Magnetic field-treated immune cells and their use
By upregulating genes related to the mitochondrial respiratory chain in T cells with a static magnetic field, the treatment enhances perforin and granzyme secretion, improving ATP levels and cytotoxic activity, addressing the unclear mechanisms of magnetic field effects on T cells and offering a non-invasive antitumor immune cell boost.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- HEYE HEALTH TECH CO LTD
- Filing Date
- 2021-04-30
- Publication Date
- 2026-06-01
AI Technical Summary
The molecular mechanisms by which static magnetic fields affect T cell behavior remain unclear, and in vivo data supporting these effects are insufficient, with existing studies showing that strong magnetic fields can cause cell damage and moderate fields may alter cell behavior.
Treating T cells with a static magnetic field upregulates the expression or activity of genes related to the mitochondrial respiratory chain, such as Uqcrb and Ndufs6, enhancing the secretion of perforins, granzymes, and cytokines, thereby improving ATP levels and cytotoxic activity.
The treatment enhances the cytotoxic activity of T cells by increasing perforin and granzyme secretion, promoting mitochondrial respiration, and improving ATP levels, providing a non-invasive method to boost immune cell function for antitumor effects.
Smart Images

Figure 0007867979000001 
Figure 0007867979000002 
Figure 0007867979000003
Abstract
Description
[Technical Field]
[0001] This invention relates to the field of immune cells, and more specifically to magnetic field-treated immune cells and their use. [Background technology]
[0002] T cells are an important component of adaptive immunity. T cells express CD4 and CD8 molecules on their surface. + T cells and CD8 + They can be divided into T cells. CD4 + T cells, also known as helper T cells, primarily release secretory factors such as IFNγ, IL-4, IL-17, and TNFα, thereby activating and regulating the activity of other immune cells. CD8 + T cells, also known as killer T cells (CTLs), can directly kill infected, damaged, and non-functional cells and play a crucial role in anti-tumor immunity. CTLs require the release of granzymes mediated by perforin to kill tumor target cells, with granzyme B being the main granular component. CTLs also kill tumor cells by secreting IFNγ and TNFα.
[0003] Magnetic fields, like temperature and pressure in the environment, are important physical elements found in nature. Based on their strength, static magnetic fields are classified into weak (<1mT), moderate (1mT~1T), strong (1~20T), and very strong (>20T). Numerous animals sense the Earth's magnetic field (25μT~65μT) and use it for navigation and migration. Cryptochrome (Cry) is considered the most likely magnetoreceptor, mediating magnetoception in birds and fruit flies through the photochemical conversion of free radical pairs. Recent research also suggests that the iron-sulfur protein Isca1 may also be a magnetoreceptor, forming a rod-shaped complex with cryptochrome in vitro, changing its orientation to match the direction of the magnetic field, much like a compass.
[0004] Recent studies have shown that static magnetic fields have biological effects on cells, such as influencing cell proliferation and differentiation, and spindle orientation. Existing studies suggest that strong and very strong magnetic fields are harmful to normal cells, for example, causing changes in cleavage and spindle orientation, and DNA damage. However, moderate magnetic fields cause far less harm to normal cells, and there have been no reports of moderate magnetic fields being clearly harmful. Furthermore, more studies suggest that moderate static magnetic fields have the potential to alter cell behavior, such as promoting osteoblast differentiation, inhibiting tumor cell proliferation, promoting oligodendrocyte differentiation, and promoting the secretion of neuronal factors (Non-patent Literature 1, 2, 3). As magnetoception mechanisms by magnetosensitive proteins in animals are revealed, it will become possible to control animal and cellular behavior with magnetic fields. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] Yang J, Zhang J, Ding C, Dong D, Shang P. Regulation of Osteoblast Differentiation and Iron Content in MC3T3-E1 Cells by Static Magnetic Field with Different Intensities. Biological trace element research 2017 [Non-Patent Document 2] Zhang L, Wang J, Wang H, Wang W, Li Z, Liu J, et al. Moderate and strong static magnetic fields directly affect EGFR kinase domain orientation to inhibit cancer cell proliferation. Oncotarget 2016, 7(27): 41527-41539 [Non-Patent Document 3] Prasad A, Teh DBL, Blasiak A, Chai C, Wu Y, Gharibani PM, et al. Static Magnetic Field Stimulation Enhances Oligodendrocyte Differentiation and Secretion of Neurotrophic Factors. Scientific reports 2017, 7(1): 6743 [Overview of the project] [Problems that the invention aims to solve]
[0006] It has already been reported that T cells respond to static magnetic fields (SMFs). Exposure of human T lymphocytes to a strong static magnetic field increases cell apoptosis and damage. Furthermore, exposure of human lymphocytes and macrophages to a 1.5T static magnetic field suppresses the expression of cytokines IL-6, IL-8, and TNF-α, but does not alter IL-10 expression. From the above, it can be concluded that static magnetic fields can alter the behavior of T cells. However, the molecular mechanisms by which static magnetic fields affect T cell behavior remain unclear, and in vivo data supporting these effects are insufficient. [Means for solving the problem]
[0007] Summary of the Invention The inventors discovered that treating T cells with a static magnetic field increased the expression or secretion of perforins, granzymes, and / or cytokines in the treated T cells, thereby improving ATP levels and enhancing cytotoxic activity, through genes related to magnetic receptors and genes related to the mitochondrial respiratory chain.
[0008] Therefore, the first aspect of the present invention provides immune cells characterized in that, in activated immune cells, the expression or activity of Uqcrb and / or Ndufs6, which are genes related to the mitochondrial respiratory chain of the immune cells, is upregulated compared to wild-type immune cells.
[0009] In one or more embodiments, Uqcrb expression or activity is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0010] In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0011] In one or more embodiments, the immune cells are subjected to magnetic field treatment.
[0012] In one or more embodiments, the magnetic field is a static magnetic field.
[0013] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0014] In one or more embodiments, the process involves placing the cells in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, and at least 108 hours.
[0015] In one or more embodiments, the genes Isca1, Cry1, and / or Cry2, which relate to magnetic receptors in immune cells, are involved in regulating the expression or activity of the genes Uqcrb and / or Ndufs6, which relate to the mitochondrial respiratory chain.
[0016] In one or more embodiments, the expression or secretion of perforin, granzyme, and / or cytokines in the immune cells is increased.
[0017] In one or more embodiments, the ATP levels of the immune cells are improved.
[0018] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0019] In one or more embodiments, the immune cells are T cells, preferably CD8+ T cells or CD4+ T cells.
[0020] In one or more embodiments, the cytotoxic activity of the immune cells is enhanced.
[0021] Another aspect of the present invention provides a pharmaceutical composition comprising immune cells as described herein and a pharmaceutically acceptable carrier.
[0022] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0023] In one or more embodiments, the immune cells are T cells, preferably CD8+ T cells or CD4+ T cells.
[0024] Another aspect of the present invention provides the use of a magnetic field in upregulating the expression or activity of genes relating to the mitochondrial respiratory chain of a cell, or in improving the ATP level of a cell.
[0025] In one or more embodiments, the magnetic field is a static magnetic field.
[0026] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0027] In one or more embodiments, the cells are immune cells.
[0028] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0029] In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0030] In one or more embodiments, the genes Isca1, Cry1, and / or Cry2, which relate to magnetic receptors in the cells, are involved in regulating the expression of the genes Uqcrb and / or Ndufs6, which relate to the mitochondrial respiratory chain.
[0031] In one or more embodiments, the expression or activity of Uqcrb and / or Ndufs6, which are genes relating to the mitochondrial respiratory chain of the cell, is upregulated. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, and at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, and at least 90%.
[0032] In one or more embodiments, the expression of Isca1, Cry1, and / or Cry2, which are genes related to magnetic receptors in the cells, remains unchanged.
[0033] In one or more embodiments, the cells are placed in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, and at least 108 hours.
[0034] Another aspect of the present invention provides the use of a magnetic field in promoting the expression or secretion of perforins, granzymes, and / or cytokines in cells, or in enhancing the cytotoxic activity of cells.
[0035] In one or more embodiments, the magnetic field is a static magnetic field.
[0036] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0037] In one or more embodiments, the cells are immune cells.
[0038] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0039] In one or more embodiments, the immune cells are T cells, preferably CD8+ T cells or CD4+ T cells.
[0040] In one or more embodiments, the genes Isca1, Cry1, and / or Cry2, which relate to magnetic receptors in the cells, are involved in regulating the expression of the genes Uqcrb and / or Ndufs6, which relate to the mitochondrial respiratory chain.
[0041] In one or more embodiments, the expression or activity of Uqcrb and / or Ndufs6, which are genes relating to the mitochondrial respiratory chain of the cell, is upregulated. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, and at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, and at least 90%.
[0042] In one or more embodiments, the expression of Isca1, Cry1, and / or Cry2, which are genes related to magnetic receptors in the cells, remains unchanged.
[0043] In one or more embodiments, the cells are placed in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, and at least 108 hours.
[0044] Another aspect of the present invention provides the use of genes relating to magnetic receptors that respond to a cellular magnetic field in order to improve the expression or activity of genes relating to the mitochondrial respiratory chain of a cell, or to improve the ATP level of a cell.
[0045] In one or more embodiments, the expression or activity of genes related to magnetic receptors that respond to a magnetic field remains unchanged.
[0046] In one or more embodiments, the magnetic field is a static magnetic field.
[0047] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0048] In one or more embodiments, when the cells are placed in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, or at least 108 hours, the gene related to the magnetoreceptor responds to the magnetic field.
[0049] In one or more embodiments, the cells are immune cells.
[0050] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0051] In one or more embodiments, the immune cells are T cells, preferably CD8 + T cells or CD4 + T cells.
[0052] In one or more embodiments, the genes related to the mitochondrial respiratory chain are Uqcrb and / or Ndufs.
[0053] In one or more embodiments, the genes related to the magnetoreceptor are Isca1, Cry1, and / or Cry2.
[0054] Another aspect of the present invention provides the use of upregulation of the expression or activity of genes related to the mitochondrial respiratory chain in promoting the expression or secretion of perforin, granzyme, and / or cytokines in cells, or improving the cytotoxic activity of cells.
[0055] In one or more embodiments, the cells are immune cells.
[0056] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0057] In one or more embodiments, the immune cells are T cells, preferably CD8 +T cells or CD4 + These are T cells.
[0058] In one or more embodiments, the gene relating to the mitochondrial respiratory chain is Uqcrb and / or Ndufs. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0059] In one or more embodiments, the granzyme is granzyme A and / or B.
[0060] In one or more embodiments, the cytokine comprises one or more selected from the following: interleukins (IL), colony-stimulating factors (CSF), interferons (IFN), tumor necrosis factor (TNF), transforming growth factor β family (TGF-β), growth factors (GF), and chemokine families.
[0061] Another aspect of the present invention provides the use of a magnetic field, a reagent for upregulating gene expression or activity related to the mitochondrial respiratory chain, in the manufacture of a reagent containing immune cells or a reagent for improving the toxic activity of immune cells.
[0062] In one or more embodiments, the magnetic field is a static magnetic field.
[0063] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0064] In one or more embodiments, the immune cells are placed in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, and at least 108 hours.
[0065] In one or more embodiments, the ATP levels of the immune cells are improved.
[0066] In one or more embodiments, the expression or secretion of perforin, granzyme, and / or cytokines in the immune cells is improved.
[0067] In one or more embodiments, the cytotoxic activity of the immune cells is improved.
[0068] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0069] In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0070] In one or more embodiments, the reagent for upregulating the expression or activity of a gene related to the mitochondrial respiratory chain is a primer that recognizes the gene related to the mitochondrial respiratory chain, or a vector containing the coding sequence of the gene related to the mitochondrial respiratory chain. Preferably, the gene related to the mitochondrial respiratory chain is Uqcrb and / or Ndufs6. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0071] In one or more embodiments, the primer sequence that recognizes genes related to the mitochondrial respiratory chain includes one or more sequences selected from SEQ ID NOs: 9, 10, 15, and 16. Preferably, the primer sequence is SEQ ID NOs: 9 and 10, or SEQ ID NOs: 15 and 16.
