Primer set for detecting sweet potato blight fungus and method for diagnosing sweet potato blight infection using the same.

A primer set targeting the ITS320 type region with a species-specific sequence allows for rapid and accurate diagnosis of sweet potato wilt disease, overcoming the limitations of existing methods by enabling efficient differentiation from similar diseases.

JP7872992B2Active Publication Date: 2026-06-11NAT AGRI & FOOD RES ORG

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
NAT AGRI & FOOD RES ORG
Filing Date
2023-02-04
Publication Date
2026-06-11

AI Technical Summary

Technical Problem

Existing methods for diagnosing sweet potato damping-off disease caused by Streptomyces ipomoeae are time-consuming, require specialized knowledge, and struggle to differentiate it from similar diseases, especially due to the conserved nature of the 16S rRNA gene sequence.

Method used

A primer set is developed that targets the ITS320 type region of the sweet potato wilt fungus, specifically designed with a species-specific sequence 1, allowing for rapid and accurate PCR-based detection using forward and reverse primers.

Benefits of technology

Enables rapid, simple, and accurate diagnosis of sweet potato wilt disease by specifically amplifying DNA fragments from infected plants, distinguishing it from closely related species of Streptomyces.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007872992000004
    Figure 0007872992000004
  • Figure 0007872992000005
    Figure 0007872992000005
  • Figure 0007872992000006
    Figure 0007872992000006
Patent Text Reader

Abstract

To provide a technique for diagnosing sweet potato plant diseases exhibiting similar external symptoms, in particular, a technique for speedy, simple and accurate diagnosis of soil rot infection by specifically detecting the presence of soil rot pathogen.SOLUTION: Provided herein is a primer set for detecting the soil rot pathogen by PCR amplification of a DNA fragment comprising the base sequence of ITS320 type region of the soil rot pathogen, where the primer set comprises soil rot pathogen-specific primer (primer 1) and a primer that forms a pair with the primer 1 in complementary strand direction (primer 2), where the primer 1 comprises "species-specific sequence 1" specific for the soil rot pathogen. A method for detecting soil rot pathogen by PCR using the primer set is also provided.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a disease diagnosis technology for sweet potato plants with similar appearance symptoms, and more particularly to a technology for specifically detecting the presence of Streptomyces ipomoeae and quickly and simply and accurately diagnosing the infection of Streptomyces ipomoeae.

Background Art

[0002] The damping-off disease of sweet potato plants is caused by the infection of Streptomyces ipomoeae. In sweet potato plants infected with this pathogenic bacterium, the growth of seedlings is inhibited or the plants wilt, and black-brown lesions occur on the tuberous roots, resulting in a decline in the quality of the tuberous roots. Diseases of sweet potato plants with symptoms similar to this disease include soil diseases such as root rot caused by Fusarium solani, basal rot of sweet potato caused by Diaporthe destruens, and vine rot of sweet potato caused by Fusarium oxysporum. In order to control the damping-off disease of sweet potato, it is necessary to appropriately diagnose the diseases of sweet potato plants, including distinguishing them from these similar diseases.

[0003] As a conventional technique in this technical field, there is a method of isolating actinomycetes from diseased sweet potato plants, culturing them on a medium, observing the colonies, and identifying the bacterial species (Non-Patent Documents 1 and 2). However, it is not easy to isolate actinomycetes from diseased plants, and in some cases, the bacteria cannot be isolated depending on the state of the diseased plants. Further, even if isolation is possible, it takes more than one week to reach a state where identification is possible, and specialized knowledge is required for species identification based on morphology and ecology. Another conventional technique in this field involves extracting DNA from the isolated strains mentioned above and analyzing the base sequence of the 16S rRNA gene to identify the blight-causing fungus. However, the base sequence of the 16S rRNA gene is a highly conserved region, and amplification of DNA fragments by PCR alone cannot be used as an indicator. It is necessary to analyze and compare the actual base sequence information using a DNA sequencer. Analyzing the base sequence requires time, effort, and cost. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Japanese Patent Publication No. 2022-035797 [Non-patent literature]

