Intrathecal delivery of recombinant adeno-associated virus encoding methyl-CPG-binding protein 2

Abstract

To provide methods and products for delivering methyl-CpG binding protein 2 (MECP2) polynucleotides to a central nervous system and expressing the polynucleotides in the central nervous system.SOLUTION: The invention provides methods for intrathecal administration (i.e., administration into a space under an arachnoid membrane of a brain or a spinal cord) of polynucleotide encoding MECP2 to a patient, the methods comprising administering an rAAV9 with a genome including the polynucleotide. Use of the methods and materials is contemplated, for example, for treatment of Rett syndrome.SELECTED DRAWING: None

Description

Technical Field

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 423,61 8, filed on November 17, 2016.

[0002] Incorporation by reference of electronically submitted materials The entire contents of a computer-readable form sequence listing, filed simultaneously with this specification, is incorporated by reference and is identified as follows: an ASCII text file named "5 0215PCT_SeqListing.txt", created on November 17, 2017 (24,148 bytes).

[0003] The present invention relates to methods and materials for intrathecal delivery of recombinant adeno-associated virus 9 (rAAV9) encoding methyl-CpG-binding protein 2 (MECP2). The use of these methods and materials is contemplated, for example, for the treatment of Rett syndrome.

Background Art

[0004] Rett syndrome is an X-linked dominant neurodevelopmental disorder that affects approximately 1 in 10,000 girls. Hemizygous males usually die of neonatal encephalopathy. Heterozygous females survive to adulthood but exhibit severe symptoms (e.g., microcephaly, loss of purposeful hand movement and language abilities) as well as motor abnormalities that appear after a period of seemingly normal development. The age of onset is approximately 6 - 18 months.

[0005] Rett syndrome is classified as classic (or typical) Rett or atypical Rett. A spontaneous mutation encoding the transcription factor methyl-CpG-binding protein 2 (MECP2) Genes cause the majority of cases (about 90%) in both classifications, but atypical cases The condition may be caused by mutations in genes other than MECP2. The nature of mutations (e.g., deletion pair mutations) and distorted X chromosome inactivation can affect the severity of the disease. It has an impact. The MECP2 transcription factor regulates the transcription of thousands of genes. Therapeutic efforts are, The focus is on downstream targets of MECP2, such as neurotransmitters, growth factors, and metabolic pathways. At least nine clinical trials conducted for Rett syndrome have shown affirmative results across various measures. While these findings report qualitative results, they have not been independently verified or are novel. It has not resulted in any standard treatment [Katz et al, Trends in Neuro Sciences, 39:100-113 (2016). Currently, for Rett syndrome There are no approved treatments.

[0006] There are male and female mouse models that exhibit RTT-like behavior [Guy et al., Nature Genetics,27:322-326(2001);Chen et al. al., Nature Genetics 27:327-331(2001); approximately Katz et al.,5:733-745(2012)].

[0007] MECP2 is a 52kD nuclear protein that is expressed in various tissues, but It is abundant in chlorofluorocarbons and is the most studied nuclear protein in the nervous system. In humans, M There are two isoforms of MECP2, known as ECP2A and MECP2B. (Figure 1) [Weaving et al., Journal of Medica] [1 Genetics, 42:1-7 (2005)]. These two isoforms are They originate from selectively spliced ​​mRNA transcripts and possess a variety of translation initiation sites. MECP2B contains exons 1, 3, and 4 and is the main isoform in the brain. MECP2 reversibly binds to methylated DNA and regulates gene expression [Guy et al.] al.,Annual Review of Cell and Developme [Ntal Biology, 27:631-652 (2011)]. These functions are [N an&Bird,Brain&Development,23,Suppl 1:S32 -37(2001)]. Initially thought to be a transcriptional repressor, MECP2 is a target gene. Both induction and suppression of gene expression are possible [Chahrour et al.,Sc [ience, 320:1224-1229 (2008)]. MECP2 is appropriate new It is hypothesized that MECP2 supports the development and maintenance of ron. In neurons, MECP2 is Synaptic activity and gene expression are influenced by DNA binding and interactions with various binding partners. To facilitate translation [Ebert et al., Nature, 499:341-345 (2013) and Lyst et al., Nature Neuroscience ,16:898-902(2013)]. In astrocytes, MECP2 deficiency is... Related to apnea events in Us [Lioy et al., Nature, 475: 497-500 (2011)]. MECP2 deficiency leads to reduced brain size and neuronal This can lead to increased packing density and decreased dendritic complexity [Armstron] g et al., Journal of Neuropathology and E experimental neurology,54:195-201(1995)]. Importantly, neuronal death is not related to MECP2 deficiency [Leonard et al.,Nature Reviews,Neurology,13:37-51 (2017)]. MECP2 is also found outside the nervous system, although its levels vary depending on the tissue. (Figure 2). Recent studies have shown that peripheral Mecp2 expression is a factor in Rett syndrome in mice. The existence was investigated [Ross et al., Human Molecular Gene tics,25:4389-4404(2016)]. Peripheral deficiency causes decreased activity and exercise fatigue. It was associated with fatigue and bone abnormalities. RTT-related behaviors, sensorimotor, gait, and autonomic nervous system The majority of the phenotypes (respiratory and cardiac) are observed in mice with peripheral MECP2 knockout. I couldn't see it.

[0008] Since MECP2 is an X-linked gene, one copy of MECP2 is X-linked in females. Expression is stopped due to chromosome inactivation (Xci). In cell-based studies, Xci is... It is thought that the MECP2 chimeric phenomenon is randomly occurring in female Rett disease. Severity is determined by whether the majority of the active X chromosome contains intact or mutated MECP2 genes. It depends on whether or not it occurs. This is called distorted Xci. Men receive Xci. Therefore, since the cells do not have a functional copy of MECP2, MECP2 deficiency is diagnosed. This is more serious. The nature of the MECP2 mutation also affects the severity of the disease. MECP2 More than 600 different mutations in the gene (e.g., deletions, nonsense mutations, and point mutations) are R In the ettBASE database (http: / / mecp2.chw.edu.au / ) This is explained. The most common mutation (about 9% of patients) affects the methyl-binding domain. The boss is the T185M allele. Other common mutations are shown in Figure 3 [Leonard, top]. Please refer to the notes. In summary, these are the cases listed in RettBASE. They account for over 40%. Large deletions, including MECP2, were found in 8-10% of cases. Li et al., Journal of Human Genetics, 52:3 8-47 (2007) and Hardwick et al., European Journal Urnal of Human Genetics,15:1218-1229(200 7) R133C, R294X and C-terminal mutations, as well as those causing milder disease. A genotype-phenotype correlation exists with deletions (downstream of TRD). Large deletions and early TRDs are associated with large deletions and early TRDs. The quenching mutations (R270X, R255X, and R168X) are associated with severe Rett syndrome. It is related to the group. Table 1 shows the consensus recently compiled by the international group of Rett clinicians. This explains the established Rett diagnostic criteria [Neul et al., Annals of Neul et al.]. Urology, 68:944-950 (2010).

[0009] [Table 1]

[0010] [Table 2]

[0011] Adeno-associated virus (AAV) is a parvovirus with replication defects, and this single-stranded DNA The genome is approximately 4.7 kb long and contains 145 reverse end repeats (ITRs) of nucleotides. The nucleotide sequence of the AAV serotype 2 (AAV2) genome is Ruffing Corrected by et al., J Gen Virol, 75:3385-3392 (1994) Srivastava et al., J Virol, 45:555-564 This is shown in 1983. This ITR includes viral DNA replication (rep), capsular It contains cis-acting sequences that direct chromosome formation / packaging and integration into host cell chromosomes. There are three types of AAV promoters (p5, p19 for their relative map locations). (and named p40) are two genes that encode the rep gene and the cap gene. Drives the expression of the AAV's internal open reading frame. Two types of rep promoters - (p5 and p19) are single AAV introns (nucleotides 2107 and 22 Combined with differential splicing (27), four types of rep proteins are derived from the rep gene. (Rep78, Rep68, Rep52, and Rep40) are produced. Rep protein The substance ultimately possesses several enzymatic properties that are involved in the replication of the viral genome. The gene is expressed from the p40 promoter and involves three types of capsid proteins: VP1, VP2, and It codes for VP3. Alternative splicing and non-consensus translation start sites are It is involved in the production of three related capsid proteins. A single consensus polyadenyl The site of transformation is located at map position 95 of the AAV genome. The life cycle and genetics of AAV The characteristic is Muzyczka, Current Topics in Microbio This is outlined in *logy and Immunology*, 158:97-129 (1992). It is being done.

[0012] AAV is a vector used, for example, in gene therapy to deliver exogenous DNA to cells. AAV possesses unique characteristics that make it attractive. AAV infection of cells in culture is noncellular. It is a variant, and natural infection in humans and other animals is asymptomatic and symptomatic. AAV infects many mammalian cells and targets many different tissues in vivo. This makes it possible that AAV can also detect slowly dividing cells and rapidly dividing cells. Transduction into cells that lack it, and transcriptionally active nuclear episomes (extrachromosomal elements) to extend the lifespan of the cell. It can essentially persist over time. The AAV proviral genome is cloned in the plasmid. It is infectious as synthetic DNA, which makes it possible to construct recombinant genomes. The signals that direct AAV replication, genome capsid formation, and integration are located in the AAV genome. Since it is included in ITR, (replicating and structural capsid protein, rep-cap (Encoding) A portion or all of approximately 4.3kb of the genome inside is foreign DNA (for example, p Place the romor (a gene cassette containing the target DNA and polyadenylation signal) into the device. Interchangeable. Rep proteins and cap proteins can be produced in trans. AA Another important characteristic of V is that it is a very stable and robust virus. AAV is The conditions used to inactivate adenovirus (56-65°C for several hours) Because AAVs can easily withstand freezing, low-temperature storage of AAVs is not very important. AAVs can freeze-dry. It is possible. Finally, AAV-infected cells do not show resistance to co-infection. Multiple serum samples of AAV The existence of different serotypes leads to diverse tissue-specific behaviors. Known serotypes include, for example, AAV1. AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Examples include AAV10, AAV11, AAV12, AAV13, and AAVrh74. AAV9 is based on U.S. Patent No. 7,198,951 and Gao et al., J. This is explained in Virol., 78:6381-6388 (2004). [Overview of the project] [Problems that the invention aims to solve]

[0013] In this technology, MECP2 polynucleotides are delivered to the central nervous system, and this central nervous system Methods and products for expressing this polynucleotide are still needed. Yes, they are. [Means for solving the problem]

[0014] This disclosure relates to a useful method for treating Rett syndrome in patients who require it. And provide materials.

[0015] A method for treating Rett syndrome in a patient, comprising methyl-CpG binding protein 2 (ME Recombinant adeno-associated virus 9 (rAAV9), which encodes CP2, requires it. The process includes intrathecal administration to the patient, and rAAV9 is self-complementary, encoding MECP2B. The sequence of the genome, including the self-complementary genome, is provided by the method described in Sequence ID No. 1. The example rAAV9 provided is an scAAV named AVXS-201. ru.