[0072] Another aspect of the present invention provides a magnetic field, a reagent for upregulating the expression or activity of genes relating to the mitochondrial respiratory chain, and its use in the manufacture of immune cells and drugs for treating cancer.
[0073] In one or more embodiments, the magnetic field is a static magnetic field.
[0074] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0075] In one or more embodiments, the drug comprises T cells, and the T cells are placed in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, and at least 108 hours.
[0076] In one or more embodiments, the cancer is a cancer targeted by CD8+ T cells and includes solid tumors and hematological malignancies such as adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, bile duct cancer, gallbladder cancer, esophageal cancer, pancreatic cancer, and prostate cancer, as well as leukemias and lymphomas such as B-cell lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myeloid leukemia.
[0077] In one or more embodiments, the cancer is melanoma and / or breast cancer.
[0078] In one or more embodiments, the ATP levels of the T cells are improved.
[0079] In one or more embodiments, the expression or secretion of perforin, granzyme, and / or cytokines in the T cells is enhanced.
[0080] In one or more embodiments, the cytotoxic activity of the T cells is improved.
[0081] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0082] In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0083] In one or more embodiments, the reagent for upregulating the expression or activity of a gene related to the mitochondrial respiratory chain is a primer that recognizes the gene related to the mitochondrial respiratory chain, or a vector containing the coding sequence of the gene related to the mitochondrial respiratory chain. Preferably, the gene related to the mitochondrial respiratory chain is Uqcrb and / or Ndufs6. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0084] In one or more embodiments, the primer sequence that recognizes genes related to the mitochondrial respiratory chain includes one or more sequences selected from SEQ ID NOs: 9, 10, 15, and 16. Preferably, the primer sequence is SEQ ID NOs: 9 and 10, or SEQ ID NOs: 15 and 16.
[0085] This specification describes a method for producing immune cells, comprising the following steps (1) to (4), (1) Treating immune cells with a magnetic field relating to this specification, (2) Processing a subject containing immune cells with a magnetic field as specified herein, The present invention further provides a method comprising one or more steps selected from (3) upregulating the expression and / or activity of genes relating to the mitochondrial respiratory chain of immune cells.
[0086] In one or more embodiments, the magnetic field is a static magnetic field.
[0087] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0088] In one or more embodiments, the process involves placing immune cells or a subject in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, or at least 108 hours.
[0089] In one or more embodiments, the reagent for upregulating the expression or activity of a gene related to the mitochondrial respiratory chain is a primer that recognizes the gene related to the mitochondrial respiratory chain, or a vector containing the coding sequence of the gene related to the mitochondrial respiratory chain. Preferably, the gene related to the mitochondrial respiratory chain is Uqcrb and / or Ndufs6. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0090] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0091] In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0092] Another aspect of the present invention is a method for improving cellular ATP levels in vivo or in vitro, promoting cellular mitochondrial respiration in vivo or in vitro, and enhancing the toxic activity of immune cells in vivo or in vitro, comprising the following steps (1) to (3): (1) Treating immune cells with a magnetic field relating to this specification, (2) Processing a subject containing immune cells with a magnetic field as specified herein, The present invention provides a method comprising one or more steps selected from (3) upregulating the expression and / or activity of genes relating to the mitochondrial respiratory chain of immune cells.
[0093] In one or more embodiments, the gene relating to the mitochondrial respiratory chain is Uqcrb and / or Ndufs6. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 90%.
[0094] In one or more embodiments, the genes relating to the magnetic receptor are Isca1, Cry1, and / or Cry2.
[0095] In one or more embodiments, the magnetic field is a static magnetic field.
[0096] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0097] In one or more embodiments, the process involves placing immune cells or a subject in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, or at least 108 hours.
[0098] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0099] In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0100] Another aspect of the present invention provides a method for treating cancer, comprising administering to a subject in need an effective amount of immune cells or a pharmaceutical composition according to the present invention.
[0101] Another aspect of the present invention provides a method for treating cancer, comprising treating a subject with a magnetic field.
[0102] In one or more embodiments, the magnetic field is a static magnetic field.
[0103] In one or more embodiments, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. Preferably, the intensity of the magnetic field is 0.05 to 0.9 T, 0.1 to 0.8 T, 0.2 to 0.7 T, 0.3 to 0.6 T, or 0.4 to 0.5 T.
[0104] In one or more embodiments, the process involves placing immune cells or a subject in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, or at least 108 hours.
[0105] In one or more embodiments, the cancer is a cancer targeted by CD8+ T cells and includes solid tumors and hematological malignancies such as adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, bile duct cancer, gallbladder cancer, esophageal cancer, pancreatic cancer, and prostate cancer, as well as leukemias and lymphomas such as B-cell lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, acute myeloid leukemia, and melanoma.
[0106] In one or more embodiments, the cancer is melanoma and / or breast cancer.
[0107] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells.
[0108] In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0109] Another aspect of the present invention provides a magnetic component including a body on which a magnet is provided.
[0110] In one or more embodiments, the magnet is a button magnet with a torque of 0.3T or 0.6T.
[0111] In one or more embodiments, the main body is made of resin fiberboard.
[0112] In one or more embodiments, the main body is a rectangular plate.
[0113] In one or more embodiments, the thickness of the main body is 0.1 to 5.0 cm, preferably 1.5 cm.
[0114] In one or more embodiments, the diameter of the magnet is 0.5 to 5 cm, preferably 1 cm.
[0115] In one or more embodiments, the distance between adjacent magnets is 0.5 to 5 cm, preferably 2.5 cm.
[0116] In one or more embodiments, a magnet is embedded within the main body.
[0117] Another aspect of the present invention provides a device that is a mammalian cage including a magnetic component according to this specification.
[0118] In one or more embodiments, the magnetic component is located in any part of the cage, for example, the top, bottom, side, or center, and preferably in the bottom.
[0119] In one or more embodiments, the north pole of the magnet in the magnetic component faces upward and the south pole faces downward.
[0120] Another aspect of the present invention provides a method for manufacturing the apparatus according to this specification, which includes installing the magnetic component according to this specification on the ceiling, bottom, sides, and center of a mammal cage, preferably on the bottom.
[0121] Another aspect of the present invention provides the use of a magnetic component or device according to this specification in the manufacture of a reagent containing immune cells or a drug for treating cancer.
[0122] In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells. In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0123] Another aspect of the present invention provides the use of magnetic components or devices according to this specification in improving cellular ATP levels in vivo or in vitro, promoting cellular mitochondrial respiration in vivo or in vitro, and enhancing the toxic activity of immune cells in vivo or in vitro. In one or more embodiments, the immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells. In one or more embodiments, the immune cells are T cells, preferably CD8 cells. + T cells or CD4 + These are T cells.
[0124] Another aspect of the present invention provides for the use of magnetic components or devices according to this specification in cancer treatment.
[0125] The present invention has the following advantages.
[0126] (1) We demonstrated that a moderate static magnetic field regulates the expression of genes in the mitochondrial respiratory chain, thereby promoting the secretion of granzymes and cytokines, as well as ATP and mitochondrial respiration levels, in immune cells (e.g., T cells).
[0127] (2) By newly linking candidate magnetic receptor genes with mitochondrial respiratory chain genes, the study provided new insights into how cells receive magnetic signals, how they are converted into biological signals, and how this leads to biological effects. Furthermore, the study revealed new immunological effects by newly linking magnetic fields, mitochondrial ATP synthesis, and immune cell (e.g., T cell) killing, as well as a novel mechanism of immune cell killing activated by magnetic fields.
[0128] (3) In addition to the fact that a moderate static magnetic field enhances the antitumor effect of immune cells (e.g., T cells), we demonstrated that in vivo injection of magnetically treated CTL cells also exhibits a clear antitumor effect. This led to the development of a novel magnetokinetic physical method for enhancing the antitumor effect of immune cells. Compared to existing chimeric antigen T cell (CAR-T) therapy, this method is a non-invasive means of regulating cell function because it does not require the introduction of DNA fragments into target cells using genome editing techniques.
[0129] (4) Various cellular effects can be obtained depending on various experimental parameters such as cell type, magnetic field strength, and exposure time. In this study, we investigated the cellular effects of a moderate static magnetic field on immune cells (e.g., T cells) at different magnetic field strengths and TCR stimulation times in vitro. The results showed that a moderate static magnetic field enhances the secretion of granzymes and cytokines in immune cells, assuming 72 hours of TCR stimulation. Furthermore, in vivo experiments demonstrated that a moderate static magnetic field (treated with a 0.6T magnetic plate) promotes the secretion of granzymes and cytokines in tumor-infiltrating immune cells. [Brief explanation of the drawing]
