, the first nucleic acid and the second nucleic acid dissociate, and a secondary structure is formed within the first nucleic acid having a stem portion formed by the pairing of the first base sequence and the second base sequence, and a loop portion or bulge structure containing the third base sequence. The chemical sensor according to [1]. [3] The chemical sensor according to [1], wherein the base length of the fourth base sequence is shorter than the base length of the second base sequence. [4] The chemical sensor according to [1], wherein the first nucleic acid of the nucleic acid probe includes a spacer sequence of one, two, or three bases between the base sequence constituting the binding site of the third base sequence and the second base sequence. [5] Between the base sequence constituting the binding site of the third base sequence and the first base sequence The chemical sensor described in [1], comprising a single base spacer. [6] The chemical sensor according to [1], wherein the first nucleic acid, which has dissociated from the second nucleic acid by the capture of the target substance by the third base sequence, forms a higher-order structure. [7] The chemical sensor according to [1], wherein the secondary structure of the first nucleic acid, formed by the capture of the target substance by the third base sequence, is a hairpin loop, an internal loop, a bulge, a pseudoknot, a three-way junction, or a four-way junction. [8] The chemical sensor according to [1], wherein the sensor element is one of the following: graphene FET, ISFET, SPR, and QCM. [9] The chemical sensor according to [1], wherein the nucleic acid probe is immobilized on the surface of the sensor element by immobilizing either the first nucleic acid or the second nucleic acid on the surface of the sensor element.

[10] The chemical sensor according to [1], wherein the fourth base sequence is a mismatch with the second base sequence.

[11] The fourth base sequence of the second nucleic acid further includes a base sequence that does not pair with the second base sequence, or the second base sequence includes a base sequence that does not pair with the fourth base sequence. The chemical sensor according to [1], comprising the nucleic acid probe having a double strand of bulge structure formed by the bonding of the second base sequence of the first nucleic acid and the fourth base sequence of the second nucleic acid.

[12] The chemical sensor according to [1], wherein the second nucleic acid is PNA in which the fourth base sequence and the amino acid sequence of a polycation are bound.

[13] The chemical sensor according to [1], wherein the liquid film contains a polycationic amino acid or PNA having a polycationic amino acid sequence.

[14] The amino acid sequence of the polycation is part of a PNA that includes a base sequence complementary to the base sequence of a part of the second nucleic acid. The polycation binds to a portion of the base sequence of the second nucleic acid to form a double helix with the second nucleic acid.

[13] Chemical sensor as described above.

[15] A donor fluorescent dye and an acceptor are bound to any two of the first base sequence, the second base sequence, and the third base sequence, respectively. Fluorescence resonance energy transfer (FRET) occurs between the base sequence to which the donor fluorescent dye is bound and the base sequence to which the acceptor is bound. [1] The chemical sensor described above.

[16] A method for detecting a target substance using the chemical sensor described in [1], (S1)[1] Prepare the chemical sensor described in [1] and a sample containing the target substance; (S2) Bringing the sample into contact with the liquid film of the chemical sensor; and, (S3) Detecting the DNA strand exchange reaction that occurs when the target substance is captured by the nucleic acid probe; The detection method, including the method described above.

[17] A method for manufacturing the chemical sensor described in [1], (S1) Prepare a sensor element in which the first nucleic acid is immobilized on its surface and coated with the liquid film, wherein the first nucleic acid includes a stem portion formed by the bonding of the first base sequence and the second base sequence, and a solution containing the second nucleic acid; (S2) Denature the first nucleic acid, which is immobilized on the surface of the sensor element prepared in (S1), such that the bond between the first base sequence and the second base sequence is dissociated; (S3) Dropping the solution containing the second nucleic acid onto the surface of the sensor element; and (S4) To form the nucleic acid probe by combining the first nucleic acid and the second nucleic acid; Methods that include...

[18] The sensor element prepared in (S1) further comprises a heating device for heating the solution constituting the liquid film and a cooling device for cooling the solution constituting the liquid film. The above (S2) is carried out by heating the solution constituting the liquid film with the heating device to denature the first nucleic acid. The method according to

[17] , wherein (S4) is performed by cooling the solution constituting the liquid film with the cooling device.

[19] The chemical sensor is provided with an apparatus for supplying a low-salt solution to the surface of the sensor element. The system further comprises an apparatus for supplying a high-salt concentration solution to the surface of the sensor element, After (S1) and before (S2), the low salt concentration solution is applied to the surface of the sensor element. The low-salt concentration solution supplied from the apparatus for supplying the liquid, which constitutes the liquid film Displacing the liquid; and After (S4), the device for supplying the high-salt concentration solution to the surface of the sensor element Replacing the solution constituting the liquid film with the high-salt concentration solution supplied from the source; The method described in

[17] , including the method described in

[17] . [Explanation of symbols]

[0102] 1, 30, ...Chemical sensor, 2...Sensor element, 2a...Sensor element surface, 3...Liquid film, 3a...Liquid film surface, 4...Nucleic acid probe, 5...Gate electrode, 6...Source electrode, 7...Drain electrode, 8...Insulator, 9...Target substance, 20...Second nucleic acid, 21...First base sequence, 22...Second base sequence, 23...Fourth base sequence, Amino acid sequence 24, Polycation 31

Claims

1. Nucleic acid probes for capturing target substances, A sensor element with the nucleic acid probe immobilized on its surface, A chemical sensor comprising a liquid film covering the sensor element, The nucleic acid probe is a double-stranded nucleic acid consisting of a first nucleic acid and a second nucleic acid bound to the first nucleic acid. The first nucleic acid is a single-stranded nucleic acid comprising a first base sequence, a second base sequence consisting of a base sequence complementary to the first base sequence, and a third base sequence having one end bound to the first base sequence and the other end bound to the second base sequence. The second nucleic acid is a single-stranded nucleic acid that includes a fourth base sequence which is complementary to a part of the second base sequence of the first nucleic acid. The base sequence constituting the binding site that captures the target substance is included in the third base sequence. When the third base sequence captures the target substance, the first nucleic acid and the second nucleic acid dissociate, and a secondary structure is formed within the first nucleic acid having a stem portion formed by the pairing of the first base sequence and the second base sequence, and a loop portion or bulge structure containing the third base sequence. The base length of the fourth base sequence is shorter than the base length of the second base sequence. Chemical sensor.