[0005] [Non-Patent Document 1] Kyushu Agricultural Research, No. 47, p. 104, 1985: Kazuichi Kudo et al.: Selective isolation medium for the pathogen of sweet potato wilt disease. [Non-Patent Document 2] Report of the National Institute for Agro-Environmental Sciences, No. 2, pp. 45-59, 1986: Masaomi Oniki et al.: Elucidation of the cause of potato turtle shell disease. [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] The present invention solves the above-mentioned conventional problems and provides a technology for diagnosing diseases of sweet potato plants that exhibit similar external symptoms, specifically detecting the presence of sweet potato wilt fungus and enabling rapid, simple, and accurate diagnosis of infection with sweet potato wilt fungus. [Means for solving the problem]

[0007] To solve the above problems, the inventors diligently conducted research and isolated pathogenic fungi from sweet potatoes exhibiting wilting symptoms in various parts of Japan, revealing that all 99 strains were the sweet potato wilting fungus (Streptomyces ipomoeae). Furthermore, by examining in detail the ITS region between the 16S rRNA gene and the 23S rRNA gene of 13 representative strains (lines) from each of the isolated regions and fields (13 different regions and fields), they found that these could be classified into 9 types based on combinations of ITS types of different sizes and subtypes based on how their mutations occur. Further research by the inventors revealed that while some strains possessed multiple ITS regions of different sizes, all 13 strains shared an ITS region classified as "ITS320 type" in their genomic DNA. Furthermore, the inventors clarified that these 13 strains possessed five subtypes, ITS320A to E, based on their mutational characteristics.

[0008] The inventors performed a sequence comparison using alignment analysis with the nucleotide sequences of ITS320A to ITS320E from all 13 strains from various locations in Japan (13 different regions and fields), the nucleotide sequence of ITS321, which is the corresponding region in a sweet potato wilt fungus strain originating from the United States, and the corresponding region of other actinomycetes (closely related species belonging to Streptomyces) that are closely related to sweet potato wilt. As a result, regarding these nucleotide sequences from sweet potato wilt (nucleotide sequences of the ITS320 type region), they found that a "species-specific sequence 1" (a nucleotide sequence with a specific insertion mutation that exists only in the sweet potato wilt fungus compared to closely related species) is present near the upstream area, which is not present in other closely related species of the genus Streptomyces.

[0009] Based on the above findings, the inventors conducted further research and designed a forward-direction PCR primer containing "species-specific sequence 1" specific to sweet potato wilt disease fungus, as a primer corresponding to the upstream area of ​​the ITS320 type region. Then, a complementary-direction PCR primer (reverse primer) was designed for the downstream side of the ITS320 type region to obtain short DNA amplification fragments that are easily amplified by PCR. Using the designed primer pair, PCR reactions were performed on DNA samples of all 13 strains representing various regions of Japan and strains originating from the United States. It was found that primer-specific DNA amplification fragments could be detected from the DNA samples of all 14 strains of sweet potato wilt disease fungus. Furthermore, the inventors prepared sweet potato plants artificially infected with the sweet potato wilt fungus and performed a PCR reaction using plants exhibiting external disease symptoms as samples. They found that even when using a simplified sample (a diluted solution of ground plant material) prepared by grinding and diluting the plant material, primer-specific DNA amplification fragments could be easily detected. On the other hand, when a PCR reaction was performed using plants that did not exhibit external disease symptoms as samples, primer-specific DNA amplification fragments were not detected.

[0010] At the time of filing this application, the applicant had filed a patent application for an invention relating to a primer set for detecting the presence of sweet potato basal rot fungus (Diaporthe destruens) (Patent Document 1). However, the technical content disclosed in said patent document pertains to filamentous fungi, which are eukaryotes, while the sweet potato damping-off fungus, which is the subject of this invention, is a type of actinomycete, which is a prokaryote. Therefore, the knowledge that 13 strains of sweet potato damping-off fungus from various parts of Japan and a US strain all share the same ITS320 type region, as well as the knowledge that a "species-specific sequence 1" specific to sweet potato damping-off fungus exists, cannot be gleaned from this document.