[0130] [Figure 1] Figure 1 shows the permanent magnets and magnetic plates used in the experiment. (A) is a 0.3T permanent magnet used in in vitro experiments. (B) is a 0.6T permanent magnet used in in vitro experiments. (C) is a magnetic plate placed at the bottom of the mouse cage used in in vivo experiments. [Figure 2]Figure 2 shows the effect of a moderate-intensity static magnetic field on the expression of active molecules on the surface of T cells in vitro. (A)-(C) CD4+ T cells were stimulated in vitro with anti-CD3 and anti-CD28 antibodies for 24h (A), 48h (B), and 72h (C), and the positive ratios of CD69, CD25, and CD44 were detected by flow cytometry, followed by comparative analysis (n=8). (D)-(F) CD8+ T cells were stimulated in vitro with anti-CD3 and anti-CD28 antibodies for 24h (A), 48h (B), and 72h (C), and the positive ratios of CD69, CD25, and CD44 were detected by flow cytometry, followed by comparative analysis (n=8). Cell samples were treated with 0.3T or 0.6T magnets, but control cells were not treated with magnets. [Figure 3] Figure 3 shows that a moderate-intensity static magnetic field has no apparent effect on cytokine secretion by CD4+ T cells in vitro. CD4+ T cells were stimulated in vitro with anti-CD3 and anti-CD28 antibodies for 24h (A), 48h (B), and 72h (C). The secretion status of IFNγ, TNFα, and Il-2 was detected by flow cytometry, and the proportion of cells expressing these antibodies was then compared and analyzed. Cell samples were treated with 0.3T or 0.6T magnets, while control cells were not treated with magnets. [Figure 4] Figure 4 shows that a moderate-intensity static magnetic field enhances the secretion of granzymes and cytokines from CD8+ T cells. (A) shows the secretion levels of granzymes and cytokines from mouse CD8+ T cells detected by flow cytometry. Cell samples were stimulated in vitro with anti-CD3 and anti-CD28 antibodies and treated with 0.3T or 0.6T permanent magnets, while control cells were not treated with magnets. (B)-(D) show the percentage of CD8+ T cells expressing GzmB, IFNγ, and TNFα, i.e., at 72h (B, n=10), 24h (C, n=4), and 48h (D, n=4). (E) is a comparative analysis of the transcription levels of the Gmzb, Tnfa, and Ifng genes in CD8+ T cells (n=6). The transcription levels of all target genes were standardized using the internal reference β-actin. [Figure 5]Figure 5 shows that the dummy material has no apparent effect on cytokine secretion by CD8+ T cells. (A) shows the secretion levels of granzymes and cytokines from mouse CD8+ T cells detected by flow cytometry. Cell samples were stimulated in vitro with anti-CD3 and anti-CD28 antibodies and treated with a non-magnetic metal material (dummy) or a 0.3T permanent magnet (0.3T), while control cells were not treated with a magnet. (B) is a summary of the cell percentages expressing GzmB, IFNγ, and TNFα in CD8+ T cells (n=6). [Figure 6] Figure 6 shows that a moderate-intensity static magnetic field has no apparent effect on the proliferation and apoptosis of CD8+ T cells in vitro. CD8+ T cells were stimulated with anti-CD3 and anti-CD28 antibodies for 72 hours, and the proliferation status of CFSE-expressing cells was detected by flow cytometry (A), while the apoptosis status of Annexin V and PI (propidium iodide)-indicating cells was detected (B). (C) shows the percentage of cells stained with Annexin V and PI, respectively, of CD8+ T cells. Cell samples were treated with a 0.3T magnet, while control cells were not treated with a magnet. [Figure 7] Figure 7 shows that a moderate-intensity static magnetic field promotes the expression of genes related to the mitochondrial respiratory chain. (A) is a PPI network diagram (protein-protein interaction diagram) of differentially expressed genes in CD8+ T cells treated with a 0.3T magnet and control cells that were not treated with a magnet. (B) is a heatmap of gene expression in CD8+ T cells treated with a 0.3T magnet and stimulated with a TCR (i.e., SMF), control cells that were not treated with a magnet but stimulated with a TCR, and cells that were neither treated with a magnet nor stimulated with a TCR. [Figure 8]Figure 8 shows that a moderate-intensity static magnetic field upregulates respiratory chain genes involved in mitochondrial ATP synthesis, thereby promoting the secretion of granzymes and cytokines in CD8+ T cells. (A) is a comparative analysis of transcriptional expression levels of respiratory chain genes involved in mitochondrial ATP synthesis in CD8+ T cells. Cell samples were stimulated in vitro with anti-CD3 and anti-CD28 antibodies for 72 hours and treated with a 0.3T permanent magnet, while control cells were not treated with a magnet (n=5-7). (B) shows the transcriptional expression levels before and after knockdown of the Uqcrb or Ndufs6 gene in CD8+ T cells (n=5). Transcriptional levels of all target genes were standardized using an internal reference β-actin. (C) to (E) show the secretion levels of granzymes and cytokines in gene knockdown CD8+ T cells detected by flow cytometry, and the cells were transfected with a blank (Figure C), shRNA-Uqcrb (Figure D), and shRNA-Ndufs6 (Figure E), respectively. (F) to (H) are summaries of the cell ratios expressing GzmB, IFNγ, and TNFα in gene knockdown CD8+ T cells (n=5 to 7). [Figure 9]Figure 9 shows that a moderate-intensity static magnetic field improves ATP production levels and mitochondrial oxygen consumption in CD8+ T cells. (A) shows the intracellular ATP level detected in CD8+ T cells. (B) shows the baseline OCR of mitochondria in CD8+ T cells (n=4). (C) shows the OCR for ATP synthesis in mitochondria of CD8+ T cells (baseline OCR minus OCR after oligomycin addition) (n=4). (D) is the OCR test graph of mitochondria in CD8+ T cells, with added inhibitors being oligomycin, FCCP (2,4-dinitrophenol), rotenone, and antimycin A, respectively. (E) shows the baseline ECAR of mitochondria in CD8+ T cells (n=4). (F) is the ECAR test graph of mitochondria in CD8+ T cells, with added inhibitors being glucose, oligomycin, and 2-DG (2-deoxy-D-glucose), respectively. (G) is the ATP concentration of gene knockdown CD8+ T cells (n=5). The above cell samples were stimulated in vitro for 72 hours with anti-CD3 and anti-CD28 antibodies and treated with a 0.3T permanent magnet, while control cells were not treated with a magnet. [Figure 10]Figure 10 shows that candidate magnetic receptor genes are involved in regulating the expression of Uqcrb and Ndufs6. (A) is a comparative analysis of the transcriptional expression levels of the Isca1 and Cry1 genes in CD8+ T cells (n=4-6). (B) shows the transcriptional expression levels before and after knockdown of the Isca1, Cry1, or Cry2 genes in CD8+ T cells (n=4-5). (C)-(D) show the detection of changes in the mRNA levels of Uqcrb and Ndufs6 in CD8+ T cells with Isca1 or Cry1 / Cry2 knockdown. (C) was not treated with a magnet, but (D) was treated with a 0.3T magnet (n=5). The transcriptional levels of all target genes were standardized using the internal reference β-actin. (E) to (G) show the secretion levels of granzymes and cytokines in gene-knockdown CD8+ T cells detected by flow cytometry, and the cells were transfected with a blank (Figure E), shRNA-Isca1 (Figure F), and shRNA-Cry1 / Cry2 (Figure G), respectively. (H) to (J) are summaries of the cell ratios expressing GzmB, IFNγ, and TNFα in gene-knockdown CD8+ T cells (n=5-6). (K) is the ATP concentration of gene-knockdown CD8+ T cells (n=4). [Figure 11]Figure 11 shows that a moderate-intensity static magnetic field enhances the toxicity of CTL cells. (A) indicates toxicity by detecting LDH release in CTL cells obtained from OT-I mice (n=4). (B) detects the secretion status of granzymes and cytokines from CTL cells by flow cytometry. (C) is a summary of the cell percentages expressing GzmB, IFNγ, and TNFα in CTL cells (n=4). (D) detects the in vivo killing efficiency by flow cytometry. CTL cells were obtained from OT-I genetically modified mice and treated with a 0.3T magnet, while control cells were not treated with a magnet. CTL cells were injected into C57BL / 6 receptor mice via tail vein injection, followed by injection of CFSE-labeled mouse spleen cells (a 1:1 mixture of CFSElow-labeled spleen cells incubated with OVA257-264 and CFSEhigh-labeled spleen cells not incubated with OVA257-264). Finally, the spleen of the receptor mice was removed, and CFSE expression was analyzed by flow cytometry to detect the killing efficiency. (E) is a comparative analysis of the killing efficiency in the in vivo killing experiment. [Figure 12] Figure 12 shows that treatment with a 0.3T magnetic plate had no apparent effect on tumor development and growth. PyMT mice were treated with a 0.3T magnetic plate, while control mice were treated with a blank plate without a magnet. Tumor development time (A; n=11) and tumor growth status (B; n=7) were monitored. [Figure 13]Figure 13 shows that a moderate-intensity static magnetic field promotes the antitumor response of CD8+ T cells in vivo. PyMT mice were treated with a 0.6T magnetic plate, while control mice were treated with a blank plate without a magnet. Tumor development time (A; n=30) and tumor growth status (B; n=17) were monitored. (C) shows the HE staining results of mammary gland tumor tissue sections from PyMT mice (magnification multipliers, ×40 and ×400; scale, 200 mm). (D) shows the ratio analysis of tumor-infiltrating CD4+ T cells, CD8+ T cells, and CD8+ / CD4+ T cells in PyMT mice (n=6), with cell ratio results analyzed by flow cytometry. (E) shows the ratio analysis of CD69, CD44, and CD25 expression positivity in tumor-infiltrating CD8+ T cells in PyMT mice (n=5). (F) shows the granzyme and cytokine secretion status of tumor-infiltrating CD8+ T cells in PyMT mice. (G) shows the percentage of tumor-infiltrating CD8+ T cells expressing GzmB, IFNγ, and TNFα (n=5-6). "SMF" in the figure represents a mouse treated with a magnetic field. [Figure 14] Figure 14 shows that a moderate-intensity static magnetic field does not affect the distribution of tumor-infiltrating CD8+ T cell subgroups. (A) shows the CD62L and CD44 expression status of PyMT mouse tumor-infiltrating T cells detected by flow cytometry. (B) is a summary of the cell ratios of CD44low CD62Lhigh and CD44high CD62Llow (n=6). (C) shows the ratio of PyMT mouse tumor-infiltrating Treg cells (CD4+CD25+ Foxp3+) detected by flow cytometry. (D) is a summary and analysis of the Treg cell ratios (n=5). (E) shows the ratio of PyMT mouse tumor MDSC cells (Gr1+ CD11b+) detected by flow cytometry. (F) is a summary and analysis of the MDSC cell ratios (n=5). [Figure 15] Figure 15 shows that a moderate-intensity static magnetic field has no effect on cytokine secretion by tumor-infiltrating CD4+ T cells. (A) shows the detection of cytokine secretion by PyMT mouse tumor-infiltrating CD4+ T cells by flow cytometry. (B) shows the proportion of tumor-infiltrating CD4+ T cells that showed positive cytokine secretion (n=5). [Figure 16] Figure 16 shows the use of transplantation of CTLs treated with a static magnetic field in tumor immunotherapy. Mice inoculated with melanoma were injected with PBS, control CTLs, and CTL cells treated with a static magnetic field, respectively. Tumor size (A; n=9) and survival status (B; n=9) were monitored. (C)(D) are antitumor efficacy tests of CTLs in combination with anti-PD-1 antibodies, including control CTLs + anti-PD-1, CTLs treated with a static magnetic field + anti-PD-1, and anti-PD-1 with PBS, and also compare control CTLs with magnetic field-treated CTLs (n=7). [Modes for carrying out the invention]
[0131] Specific implementation methods The inventors studied the effects of a moderate static magnetic field on the cellular behavior of immune cells using mice as a research model. The results showed that a moderate static magnetic field affects immune cells (e.g., CD8 + It can promote the secretion of granzymes and cytokines in T) and enhance the levels of ATP and mitochondrial respiration. Specifically, the inventors found that a moderate static magnetic field regulates the expression of genes in the mitochondrial respiratory chain, thereby enhancing the expression of immune cells (e.g., CD8) + We discovered that T) promotes the secretion of granzymes and cytokines, as well as ATP and mitochondrial respiration levels. When the mitochondrial respiratory chain genes Uqcrb and Ndufs6 are knocked down, magnetic field treatment affects immune cells (e.g., CD8). + This can suppress the increased secretion of granzymes and cytokines, and the increased expression of ATP in T). The inventors further discovered that Isca1 and Cry1 / Cry2, candidate magnetic receptor genes, are involved in the regulation of Uqcrb and / or Ndufs6, genes of the mitochondrial respiratory chain. By knocking down Isca1 or Cry1 / Cry2, the expression levels of Uqcrb and / or Ndufs6 can be downregulated, thereby suppressing the magnetic field-induced immune cell (e.g., CD8) +The increase in granzyme and cytokine secretion, and the increase in ATP expression of T) can be suppressed. The inventors have shown that a moderate static magnetic field in vivo can suppress immune cells (e.g., CD8) + In addition to enhancing the antitumor effect of T), we demonstrated that in vivo injection of magnetically treated CTL cells has a clear antitumor effect.
[0132] The magnetic field according to this specification may be a moderate-intensity static magnetic field (steady-state magnetic field). The magnetic field strength of the moderate static magnetic field may be 1mT to 1.0T, 0.05 to 0.9T, 0.1 to 0.8T, 0.2 to 0.7T, 0.3 to 0.6T, or 0.4 to 0.5T, for example, 0.3T and 0.6T, preferably 0.3T. The magnetic field may be provided by a permanent magnet or an electromagnet. In the in vitro experiment according to this specification, a 0.3T permanent magnet is shown in Figure 1A, and a 0.6T permanent magnet is shown in Figure 1B. Normally, the surface magnetic field strength of a permanent magnet weakens as the measurement distance increases, but it is about 5mT per 1mm. One embodiment of the present invention provides a magnetic plate for use in in vivo experiments on mice, which is a resin fiber plate on which magnets are provided, and which has 0.3T or 0.6T button magnets provided or embedded in it. Exemplary, each button magnet has a diameter of 1 cm, and the distance between adjacent embedded magnets is 2.5 cm. As the detection distance increases, the surface magnetic field strength of the button magnets weakens, but remains at 50 mT per mm. Another embodiment of the present invention provides a mouse cage including the magnetic plate. The size of the magnetic plate is determined by the size of the mouse cage. When in use, the magnetic plate may be placed at the bottom of the mouse cage (as shown in Figure 1C). In the embodiments, when placing permanent magnets or magnetic plates, the north pole faces upward and the south pole faces downward. A method for manufacturing the above device includes installing the main body on which the magnets according to this specification are provided in the ceiling, bottom, side, center, preferably the bottom, of a mammal cage.