[0016] Iohexol, iobitridol, iomeprole, iopamidol, for this patient Iopentol, Iopromide, Ioversol, or Ioxirane, or a combination of these. The process further comprises the step of intrathecal administration of one or more mixtures and / or the patient is treated with Trendelen A method is provided that further includes placing the person in the Burg position. [Brief explanation of the drawing]

[0017] [Figure 1] This is a diagram of the human MECP2 gene locus. The image shows the selective transcription start site (arrow), exons (squares), and splicing pattern of mature mRNA. MECP2B is the most abundant isoform in the brain and is encoded by AVXS-201. [Figure 2] The graph shows the relative MECP2 protein expression levels in various human tissues as detected by immunohistochemistry. Modified from The Human Protein Atlas (www.proteinatlas.org). [Figure 3] These are key functional domains of the MECP2 protein and common mutations found in Rett patients: MBD = methyl-CpG binding, TRD = transcriptional repression domain, NID = NCOR-SMRT interaction domain (NID) and nuclear localization signal (NLS). [Figure 4] This is proof of the concept by restoring Mecp2 expression mediated by AAV9 in male red mice. Figure 4A) Depiction of the recombinant AAV genome. Figure 4B) Experimental design. Figure 4C) Kaplan-Meier survival curves showing increased survival in red mice treated with scAAV9.738.Mecp2 compared to animals treated with the control vector. Figure 4D) Behavioral phenotype improvement as measured by Bird scoring due to vector-mediated Mecp2 restoration (Box 1). [Figure 5]Treatment of female red mice with scAAV9.738.Mecp2 induces physiological levels of Mecp2, improving abnormal behaviors. Figure 5A) Experimental design. Figure 5B) Fluorescence intensity measurements from immunolabeled brain sections for Mecp2 from wild-type and scAAV9.738.Mecp2-treated red mice. The distribution of intensity measurements is similar between the two groups. Figure 5C) Bird phenotypic scoring shows symptom reduction in animals treated with scAAV9.738.Mecp2. Figures 5D-5G) Rotarod, inverted grid, platform, and nesting behavior assessments all show improvement in scAAV9.738.Mecp2-treated versus control-treated animals. [Figure 6] This is a depiction of the first-generation (Figure 6A) and revised (Figure 6B, AVXS-201) recombinant AAV genomes described herein. The colors reflect similarities and differences between the constructs. Between scAAV9.738.Mecp2 and AVXS-201, the promoter was shortened, intervening sequences between key elements were shortened, mouse Mecp2 alpha cDNA was replaced with human MECP2B cDNA, and the bovine growth hormone polyadenylation signal was changed to a shorter synthetic element. The overall objective of these changes was to improve packaging efficiency while maintaining the physiological expression levels of clinically relevant MECP2 cDNA. [Figure 7] This shows the dose-response relationship of AVXS-201 in Mecp2- / y mice. Figure 7A) Kaplan-Meier plots of various doses used to treat Mecp2- / y mice. Median survival times for each dose group are color-coded and shown as dashed lines. All cohorts treated with AVXS-201 had extended survival times compared to null mice treated with control. Figure 7B) Dose-response curves are shown, plotting median survival time data from each group. The dashed line represents the median survival time for Mecp2- / y mice treated with PBS. These data are consistent with the known effects of MECP2 deficiency and excess. [Figure 8]This is the Bird behavior scoring for Mecp2- / y mice treated with AVXS-201. Figure 8A) Sick mice treated with controls accumulate deficits with age. Behavioral deficits are reduced by AVXS-201 treatment, regardless of the dose. Figure 8B) The same data as in Figure 8A is regraphed, showing only the treated controls and the AVXS-201 1.44×10¹⁰vg group. [Figure 9] Mecp2 null mice treated with AVXS-201 regain spontaneous walking movement. Open-field analysis shows that null mice treated with AVXS-201 cross (Figure 9A) longer distances and (Figure 9B) higher average speeds compared to null mice treated with control. (Figure 9C) Rotarod ability at 3 months of age was also improved with a moderate dose of AVXS-201. +=p≦0.001; *=p≦0.05;

number

[0018] In one embodiment, the present invention provides intrathecal delivery of a polynucleotide encoding MECP2 to a patient. A method of administration (i.e., administration into the subarachnoid space of the brain or spinal cord), and this polynucleo The present invention provides a method comprising administering rAAV9 having a genome containing tide. In one embodiment, the rAAV9 genome is a self-complementary genome. In another embodiment, This rAAV9 genome is a single-stranded genome.

[0019] This method allows MECP2 to be introduced into the patient's brain and spinal cord (i.e., the patient's central nervous system). The encoding polynucleotide is delivered. Several target regions in the brain to which delivery is intended. These include, but are not limited to, the motor cortex and brainstem. Some target cells in the central nervous system include neurons and glial cells, but These are not limited to glial cells. Examples of glial cells include microglia, oligodendrocytes, and astrocytes. It is a website.

[0020] The delivery of polynucleotides encoding MECP2 is suitable, for example, for the treatment of Rett syndrome. It will be accepted.

[0021] "Treatment" refers to an effective dose or multiple effective doses of the composition containing rAAV of the present invention. This includes the step of administering it to target animals (including human patients) that require it via an intrathecal route. If this dose is administered before the onset of the disorder / disease, this administration is prophylactic. When administered after the onset of a disorder / disease, this administration is therapeutic. Embodiment of the present invention In this context, an effective dose is defined as at least one symptom related to the disorder / disease condition being treated. The dose to alleviate (eliminate or reduce), related to the condition of the disorder / disease being treated. A dose that improves at least one symptom, or slows the progression to a disorder / disease state. This refers to the preventive dose, the dose that reduces the severity of the disease, and the dose that brings about (partial or complete) remission of the disease. This is the dose that induces and / or extends survival time.

[0022] In the treatment of Rett syndrome, this method is effective for the patient, and the following effects can be cited. These include, but are not limited to: recovery of intentional hand movements, improvement of vocalization, and reduction of apnea. Less seizures, reduced anxiety, increased socialization, increased IQ, normalization of sleep patterns, and / or increased mobility.

[0023] The present invention also considers combined treatments. Combinations used herein include simultaneous treatment or This includes both sequential treatment. The method of the present invention and standard medical treatment for Rett syndrome The combination with the device is specifically intended to be a combination with a novel treatment.

[0024] The intention is to deliver it to individuals who need it after birth, but intrauterine delivery to the fetus is also being considered. It can be done.

[0025] In another embodiment, the present invention provides an rAAV genome, which is MEC One or more AAV ITs are located on either side of the polynucleotide encoding P2. Contains R. This polynucleotide is part of transcriptional regulatory DNA (specifically promoter DNA). and polyadenylated signals that function in target cells to form a "gene cassette" It is operablely linked to a sequence DNA. This gene cassette is connected to a neuron or a g It may include promoters that enable specific expression within rear cells. For example, neuro Examples include the geno-specific enolase promoter and the glial fibrillary acidic protein promoter. A controlled inducible promoter of the ingested drug may also be used. For example, Tet Lacyclin (TET on / off) system [Urlinger et al., Proc.N atl.Acad.Sci.USA 97(14):7963-7968(2000)] and Ecdysone receptor adjustable system [Palli et al., Eur J Examples include the system described in Biochem 270:1308-1315 (2003), but These are not the only examples. This gene cassette is a polynucleotide in mammalian cells. When expressed, it contains intron sequences to facilitate the processing of RNA transcripts. It may include these.

[0026] The rAAV genome of this invention lacks AAV rep and cap DNA. AAV DNA (e.g., ITR) in the V genome may originate from any recombinant virus. It may originate from the following AAV serotypes, but is not limited to these. Not applicable: AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13 and AAVrh74. The nucleotide sequences of the genomes of these AAV serotypes are in the field of this technology. This is known. For example, the AAV9 genome is known from Gao et al., J. Virol. It is described in 78:6381-6388 (2004).

[0027] In another embodiment, the present invention provides a DNA plasmid comprising the rAAV genome of the present invention. This DAN plasmid contains the AAV9 capsid protein of this rAAV genome. AAV helper viruses (e.g., adenoids) for constructing infectious viral particles Cells that tolerate infection by viruses, E1-deleted adenoviruses, or herpesviruses. It is introduced into the AAV genome, rep gene and cap gene, which are packaged. Furthermore, technology for producing rAAV particles that confer helper virus function to cells. This is standard in this field. The generation of rAAV requires the following components to be in a single cell (Honmei It is necessary for it to be present within the packaging cell (referred to as "packaging cell" in the detailed document): rAAV geno Hmm, AAV rep variants independent of this rAAV genome (i.e., not within this rAAV) Genetic and cap genes, as well as helper virus function. The production of pseudotyped rAAV is, for example, This information is disclosed in International Publication No. 01 / 83692, and this pamphlet is The entirety of which is incorporated herein by reference. In various embodiments, the AAV caps Capsid proteins can be modified to enhance the delivery of recombinant vectors. Modification of proteins is generally known in the art. For example, U.S. Patent Application Publication No. 200 Specification No. 5 / 0053922 and Specification No. 2009 / 0202490 (these opening See the reference (which is incorporated herein by reference in its entirety).

[0028] The method for generating packaging cells involves stably supplying all the components essential for AAV particle production. The goal is to create cell lines that express the gene. For example, AAV rep gene and cap gene. rAAV genome lacking offspring, AAV rep gene independent of this rAAV genome, and The cap gene, as well as the selection marker (e.g., neomycin resistance gene), plus Mido (or multiple plasmids) are incorporated into the cell's genome. The AAV genome is GC-T Ring (Samulski et al., 1982, Proc. Natl. Acad.) S6.USA,79:2077-2081), including the restricted endonuclease cleavage site Addition of a solid linker (Laughlin et al., 1983, Gene, 23:65) -73) or direct blunt end ligation (Senapathy & Carter, Detailed procedures such as those described in 1984, J. Biol. Chem., 259:4661-4666) It is introduced into a bacterial plasmid. Then, adenovirus etc. are introduced into this packaging cell line. Infect with the helper virus. The advantage of this method is that cells are selectable and rAA It is suitable for large-scale production of V. Another example of a suitable method is packaging cells To introduce the rAAV genome and / or rep and cap genes, Use adenovirus or baculovirus instead of rasmid.

[0029] The general principle of rAAV production is described, for example, in Carter, 1992, Current Op. Inions in Biotechnology, 1533-539; and Muzy czka,1992,Curr.Topics in Microbial.and I This is outlined in mmunol., 158:97-129). Various approaches are described below. Explained: Ratschin et al., Mol.Cell.Biol.4: 2072(1984);Hermonat et al.,Proc.Natl.Aca d.Sci.USA,81:6466(1984);Tratschin et al. ,Mo1.Cell.Biol.5:3251(1985);McLaughlin e t al., J. Virol., 62:1963 (1988); and Lebkowsk i et al.,1988 Mol.Cell.Biol.,7:349(1988) . Samulski et al. (1989, J. Virol., 63:3822-3 828); U.S. Patent No. 5,173,414; International Publication No. 95 / 13365 Frets and corresponding U.S. Patent No. 5,658,776; International Publication No. 95 / 13 Brochure No. 392; Brochure No. 96 / 17947; PCT / US Patent Application Publication No. 98 / 18600; International Publication No. 97 / 09441 (PCT) U.S. Patent Application Publication No. 96 / 14423; U.S. Patent Application Publication No. 97 / 08298 (Pamphlet) (PCT / U.S. Patent Application Publication No. 96 / 13872); same No. 97 / 21825 Brochure (PCT / US Patent Application Publication No. 96 / 20777 Specification); Same as No. 97 / 0 Brochure No. 6243 (PCT / French Patent Application Publication No. FR96 / 01064) ; Pamphlet No. 99 / 11764; Perrin et al. (1995) Va ccine 13:1244-1250;Paul et al. (1993) Huma n Gene Therapy 4:609-615;Clark et al.(19 96) Gene Therapy 3:1124-1132; U.S. 5,786,2 Specification No. 11; Specification No. 5,871,982; and Specification No. 6,258,595 Detailed explanation. The aforementioned literature particularly highlights the sections on rAAV production in these documents. These are then incorporated herein by reference.