2. The chemical sensor according to claim 1, wherein the fourth base sequence and the third base sequence do not have complementary strands to each other.

3. The chemical sensor according to claim 1, wherein the first nucleic acid of the nucleic acid probe includes a spacer sequence of one, two, or three bases between the base sequence constituting the binding site of the third base sequence and the second base sequence.

4. The chemical sensor according to claim 1, comprising a single-base spacer between the base sequence constituting the binding site of the third base sequence and the first base sequence.

5. The chemical sensor according to claim 1, wherein the first nucleic acid, which has dissociated from the second nucleic acid by the third base sequence capturing the target substance, forms a higher-order structure.

6. The chemical sensor according to claim 1, wherein the secondary structure of the first nucleic acid, formed by the capture of the target substance by the third base sequence, is a hairpin loop, an internal loop, a bulge, a pseudoknot, a three-way junction, or a four-way junction.

7. The chemical sensor according to claim 1, wherein the sensor element is one of the following: graphene FET, ISFET, SPR, and QCM.

8. The chemical sensor according to claim 1, wherein the nucleic acid probe is immobilized on the surface of the sensor element by immobilizing either the first nucleic acid or the second nucleic acid on the surface of the sensor element.

9. The chemical sensor according to claim 1, wherein the fourth base sequence has a base sequence that is a mismatch with the second base sequence.

10. The fourth base sequence of the second nucleic acid further includes a base sequence that does not pair with the second base sequence, or the second base sequence includes a base sequence that does not pair with the fourth base sequence. The chemical sensor according to claim 1, comprising a nucleic acid probe including a double-stranded bulge structure formed by the bonding of the second base sequence of the first nucleic acid and the fourth base sequence of the second nucleic acid.

11. The chemical sensor according to claim 1, wherein the second nucleic acid is PNA in which the fourth base sequence and the amino acid sequence of a polycation are bonded.

12. The chemical sensor according to claim 1, wherein the liquid film contains a polycationic amino acid or PNA having a polycationic amino acid sequence.

13. The amino acid sequence of the polycation is part of a PNA that includes a base sequence complementary to the base sequence of a part of the second nucleic acid. The polycation binds to a portion of the base sequence of the second nucleic acid to form a double helix with the second nucleic acid. The chemical sensor according to claim 12.

14. A donor fluorescent dye and an acceptor are bound to any two of the first base sequence, the second base sequence, and the third base sequence, respectively. Fluorescence resonance energy transfer (FRET) occurs between the base sequence to which the donor fluorescent dye is bound and the base sequence to which the acceptor is bound. The chemical sensor according to claim 1.

15. A method for detecting a target substance using the chemical sensor described in claim 1, (S1) Prepare the chemical sensor described in claim 1 and a sample containing the target substance; (S2) Bringing the sample into contact with the liquid film of the chemical sensor; and, (S3) Detecting the DNA strand exchange reaction that occurs when the target substance is captured by the nucleic acid probe; The detection method, including the method described above.

16. A method for manufacturing the chemical sensor described in claim 1, (S1) A sensor element having the first nucleic acid immobilized on its surface and coated with the liquid film, wherein the first nucleic acid includes a stem portion formed by the bonding of the first base sequence and the second base sequence, and a solution containing the second nucleic acid; (S2) Denature the first nucleic acid that is immobilized on the surface of the sensor element prepared in (S1) so as to dissociate the bond between the first base sequence and the second base sequence; (S3) Dropping the solution containing the second nucleic acid onto the surface of the sensor element; and (S4) To form the nucleic acid probe by combining the first nucleic acid and the second nucleic acid; Methods that include...

17. The sensor element prepared in (S1) further comprises a heating device for heating the solution constituting the liquid film and a cooling device for cooling the solution constituting the liquid film. The above (S2) is carried out by heating the solution constituting the liquid film with the heating device to denature the first nucleic acid. The method according to claim 16, wherein (S4) is performed by cooling the solution constituting the liquid film with the cooling device.

18. The chemical sensor further comprises a device for supplying a low-salt concentration solution to the surface of the sensor element, and a device for supplying a high-salt concentration solution to the surface of the sensor element. After (S1) and before (S2), replace the solution constituting the liquid film with the low-salt solution supplied from the apparatus for supplying the low-salt solution to the surface of the sensor element; and After (S4) above, the solution constituting the liquid film is replaced with the high-salt concentration solution supplied from the apparatus for supplying the high-salt concentration solution to the surface of the sensor element; The method according to claim 16, including the method described in claim 16.

Citation Information

Patent Citations

  • Method for analyzing nucleic acid base sequence

    JP2003319799A

  • Cocaine aptamer and method for detecting cocaine using the same

    JP2018061504A

  • Sensor, reagent, probe molecule production method, sensor production method, and polymer molecule production method

    JP2019041626A

  • Method for detecting target substance, sensor chip, and detection device

    WO2013014843A1

  • Target substance detection method using FET biosensor

    WO2016111237A1