[0133] The inventors have discovered that treating cells in a moderate static magnetic field can induce upregulation of the expression or activity of Uqcrb and / or Ndufs6, genes related to the mitochondrial respiratory chain of cells. In one or more embodiments, the expression or activity of Uqcrb is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, and at least 90%. In one or more embodiments, the expression or activity of Ndufs6 is upregulated by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, and at least 90%. The treatment involves leaving the cells in the magnetic field for at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, or at least 108 hours. The inventors further discovered that the upregulation of the expression or activity of Uqcrb and / or Ndufs6, genes related to the mitochondrial respiratory chain, is regulated by Isca1, Cry1 and / or Cry2, genes related to magnetic receptors. This enhances cellular respiration and improves ATP levels. Therefore, treating killer T cells with a moderate static magnetic field can improve the level of mitochondrial respiration, supplying energy to killer T cells and improving killing efficiency. The inventors also further discovered that the magnetic field described herein enhances the expression or secretion of perforin, granzyme, and / or cytokines in T cells by upregulating the expression or activity of genes related to the mitochondrial respiratory chain (e.g., Uqcrb and / or Ndufs6), thereby enhancing the cytotoxic activity of T cells. For this reason, treatment of T cells with a moderate static magnetic field can be used to promote the expression or secretion of perforin, granzyme, and / or cytokines in cells and to improve the cytotoxic activity of cells. Furthermore, treating bioreactor cells in a moderate static magnetic field can improve the level of mitochondrial respiration in the bioreactor cells, thereby increasing the efficiency and yield of the reaction.
[0134] The cells according to the present invention may be any cells that benefit from enhanced respiratory levels, for example, bioreactor cells or immune cells. Immune cells include lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells. Where referring to immune cells, “activation” as used herein means enhancing the toxic activity or toxicity of the immune cells, so “activated immune cells” or “activated T cells” are immune cells with enhanced toxic activity. In one or more embodiments, the immune cells are T cells. The T cells according to the present invention may be any type of T cell, including helper T cells, suppressor T cells, effector T cells, cytotoxic T cells, naive or natural T cells, and memory T cells. Exemplarily, the T cells are CD8 + T cells or CD4 +These are T cells. Furthermore, these T cells may be genetically modified cells used for therapeutic purposes, such as chimeric antigen receptor T cells (CAR-T). Therefore, the method of treating cells with a magnetic field according to the present invention can be used in combination with chimeric antigen receptor technology. To upregulate the expression or activity of Uqcrb and / or Ndufs6, which are genes related to the respiratory chain of T cells, T cells may be treated with a magnetic field, or the expression or activity of Uqcrb and / or Ndufs6, which are genes related to the respiratory chain, may be improved by methods commonly used in this field. Regarding the upregulation of the above genes, this upregulation may be achieved by overexpression in the host or host cells. Therefore, the reagent for upregulating the expression of the above genes is a gene expression vector. For example, an expression vector suitable for the expression of Isca1, Cry1 / Cry2, Uqcrb, and / or Ndufs6 in host cells may be constructed using commonly used techniques in this field, introduced into host cells using commonly used methods, and the expression of the molecules in the host cells using the expression vector may be used to achieve upregulation of the expression of the molecules. The expression vector contains other components necessary for the expression of these genes in host cells, and these components are well known to those skilled in the art. In certain embodiments, the expression of these molecules is improved by regulating the expression of the upstream genes of these molecules. For example, in certain embodiments, the level of gene expression in the cells of a subject is improved by administering a viral vector (e.g., a lentiviral vector) expressing Isca1, Cry1 / Cry2, Uqcrb, and / or Ndufs6 to the subject. According to the gene or amino acid sequences disclosed in NCBI, those skilled in the art can obtain an expression vector containing the coding sequences of Isca1, Cry1 / Cry2, Uqcrb, and / or Ndufs6. Magnetic field-treated T cells, or T cells overexpressing the above-mentioned genes, exhibit increased expression or secretion of perforin, granzyme, and / or cytokines, improved ATP levels, and enhanced cytotoxicity.
[0135] The cytokines relating to this specification include one or more selected from the following: interleukins (IL), colony-stimulating factors (CSF), interferons (IFN), tumor necrosis factor (TNF), transforming growth factor β family (TGF-β), growth factors (GF), and chemokine families. Specifically, the cytokines include the following: IL-1 to IL-38, G-CSF, M-CSF, GM-CSF, Multi-CSF (IL-3), SCF, EPO, IFN-α, IFN-β, IFN-γ, TNF-α, TNF-β, TGF-β1, TGF-β2, TGF-β3, TGFβ 1β2, bone morphogenetic protein (BMP), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), insulin-like growth factor I (IGF-1), IGF-II, leukemia inhibitory factor (LIF), nerve growth factor (NGF), oncos It contains one or more proteins selected from Tatin M (OSM), platelet-derived endothelial growth factor (PDECGF), transforming growth factor α (TGF-α), vascular endothelial growth factor (VEGF), melanoma cell growth stimulating activity (GRO / MGSA), platelet factor 4 (PF-4), platelet basic protein, inflammatory protein 10 (IP-10), ENA-78, macrophage inflammatory protein 1α (MIP-1α), MIP-1β, RANTES, monocyte chemotactic protein 1 (MCP-1 / MCAF), MCP-2, MCP-3, I-309, and lymphocyte chemotactic protein.
[0136] In this specification, reagents that upregulate magnetically treated T cells and genes related to the chondrian respiratory chain (e.g., Uqcrb and / or Ndufs6) may be used to treat diseases, particularly those targeted by CD8+ T cells. Therefore, the diseases described herein include various cancers related to CD8+ T cells, including solid tumors and hematological malignancies such as adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, bile duct cancer, gallbladder cancer, esophageal cancer, pancreatic cancer, and prostate cancer, as well as leukemias and lymphomas such as B-cell lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myeloid leukemia. Preferably, the cancer is melanoma and / or breast cancer.
[0137] Another aspect of the present invention provides a pharmaceutical composition comprising T cells as described herein and a pharmaceutically acceptable additive. In this specification, “pharmaceutically acceptable additive” means a vector, diluent, and / or excipient that is pharmacologically and / or physiologically compatible with the subject or active ingredient, and includes, but is not limited to, pH adjusters, surfactants, carbohydrates, adjuvants, antioxidants, chelating agents, ionic strength enhancers, preservatives, carriers, flow enhancers, sweeteners, dyes / colorants, flavoring agents, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers. In some embodiments, the pharmaceutically acceptable additive may include one or more inactive ingredients, including, but is not limited to, stabilizers, preservatives, additives, adjuvants, sprays, compressed air or other suitable gases, or suitable inactive ingredients used in combination with other pharmaceutically active compounds. Specifically, a suitable pharmaceutically acceptable additive may be an additive commonly used in the art for the administration of plant extracts or nucleic acids.
[0138] Typically, a pharmaceutical composition contains a therapeutically effective dose of magnetic field-treated T cells, T cells with upregulation of mitochondrial respiratory chain genes (e.g., Uqcrb and / or Ndufs6), or a reagent that upregulates mitochondrial respiratory chain genes (e.g., Uqcrb and / or Ndufs6). The therapeutically effective dose is the dose that can achieve treatment, prevention, reduction, and / or mitigation of a disease or condition in a subject. The therapeutically effective dose is determined by factors such as the patient's age, sex, the condition and its severity, and other health conditions. The therapeutically effective dose may be administered as a single dose or as multiple doses depending on an effective treatment plan. In this specification, a subject or patient is typically a mammal, and in particular, a human.
[0139] The T cells according to the present invention may be administered alone or as part of a pharmaceutical composition. The cells or pharmaceutical composition according to the present invention may be administered in a manner suitable for the treatment (or prevention) of a disease. The amount and frequency of administration will be determined by various factors, such as the patient's condition, the type and severity of the patient's disease. Administration of the composition may be carried out by any convenient method, including injection, infusion, implantation, or transplantation. The compositions according to this specification may be administered to the patient by subcutaneous, intradermal, intratumoral, intranodular, intraspinal, intramuscular, intravenous, or intraperitoneal injection. In one embodiment, the T cell composition according to the present invention may be administered to the patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition according to the present invention is preferably administered by intravenous injection. The T cell composition may be injected directly into a tumor, lymph node, or infected area.
[0140] The T cells or reagents relating to this specification may be used in combination with other reagents that enhance cellular mitochondrial respiration, enhance cellular ATP levels, promote the expression or secretion of perforins, granzymes, and / or cytokines in cells, enhance cellular cytotoxicity, or treat cancer, such as anti-PD-1 antibodies. Those skilled in the art may determine the dosage of other reagents. The T cells or reagents relating to this specification may be used in combination with other therapies known in the art, including, but not limited to, chemotherapy, radiotherapy, and immunosuppressants. For example, they may be used in combination with radiotherapy or chemotherapeutic agents for treating tumor antigen-mediated diseases known in the art.
[0141] The present invention further includes a method for improving cellular ATP levels, promoting cellular mitochondrial respiration, promoting the expression and / or secretion of cellular perforins, granzymes and / or cytokines, and enhancing T cell toxicity, comprising one or more steps selected from the following: (1) treating cells with a magnetic field provided herein or generated by an instrument provided herein; and (2) upregulating the expression and / or activity of genes relating to the cellular mitochondrial respiratory chain (e.g., Uqcrb and / or Ndufs6).
[0142] Another aspect of the present invention provides a method for improving the ATP levels of a subject's cells, promoting mitochondrial respiration of the subject's cells, promoting the expression and / or secretion of perforins, granzymes, and / or cytokines of the subject's cells, enhancing the toxicity of the subject's T cells, or treating cancer in the subject. The method comprises administering a therapeutically effective amount of T cells, reagents, or pharmaceutical compositions according to this specification to the subject in question. The method also comprises treating the subject with a magnetic field according to this specification or a magnetic field generated by an instrument according to this specification.
[0143] In this specification, "antitumor effect" refers to a biological effect that manifests as a reduction in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in expected lifespan, or an improvement in various physiological symptoms related to cancer.
[0144] This invention involves stimulating CD8+ T cells in vitro with anti-CD3 / anti-CD28 antibodies for 96 hours, and then treating the CD8+ T cells with a 0.3T magnet to obtain CTL effector cells. These CTL effector cells exhibit clear antitumor effects both in vivo and in vitro. In this invention, a 0.3T to 0.6T static magnetic field and TCR are used to stimulate CD8+ T cells. + CD8 obtained by stimulating T cells for 72 hours + T cells exhibit clearly increased secretion of granzymes and cytokines, and enhanced antitumor capacity. This invention clearly inhibits tumor growth in mice by treating them with a magnetic field with an average surface magnetic field strength of 0.31T, generated by a 0.6T magnetic plate.
[0145] The present invention has been described in more detail with reference to the experimental examples described below. These examples are presented for illustrative purposes only and are not limiting unless otherwise noted. Therefore, the present invention is not limited to the examples described below and includes any and all variations that become apparent from the suggestions provided herein. The methods and reagents used in the examples are common methods and reagents in the art unless otherwise noted. [Examples]
[0146] 1. Experimental materials and methods
[0147] 1. Mouse C57BL / 6 wild-type mice were purchased from SLAC, while OT-I TCR recombinant mice and PyMT mice were obtained from the Jackson Laboratory in the United States. All experimental mice were housed in an SPF-grade breeding facility at the Institute of Biochemistry and Cell Biology, Shanghai Institute of Life Sciences, Chinese Academy of Sciences. All animal experiments were authorized by the Animal Management Committee of the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.
[0148] 2. Cell line B16-F10-OVA and EL-4 cells were provided by researcher XU, Chenqi of the Institute of Biochemistry and Cell Biology, Shanghai Institute of Biosciences, Chinese Academy of Sciences. B16-F10 cells were cultured in DMED medium [10% serum, l-glutamine (2mM), penicillin (100U / ml), streptomycin (10U / ml)]. EL-4 cells were cultured in RPMI 1640 medium [10% serum, l-glutamine (2mM), penicillin (100U / ml), streptomycin (10U / ml)].