[0030] Therefore, the present invention provides packaging cells that produce replication-deficient infectious rAAV. Provided. In one embodiment, the packaging cells are stably transformed cancer cells (e.g., For example, HeLa cells, 293 cells, and PerC.6 cell lines (related 293 cells) In another embodiment, the packaging cells are non-cancer cells that have been transformed. For example, low passage 293 cells (human fetal kidney cells transformed with adenovirus E1) MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), V These are ero cells (monkey kidney cells) and FRhL-2 cells (rhesus monkey fetal lung cells). .

[0031] Therefore, in another embodiment, the present invention relates to rAAV9 containing the rAAV genome of the present invention (i.e.) We provide rAAVs such as replication-deficient infectious capsidized rAAV9 particles. The genome lacks AAV rep and cap DNA, i.e., between the ITRs of the genome. AAV rep or cap DNA is absent. In some embodiments, rAAV The genome is a self-complementary genome. In some embodiments, the rAAV genome is a single genome. It is a strand genome.

[0032] Self-complementary AAV9 (scAAV9) and other rAAVs, named "AVXS-201". This is provided. This rAAV gene cassette (AVXS- described in SEQ ID NO: 1) Nucleotides 151-2558 of genome 201 are derived from the mouse MECP2 gene in the sequence. The 546bp promoter fragment from the previous version (SEQ ID NO: 2) (NC_000086.7 in reverse direction) Nucleotides (74085586~74086323), SV40 intron, human ME CP2B cDNA (Sequence ID 3) (CCDS Database #CCDS4819) 3.1) and has a synthetic polyadenylation signal sequence (SEQ ID NO: 4). This gene The set allows for the packaging of self-complementary AAV genomes together with the AAV2 reverse variant. The terminal repeat (ITR) and the wild-type AAV2 inverted terminal repeat are located on both sides. The genome lacks AAV rep and cap DNA, i.e., the ITR of this genome. There is no AAV rep or cap DNA in between.

[0033] rAAV, including scAAV9 named "scAAV9.738.Mecp2", is provided. This is done. This rAAV gene cassette (scAAV9.7 described in SEQ ID NO: 5) 38. Nucleotides 198-2890 of the Mecp2 genome contain mouse MECP 738 bp promoter fragments derived from 2 genes (SEQ ID NO: 6) (NC_000 in reverse direction) nucleotides 74085586~74086323 of 086.7, SV40 intron Mouse MECP2α cDNA (SEQ ID NO: 7) (CCDS Database #CC) DS41016.1) and polyadenylated signal sequences derived from the bovine growth hormone gene This gene cassette enables the packaging of self-complementary AAV genomes. The mutant AAV2 inverted terminal repeat (ITR) and the wild-type AAV2 inverted terminal repeat are bilateral. It is located at [location]. This genome lacks AAV rep and cap DNA, In other words, there is no AAV rep or cap DNA between the ITRs of this genome.

[0034] rAAV9 genome (for example, a gene cassette within the rAAV9 genome, but not limited to) Conservative nucleotide substitutions are intended within the gene cassette. For example, MECP2 c in a gene cassette. The DNA is MECP2α cDNA or AVX in scAAV9.738.Mecp2. 80%, 81%, 82%, 83%, 84% of MECP2B cDNA in S-201 %, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% It may have sequence identity of %, 95%, 96%, 97%, 98%, or 99%.

[0035] In some embodiments, the MECP2 polypeptide encoded by rAAV9 of the present invention Chido may be a variant MECP2 polypeptide. The variant polypeptide is M MECP2α cD in scAAV9.738.Mecp2 retains ECP2 activity. MECP2 encoded by MECP2B cDNA in NA or AVXS-201 At least approximately 60, 70, 80, 85, 90, 95 amino acids relative to the polypeptide amino acid sequence They have 97, 98, 99, or 99.5% identical amino acid sequences.

[0036] This rAAV is targeted in the field by column chromatography or cesium chloride gradients, etc. It can be purified by standard methods. A method for purifying the rAAV vector from the helper virus is: This is known in the art, for example, Clark et al., Hum. Gene Th er.,10(6):1031-1039(1999);Schenpp and Cl. ark, Methods Mol. Med., 69:427-443 (2002); USA In Japanese Patent No. 6,566,118 and International Publication No. 98 / 09657 The methods that have been disclosed are listed below.

[0037] In another embodiment, the present invention relates to rAAV (for example, r) encoding the MECP2 polypeptide. The composition contains AAV9).

[0038] The composition of the present invention contains rAAV in a pharmaceutically acceptable carrier. This composition is diluted Other components such as agents and adjuvants may also be included. Acceptable carriers, diluents and adjuvants The substance is nontoxic to the recipient and, preferably, does not cause harm at the dosage and concentration used. Active substances include: buffers, e.g., phosphates, citrates, or other organic compounds. Acids; antioxidants, e.g., ascorbic acid; low molecular weight polypeptides; proteins, e.g., blood Clear albumin, gelatin, or immunoglobulin; hydrophilic polymers, such as polyvinyl acetate. Loridone; amino acids, such as glycine, glutamine, asparagine, arginine or Lysine; monosaccharides, disaccharides and other carbohydrates, such as glucose, mannose or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and / or nonionic surfactants , such as Tween, Pluronic or polyethylene glycol (PEG).

[0039] If necessary, incorporate rAAV in a suitable solvent in the required amounts together with various other components listed above, and subsequently filter sterilize to prepare a sterile injectable solution. Generally, prepare a dispersion by incorporating the sterile active component into a sterile vehicle containing a base dispersion medium and other necessary components from those listed above. For the preparation of a sterile injectable solution, in the case of a sterile powder, a preferred preparation method is vacuum drying and lyophilization techniques to obtain a powder of the active component and any additional desired components from a pre-sterilized filtered solution. The titer and dosage of rAAV administered by the method of the present invention may vary, for example, depending on the specific rAAV, mode of administration, treatment objective, individual, timing of administration and type of target cells, and can be determined by standard methods in the art. The titer of rAAV is about <......><......>about 1×10 about 1×10 about 1×10 1×10 11 about 1×10 7 about 1×10 8 about 1×10 9 about 1×10 10 about 1×10 11 about 1×10 12 about 1×10 13 to about 1×10 14 or more DNase-resistant particles (DRP). The dosage can also be expressed in units (vg) of the viral genome. This is possible. The dosage of rAAV is approximately 1 × 10⁻⁶. 9 vg or more, about 1×10 10 vg or more, approx. 1 x 10 11 vg or more, about 1×10 12 vg or more, approximately 6×10 12 In summary, approximately 1 x 10 13 vg or more, approximately 1.3×10 13 vg or more, approximately 1.4×10 13 vg or more, approximately 2×10 13 vg or more, approximately 3×10 13 vg or more, approximately 6×10 13 vg or more, about 1×10 14 vg or more , about 3×10 14 The above is approximately 6 x 10 14 In summary, approximately 1 x 10 15 vg or more, approximately 3×10 15 The above is approximately 6 x 10 15 In summary, approximately 1 x 10 16 The above is approximately 3 x 10 16 or approximately 6 x 10 16 The range may be as described above. In neonates, the dose of rAAV is approximately 1 × 10⁻⁶. 9 vg or more , about 1×10 10 vg or more, about 1×10 11 vg or more, about 1×10 12 Vg or more, about 6× 10 12 In summary, approximately 1 x 10 13 vg or more, approximately 1.3×10 13 vg or more, approximately 1.4×10 13 vg or more, approximately 2×10 13 vg or more, approximately 3×10 13 vg or more, approximately 6×10 13 vg In summary, approximately 1 x 10 14 vg or more, approximately 3×10 14 The above is approximately 6 x 10 14 In summary, approximately 1 x 10 15 vg or more, approximately 3×10 15The above is approximately 6 x 10 15 In summary, approximately 1 x 10 16 The above is approximately 3x 10 16 or approximately 6 x 10 16 It could be within the above range.

[0041] The method of the present invention allows target cells (e.g., nerve cells or glial cells, but not limited to) to be targeted. ) is transduced. The term "transduction" refers to the functional MECP2 port of recipient cells. In vivo, via replication-deficient infectious rAAV of the present invention, which results in the expression of lipeptides. Or it refers to the administration / delivery of polynucleotides to target cells either in vitro. It is used.

[0042] Transduction of cells using the rAAV of the present invention results in the encoding of this rAAV The MECP2 polypeptide is continuously expressed. In some embodiments, the target expression level The normal (or wild-type) physiological expression level in subjects without Rett syndrome. The target expression level is intended to be approximately 75% to 125% of normal expression. Levels of approximately 75%, 80%, 85%, 90%, 95%, 100%, and 105% It could be approximately 110%, 115%, 120%, or 125%.

[0043] In some embodiments of the treatment method of the present invention, a nonionic hypoosmolar contrast agent is also administered to the patient. They contribute. Examples of such contrast agents include iovitridol, iohexol, and iomeprole. Iopamidol, Iopentol, Iopromide, Ioversol, Ioxirane Examples include, but are not limited to, mixtures of two or more of these contrast agents. In some embodiments, this treatment method further includes administering iohexol to the patient. Hmm. This non-ionic, low-osmolality contrast agent increases the transduction of target cells in the patient's central nervous system. It is thought that this will be added. Compared to the transduction of cells when the rAAV of this disclosure is used alone. In contrast, when the rAAV of this disclosure is used in combination with the contrast agents described herein... It is thought that cell transduction increases. In various embodiments, cell transduction is produced Compared to transduction of the vectors of this disclosure when not used in combination with a contrast agent, this disclosure When the vector is used in combination with the contrast agent described herein, at least about 1% or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least Approximately 120%, at least approximately 150%, at least approximately 180%, at least approximately 200%, less At least approximately 250%, at least approximately 300%, at least approximately 350%, at least approximately 40 It increases from 0%, to at least about 450%, to at least about 500%, or even more. In a particular embodiment, cell transduction is performed when not used in combination with a contrast agent. Compared to the transduction of vectors, the vectors of this disclosure combine with the contrast agents described herein. When used in combination, use in amounts of approximately 10% to 50%, or approximately 10% to 100%. , or approximately 5% to approximately 10%, or approximately 5% to approximately 50%, or approximately 1% to approximately 500 Up to %, or approximately 10% to approximately 200%, or approximately 10% to approximately 300%, or approximately From 10% to approximately 400%, or from approximately 100% to approximately 500%, or from approximately 150% to approximately 3 It increases to 00%, or from approximately 200% to approximately 500%.

[0044] In the embodiments described above, the patient is placed in the Trendelenburg position (head-down position). In some cases, it is thought that cell transduction increases. In some embodiments, for example, in the medullary cavity During or after intravector injection, the patient is rotated approximately 1 to 30 degrees, approximately 15 to 30 degrees, and approximately 30 degrees. In a position with the head down at approximately 60 degrees, 60 to 90 degrees, or 90 to 180 degrees. Tilt. In various embodiments, the Trendelenburg position is used for transduction of cells. When using the Trendelenburg position as described herein, compared to the case without the Trendelenburg position, , at least about 1%, at least about 5%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 100 %, at least about 120%, at least about 150%, at least about 180%, at least Approximately 200%, at least approximately 250%, at least approximately 300%, at least approximately 350%, small At least around 400%, at least around 450%, at least around 500%, or even more. It increases.