[0149] 3. Permanent magnets and magnetic plates The magnets with surface magnetic field strengths of 0.3T and 0.6T, respectively, were purchased from Hangzhou Yongzi Group. The 0.3T permanent magnet measures 10cm long x 10cm wide x 5cm high (Figure 1A), and the 0.6T permanent magnet measures 10cm long x 10cm wide x 10cm high (Figure 1B). As the measurement distance increases, the surface magnetic field strength of the permanent magnets weakens, by approximately 5mT per millimeter. The magnetic plates used in the in vivo experiments with mice were designed and provided by Zhejiang Heya Health Technology Co., Ltd. Button magnets of 0.3T and 0.6T are embedded in the resin fiber plates. Each button magnet has a diameter of 1cm, and the distance between adjacent embedded magnets is 2.5cm. As the detection distance increases, the surface magnetic field strength of the button magnets weakens, by 50mT per millimeter. The size of the magnetic plate is determined by the size of the mouse cage, and is 32 cm long x 12.5 cm wide x 1.5 cm high. When in use, the magnetic plate is placed at the bottom of the mouse cage (Figure 1C). In this study, when all permanent magnets and magnetic plates are placed, the north pole of the magnet is facing upwards and the south pole is facing downwards.
[0150] 4. Antibodies The following antibodies, namely anti-CD4 (RM4-5), anti-CD8a (53-6.7), anti-CD44 (IM-7), anti-CD62L (MEL-14), anti-CD69 (H1.2F3), anti-Ly6G (Gr1) (RB6-8C5), anti-CD11b (M1 / 70), anti-TNFα (MP6-XT22), anti-IL-2 (JES6-5H4), and anti-IL-4, are all mouse antibodies purchased from BD. Anti-mFoxp3 (FJK-16s), anti-granzyme B (NGZB), and anti-IL-17 (eBio17B7) were purchased from eBioscience. Anti-CD25 (PC61), anti-IFNγ (XMG1.2), and FITC Annexin V were purchased from Biolegend. The anti-CD3(145-2C11) and anti-CD28(37.51) antibodies used in in vitro T cell stimulation experiments were purchased from BD.
[0151] 5. Isolation and staining of T cells CD4 + T cells or CD8 + All T cells were obtained from the spleen of C57BL / 6 mice, and CD4 + T cells or CD8 + After purification using the T cell negative selection reagent kit (Stem Cell), 1 μg ml -1 Cells were cultured and stimulated in 48-well plates plated with anti-CD3 and anti-CD28 antibodies. On day 1 of stimulation, cells were 0.7 × 10⁶ per well. 6 Cells were inoculated at the specified density and passaged at a 1:2 ratio for 48 hours after stimulation. Cells from the magnet detection group were cultured in 48-well plates under a permanent magnet, while control cells were cultured normally without magnet treatment. For the isolation of tumor-infiltrating lymphocytes, mouse tumors were removed, lysed, digested with collagenase IV, and then tumor-infiltrating lymphocytes were obtained by 40-80% (v / v) Percoll (GE) gradient centrifugation. CD4 + T cells or CD8 + When detecting cytokine secretion from T cells, purified cells are used in PMA (50 ng ml). -1 ), ionomycin (1 μM) and 5 μg ml -1Cells were repeatedly stimulated with brefeldin A for 4 hours before staining. For intracellular staining, cells were fixed for 10 minutes using 1 ml of PBS solution containing 2% formaldehyde at room temperature, and then electroporated for 5 minutes with the intracellularly stained buffer before staining. Samples of T cells not stimulated by TCR or stained with allogeneic antibodies were used as negative controls. Cell fluorescence was detected by FACSCalibur (BD Biosciences) flow cytometry, and the obtained data were analyzed with FlowJo software.
[0152] 6. CD8 + In vitro detection of T cell toxicity CD8 + For in vitro T cell killing detection, refer to the experimental method of the Qiu Xiaoyan research team (2014). The spleen of OT-I genetically modified mice was taken and purified using a negative reagent kit to obtain CD8 + After obtaining T cells, they were stimulated in vitro with anti-CD3 / anti-CD28 antibodies for 96 hours and treated with a 0.3T magnet as CTL effector cells, whereas the control group was not treated with a magnet. EL-4 cells were used as target cells, and 10nM OVA was administered. 257-264 After incubation at 37°C for 30 minutes, toxicity detection was performed. CTL and EL-4 cells were washed three times with PBS, then resuspended in toxicity buffer (without phenol red RPMI 1640, but containing 2% serum), and the two cell types were diluted in concentration gradients of 1.25:1, 2.5:1, and 5:1. The two cell types were incubated together at 37°C for 4 hours, and toxicity efficiency was indicated by detecting lactate dehydrogenase (LDH) levels using the CytoTox 96 toxicity reagent kit (Promega).
[0153] 7. CD8 + In vivo detection of T cell toxicity CD8 + For in vitro T cell killing detection, refer to the experimental method of the Wang Hongyan research team (2015). CTL cells were obtained from OT-I genetically modified mice, as in the above experiment, and treated with a 0.3T magnet, but control cells were not treated with a magnet. CTL (3 × 10⁻¹⁰)6 ) was injected into C57BL / 6 receptor mice via tail vein injection, and CFSE-labeled mouse spleen cells (3 × 10) were injected via tail vein injection 4 hours later. 6 )[10nM OVA 257-264 CFSE incubated with low (1 μM)-labeled spleen cells and OVA 257-264 CFSE not incubated high A 1:1 mixture of (10 μM)-labeled spleen cells was injected. After 6 hours, the spleen of receptor mice was removed, and CFSE expression was analyzed by flow cytometry to detect the killing efficiency. Killing efficiency = [1 - (% CFSE] low ) / (% CFSE high )] × 100%.
[0154] 8. Transplantation of CTLs treated with a static magnetic field into a melanoma mouse model. The T cell transplantation experiment follows the experimental method of the Xu Chenqi research team (2016). B16F10-OVA cells were inoculated subcutaneously in the groin of 8-10 week old C57BL / 6 mice, resulting in 2 × 10⁶ cells per mouse. 5 Cells were injected. Twelve days after tumor inoculation, to eliminate individual differences, mice with excessively large or small tumors were removed, and mice with the same tumor size were divided into three groups of approximately 7-10 mice each. CTLs (1.5 × 10) were treated with a 0.3T magnet via tail vein injection. 6 ), control CTL (1.5 × 10 6) and PBS were injected, respectively. Refer to the description in "6" for the production of CTLs. To detect the combined use of CTLs and anti-PD-1 antibodies, the tumor growth and survival status of the following three groups of mice were compared: (1) mice injected with anti-PD-1 antibody alone, (2) mice injected with anti-PD-1 antibody and CTLs treated with a 0.3T magnet, and (3) mice injected with anti-PD-1 antibody and control CTLs. Anti-PD-1 antibody was injected intraperitoneally every three days (RMP1-14, Bio X Cell, 200 μg per mouse), for a total of three consecutive injections. From day 12 after inoculation of B16 cells into the mice, tumor size was measured every two days, and the survival status of the mice was recorded daily. Tumor size is expressed as length × width. Considering the ethics and welfare of the mice, mice with a tumor diameter exceeding 20 mm were judged to have died.
[0155] 9. Tumor growth and histochemical detection in PyMT mammary cancer mice PyMT genetically modified mice (FYB background) were treated with a 0.3T or 0.6T magnetic plate on day 21, while control mice were treated with a resin fiber plate without a magnet. Tumor progression in the mice was observed every two days, and tumor size was measured weekly using calipers. Tumor size was A×B 2 The values are expressed as / 2, where "A" is the vertical length (mm) and "B" is the horizontal length (mm). When the tumor grew to 10-15 mm, the tumor tissue block was fixed overnight with 4% formaldehyde, then embedded in paraffin, cut into sections, and then stained with HE. The HE staining results were detected using an Olympus BX51 microscope, and photographs were taken with a DP71 camera (Olympus).
[0156] 10. RNA sequencing and bioinformatics analysis The extracted RNA was analyzed for concentration, purity, and integrity using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, US). An RNA library was established using a SMARTer Stranded TotalRNA-Seq Kit-Pico Input Mammalian (Illumina), and sequencing was performed on the library using an Illumina HiSeq X-Ten sequencer. After sequencing, mass filtering was performed using Trimmomatic (version 0.36) to remove sequencing adapters, and RNA-seq reads were compared with mouse gene sets using HISAT2. As a result, only the reads matched to the sites of single gene sets, and gene expression was calculated using StringTie. All gene expressions were normalized to FPKM, and the fold change and p-value of gene expression were predicted using Ballgown. Only genes with a fold change of ≥2 and a p-value of ≤0.05 were recognized as differentially expressed genes. The GO DAVID (modified Fisher exact p-value < 0.05) was calculated. All sequencing results for this study are available in the NCBI's Gene Expression Omnibus (GEO), with access number GSE113858 (URL: https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE113858, token: orqlmoqkfbwpxgp).
[0157] 11. RNA extraction, reverse transcription, and real-time quantitative PCR Total RNA from cell samples was extracted using TRIzol (Invitrogen), reverse transcribed using the SuperScript III First-Strand kit (Invitrogen), and then subjected to real-time quantitative PCR (RT-PCR). The primers for RT-PCR are as follows: Actb(Forward, GACGGCCAGGTCATCACTATTG(Sequence ID: 1); Reverse, AGGAAGGCTGGAAAAGAGCC(Sequence ID: 2)), Ndufc1(forward, CACGGTCGAAGTTCTATGTC(sequence code:3); reverse, TTGTGTGTTTGGATGAGATAAATC(sequence code:4)), Atp6v0b(forward, AGTTGCTCTACCTCGGGATCT(sequence code:5); reverse, ATGCCACATCAAAGCGAAAGC(sequence code:6)), Idh3b(Forward, AGGCACAAGATGTGAGGGTG(Sequence ID:7); Reverse, CAGCAGCCTTGAACACTTCC(Sequence ID:8)), Ndufs6(Forward, GGGGAAAAGATCACGCATACC(Sequence ID:9); Reverse, CAAAACGAACCCTCCTGTAGTC(Sequence ID:10)), mt-Nd4(forward, GAGTTCACCTATGACTACCA(sequence code:11); reverse, CTAGAATAATGGAGATGCGAAT(sequence code:12)), Uqcrc2(forward, AAAGTTGCCCCGAAGGTTAAA(sequence number:13); reverse, GAGCATAGTTTTCCAGAGAAGCA(sequence number:14)), Uqcrb(forward, GGCCGATCTGCTGTTTCAG(sequence number:15); reverse, CATCTCGCATTAACCCCAGTT(sequence number:16)), Ndufa13(forward, ACGGCCCCATCGACTACAA(sequence number:17); reverse, CCTGGTTCCACCTCATCATTCT(sequence number:18)), Atp5k(forward, GTTCAGGTCTCTCCACTCATCA(sequence code:19); reverse, CGGGGTTTTAGGTAACTGTAGC(sequence code:20)), Uqcrfs1(Forward, GAGCCACCTGTTCTGGATGTG(Sequence ID:21); Reverse, GCACGACGATAGTCAGAGAAGTC(Sequence ID:22)), Cox7b(forward, TTGCCCTTAGCCAAAAACGC(sequence number:23); reverse, TCATGGAAACTAGGTGCCCTC(sequence number:24)), Ndufa10(forward, ACCTTTCACTACCTGCGGATG(sequence code:25); reverse, GTACCCAGGGGCATACTTGC(sequence code:26)), mt-Nd5(forward, CCAACAACAACGACAATCTA(sequence code:27); reverse, TTGAGTGTAGTAGTGCTGAA(sequence code:28)), mt-Nd3(forward, CTCTTCTACTTCCACTACCAT(sequence number:29); reverse, GCCTAGAGATAGAATTGTGACTA(sequence number:30)), mt-Nd4l(forward, CTTCTTCAACCTCACCATAG(sequence code:31); reverse, CTTCCAGGCATAGTAATGTG(sequence code:32)), mt-Atp8(Forward, GGTAATGAATGAGGCAAATAGA(Sequence ID:33); Reverse, GTAATGAATGAGGCAAATAGATT(Sequence ID:34)), Gzmb(forward, TCTCGACCCTACATGGCCTTA(sequence code:35); reverse, TCCTGTTCTTTGATGTTGTGGG(sequence code:36)), Tnf(forward, CTGGATGTCAATCAACAATGGGA(sequence number:37); reverse, ACTAGGGTGTGAGTGTTTTCTGT(sequence number:38)), Ifng(Forward, TCCTCGCCAGACTCGTTTTC(Sequence ID:39); Reverse, GTCTTGGGTCATTGCTGGAAG(Sequence ID:40)), Isca1(forward, CTTAAAGACAAACCTGAGCAT(sequence number:41); reverse, TTCCACATAGTCCATCTCTG(sequence number:42)), Cry1(Forward, TTGAAGAGTTACTGCTTGATG(Sequence ID:43); Reverse, ACGCCTAATATAGTCTCCATT(Sequence ID:44)), This is shown in Cry2(forward, TGTGGGCATCAACCGATGG(sequence code:45); reverse, CGGACTACAAACAGACGCGAA(sequence code:46)).
[0158] 12. Gene knockdown experiment of primary T cells The constructed MLP shRNA plasmid was transfected into Plat-E cells using calcium phosphate transfection, and the viral supernatant was collected after 48 hours. The virus solution and RPMI-1640 complete culture medium were mixed in a 1:1 ratio, and T cells stimulated with anti-CD3 (1 μg / ml) and anti-CD28 (1 μg / ml) for 24 hours were infected. Ploybrene was added to a final concentration of 4 μg / ml. The cells were centrifuged at 30°C and 1100 g for 2 hours using a horizontal centrifuge. After that, they were cultured in a 37°C incubator for 10 hours, and then the virus solution was replaced with fresh RPMI-1640 complete culture medium. The cells were further stimulated with anti-CD3 (1 μg / ml) and anti-CD28 (1 μg / ml) for 72 hours and treated with a 0.3T magnet, while the control cells were not treated with a magnet. GFP-positive cells were isolated and sorted by flow cytometry, RNA was extracted, reverse transcribed, and then the gene knockdown efficiency was measured by RT-PCR. The sequences of the constructed shRNA primers are as follows: Uqcrb-target shRNA:5'-TGCTGTTGACAGTGAGCGCAAGAAGTGATCTTTTAGTTAATAGTGAAGCCACAGATGTATTAACTAAAAGATCACTTCTTTTGCCTACTGCCTCGGA-3'. (SEQ ID NO: 47), Ndufs6-target shRNA:5'-TGCTGTTGACAGTGAGCGCGCCATTGATTTGATAGCACAATAGTGAAGCCACAGATGTATTGTGCTATCAAATCAATGGCATGCCTACTGCCTCGGA-3'. (SEQ ID NO: 48), Isca1-target shRNA:5'-TGCTGTTGACAGTGAGCGATGCCTCGTGGTGAAAATAAATAGTGAAGCCACAGATGTATTTATTTTCACCCACGAGGCAGTGCCTACTGCCTCGGA-3'. (SEQ ID NO: 49), Cry1-target shRNA: 5'-TGCTGTTGACAGTGAGCGCCCGCCTCTTTATTTACATCTATAGTGAAGCCACAGATGTATAGATGTAAATAAAGAGGCGGATGCCTACTGCCTCGGA-3'.(Sequence ID: 50), Cry2-target shRNA: This is shown in 5'-TGCTGTTGACAGTGAGCGCCAGTTTGTTTGTGAATATTTATAGTGAAGCCACAGATGTATAAATATTCACAAACAAACTGTTGCCTACTGCCTCGGA-3' (Sequence ID: 51).
[0159] 13. Measurement of cellular ATP concentration From the detected sample 10 5 CD8 + Each T cell was isolated, and the ATP concentration was detected using an ATP detection reagent kit (S0027, Beyotime) in accordance with the product's instruction manual. The chemiluminescence value of the sample was then detected using a GloMax® 20 / 20 chemiluminescence detector.
[0160] 14. Detection of mitochondrial respiration CD8 +T cell OCRs (oxygen consumption rate) and ECARs (extracellular acidification rate) were detected using the Seahorse MitoStress Test Kit. The following inhibitors were added to the samples for measurement: 1 μM oligomycin (inhibits ATP synthesis), 1 μM FCCP (mitochondrial oxidative phosphorylation uncoupling agent), 1 μM rotenone and antimycin A (respiratory chain inhibitors), 10 mM glucose (induces glycolysis), and 100 mM 2-Deoxy-D-glucose (2-DG, glycolysis inhibitor). All detected samples were analyzed using the Seahorse series cell energy metabolism detector (XF-24 Extracellular Flux Analyzer, Seahorse Bioscience).
[0161] 15. Statistical analysis of organisms Statistical analysis was performed using GraphPad Prism 6 software. All statistical data are expressed as mean ± standard error (mean ± sem). Tumor-free curves were analyzed using time series detection. Comparison of the two independent experimental groups was performed using a two-sided t-test, and a p-value less than 0.05 was considered statistically significant. *P<0.05, **P<0.001, ***P<0.0001, ****P<0.0001.
[0162] 2. Experimental Results
[0163] 1. A moderate static magnetic field is CD8 + Promotes the secretion of granzymes and cytokines from T cells. 1.1. To evaluate the effects of moderate static magnetic fields on T cell function, we first stimulated T cells in vitro using the TCR and compared and analyzed the activation status of T cells under different treatment conditions such as stimulation time and magnetic field strength. CD4 + T cells and CD8 +T cells were purified and cultured in 48-well plates. The magnetic field-treated group had their 48-well plates placed on permanent magnets with magnetic field strengths of 0.3T or 0.6T (Figure 1, A, B), while the control group was not treated with magnets. The expression levels of active molecules such as CD69, CD44, and CD25 were detected after 24h, 48h, and 72h stimulation with the TCR. The results showed that CD4 + Regarding T cells, when treated with a 0.3T magnetic field, CD44 expression in the cells was slightly improved compared to the control group at all time points. However, when treated with a 0.6T magnetic field, there was no significant difference, and no significant differences were observed in CD69 and CD25. + Regarding T cells, when treated with a 0.3T magnetic field, CD25 expression in the cells improved compared to the control group at 48h and 72h. However, when treated with a 0.6T magnetic field, there was no significant difference, and no significant differences were observed in CD69 and CD44 (Figure 2).
[0164] 1.2. Next, the CD4 of a moderate magnetic field + T cells and CD8 + The effect on cytokine secretion by T cells was detected. The results showed that at all detection points, a moderate magnetic field was present in CD4 + There is no apparent effect on cytokine secretion from T cells (Figure 3).
[0165] 1.3. Interestingly, when treated with 0.3T and 0.6T magnetic fields under the assumption of 72 hours of stimulation with TCR, CD8 + The secretion of granzymes and IFNγ and TNFα cytokines from T cells was clearly enhanced (Figure 4, A, B). However, there was no clear difference when treated with 0.3T and 0.6T magnetic fields under the assumption of 24h and 48h stimulation in the TCR (Figure 4, C, D). To eliminate the influence of non-magnetic impurities in the magnet, CD8 was analyzed in three groups: those treated with a non-magnetic metal material (same size as the 0.3T magnet) (Figure 5, "dummy" group), those not treated with a magnet (Figure 5, "control" group), and those treated with a 0.3T magnet (Figure 5, "0.3T" group). + The effects on cytokine secretion by T cells were compared. The results showed that CD8 in the "control" group and the "dummy" group were different. +While there were no clear differences in granzyme and cytokine secretion from T cells, those treated with a 0.3T magnet showed clear improvement compared to the "control" or "dummy" groups (Figure 5, A, B). This indicates that those treated with a 0.3T magnet showed improved CD8 secretion. + It can promote the secretion of granzymes and cytokines from T cells, but non-magnetic impurities do not have this biological effect. Subsequently, the magnetic field, CD8 + The effects of granzyme and cytokine gene transcription levels on T cells were detected. The results showed that CD8 cells treated with a 0.3T magnetic field... + While the expression of Gmzb and Ifnr genes in T was clearly improved, Tnf showed no significant change (Figure 4, E).
[0166] 1.4. Next, the static magnetic field is CD8 + We detected whether it affected T cell proliferation and survival. CFSE labeling experiments detected CD8 in the magnetic field. + The results of detecting the effect on T cell proliferation showed that treatment with a 0.3T magnetic field had no effect on cell proliferation (Figure 6, A). Furthermore, the magnetic field treatment was effective for CD8 + It has no effect on T cell apoptosis and death (Figure 6, B, C). According to the above results, a moderate static magnetic field is CD8 + It promotes the secretion of granzymes and cytokines from T cells, but CD8 + It does not affect T cell proliferation and survival, CD4 + It does not affect the secretion of cytokines from T cells.
[0167] 2. A moderate static magnetic field upregulates the expression of genes in the respiratory chain. Static magnetic field is CD8 + To study the molecular mechanisms that promote the secretion of granzymes and cytokines from T cells, CD8 cells were treated with a 0.3T magnetic field. + T cells (stimulated via TCR for 72 hours), CD8 cells not treated with a magnetic field. + T cells (stimulated via TCR for 72 hours) and unstimulated CD8 cells +Comparative analysis of transcriptomes based on RNA-Seq was performed for T cells (GEO: GSE113858). By gene set enrichment analysis, the genes with significant differential expression (fold change ≥ 2) were divided into two gene clusters. Gene cluster 1 contains 198 genes and is mainly involved in mRNA metabolism and RNA processing (Figure 7, A). Gene cluster 2 contains 24 genes and is mainly involved in ATP metabolism and mitochondrial respiratory chain transmission (Figure 7, A, B). Genes in the mitochondrial respiratory transmission chain contain a large number of genes of iron-sulfur proteins. Furthermore, according to existing research, genes of iron-sulfur proteins are likely to be genes of magnetoreceptor proteins. Therefore, gene cluster 2 was focused on. Interestingly, compared with cells not treated with magnetic fields, in cells treated with magnetic fields, most of the genes in gene cluster 2 were clearly upregulated (Figure 7, B).
[0168] Thus, it is speculated that magnetic fields promote the secretion of granzyme and cytokines of CD8 + T cells by upregulating the expression of genes related to the mitochondrial respiratory chain. Subsequently, the expression of 16 genes related to the upregulated respiratory chain was further verified by Real-Time PCR technology. According to the results, compared with control cells, in cells treated with magnetic fields, Uqcrb and / or Ndufs6 among these genes were clearly upregulated (Figure 8, A). Regarding whether the upregulation of Uqcrb or Ndufs6 is essential for the secretion of granzyme and cytokines of CD8 + T cells, a knockdown system was constructed using a shRNA vector expression system. First, the knockout efficiency of the genes of Uqcrb and Ndufs6 in primary CD8 + T cells was examined. As a result, it was found that the expression of the genes of Uqcrb or Ndufs6 was clearly downregulated after introduction of shRNA (Figure 8, B). When Uqcrb or Ndufs6 was effectively downregulated, CD8 +The improvement of granzyme and cytokine in T cells was significantly suppressed, especially the upregulation of IFNγ changed to downregulation (Figure 8, C-H). According to these data, by upregulating the expression of Uqcrb and Ndufs6 genes, which are genes related to the mitochondrial respiratory chain, by static magnetic fields, CD8 + T cells are likely to promote the secretion of granzyme and cytokine.