[0045] In further embodiments, cell transduction is performed in combination with a contrast agent and the Trendelenburg position. Compared to the transduction of the vectors of this disclosure when not used in combination, the vectors of this disclosure - Used in combination with the contrast agents and Trendelenburg position described herein. In that case, approximately 10% to approximately 50%, or approximately 10% to approximately 100%, or approximately 5% to approximately Up to 10%, or approximately 5% to approximately 50%, or approximately 1% to approximately 500%, or approximately 1 0% to approximately 200%, or approximately 10% to approximately 300%, or approximately 10% to approximately 400% up to, or approximately 100% to approximately 500%, or approximately 150% to approximately 300%, or It increases by approximately 200% to 500%.

[0046] This disclosure provides embodiments of a treatment method, which involves the vector and contrast agent of this disclosure, and which are necessary for the treatment method. The vector of this disclosure is administered intrathecally to the central nervous system of the target patient in the absence of contrast agent. The present invention also provides embodiments in which patient survival is increased compared to when the drug is administered in a conventional manner. In various embodiments, the vector and contrast agent of this disclosure are used to enhance the central nervous system of patients who require it. Administration to the system improves patient survival when the vector of this disclosure is administered in the absence of a contrast agent. In comparison, patient survival rates were at least approximately 1%, at least approximately 5%, at least approximately 10%, and less At least about 20%, at least about 30%, at least about 40%, at least about 50%, little At least about 60%, at least about 70%, at least about 80%, at least about 90%, little At least approximately 100%, at least approximately 150%, at least approximately 200%, or more. do.

[0047] This disclosure provides embodiments of a treatment method, wherein the vector and contrast agent of this disclosure are trendy By intrathecal administration to the central nervous system of a patient requiring it while in the Lemburg position, this Patients receiving the disclosed vector in the absence of contrast agent and Trendelenburg position The invention also provides embodiments in which patient survival is further increased compared to survival. The vector and contrast agent of this disclosure require that the vector be placed in the Trendelenburg position. By administering the vector of this disclosure to the central nervous system of a patient, the vector is used as a contrast agent and Trendelenb Compared to patient survival when administered in the absence of the Lug position, patient survival is at least approximately 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30 %, at least about 40%, at least about 50%, at least about 60%, at least about 70% %, at least about 80%, at least about 90%, at least about 100%, at least about 1 It will increase by 50%, at least about 200%, or more. [Examples]

[0048] The present invention is described below. • Proof-of-concept studies in female and male redmouth models are available at scAAV9.738.Me Therapeutic effects were observed after intravenous injection of cp2 (Example 1). • The second-generation gene therapy vector AVXS-201 is Mec2 - / y Mouse ventricles After internal (ICV) treatment, survival time is extended across a wide range of doses. Median survival time The maximum increase was 477% after AVXS-201 treatment (Example 2). • Male Mecp2 treated with AVXS-201 - / y The mouse is open for red mice. The overall evaluation, when measured, shows a lasting improvement in behavior (Example 3). • Mecp2 treated with AVXS-201 - / y The phenotypic advantage in mice is moderate. Obtained by protein expression (Example 4). Treatment of wild-type mice with AVXS-201 showed behavioral scores only in the high-dose group. With consistent changes in the urinary tract, all tested doses showed good tolerability. Examples 5 and 6). Intrathecal administration of AVXS-201 to non-human primates has been shown to be safe for 18 months after injection. It is present and exhibits good tolerance (Example 7). AVXS-201, after a single intrathecal injection, spreads throughout the brains and spinal cords of non-human primates. The introduced gene is expressed at a physiological level (Example 8).

[0049] Example 1 Proof-of-concept study of gene therapy for Rett syndrome in female red mice As proof of concept, symptomatic male and female red mice were introduced to scAAV9.738.Mec Intravenous treatment was performed at p2 [Garg et al., The Journal of Ne uroscience:The Official Journal of the S Society for Neuroscience,33:13612-13620 ( (2013). Recombinant viral genome of scAAV9.738.Mecp2 (SEQ ID NO: 5) ) is mouse Mecp2α cDNA (CCDS Database #CCDS410) 16.1) Promoter cleavage of 738 bp from the mouse Mecp2 gene that drives expression [Adachi et al., Human Molecular Genetics] ,14:3709-3722(2005)] and bovine growth hormone polyadenylated signal It includes the gene cassette (nucleotides 198-2890 of sequence number 5), which is autophase. A mutant AAV2 inverted terminal repeat (ITR) enables packaging of complementary AAV genomes. And wild-type AAV2 ITRs are positioned on both sides.

[0050] In 293 cells, self-complementary AAV9 (scAAV9) was found to be adenovirus herpes. Perplasmid pHelper (Stratagene, Santa Clara, CA) ) along with the plasmid [Gao] which encodes the Rep2Cap9 sequence already described. According to et al., J. Virol., 78:6381-6388 (2004), It is produced by a transient transduction procedure using a full-strand AAV2-ITR based vector. For the experiment, the virus was produced in three separate batches, and the cesium chloride density was measured twice. The product is purified using a separate purification process, dialyzed against PBS, and diluted to 0.001% to prevent viral agglutination. Formulated with %Pluronic-F68 and stored at 4°C. All vector preparations were T The vector purity was titrated by quantitative PCR using aq-Man technology. Sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (In vitro) Evaluated by gen, Carlsbad, CA.

[0051] Male mice possessing the Mecp2 null allele were raised to scAAV9.738.M at 4-6 weeks of age. 3 x 10 ecp2 or scAAV9 control vectors 12 Intravenous via VG The treatment was administered. This animal was tracked for survival and phenotypic score [Guy et al.,Sc We evaluated the following weekly: [ience, 315:1143-1147 (2007)].

[0052] Components of phenotypic scoring from Guy et al. 2007 A. Mobility: The mouse was placed on a bench for observation, then handled gently and observed again. 0 = Wild In the case of the type. 1 = Movement is reduced compared to the wild type: When first placed on the bench... The period of inactivity lengthened, and it remained immobile for an even longer period. 2 = When placed on a bench, No specific movement: Mice move in response to gentle stimuli or food pellets placed nearby. (Note: Mice may become more active when they are in their own cage environment.) B. Walking: 0 = Wild type. 1 = Walks or runs with a low pelvic height. Compared to the wild type, the hind legs are wider, resulting in a "wobbly" gait. 2 = More severe abnormality: Legs are raised The trembling when stepping, walking backward, or lifting both hind legs at once, is called a "bunny hoist." "Pu." C. Hindlimb Grasp: The mouse was suspended by the base of its tail and observed. 0 = Legs spread outwards. . 1 = The hind legs are drawn towards each other (without touching), or one leg is against the body To be drawn together. 2 = Both legs are firmly drawn in and touch each other, or the body Physical contact. D. Tremors: Mice were observed while standing on the palm of a hand. 0 = No tremors. 1 = Intermittent, mild tremors. Trembling. 2 * = Continuous tremors, or intermittent, violent tremors. E. Respiration: Observe the movement of the animal's flanks while it is at rest. 0 = Normal respiration. 1 = Regular respiration. The typical respiratory period is interspersed with short bursts of faster breathing or interruptions in breathing. 2 * = very Irregular breathing - gasping or shallow, rapid breathing. F. Overall health: Regarding indicators of general health status of mice, such as the condition of their fur, eyes, and body posture. Observations were made. 0 = clean, glossy fur, clean eyes, normal posture. 1 = vacant eyes, glossy No / slightly dirty hair, slightly hunched posture. 2 * = The eyes are covered with scabs or narrowed A hunched posture with prominent hair.

[0053] Figure 4 shows the median survival rate during the experimental period for the group treated with scAAV9.738.Mecp2. Although the value was not reached, it indicates that the results surpassed those of the control animals at over 10 weeks at the time of publication. Animals treated with scAAV9.738.Mecp2 compared to control animals Their behavioral scores were also low. This experiment was repeated with affected female mice (Figure 5). The object, as previously controlled by the male, scAAV9.738.Mecp2 or control IV treatment was administered at either stage. If the red mouse is symptomatic, females are treated at 10-12 months of age. The animals were followed for approximately 6 months after injection and tested for phenotypic scores. Furthermore, female redmouths do not have the same severe early lethality as males [Guy et al. l., Nature Genetics, 27:322-326 (2001)]. scA Treatment with AV9.738.Mecp2 halts disease progression and brings the score to around 1. This reversed the severity of the disease, with a phenotypic score around 6 indicating worsening of symptoms. This was in stark contrast to the control animals after the experiment (Figure 5C). (Rotor Rod) All data from inverted screen testing, platform testing, and nesting capability Compared to control animals, those treated with scAAV9.738.Mecp2 This supports behavioral improvement in animals treated with scAAV9.738.Mecp2. Postmortem brain analysis of females revealed that the fluorescence intensity of MECP2 expression was measured to indicate gene therapy gene development. This indicates that the current state reflects measurements of a wild-type brain, suggesting that the current state was at a nearly physiological level. Ta.

[0054] Example 2 AVXS-201 Preclinical Efficacy Study To improve packaging efficiency and maintain physiological levels of gene expression while clinically To incorporate the relevant human MECP2 cDNA, scAAV9.738.Mec p2 is a shorter promoter, human MECP2B cDNA and synthetic polyadenylated cyanide. It was redesigned using Gunnar. This redesigned genome was then used with the AAV9 capsule as described below. It was packaged in a box, and the resulting scAAV was named "AVXS-201". (Figure 6). AVXS-201 was originally named "AAV9-P545-MeCP2". . Promoter region sequence (mouse MeCP2 promoter fragment) (SEQ ID NO: 2) [ka] Coding region sequence (human MeCP2B cds) (Sequence ID 3) [ka] Poly-A sequence (synthetic) (SEQ ID NO: 4) AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTT TTTTGTGTG

[0055] scAAV9 was introduced into 293 cells using the adenovirus helper plasmid pHel. Along with per(Stratagene, Santa Clara, CA), already explained Plasmid encoding the Rep2Cap9 sequence [Gao et al., see above] Transient phenotype using double-stranded AAV2-ITR-based vectors [to be illuminated] The viruses were produced in the order they were acquired. For the experiment, the viruses were produced in three separate batches, twice. The cesium chloride is purified by a density gradient purification process, dialyzed against PBS, and viral agglutination is removed. To prevent this, the formulation was prepared with 0.001% Pluronic-F68 and stored at 4°C. The vector preparations were titrated by quantitative PCR using Taq-Man technology. - Purity of 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver Evaluation was performed by staining (Invitrogen, Carlsbad, CA).

[0056] Efficacy and administration studies were conducted in red mice of the same strain as shown in Figure 4. Example 1 and The dosages between Example 1 and Example 2 have not been compared due to improvements in the titration method. The experiment used optical titration of the virus preparation, but the studies in Example 2 and below were more accurate. Use accurate digital droplet PCR titration. Mimic the proposed clinical delivery route for intrathecal administration. Therefore, these injections were administered intraventricularly (ICV) to infants one day old. To directly deliver AVXS-201 to the nervous system, which is a key site of action in T syndrome, the spinal cavity We chose internal delivery. We track the offspring in relation to their natural life, survival, composite phenotypic score, and Poonfield and rotord behavior were evaluated. Survival across the 2-log dose range. The data is shown in Figure 7. The results shown in Figure 7 are the vector used in the treatment method of the present invention and This demonstrates that the combination of technologies achieves improved results. All doses tested were... Control treatment Mecp2 y / - The median survival time was longer than that of mice, and observations were made. The maximum individual survival time is 500 days (ongoing) compared to 93 days for control-treated red mice. ) reached. The maximum median lifespan (315 days) was 1.44 × 10 per animal. 10 vg This was achieved at moderate doses. This data is based on previously observed inappropriate MECP2 dosages. The effect of (gene copy number) [e.g., Lombardi et al., The Journal] rnal of Clinical Investigation,125:2914- See 2923 (2015) for the bell that distinguishes the results achieved herein. The dose-response pattern (Figure 7B) is shown. Importantly, even at the highest dose tested, AVXS-20 1. Treatment is Mecp compared to control treatment. - / y It did not shorten the lifespan of the mice. .