[0169] 3. Medium static magnetic fields enhance ATP production and mitochondrial respiratory capacity According to the above research results, on the premise of stimulating with TCR for 72h, a 0.3T medium static magnetic field upregulates the ATP metabolism of CD8 + T cells and the expression of genes related to the mitochondrial respiratory chain. This suggests that static magnetic fields may affect the ATP level and mitochondrial respiratory capacity of CD8 + T cells. Subsequently, the effect of static magnetic fields on the ATP level of CD8 + T cells was detected. According to the results, the ATP concentration of CD8 + T cells treated with a 0.3T static magnetic field was significantly higher than that of control cells (Figure 9, A). The oxygen consumption of mitochondria in CD8 + T cells was detected to indicate mitochondrial respiratory capacity. According to the results, the OCR value (oxygen consumption rate) of CD8 + T cells treated with static magnetic fields was significantly higher than that of control cells (Figure 9, B, D). In addition, the ATP production rate reflected by OCR in CD8 + T cells treated with static magnetic fields was significantly higher than that of control cells (Figure 9, C, D). This is consistent with the result of the improvement of ATP level. Also, the effect of static magnetic fields on the extracellular acidification rate (ECAR) of mitochondria in CD8 + T cells was detected. As a result, the ECAR value of CD8 + T cells treated with static magnetic fields was lower than that of control cells (Figure 9, E, F).
[0170] According to the research results above, a static magnetic field upregulates the expression of Uqcrb and / or Ndufs6, genes related to the mitochondrial respiratory chain, thereby promoting CD8 + While T cells promote the secretion of granzymes and cytokines, it is unclear whether the expression of these two genes is involved in regulating ATP levels. Next, knockdown experiments of these two genes were performed, and the results showed that knockdown of Uqcrb or Ndufs6 clearly suppressed the increase in ATP levels in magnetically treated cells (Figure 9, G). Based on the above, these research results suggest that a static magnetic field upregulates the expression of Uqcrb and Ndufs6, genes related to the mitochondrial respiratory chain, thereby regulating CD8 + It is highly likely to improve ATP levels in T cells.
[0171] 4. Candidate magnetic receptor genes are involved in regulating the expression of Uqcrb and Ndufs6. Since Isca1 and Cry1 / Cry2 are recognized as candidate magnetoreceptor genes, we investigated whether a moderate static magnetic field regulates the expression of Uqcrb or Ndufs6 via these candidate magnetoreceptor genes. RNA-seq results showed that CD8 treated with a 0.3T magnetic field regulated expression. +T cells did not contain Isca1 and Cry1 / Cry2, genes showing clear differences in expression compared to control cells (Figure 7, A, B). Subsequent verification by RT-PCR revealed no clear difference in the expression levels of Isca1 and Cry1 / Cry2 between cells treated with a 0.3T magnetic field and control cells (Figure 10, A), which is consistent with RNA-seq results. Next, knockdown experiments of Isca1 and Cry1 / Cry2 were performed to detect their effects on Uqcrb and / or Ndufs6 transcription, and the results of the knockdown efficiency are shown in Figure 10, B. The results show that knockdown of Isca1 or Cry1 / Cry2 can reverse the upregulation of Uqcrb and Ndufs6 in magnetic field-treated cells, and the suppressive effect is more pronounced when cells are not treated with a magnet compared to when they are treated with a 0.3T magnet (Figure 10, C, D). This is thought to be because processing with a 0.3T magnet upregulates Uqcrb and / or Ndufs6 (Figure 8, A).
[0172] Next, we will discuss the knockdown of candidate magnetic receptor genes by magnetic field treatment of CD8 + The effects on changes in granzyme, cytokine, and ATP levels in T cells were detected. The results showed that when Isca1 or Cry1 / Cry2 was knocked down, magnetic field-treated CD8 + The enhancement of granzymes and cytokines in T cells was clearly suppressed (Figure 10, EJ). Furthermore, knockdown of Isca1 suppressed magnetic field-treated CD8 + The upregulation of GzmB and IFNγ in T cells can be reversed (Figure 10, HJ). Furthermore, knockdown of Isca1 or Cry1 / Cry2 can similarly reverse the magnetic field-induced CD8 + The upregulation of T cell ATP levels can be suppressed, and the effect of Isca1 is more evident (Figure 10, K). These data suggest that the candidate magnetic receptor genes Isca1 and Cry1 / Cry2 are involved in regulating the transcription levels of Uqcrb and / or Ndufs6, as well as in CD8 after knockdown by 0.3T magnetic field treatment.+ This can suppress the upregulation of granzymes, cytokines, and ATP levels in T cells.
[0173] 5. A moderate static magnetic field is CD8 + Enhances T cell damage CD8 + T cells, also known as killer cells (CTLs), primarily kill tumor cells by secreting perforin, granzymes, and cytokines. According to the results above, a moderate static magnetic field is CD8 + Since the secretion of granzymes and cytokines from T cells can be enhanced, the effect of magnetic fields on CTL damage was subsequently detected. The spleen of OT-I TCR recombinant mice was taken and CD8 + T cells are isolated and stimulated in vitro via the TCR to create effector cells. These cells are then used in OVA. 257-264 It can specifically recognize OVA. 257-264 EL-4 cells incubated with [method] are used as target cells. CD8 [units] are detected by the LDH method. + Detection of T-damaging activity revealed that CTL cells treated with a moderate static magnetic field showed stronger damaging compared to control cells (Figure 11, A) and secreted higher levels of granzymes and cytokines (Figure 11, B, C). This indicates that a static magnetic field in vitro is effective in damaging CD8 cells. + By enhancing the secretion of granzymes and cytokines from T cells, the toxic effect can be increased. However, it is unknown whether this toxic effect can be maintained after in vivo injection. Subsequently, the toxic activity was further detected in vivo. CTLs treated with a static magnetic field and control CTLs were injected into receptor mice via tail vein injection, followed by OVA. 257-264 Splenocytes incubated with (CFSE) low ) and unincubated spleen cells (CFSE) high A 1:1 mixture of ) was used as target cells and injected into receptor mice via tail vein injection. Experimental results showed that magnetic field-treated CTLs were more damaging than control cells (Figure 11, D, E). According to the above data, in vitro static magnetic field treatment of CD8 +It was found that this enhances the toxicity of T cells, and that this effect can be maintained in vivo.
[0174] 6. In vivo detection of moderate static magnetic field results in CD8 + Enhances the antitumor function of T cells. According to the research findings above, a static magnetic field promotes the secretion of granzymes and cytokines, thereby increasing CD8 + It enhances the toxicity of T cells. CD8 + It has already been demonstrated that T cells play an important role in antitumor activity by releasing granzymes and cytokines. Next, we will use a tumor model to study CD8 in vivo in a static magnetic field. + The effect of T cells on antitumor function was investigated. PyMT genetically modified mice (spontaneous breast cancer) were used as a model. Resin fiberboards embedded with 0.3T and 0.6T button magnets (Figure 1, C) were placed in mouse cages, while the control group was placed in blank plates without magnets. PyMT female littermates were treated with either magnetic plates or blank plates from day 21. It should be recognized that the surface magnetic field strength of such button magnets (1 cm in diameter) is unevenly distributed, with the magnetic field strength at the center of the magnet being much stronger than the surrounding magnetic field strength. In short, the average surface magnetic field strength of the fiberboard embedded with 0.3T magnets was approximately 0.18T, and the average surface magnetic field strength of the fiberboard embedded with 0.6T magnets was approximately 0.31T.
[0175] First, the effect of two magnetic plate treatment intensities on mouse tumor development time was observed. The results showed no significant difference in tumor development time between the 0.3T magnetic plate treatment group and the control group (Figure 12, A), but the 0.6T magnetic plate treatment group showed a clearly delayed tumor development time compared to the control group (Figure 13, A). Subsequently, the effect of magnetic plate treatment on tumor growth was detected. The results showed no significant difference in the mouse tumor growth curves between the 0.3T magnetic plate treatment group and the control group (Figure 12, B), but the 0.6T magnetic plate treatment group showed clearly inhibited tumor growth compared to the control group (Figure 13, B). Furthermore, HE staining of tumor tissue sections revealed that the majority of the control group mice were tumor cells, but the 0.6T magnetic plate treated mice showed clearly delayed tumor progression and more normal mammary gland tissue compared to the control group mice (Figure 13, C). Based on these results, 0.6T magnetic plate treatment can clearly suppress tumor growth.
[0176] Subsequently, magnetic field treatment was performed on tumor infiltration CD8 + We investigated whether tumor growth could be influenced by affecting T cell function. First, we compared the subgroup ratios of tumor-infiltrating T cells in 0.6T magnetic plate-treated mice (shown as SMF in the figure) and control mice. The results showed that CD4 + T, CD8 + T and CD8 + / CD4 + There was no significant difference in the ratio of T cells between magnetic field-treated mice and control mice (Figure 13, D). Subsequently, the activation level of tumor-infiltrating T cells was detected, and CD44 +high CD69 + and CD25 + CD8 + Activated CD8 including T cells + There was no significant difference in the ratio of T cells between magnetic field-treated mice and control mice (Figure 13, E). Also, naive CD4 + T, CD8 + T cell ratio (CD62L high CD44 low ) and the ratio of effector T cells (CD62L low CD44 highThere were no clear differences (Figure 14, A, B). Furthermore, Treg cells and MDSCs (myelin-derived suppressor cells) that suppress immune response function are present in the tumor immune microenvironment, and these cells have a promoting effect on tumor growth. Analysis of these cells revealed no clear difference in the ratio of Treg cells to MDSC cells between magnetic field-treated mice and control mice (Figure 14, CF). Tumor infiltration CD8 in magnetic field-treated mice + It should be noted that T cells secreted higher levels of granzymes and cytokines, including granzyme B, IFNγ, and TNFα, compared to control mice (Figure 13, F, G). However, tumor-infiltrating CD4 + There is no clear difference in the levels of cytokine secretion by T cells (Figure 14). From the above, it can be concluded that in vivo, a static magnetic field promotes the secretion of granzymes and cytokines from cells, thereby affecting CD8 + It enhances the antitumor capacity of T.
[0177] 7. Use CTLs treated with a static magnetic field for tumor immunotherapy through transplantation. According to the experimental results above, the static magnetic field was CD8 in vitro and in vivo. + While it can enhance the toxicity of T cells, the antitumor effect was detected by transplanting magnetically treated CTLs (killer T cells) into tumor-inoculated mice. B16F10-OVA 257-264 Using a melanoma mouse model inoculated with cells via subcutaneous injection, PBS, untreated CTLs (shown as "control" in the figure), and treated CTLs (shown as "SMF" in the figure) were injected into the mouse tail vein, respectively. The CTL cells were taken from the spleen of OT-I TCR recombinant mice and CD8 +T cells were isolated and obtained by stimulating them in vitro with a TCR (see Part 5). Experimental results showed that mice injected with magnetic field-treated CTLs exhibited stronger antitumor activity, smaller tumors, and longer mouse survival times compared to mice injected with control CTLs (Figure 16, A, B). Next, the antitumor activity of transplantation of CTLs treated with a static magnetic field in combination with an anti-PD-1 antibody was detected. The results showed that the combination had a superior antitumor effect compared to monotherapy (Figure 16, C, D). Furthermore, transplantation of CTLs treated with a static magnetic field in combination with an anti-PD-1 antibody showed a stronger antitumor effect compared to transplantation of control CTLs not treated with a static magnetic field in combination with an anti-PD-1 antibody (Figure 16, C, D). These data suggest that transplantation of CTLs treated with a static magnetic field into tumor-transplanted mice has a clear antitumor effect, and that the combination with anti-PD-1 has a stronger antitumor effect compared to monotherapy.
[0178] 3. Summarization and Review
[0179] (1) The above study showed that moderate static magnetic fields regulate the expression of mitochondrial respiratory chain genes, CD8 + We demonstrated that T cells secrete granzymes and cytokines, and promote ATP and mitochondrial respiration levels. Knockdown of the mitochondrial respiratory chain genes Uqcrb and Ndufs6 resulted in improved CD8 levels through magnetic field treatment. + This can suppress the increased secretion of granzymes and cytokines from T cells, as well as the increased expression of ATP. + This study presents a novel molecular mechanism that affects T cell function. Uqcrb is a subunit of mitochondrial complex III, and Ndufs6 is a subunit of mitochondrial complex I; mutations in either of these lead to mitochondrial dysfunction. Furthermore, existing research has shown that mitochondrial respiration is linked to CD8 + It has been reported that CD8 is extremely important for the secretion of T cell cytokines IFNγ and IL-2. +When the negative regulator MCJ of mitochondrial respiration is lost, T cells increase ATP and mitochondrial respiration levels, as well as the secretion of cytokines IFNγ and IL-2. This leads to the detection of CD8 ionization by magnetic field treatment in experiments. + The increased secretion of cytokines from T cells may be due to improved ATP production and mitochondrial respiration.