[0057] In addition to survival, the treated mice and control mice exhibited the Rett phenotype (as described in the previous example). The phenotypes listed were scored weekly. Untreated males ranged from a score of 0 to 5 up to 10 weeks of age. It progresses rapidly to an average peak of 25 (Figure 8). In contrast, the phenotypic scores of all treatment groups are shown. At 18 weeks, the score reached 5.56 × 10 10 Except for the vg group, approximately 2 weeks until 17 weeks of age Only the score was reached. Treatment animals and control animals were subjected to open field trials. The condition was also evaluated using the rotorod test (Figure 9). Reduced spontaneous movement was a symptom in male red mice. Open-field analysis is performed in groups of 2-3 to evaluate spontaneous movement and velocity. The study was conducted when the animals were of a certain age. Infected animals had a significantly higher total migration distance compared to wild-type mice. It decreased by approximately 43%. A significant increase in travel distance was observed in all cases, but AVXS-201 was used to treat Two of the groups that were placed out performed better than the controlled Mecp2 knockout males. The rate was also significantly improved compared to the knockout treatment in male redmouth mice. Dell's AVXS-201 treatment improves exploratory behavior and gait. Control animals were evaluated on their ability to perform on a rotarod, a measure of motor coordination, at 3 months of age. The study was conducted by testing animals for three consecutive days, and the scores were averaged over the number of days and dose. The results are shown in Figure 9C. The control treatment performed was Mecp. - / y The mouse controls Compared to roll-treated wild-type littermates, the condition worsened significantly with the Rotarod treatment. 7.00 × 10 9 v g cohort and 1.44 × 10 10 In the VG cohort, the rotor rod capability is controlled It showed significantly better results than the previous treatment.

[0058] Example 3 AVXS-201 expression of MECP2 protein in the brains of treated red mice Three weeks after injection, male wild-type treated with PBS, untreated red, and vector-treated... The placed Redt animals were euthanized, and AVXS-201 was administered to the brain after ICV injection at 1 day of age. MECP2 protein levels were examined. One hemisphere of the brain was homogenized and Western blotted. MECP2 expression was monitored by analyzing the samples by lot. Representative blot and quantitative analysis were performed. Figure 10 shows the normalized knockout and 1 0.75×10 9 The vg AVXS-201 dose group has detectable levels of MECP2. It wasn't there. 3.50 x 10 9 VG and 7.00×10 9 Treatment with vg is performed in each field Detectable MECP2 levels were observed in approximately 1% and 3.6% of viable specimens. The most effective dose when measured by the median increase (1.44 × 10) 10 vg) is the wild type Approximately 11% of MeCP2 levels were obtained. Western blot analysis was performed on 5.56 × 10⁻⁶ 10 v The g dose produced approximately 54% of the MECP2 level of the wild type, resulting in 1.13 × 10⁻⁶ levels. 11 is wild type The level more than doubled. These data predict the effectiveness of MECP2 gene therapy. This indicates that the levels and distribution of protein expression throughout the brain are important.

[0059] Example 4 Treatment of wild - type mice with AVXS - 201 is safe and shows good tolerance. An important concern regarding MECP2 replacement therapy is to evaluate the impact on cells that express intact copies of MECP2. To support the physiological regulation of the MECP2 transgene, AVXS - 201 was designed by incorporating a fragment of the mouse Mecp2 promoter. In consideration of this, survival and behavioral analyses were performed on a cohort of wild - type mice that received an ICV injection of AVXS - 201 in the same manner as male litter [[ID=II]] mice. A total of 131 wild - type male mice were treated with various ICV administrations of AVXS - 201 and followed for survival (Figure 11). At the target therapeutic dose (1.44×10

[0060] vg), no deaths were recorded, and 21 treated animals survived for up to P342. No deaths were recorded in the PBS - treated group, and one death was recorded in each of the treatment groups at 3.50×10 10 vg, 2.78×10 vg, and 1.13×10 vg. 9 Behavioral scoring using the criteria from Box 1 10 showed that the vector - treated groups mainly had an average phenotypic score <1. 11 An average total score >1 was only observed in the two highest - dose groups (5.56×10 vg and 1.13×10 vg). 10 The open - field test at 2 - 3 months of age showed no statistical difference between wild - type 11 males treated with the vector and wild - type males treated with PBS (Figure 12). Interestingly, compared to control - treated wild - type mice at 3 months of age, 1.13×10 vg ​1 1 In the vg cohort, a significant decrease in rotor rod ability was detected. These data suggest the toxic effect of MECP2 overexpression at the highest AVXS-201 dose. These data summarized that in the "worst scenario" of AVXS-201 treatment that only transduced wild-type cells, it showed that at the target therapeutic dose, the impact on animal survival and behavior was minimal.

[0061] Example 5 MECP2 physiological levels were maintained in the brains of wild-type mice treated with the therapeutic dose of AVXS-201. To further investigate the levels associated with symptomatic MECP2 overexpression, wild-type male mice were injected ICV at P1 with the therapeutic target of 1.44×10 10 vg or the highest dose tested of 1.13×10 11 vg of PB S or AVXS-201. The animals were euthanized 3 weeks after injection, and the brains were harvested for western blot. For comparison, tissues were blotted together with brains from a mouse model of MECP2 overexpression designated as Tg3. The brains were dissected into separate regions (Cb = cerebellum, Med = medulla, Hipp = hippocampus, Ctx = cortex and Mid = midbrain, Figure 13), and the individual regions were homogenized for blotting. The data were normalized to MECP2 levels in wild-type brains treated with PBS. Treatment with the target therapeutic dose (1.44×10 10 vg) had MECP2 levels 1 to 1.5 times that of wild-type tissue across all regions examined. The high dose (1.13×10 vg) ranged from 1.31 to 2 11 56 times that of wild-type levels but did not reach 2.31 to 3.93 times the levels of Tg3 tissue. ​​ These data, along with the behavioral and survival data presented earlier, are relevant when administered at the target dose. This gives confidence that AVXS-201 expresses the protein at a near physiological level. Importantly, the therapeutic dose should be at the double protein level associated with MECP2 duplication syndrome. Stay away. This demonstrates the safety of the MECP2 replacement approach using gene therapy.

[0062] Example 6 For 18 months after intrathecal injection of AVXS-201, body weight, hematology, and serological chemistry were non- Inconspicuous among human primates To investigate the safety and tolerability of AVXS-201 and related intrathecal injection procedures Three treated male cynomolgus monkeys were followed for 18 months after injection. The administered parameters were... Table 2 shows the results.

[0063] [Table 3]

[0064] Therapeutic dose intended for two animals (approximately 1.44 × 10⁴ per kg of body weight) 9 (vg equivalent) Place the food in a container and give each animal approximately twice the normal dose (approximately 7.00 x 10 per kg of body weight). 8 Administer (vg equivalent) The intrathecal injection procedure is described in Meyer et al., Molecular Therapy. y:The Journal of the American Society of This has already been explained in Gene Therapy, 23:477-487 (2015). To put it simply, the vector was mixed with a contrast agent to verify the diffusion of the vector. Anesthesia was administered. Place the subject in a lateral decubitus position and prepare the injection site at approximately the L4 / 5 level (below the conus cone of the spinal cord) along the posterior midline. Performed. Under aseptic conditions, an intrathecal needle with a stylet was inserted, and from this needle the insertion of an intrathecal cannula was confirmed by the flow of clear CSF. To lower the pressure in the intrathecal space, 0.8 ml of CSF was drained immediately after injection of the vector solution. After injection the animals were placed in the Trendelenburg position and the body was tilted head down for 10 minutes . The treated animals were dosed at 6 or 12 months of age, and body weight, blood cell counts, and serum chemistries were collected monthly for the first 6 months after injection and then every 2 months thereafter. Body weight is shown in Figure 14, blood cell counts are shown in Figure 15, serum chemistries are shown in Figures 16 and 17, and Mannheimer Fo undation (Homestead, FL) with values from control treated animals from the same colony were graphed. Overall, body weight, cell counts, and serum values from vector-treated animals were consistent with control-treated animals. With the exception of higher amylase at baseline in 2 vector-treated animals, there were no values that substantially deviated from controls for more than 2 consecutive observations in a given animal. These data indicate that AVXS- 201 and the intrathecal injection procedure are safe and exhibit good tolerance.

[0065] Example 7 Pathological analysis of tissues from non-human primates after intrathecal injection of AVXS-201 In addition to in vivo (Example 6) and postmortem analysis (Example 8), samples of visceral and central nervous tissue from animals 15C38, 15C 49 and 15C34 (Table 1) were sent to GEMpath Inc . (Longmont, CO) for paraffin embedding, sectioning, and hematoxylin and eosin staining. The remaining animals (Table 8.2) are still alive <​​It will be sent for analysis at the end of the research. GEMpath Board certified. A veterinary pathologist read the slides and prepared a report. The groups that were sampled and examined... The tissue is shown in Table 3. Pathology reports are given at 6 weeks or 18 months after AVXS-201 treatment. It is noted that the study did not induce lesions in any protocol-specific tissue.

[0066] [Table 4]

[0067] Example 8 Physiological levels of MeCP2 in the brains of non-human primates after intrathecal injection of AVXS-201. Two 12-month-old male crab-eating macaques were given AVXS-201 7 as described above. 7×10 12 The drug was administered intrathecally at a dose of vg / kg. The animals survived for 6 weeks after injection, and M The animals were euthanized for eCP2 expression analysis. Selected brain regions were analyzed by immunohistochemistry. We analyzed eCP2 expression (Figure 18). A clear increase in MeCP2 was observed in the cortical region and It was not detected in the subcortical region, nor near the injection site (lumbar spinal cord). Important Moreover, these data are not applicable to tissues derived from animals injected with AVXS-201. It does not show any overall abnormalities. To further investigate the expression of the introduced gene, a brain region was homogenized. The tissue was then compared with historical control tissue of animal origin from the same colony (Figure 19). Samples of the cranial and temporal cortex, hypothalamus, lumbar spinal cord, thalamus, amygdala, hippocampus, and cerebellum Total MeCP2 expression was analyzed by Western blotting. Furthermore, there were no regions where the MeCP2 expression level was more than twice that of Kotonol. MeCP2 is located in the hypothalamus and flank, which are regions near the third ventricle and lateral ventricle, respectively. It was detected in the amygdala but not in the cerebellum. Furthermore, the lumbar spinal cord, which is proximal to the injection site, was No elevated MeCP2 levels were observed. These data are related to viral dose and expression structure. This suggests that the combination of structures regulates MeCP2 expression. Furthermore, in situ... Hybridization (ISH) is performed to detect vector-derived transcripts, and Distribution in the brain was determined at 6 weeks and 18 months post-ejection (Figures 20 and 21). Brain and spinal cord. All areas examined (occipital cortex, temporal cortex, hippocampus, corpus callosum, thalamus, caudate nucleus, putamen, superior colliculus) The pons, medulla, cerebellum, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord contain tissues derived from control treatment animals. It showed expression of a transcript derived from a vector that was not present. These data are vector-derived. This demonstrates the specificity of the ISH probe for MECP2 transcripts, and also shows AVXS-201 These data demonstrate that the romortic structure functions within the NHP nervous system tissue. When administered via puncture, AVXS-201 is widely distributed throughout the CNS, and This demonstrates that it manifests at a scientific level.

[0068] Disclosure from Provisional Patent Application No. 62 / 423,618

[0069] Gene therapy for Rett syndrome Gene therapy to restore the transcription factor MeCP2 is used to treat obvious autistic behaviors and motor skills. Treating Rett syndrome, a progressive neurodevelopmental disorder that causes loss of ability and premature death. This appears to be a viable strategy for truncated endogenous promotion. Adeno-associated virus serotype 9 (AAV9) expressing human MECP2 under the control of a chemist. The study aims to investigate mice (MeCP2 null and wild type) and non-humans. The objective is to evaluate the efficacy and safety of this vector in primates through ongoing research. Therefore, the inventors' goal is to move this procedure from a bench to the bedside. AAV9-P545-MeCP2 Promoter region sequence (mouse MeCP2 promoter fragment) [ka] Coding region sequence (human MeCP2 cds) [ka] Poly-A sequence (synthetic) AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTT TTTTGTGTG

[0070] [Table 5]

[0071] [Table 6]

[0072] [Table 7]

[0073] [Table 8]

[0074] [Table 9]

[0075] Table 10

[0076] Table 11

[0077] Table 12

[0078] Table 13

[0079] Table 14

[0080] Table 15

[0081] Table 16

[0082] Table 17

[0083] Table 18

[0084] Table 19

[0085] Table 20

[0086] Table 21

[0087] Table 22

[0088] Table 23

[0089] Table 24

[0090] Table 25

[0091] Table 26

[0092] Table 27

[0093] Table 28

[0094] Table 29

[0095] Table 30

[0096] [Table 31]

[0097] [Table 32]

[0098] [Table 33]

[0099] [Table 34]

[0100] [Table 35]

[0101] [Table 36]

[0102] [Table 37]

[0103] [Table 38]

[0104] [Table 39]

[0105] The present invention has been described in terms of various embodiments and examples, but those skilled in the art will be able to find modified forms and It is understood that this will lead to the idea of ​​improved forms. Therefore, as will appear in the claims. Only such limitations should be imposed on the present invention.