[0180] (2) The above studies have shown that the candidate magnetic receptor genes Isca1 and Cry1 / Cry2 are involved in the regulation of the mitochondrial respiratory chain genes Uqcrb and / or Ndufs6. By knocking down Isca1 or Cry1 / Cry2, the expression levels of Uqcrb and / or Ndufs6 are downregulated, allowing for magnetic field-induced CD8 + This study can suppress the increased secretion of granzymes and cytokines from T cells, as well as the increased expression of ATP. While Isca1 and Cry1 / Cry2 have been identified as candidate magnetoreceptor genes, their downstream signaling pathways and target molecules remain unclear. This research, by newly linking candidate magnetoreceptor genes with mitochondrial respiratory chain genes, offers new insights into how cells receive magnetic signals, how they are converted into biological signals, and how this leads to biological effects. Furthermore, this study explores the relationship between magnetic fields, mitochondrial ATP synthesis, and CD8 + By newly linking T-cell killing, this study presents a new immunological effect and introduces a novel CD8 function mediated by magnetic fields. + We presented the mechanism of T cell-mediated killing.
[0181] (3) In vivo, a moderate static magnetic field is detected in CD8 +In addition to enhancing the antitumor effect of T cells, we demonstrated that in vivo injection of magnetically treated CTL cells exhibits a clear antitumor effect. This led to the development of a novel magnetosensory-based physical method for enhancing the antitumor effect of T cells. Compared to existing chimeric antigen T cell (CAR-T) therapies, this method is a non-invasive means of regulating cell function because it does not require the introduction of DNA fragments into target cells using genome editing techniques.
[0182] (4) In this study, we investigated the CD4 in a moderate static magnetic field at different magnetic field strengths and TCR stimulation times. + T and CD8 + The cellular effects on T cells were detected in vitro. CD8 was analyzed under the assumption that a moderate static magnetic field stimulated the TCR for 72 hours. + It was found that it increases the secretion of granzymes and cytokines from T cells, but there is no clear effect when the TCR is stimulated for 24 hours and 48 hours. A moderate static magnetic field was found to be CD4 at the above time. + There was no clear change in cytokine secretion by T cells. Furthermore, the above in vivo experiment showed that a moderate static magnetic field (treated with a 0.6T magnetic plate) was used to target tumor-infiltrating CD8 cells. + It promotes the secretion of granzymes and cytokines from T cells, but CD4 + The study demonstrated that there was no effect on T cell cytokine secretion, and furthermore, that there was no clear antitumor effect when treated with a 0.3T magnetic plate. According to these experimental results, a moderate static magnetic field is effective against CD4 + T cells and CD8 + It is clear that the biological effects on T cells differ, and that magnetic field strength is also an important experimental parameter. This disclosure provides, for example, the following: [Section 1] An activated immune cell characterized in that the expression or activity of Uqcrb and / or Ndufs6, genes related to the mitochondrial respiratory chain of the immune cell, is upregulated compared to wild-type immune cells. [Section 2] The immune cells described in item 1, wherein the immune cells are as follows: The immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells; Increased expression or secretion of perforin, granzyme, and / or cytokines in the immune cells; The ATP levels of the immune cells improve; and The cytotoxicity of the aforementioned immune cells is enhanced. An immune cell characterized by having one or more characteristics selected from the following. [Section 3] The immune cells described in item 1 or 2, wherein the cells are subjected to magnetic field treatment, Preferably, the magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T, and / or The aforementioned process involves placing the cells in the magnetic field for at least 48 hours. immune cells. [Section 4] A pharmaceutical composition comprising immune cells as described in any one of items 1 to 3, and a pharmaceutically acceptable carrier. [Section 5] A method for upregulating the expression or activity of genes relating to the mitochondrial respiratory chain of cells, or for improving the ATP level of cells, comprising treating the cells with a magnetic field, preferably a static magnetic field. [Section 6] The method described in item 5, wherein the method has the following characteristics, namely, The aforementioned magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. The aforementioned cells are immune cells, preferably selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells. The aforementioned genes related to the mitochondrial respiratory chain are Uqcrb and / or Ndufs6. A method characterized by having one or more features selected from the above, wherein the processing includes placing cells in the magnetic field for at least 48 hours. [Section 7] The use of a reagent that upregulates the expression or activity of genes related to magnetic fields or mitochondrial respiratory chains in the manufacture of a reagent containing immune cells or a reagent that enhances the toxic activity of immune cells, The aforementioned magnetic field is a static magnetic field, The reagent for upregulating the expression or activity of genes related to the mitochondrial respiratory chain is a primer that recognizes genes related to the mitochondrial respiratory chain, or a vector containing the coding sequence of genes related to the mitochondrial respiratory chain, preferably characterized in that the genes related to the mitochondrial respiratory chain are Uqcrb and / or Ndufs6. [Section 8] The use described in paragraph 7, wherein the said use has the following characteristics, namely: The aforementioned magnetic field is a static magnetic field with an intensity of 1 mT to 1.0 T. The immune cells are placed in the magnetic field for at least 48 hours. The cytotoxic activity of the aforementioned immune cells is improved. The expression or secretion of perforin, granzyme, and / or cytokines in the immune cells is improved. The immune cells are selected from lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells. The granzyme is granzyme A and / or B. The cytokine has one or more characteristics selected from the following: namely, it contains one or more selected from interleukins (IL), colony-stimulating factors (CSF), interferons (IFN), tumor necrosis factor (TNF), transforming growth factor β family (TGF-β), growth factors (GF), and chemokine families. Preferably, the primer sequence that recognizes genes related to the mitochondrial respiratory chain includes one or more sequences selected from SEQ ID NOs: 9, 10, 15, and 16. [Section 9] The use of a magnetic field, a reagent that upregulates the expression or activity of genes related to the mitochondrial respiratory chain, or any one of the immune cells described in item 1 to 3, in the manufacture of a drug for treating cancer, The aforementioned magnetic field is a static magnetic field, preferably a static magnetic field with an intensity of 1 mT to 1.0 T. The reagent for upregulating the expression or activity of genes related to the mitochondrial respiratory chain is a primer that recognizes genes related to the mitochondrial respiratory chain, or a vector containing the coding sequence of genes related to the mitochondrial respiratory chain, preferably characterized in that the genes related to the mitochondrial respiratory chain are Uqcrb and / or Ndufs6. [Section 10] The magnetic component is used in the manufacture of reagents containing immune cells, or in the manufacture of devices for improving ATP levels of cells in vivo or in vitro, promoting mitochondrial respiration of cells in vivo or in vitro, enhancing the toxic activity of immune cells in vivo or in vitro, or in the manufacture of devices for treating cancer, wherein the magnetic component is capable of generating a static magnetic field with an intensity of 1 mT to 1.0 T, and preferably, the magnetic component has the following characteristics, namely: The magnetic component includes a body on which a magnet is provided. The magnet is a button magnet with a thickness of 0.3T or 0.6T. The main body is made of resin fiberboard. The thickness of the main body is 0.1 to 5.0 cm, preferably 1.5 cm. The diameter of the magnet is 0.5 to 5 cm, preferably 1 cm. The distance between adjacent magnets is 0.5 to 5 cm, preferably 2.5 cm. The magnet is embedded inside the main unit. The magnetic component is located at any part of the device, preferably at the bottom. The use is characterized by having one or more features selected from the fact that the device is a mammal cage containing the magnetic component.
Claims
1. A magnetic field-treated, activated immune cell characterized in that the expression or activity of genes related to the mitochondrial respiratory chain is upregulated, wherein the immune cell is a CD8+ T cell, the magnetic field is a static magnetic field with an intensity of 0.3 T to 0.6 T, and the treatment is that the cell is placed in the magnetic field for at least 72 hours.
2. An immune cell according to claim 1, wherein the immune cell is as follows: The immune cells are characterized by upregulation of the expression or activity of Uqcrb and / or Ndufs6, which are genes related to the mitochondrial respiratory chain, compared to wild-type immune cells. Increased expression or secretion of perforin, granzyme, and / or cytokines in the immune cells; The ATP levels of the immune cells improve; and The cytotoxic activity of the aforementioned immune cells is enhanced. An immune cell characterized by having one or more characteristics selected from the group consisting of the following.
3. A pharmaceutical composition comprising immune cells according to claim 1 or 2 and a pharmaceutically acceptable carrier.
4. A method for upregulating the expression or activity of genes relating to the mitochondrial respiratory chain of cells, or for improving the ATP level of cells, comprising treating the cells in a static magnetic field of intensity 0.3 T to 0.6 T for at least 72 hours, wherein the cells are CD8+ T cells.
5. A method according to claim 4, characterized in that the gene relating to the mitochondrial respiratory chain is Uqcrb and / or Ndufs6.
6. The use of magnetic components capable of generating a magnetic field in the manufacture of reagents including immune cells, The aforementioned magnetic field is a static magnetic field with an intensity of 0.3 T to 0.6 T. The immune cells are placed in the magnetic field for at least 72 hours. The aforementioned immune cells are CD8+ T cells, and The immune cells are characterized by upregulation of the expression or activity of genes related to the mitochondrial respiratory chain. A use characterized by the following:
7. The use according to claim 6, characterized in that the expression or activity of the immune cells, which are genes related to the mitochondrial respiratory chain, Uqcrb and / or Ndufs6, is upregulated compared to wild-type immune cells.
8. The use described in claim 6, wherein the use has the following characteristics, namely, The cytotoxic activity of the aforementioned immune cells is improved, and The expression or secretion of perforin, granzyme, and / or cytokines in the immune cells is improved. A use having one or more characteristics selected from the group consisting of ,
9. The use described in Claim 8, wherein the use has the following characteristics, namely, The granzyme is granzyme A and / or B, and The cytokine is used having one or more characteristics selected from the group consisting of the following: interleukin (IL), colony-stimulating factor (CSF), interferon (IFN), tumor necrosis factor (TNF), transforming growth factor β family (TGF-β), growth factor (GF), and chemokine family.
10. The use according to any one of claims 6 to 9, wherein the magnetic component includes a body on which a magnet is provided, and the use is characterized by the following features, namely, The main body is made of resin fiberboard. The thickness of the main body is 0.1 to 5.0 cm, or 1.5 cm. The diameter of the magnet is 0.5 to 5 cm, or 1 cm. The distance between adjacent magnets must be 0.5 to 5 cm, or 2.5 cm, and The use is characterized by having one or more features selected from the group consisting of the magnet being embedded inside the main body.
11. The use of immune cells according to claim 1 or 2 in the manufacture of a drug for treating cancer.
12. Use of a magnetic component in the manufacture of an apparatus comprising a magnetic component for improving ATP levels of cells in vivo or in vitro, promoting mitochondrial respiration of cells in vivo or in vitro, enhancing the cytotoxic activity of immune cells in vivo or in vitro, or treating cancer, wherein the magnetic component is capable of generating a static magnetic field of intensity 0.3 T to 0.6 T, the use comprises treating immune cells in the static magnetic field for at least 72 hours, wherein the expression or activity of genes relating to the mitochondrial respiratory chain is upregulated in the immune cells, and the immune cells are CD8+ T cells.
13. The use according to claim 12, wherein the magnetic component includes a body on which a magnet is provided, and further the use is characterized by the following features, namely, The main body is made of resin fiberboard. The thickness of the main body is 0.1 to 5.0 cm, or 1.5 cm. The diameter of the magnet is 0.5 to 5 cm, or 1 cm. The distance between adjacent magnets must be 0.5 to 5 cm, or 2.5 cm. The magnet is fitted inside the main body. The magnetic component is located at the bottom of the device, and The use is characterized by having one or more features selected from the group consisting of the device being a mammal cage containing the magnetic component.