[0106] All references mentioned herein are incorporated in their entirety by reference. The present invention may provide the following embodiments. [1] A method for treating Rett syndrome in a patient, comprising methyl-CpG binding protein 2( Recombinant adeno-associated virus 9 (rAAV9), which encodes MECP2, requires it. The process includes the step of intrathecal administration to the patient, and the rAAV9 encodes MECP2B. It includes a self-complementary genome, the sequence of which is described in Sequence ID No. 1. method. [2] The method according to [1] above, wherein the rAAV9 is rAAV9 AVXS-201. 。 [3] Iohexol, Iovitridol, Iomeprole, Iopamidol, Iopen Toll, Iopromide, Ioversol, or Ioxirane, or two or more of these. The method according to [1] or [2] above, further comprising intrathecal administration of the mixture. [4] The above [1] to [3] further includes placing the patient in the Trendelenburg position. Either method. (Sequence Listing) SEQUENCE LISTING <110> Kaspar, Brian et al. <120> INTRATHECAL DELIVERY OF RECOMBINANT ADENO-ASSOCIATED VIRUS ENCODING METHYL-CPG BINDING PROTEIN 2 <130> 28335 / 50215PCT <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 2558 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <220> <221> misc_feature <223> AVXS-201 genome <220> <221> misc_feature <222> (1)..(106) <223> mutated ITR <220> <221> misc_feature <222> (151)..(699) <223> 546 promoter fragment <220> <221> misc_feature <222> (729)..(827) <223> SV40 intron <220> <221> misc_feature <222> (848)..(2344) <223> hMECP2B cds <220> <221> misc_feature <222> (2345)..(2393) <223> synthetic pA <220> <221> misc_feature <222> (2418)..(2558) <223> ITR <400> 1 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgccccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatt cacgcgtgga 120 tctgaattca attcacgcgt ggtaccacgc gtgaacaacg ccaggctcct caacaggcaa 180 ctttgctact tctacagaaa atgataataa agaaatgctg gtgaagtcaa atgcttatca 240 caatggtgaa ctactcagca gggaggctct aataggcgcc aagagcctag acttccttaa 300 gcgccagagt ccacaagggc ccagttaatc ctcaacattc aaatgctgcc cacaaaacca 360 gcccctctgt gccctagccg cctctttttt ccaagtgaca gtagaactcc accaatccgc 420 agctgaatgg ggtccgctc ttttccctgc ctaaacagac aggaactcct gccaattgag 480 ggcgtcaccg ctaaggctcc gccccagcct gggctccaca accaatgaag ggtaatctcg 540 acaaagagca aggggtgggg cgcgggcgcg caggtgcagc agcacacagg ctggtcggga 600 gggcggggcg cgacgtctgc cgtgcggggt cccggcatcg gttgcgcgcg cgctccctcc 660 tctcggag agggctgtgg taaaacccgt ccggaaacg cgtcgaaggg cgaattctgc 720 agatactgg taagtttagt cttttgtc ttttattca ggtcccggat ccggtggtgg 780 tgcaaatcaa agaactgctc ctcagtcgat gttgccttta cttctaggcc tgtacggaag 840 tgttactatg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggcgagga 900 ggagagactg gagaaaagt cagagacca ggacctccag ggcctcagg acaacccct 960 caagtttaa aagtgaaga agagagaaa gaggcaagc atgagcccgt 1020 gcagccatca gcccaccact ctgctgagcc cgcagaggca ggcaagcag agacatcaga 1080 agggtcaggc tccgccccgg ctgtgccgga agctctgcc tccccaac agcggcgctc 1140 catcatccgt gaccgggac ccatgtatga tgaccccacc ctgcctgaag gctggacacg 1200 gaagcttaag caaggaat ctggccgctc tgctgggaag tatgatgtgt atttgatcaa 1260 tccccaggga aaagcctttc gctctaaagt ggagttgatt gcgtacttcg aaaaggtagg 1320 cgacacatcc ctggacccta atgattttga cttcacggta actgggagag ggagcccctc 1380 ccgggggagag cagaaaccac ctaagaagcc caaatctccc aaagctccag gaactggcag 1440 aggccggga cgccccaaaag ggagcggcac cacgagaccc aaggcggcca cgtcagaggg 1500 tgtgcaggtg aaaagggtcc tggagaaaag tcctgggaag ctccttgtca agatgccttt 1560 tcaaacttcg ccaagggggca aggctgaggg gggtggggcc accacatcca cccaggtcat 1620 ggtgatcaaa cgccccggca ggaagcgaaa agctgaggcc gaccctcagg ccattcccaa 1680 gaaacggggc cgaaagccgg ggagtgtggt ggcagccgct gccgccgagg ccaaaaaagaa 1740 agccgtgaag gagtcttcta tccgatctgt gcaggagacc gtactcccca tcaagaagcg 1800 caagacccgg gagacggtca gcatcgaggt caagaagtg gtgaagcccc tgctggtgtc 1860 1920 caaggagagc agccccaagg ggcgcagcag cagcgcctcc tcacccccca agaaggagca 1980 ccaccaccat caccaccact cagagtcccc aaaggccccc gtgccactgc tcccacccct 2040 gcccccacct ccacctgagc ccgagagctc cgaggacccc accacgcccc ctgagcccca 2100 2160 cgacggctgc cccaaggagc cagctaagac tcagcccgcg gttgccaccg ccgccacggc 2220 cgcagaaaag tacaaacacc gaggggaggg agagcgcaaa gacattgttt catcctccat 2280 gccaaggcca aacagagagg agcctgtgga cagccggacg cccgtgaccg agagagttag 2340 ctgaataaa agatctttat tttcattaga tctgtgtgtt ggttttttgt gtggcatgct 2400 ggggagagat cgatctgagg aacccctagt gatggagttg gccactccct ctctgcgcgc 2460 tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc 2520 ggcctcagtg agcgagcgag cgcgcagaga gggagtgg 2558 <210> 2 <211> 549 <212> DNA <213> Mus musculus <400> 2 gtgaacaacg ccaggctcct caacaggcaa ctttgctact tctacagaaa atgataataa 60 agaaatgctg gtgaagtcaa atgcttatca caatggtgaa ctactcagca gggaggctct 120 aataggcgcc aagagcctag acttccttaa gcgccagagt ccacaagggc ccagttaatc 180 ctcaacattc aaatgctgcc cacaaaacca gcccctctgt gcctagccg cctcttttt 240 ccaagtgaca gtagaactcc accaatccgc agctgaatgg ggtccgcctc ttttccctgc 300 ctaaacagac aggaactcct gccaattgag ggcgtcaccg ctaaggctcc gccccagcct 360 gggctccaca accaatgaag ggtaatctcg acaaagagca aggggtgggg cgcgggcgcg 420 caggtgcagc agcacagg ctggtcggga gggcggggcg cgacgtctgc cgtgcggggt 480 cccggcatcg gttgcgcgcg cgctccctcc tctcggag agggctgtgg taaaacccgt 540 ccgaaac 549 <210> 3 <211> 1497 <212> DNA <213> Homo sapiens <220> <221> misc_feature <223> MeCP2B cds <400> 3 atggccgccg ccgccgccgc cgcgccgagc ggaggaggag gaggaggcga ggaggagaga 60 ctggaagaaa agtcagaaga ccaggacctc cagggcctca aggacaaacc cctcaagttt 120 aaaaaggtga agaagaata gaaagagag aagagggca agcatgagcc cgtgcagcca 180 tcagccccacc actctgctga gcccgcagag gcaggcaag cagagacac agaagggtca 240 ggctccgccc cggctgtgcc ggaagctct gccccccca aacagcggcg ctccatcatc 300 cgtgaccggg gacccatgta tgatgacccc accctgcctg aaggctggac acggaagctt 360 aagcaaagga aatctggccg ctctgctggg aagtatgatg tgtatttgat caatccccag 420 ggaaaagcct ttcgctctaa agtggagttg attgcgtact tcgaaaaggt aggcgacaca 480 tccctggacc ctaatgattt tgacttcacg gtaactggga gagggagccc ctcccggcga 540 gagcagaaac cacctaagaa gcccaaatct cccaaagctc caggaactgg cagaggccgg 600 ggacgcccca aagggagcgg caccacgaga cccaaggcgg ccacgtcaga gggtgtgcag 660 gtgaaaaggg tcctggagaa aagtcctggg aagctccttg tcaagatgcc ttttcaaact 720 tcgccagggg gcaaggctga ggggggtggg gccaccacat ccacccaggt catggtgatc 780 aaacgccccg gcaggaagcg aaaagctgag gccgaccctc aggccattcc caagaaacgg 840 ggccgaaagc cggggagtgt ggtggcagcc gctgccgccg aggccaaaaa gaaagccgtg 900 aaggtctt ctatccgatc tgtgcaggag accgtactcc ccatcaagaa gcgcaagacc 960 cgggagacgg tcagcatcga ggtcaaggaa gtggtgaagc ccctgctggt gtccaccctc 1020 ggtgagaaga gcgggaaagg actgaagacc tgtaagagcc ctgggcggaa aagcaaggag 1080 agcagcccca aggggcgcag cagcagcgcc tcctcacccc ccaagaagga gcaccaccac 1140 catcaccacc actcagagtc cccaaaggcc cccgtgccac tgctcccacc cctgccccca 1200 cctccacctg agcccgagag ctccgaggac cccaccagcc cccctgagcc ccaggacttg 1260 1320 tgccccaagg agccagctaa gactcagccc gcggttgcca ccgccgccac ggccgcagaa 1380 aagtacaac accgaggga gggagagcgc aaagacattg tttcatcctc catgccaagg 1440 ccaaacagag aggagcctgt ggacagccgg acgccccgtga ccgagagagt tagctga 1497 <210> 4 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <220> <221> misc_feature <223> Poly A sequence <400> 4 aataaaagat ctttattttc attagatctg tgtgttggtt ttttgtgtg 49 <210> 5 <211> 3093 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <220> <221> misc_feature <223> scAAV9.738.Mecp1 genome <220> <221> misc_feature <222> (1)..(106) <223> mutated ITR <220> <221> misc_feature <222> (198)..(936) <223> 738 promoter fragment <220> <221> misc_feature <222> (941)..(1037) <223> SV40 intron <220> <221> misc_feature <222> (1138)..(2643) <223> MeCP2 cds <220> <221> misc_feature <222> (2709)..(2890) <223> BGHpA <220> <221> misc_feature <222> (2953)..(3093) <223> ITR <400> 5 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatt cacgcgtgga 120 tctgaattca attcacgcgt ggtaccgagc tcggatccac tagtaacggc cgccagtgtg 180 ctggaattcg cccttaatat caaaccatct gattcaacaa tgacagaccg atctcttatg 240 ggcttggcac acaccatctg cccattataa acgtctgcaa agaccaaggt ttgatatgtt 300 gattttactg tcagccttaa gagtgcgaca tctgctaatt tagtgtaata atacaatcag 360 tagacccttt aaaacaagtc ccttggcttg gaacaacgcc aggctcctca acaggcaact 420 ttgctacttc tacagaaaat gataataaag aaatgctggt gaagtcaaat gcttatcaca 480 atggtgaact actcagcagg gaggctctaa taggcgccaa gagcctagac ttccttaagc 540 gccagagtcc acaagggccc agttaatcct caacattcaa atgctgccca caaaaccagc 600 ccctctgtgc cctagccgcc tcttttttcc aagtgacagt agaactccac caatccgcag 660 ctgaatgggg tccgcctctt ttccctgcct aaacagacag gaactcctgc caattgaggg 720 cgtcaccgct aaggctccgc cccagcctgg gctccacaac caatgaaggg taatctcgac 780 aaagagcaag gggtggggcg cgggcgcgca ggtgcagcag cacacaggct ggtcgggagg 840 gcggggcgcg acgtctgccg tgcggggtcc cggcatcggt tgcgcgcgcg ctccctcctc 900 tcggagagag ggctgtggta aaacccgtcc ggaaaaactg gtaagtttag tctttttgtc 960 ttttattca ggtcccggat ccggtggtgg tgcaaatcaa agaactgctc ctcagtggat 1020 gttgcctta cttctaggcc tgtacggaag tgttacttct gctctaaaag ctgcggaatt 1080 gtacccgcgg ccgatccacc ggttttaagg gccgaggcgg ccagatcttt cgaagatatg 1140 gccgccgctg ccgccaccgc cgccgccgcc gccgcgccga gcggaggagg aggaggaggc 1200 gaggaggaga gactggagga aaagtcagaa gaccaggatc tccagggcct cagagacaag 1260 ccactgaagt ttaagaaggc gaagaaagac aagaaggagg acaaagaagg caagcatgag 1320 ccactacaac cttcagccca ccattctgca gagccagcag aggcaggcaa agcagaaaca 1380 tcagaaagct caggctctgc cccagcagtg ccagaagcct cggcttcccc caaacagcgg 1440 cgctccatta tccgtgaccg gggacctatg tatgatgacc ccaccttgcc tgaaggttgg 1500 acacgaaagc ttaaacaaag gaagtctggc cgatctgctg gaaagtatga tgtatatttg 1560 atcaatcccc agggaaaagc ttttcgctct aaagtagaat tgattgcata ctttgaaaag 1620 gtgggagaca cctccttgga ccctaatgat tttgacttca cggtaactgg gagagggagc 1680 ccctccagga gagagcagaa accacctaag aagcccaaat ctcccaaagc tccaggaact 1740 ggcaggggtc ggggacgccc caaagggagc ggcactggga gaccaaaggc agcagcatca 1800 gaaggtgttc aggtgaaaag ggtcctggag aagagccctg ggaaacttgt tgtcaagatg 1860 cctttccaag catcgcctgg gggtaagggt gagggaggtg gggctaccac atctgcccag 1920 gtcatggtga tcaaacgccc tggcagaaag cgaaaagctg aagctgaccc ccaggccatt 1980 cctaagaaac ggggtagaaa gcctgggagt gtggtggcag ctgctgcagc tgaggccaaa 2040 aagaaagccg tgaaggagtc ttccatacgg tctgtgcatg agactgtgct ccccatcaag 2100 aagcgcaaga cccgggagac ggtcagcatc gaggtcaagg aagtggtgaa gcccctgctg 2160 gtgtccaccc ttggtgagaa aagcgggaag ggactgaaga cctgcaagag ccctgggcgt 2220 aaaagcaagg agagcagccc caaggggcgc agcagcagtg cctcctcccc acctaagaag 2280 gagcaccatc atcaccacca tcactcagag tccacaaagg cccccatgcc actgctccca 2340 tccccacccc cacctgagcc tgagagctct gaggacccca tcagcccccc tgagcctcag 2400 gacttgagca gcagcatctg caaagaagag aagatgcccc gaggaggctc actggaaagc 2460 gatggctgcc ccaaggagcc agctaagact cagcctatgg tcgccaccac taccacagtt 2520 gcagaaaagt acaaacaccg aggggaggga gagcgcaaag acattgtttc atcttccatg 2580 ccaaggccaa acagagagga gcctgtggac agccggacgc ccgtgaccga gagagttagc 2640 tgaatcggcg ccgctagcgc ggccgcgttt aaaccctgca ggtctagaaa gcttatcgat 2700 accgtcgact agagctcgct gatcagcctc gactgtgcct tctagttgcc agccatctgt 2760 tgtttgcccc tccccgtgc cttccttgac cctggaaggt gccactccca ctgtccttc 2820 ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg 2880 tggggtgggg caggacagca agggggagga ttgggaagac atagcaggc atgctgggga 2940 gagatcgatc tgaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct 3000 cgctcactga ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct 3060 cagtgagcga gcgagcgcgc agagagggag tgg 3093 <210> 6 <211> 739 <212> DNA <213> Mus musculus <220> <221> misc_feature <223> MECP2 promoter <400> 6 tatcaaacca tctgattcaa caatgacaga ccgatctctt atgggcttgg cacacaccat 60 ctgcccatta taaacgtctg caaagaccaa ggtttgatat gttgatttta ctgtcagcct 120 taagagtgcg acatctgcta atttagtgta ataatacaat cagtagaccc tttaaaacaa 180 gtcccttggc ttggacaac gccaggctcc tcacaggca acttgctac ttctacagaa 240 aatgatata aagaaatgct ggtgaagtca aatgcttatc acatggtga actactcagc 300 agggaggctc taataggcgc caagccta gactcctta agcgccagag tccacaaggg 360 cccagttaat cctcacatt caatgctgc ccacaaacc agcccctg tgcctagcc 420 gcctcttttt tccaagtgac agtagaactc caccaatccg cagctgaatg gggtccgcct 480 cttttccctg cctaaacaga caggaactcc tgccaattga gggcgtcacc gctaaggctc 540 cgccccagcc tgggctccac aaccaatgaa gggtaatctc cakaagagc aaggggtggg 600 gcgcgggcgc gcaggtgcag cagcacacag gctggtcggg agggcggggc gcgacgtctg 660 ccgtgcgggg tcccggcatc ggttgcgcgc gcgctccctc ctctcggaga gagggctgtg 720 gtaaaacccg tccggaaaa 739 <210> 7 <211> 1563 <212> DNA <213> Muscles <220> <221> misc_feature <223> MECP2alpha <400> 7 gtacccgcgg ccgatccacc ggttttaagg gccgaggcgg ccagatctt cgaagatatg 60 gccgccgctg ccgccaccgc cgccgccgcc gccgcgccga gcggaggagg aggaggaggc 120 gaggaggaga gactgagga aaagtcagaa gaccaggatc tccaggcct cagagacaag 180 slowspeed slowssssssssssssssssssssssssssssssssssss ccactacaac cttcagccca ccattctgca gagccagcag agcaggca agcagaaaca 300 tcagaaagct caggctctgc cccagcagtg ccagaagcct cggcttcccc caacagcgg 360 cgctccatta tccgtgaccg gggacctatg tatgatgacc ccaccttgcc tgaagttgg 420 acacgaaagc ttaacaag gaagtctggc cgatctgctg gaagtatga tgtatattg 480 atcaatcccc agggaaaagc ttttcgctct aaagtagaat tgattgcata ctttgaaaag 540 gtgggagaca cctccttgga ccctaatgat tttgacttca cggtaactgg gagagggagc 600 ccctccagga gagagcagaa accacctaag aagcccaaat ctcccaaagc tccaggaact 660 ggcaggggtc ggggacgccc caaagggagc ggcactggga gaccaaaggc agcagcatca 720 gaaggtgttc aggtgaaaag ggtcctggag aagagccctg ggaaacttgt tgtcaagatg 780 cctttccaag catcgcctgg gggtaagggt gagggaggtg gggctaccac atctgcccag 840 gtcatggtga tcaaacgccc tggcagaaag cgaaaagctg aagctgaccc ccaggccatt 900 cctaagaaac ggggtagaaa gcctgggagt gtggtggcag ctgctgcagc tgaggccaaa 960 aagaaagccg tgaaggagtc ttccatacgg tctgtgcatg agactgtgct ccccatcaag 1020 aagcgcaaga cccgggagac ggtcagcatc gaggtcaagg aagtggtgaa gcccctgctg 1080 gtgtccaccc ttggtgagaa aagcgggaag ggactgaaga cctgcaagag ccctgggcgt 1140 aaaagcaagg agagcagccc caaggggcgc agcagcagtg cctcctcccc acctaagaag 1200 gagcaccatc atcaccacca tcactcagag tccacaaagg cccccatgcc actgctccca 1260 tccccacccc cacctgagcc tgagagctct gaggacccca tcagcccccc tgagcctcag 1320 gacttgagca gcagcatctg caaagaagag aagatgcccc gaggaggctc actggaaagc 1380 gatggctgcc ccaaggagcc agctaagact cagcctatgg tcgccaccac taccacagtt 1440 gcagaaaagt acaaacaccg aggggaggga gagcgcaaag acattgtttc atcttccatg 1500 ccaaggccaa acagagagga gcctgtggac agccggacgc ccgtgaccga gagagttagc 1560 tga 1563 <210> 8 <211> 6087 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Plasmid for AVXS-201 production <220> <221> misc_feature <222> (1)..(106) <223> mutated ITR <220> <221> misc_feature <222> (151)..(699) <223> 546 promotor fragment <220> <221> misc_feature <222> (729)..(829) <223> SV40 intron <220> <221> misc_feature <222> (848)..(2344) <223> hMECP2B <220> <221> misc_feature <222> (2345)..(2393) <223> synthetic pA <220> <221> misc_feature <222> (2418)..(2558) <223> ITR <220> <221> misc_feature <222> (3309)..(4259) <223> kanamycin resistance <220> <221> misc_feature <222> (4325)..(4939) <223> The original pMB1 <400> 8 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc cgggcgtcg ggcgacctt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggaatt cacgcgtgga 120 tctgaattca attcacgcgt ggtaccacgc gtgaacaacg ccaggctcct caacaggcaa 180 cttgctact tctacagaaa atgataataa agaaatgctg gtgaagtcaa atgcttatca 240 caatggtgaa ctactcagca gggaggctct aataggcgcc aagagcctag acttccttaa 300 gcgccagagt ccacaagggc ccagttaatc ctcaacattc aaatgctgcc cacaaaacca 360 gccctctgt gccctagccg ccttttttt ccaagtgaca gtagaactcc accaatccgc 420 agctgaatgg ggtccgcctc ttttccctgc ctaaacagac aggaactcct gccaattgag 480 ggcgtcaccg ctaaggctcc gccccagcct gggctccaca accaatgaag ggtaatctcg 540 aaagagca aggggtgggg cgcggggcgcg caggtgcagc agcacagg ctggtcggga 600 gggcggggcg cgacgtctgc cgtgcggggt cccggcatcg gttgcgcgcg cgctccctcc 660 tctcggag agggctgtgg taaaacccgt ccggaaacg cgtcgaaggg cgaattctgc 720 agatactgg taagtttagt cttttgtc ttttattca ggtcccggat ccggtggtgg 780 tgcaaatcaa agaactgctc ctcagtcgat gttgccttta cttctaggcc tgtacggaag 840 tgttactatg gccgccgccg ccgccgccgc gccgagcgga ggaggaggag gaggcgagga 900 ggagagactg gagaaaagt cagagacca ggacctccag ggcctcagg acaacccct 960 caagtttaa aagtgaaga agagagaaa gaggcaagc atgagcccgt 1020 gcagccatca gcccaccact ctgctgagcc cgcagaggca ggcaagcag agacatcaga 1080 agggtcaggc tccgccccgg ctgtgccgga agctctgcc tccccaac agcggcgctc 1140 catcatccgt gaccggggac ccatgtatga tgaccccacc ctgcctgaag gctggacacg 1200 gaagcttaag caaaggaaat ctggccgctc tgctgggaag tatgatgtgt atttgatcaa 1260 tccccaggga aaagcctttc gctctaaagt ggagttgatt gcgtacttcg aaaaggtagg 1320 cgacacatcc ctggacccta atgattttga cttcacggta actgggagag ggagcccctc 1380 ccggcgagag cagaaaccac ctaagaagcc caaatctccc aaagctccag gaactggcag 1440 aggccgggga cgccccaaag ggagcggcac cacgagaccc aaggcggcca cgtcagaggg 1500 tgtgcaggtg aaaagggtcc tggagaaaag tcctgggaag ctccttgtca agatgccttt 1560 tcaaacttcg ccagggggca aggctgaggg gggtggggcc accacatcca cccaggtcat 1620 ggtgatcaaa cgccccggca ggaagcgaaa agctgaggcc gaccctcagg ccattcccaa 1680 gaaacggggc cgaaagccgg ggagtgtggt ggcagccgct gccgccgagg ccaaaaagaa 1740 agccgtgaag gagtcttcta tccgatctgt gcaggagacc gtactcccca tcaagaagcg 1800 caagacccgg gagacggtca gcatcgaggt caagaagtg gtgaagcccc tgctggtgtc 1860 1920 caaggagagc agccccaagg ggcgcagcag cagcgcctcc tcacccccca agaaggagca 1980 ccaccaccat caccaccact cagagtcccc aaaggccccc gtgccactgc tcccacccct 2040 gcccccacct ccacctgagc ccgagagctc cgaggacccc accacgcccc ctgagcccca 2100 2160 cgacggctgc cccaaggagc cagctaagac tcagcccgcg gttgccaccg ccgccacggc 2220 cgcagaaaag tacaaacacc gaggggaggg agagcgcaaa gacattgttt catcctccat 2280 gccaaggcca aacagagagg agcctgtgga cagccggacg cccgtgaccg agagagttag 2340 ctgaaataaa agatctttat tttcattaga tctgtgtgtt ggttttttgt gtggcatgct 2400 ggggagagat cgatctgagg aacccctagt gatggagttg gccactccct ctctgcgcgc 2460 tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc 2520 ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc cccccccccc cccccccggc 2580 gattctcttg tttgctccag actctcaggc aatgacctga tagcctttgt agagacctct 2640 caaaaatagc taccctctcc ggcatgaatt tatcagctag aacggttgaa tatcatattg 2700 atggtgattt gactgtctcc ggcctttctc acccgtttga atctttacct acacattact 2760 caggcattgc atttaaaata tatgagggtt ctaaaaattt ttatccttgc gttgaaataa 2820 aggcttctcc cgcaaaagta ttacagggtc ataatgtttt tggtacaacc gatttagctt 2880 tatgctctga ggctttattg cttaattttg ctaattcttt gccttgcctg tatgatttat 2940 tggatgttgg aatcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca 3000 ccgcatatgg tgcactctca gtacaatctg ctctgatgcc ccatagttaa gccagccccg 3060 acacccgcca acactatggt gcactctcag tacaatctgc tctgatgccg catagttaag 3120 ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc 3180 atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc 3240 gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctattt tatagggttaa 3300 tgtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt 3360 taaatcaatc taaagtatat atgagtaaac ttggtctgac agttagaaaa actcatcgag 3420 catcaaatga aactgcaatt tattcatatc aggattatca ataccatatt tttgaaaaag 3480 ccgtttctgt aatgaaggag aaaactcacc gaggcagttc cataggatgg caagatcctg 3540 gtatcggtct gcgattccga ctcgtccaac atcaatacaa cctattaatt tcccctcgtc 3600 aaaaataagg ttatcaagtg agaaatcacc atgagtgacg actgaatccg gtgagaatgg 3660 caaaagttta tgcatttctt tccagacttg ttcaacaggc cagccattac gctcgtcatc 3720 aaaatcactc gcatcaacca aaccgttatt cattcgtgat tgcgcctgag cgaggcgaaa 3780 tacgcgatcg ctgttaaaag gacaattaca aacaggaatc gagtgcaacc ggcgcaggaa 3840 cactgccagc gcatcaacaa tattttcacc tgaatcagga tattcttcta atacctggaa 3900 cgctgttttt ccggggatcg cagtggtgag taaccatgca tcatcaggag tacggataaa 3960 atgcttgatg gtcggaagtg gcataaattc cgtcagccag tttagtctga ccatctcatc 4020 tgtaacatca ttggcaacgc tacctttgcc atgtttcaga aacaactctg gcgcatcggg 4080 cttcccatac aagcgataga ttgtcgcacc tgattgcccg acattatcgc gagcccattt 4140 atacccatat aaatcagcat ccatgttgga atttaatcgc ggcctcgacg tttcccgttg 4200 aatatggctc atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct 4260 catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 4320 gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 4380 aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 4440 gaaggtaact ggcttcagca gagcgcagat accaaatact gttcttctag tgtagccgta 4500 gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 4560 gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 4620 atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 4680 cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 4740 cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 4800 agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 4860 tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 4920 gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 4980 catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 5040 agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc 5100 ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 5160 ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 5220 tggcgaatgg cgattccgtt gcaatggctg gcggtaatat tgttctggatattacco 5280 aggccgatag tttgagttct tctactcagg caagtgatgt tattactaat caaagaagta 5340 ttgcgacaac ggttaatttg cgtgatggac agactctttt actcggtggc ctcactgatt 5400 ataaaaacac ttctcaggat tctggcgtac cgttcctgtc taaaatccct ttaatcggcc 5460 tcctgtttag ctcccgctct gattctaacg aggaaagcac gttatacgtg ctcgtcaaag 5520 caaccatagt acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc 5580 agcgtgaccg ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc 5640 tttctcgcca cgttcgccgg ctttccccgt caagctctaa atcggggct ccctttaggg 5700 ttccgattta gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca 5760 cgtagtgggc catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc 5820 tttaatagtg gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct 5880 tttgatttat aagggatttt gccgatttcg gcctattggt taaaaaatga gctgattttaa 5940 caaaaattta acgcgaattt taacaaata ttaacgctta caatttaaat atttgcttat 6000 acaatcttcc tgtttttgg gcttttctga ttatcaaccg gggtacatat gattgacatg 6060 ctagttttac gattaccgtt catcgcc 6087

Claims

1. A DNA plasmid containing a recombinant adeno-associated virus (rAAV) genome, The genome is as follows: A promoter consisting of the sequence of sequence number 2, SV40 Intron, Methyl-CpG-binding protein 2 (MECP2) containing the sequence of SEQ ID NO: 3 Polynucleotides that are used, and Synthetic polyadenylation signal Includes a gene cassette containing, The gene cassette has inverted end repeats of mutant AAV2 and wild-type inverted ends on both sides. A DNA plasmid in which repeats are arranged.

2. The SV40 intron includes the sequence of nucleotides 729-827 of SEQ ID NO:

1. The DNA plasmid according to claim 1.

3. The aforementioned synthetic polyadenylation signal corresponds to nucleotides 2345-2393 of Sequence ID No.

1. A DNA plasmid according to claim 1 or 2, comprising a sequence.

4. The DNA plasmid according to any one of claims 1 to 3, wherein the rAAV genome comprises the polynucleotide sequence of SEQ ID NO:

1.

5. A lack of the rep gene and cap gene of AAV, according to any one of claims 1 to 4 The DNA plasmid described.

6. A DNA plasmid according to any one of claims 1 to 5, further comprising a selection marker.

7. The DNA plasmid according to claim 6, wherein the selection marker is a neomycin resistance gene. Do.

8. The rAAV genome is a self-complementary genome, as described in any one of claims 1 to 7. DNA plasmid.

9. The dN according to any one of claims 1 to 7, wherein the rAAV genome is a single-stranded genome. Plasmid A.

10. A cultured cell comprising the DNA plasmid described in any one of claims 1 to 9.

11. HeLa cells, 293 cells, PerC. 6 cells, MRC-5 cells, WI-38 cells, V The cell according to claim 10, which is an ero cell or an FRhL-2 cell.

12. To produce recombinant adeno-associated virus (rAAV) to treat Rett syndrome, The method of the IVITRO, A step of introducing a DNA plasmid according to any one of claims 1 to 9 into a cell, The AAV helper plasmid and the AAV rep / cap plasmid are introduced into the cells. The process of entering, The process of generating rAAV particles with the DNA plasmid capsid in the cells The course, and The process of separating the rAAV particles from the cells. A method comprising the rAAV particle having replication defects.

13. The aforementioned cells include HeLa cells, 293 cells, PerC. 6 cells, MRC-5 cells, and WI- The method according to claim 12, wherein the cells are 38 cells, Vero cells, or FRhL-2 cells.

14. Claim that the rep / cap plasmid encodes the AAV9 capsid protein. The method described in 12 or 13.

15. Produced using the cells described in claim 10 or 11, or according to claims 12 to 14 rAAV particles produced using the method described in any one of the following items, below: A promoter consisting of the sequence of sequence number 2, SV40 Intron, Methyl-CpG-binding protein 2 (MECP2) containing the sequence of SEQ ID NO: 3 Polynucleotides that are used, and Synthetic polyadenylation signal Includes an rAAV genome containing a gene cassette containing, The gene cassette is an rAAV particle in which inverted terminal repeats of mutant AAV2 and wild-type are positioned on both sides.

Images