[0011] Based on the above findings, the inventors have completed the present invention. Specifically, the present invention relates to the invention described below. [Section 1] A primer set for PCR amplification of a DNA fragment containing the nucleotide sequence of the ITS320 type region of the sweet potato blight fungus, comprising a sweet potato blight fungus-specific primer (forward primer: hereinafter referred to as primer 1) and a complementary-direction primer (reverse primer) that forms a primer pair with the aforementioned primer; This primer set, (1-1) A PCR primer that includes a sequence of 16 or more consecutive bases at its 3' end, which is contained in the base sequence from the 1st to the 35th base of Sequence ID No. 1 indicating ITS320A (the base sequence constituting the ITS320 type-specific primer design region of the sweet potato wilt fungus ITS320), and which includes a "species-specific sequence 1" (the base sequence from the 19th to the 23rd base of Sequence ID No. 1) that is specific to the sweet potato wilt fungus, as the PCR primer corresponding to Primer 1 (Primer 1-1). (1-2) If the "sequence of 16 or more consecutive bases" relating to primer 1-1 does not match the corresponding base sequence in the base sequence of sequence number 3 indicating ITS320C, A PCR primer containing a sequence of 16 or more consecutive bases at its 3' end, which is part of the base sequence from the 1st to the 35th base of Sequence ID No. 3 (the base sequence constituting the type-specific primer design region for ITS320 type-specific primer of the sweet potato wilt fungus), and which includes a PCR primer containing "species-specific sequence 1" (the base sequence from the 19th to the 23rd base of Sequence ID No. 3) specific to the sweet potato wilt fungus within that sequence of 16 or more bases, is included as the PCR primer corresponding to Primer 1 (Primer 1-2); Primer set for detecting sweet potato wilt disease fungus. [Section 2] Regarding the above primer set, (1-1') Primer 1-1 is a PCR primer that contains the 16th base "T" of SEQ ID NO: 1 in the sequence of 16 or more consecutive bases, (1-2') The above primers 1-2 are PCR primers that contain the 16th base "C" of SEQ ID NO: 3 in the sequence of 16 or more consecutive bases. Primer set for detecting sweet potato wilt disease fungus, as described in item 1. [Section 3] Regarding the above primer set, (1-1'') The above primer 1-1 is a PCR primer that includes at least 16 consecutive bases in the base sequence from the 17th to the 35th base of Sequence ID No. 1 representing ITS320A (a base sequence that is completely identical in all ITS320A~E and ITS321) at its 3' end. (1-2'') Primers 1-2 above are not included. Primer set for detecting sweet potato wilt disease fungus, as described in item 1. [Section 4] The primer in the complementary strand direction described above (hereinafter referred to as primer 2) is a PCR primer that includes at its 3' end a complementary nucleotide sequence of 16 or more consecutive nucleotides at a position in the nucleotide sequence constituting the ITS320 type region of the sweet potato blight fungus where primer 1 can be formed as a primer pair; This primer set, (2-1) A PCR primer (primer 2-1) that includes a PCR primer corresponding to primer 2 above, which contains a complementary nucleotide sequence at the 3' end of the nucleotide sequence from the 68th to the 112th nucleotide of sequence number 1 showing ITS320A, or a sequence of 16 or more consecutive nucleotides in the nucleotide sequence from the 113th to the 320th nucleotide, (2-2) If the "sequence of 16 or more consecutive bases" relating to primer 2-1 does not match the corresponding base sequence in the base sequence of sequence number 2 indicating ITS320B, A PCR primer (primer 2-2) corresponding to primer 2 includes a PCR primer containing, at its 3' end, a complementary nucleotide sequence of 16 or more consecutive nucleotide sequences within the nucleotide sequence 68 to 112 of sequence number 2 representing ITS320B, or the nucleotide sequence 113 to 320. (2-3) If the "sequence of 16 or more consecutive bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 3 indicating ITS320C, and the "sequence of 16 or more consecutive bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 3 indicating ITS320C, A PCR primer (primer 2-3) corresponding to primer 2 includes a PCR primer containing, at its 3' end, a complementary nucleotide sequence of 16 or more consecutive nucleotide sequences within the nucleotide sequence 68 to 112 of sequence number 3 representing ITS320C, or the nucleotide sequence 113 to 320. (2-4) If the "sequence of 16 or more bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 4 indicating ITS320D, and the "sequence of 16 or more bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 4 indicating ITS320D, and the "sequence of 16 or more bases" for primer 2-3 does not match the corresponding base sequence in the sequence of sequence number 4 indicating ITS320D, A PCR primer (primer 2-4) corresponding to primer 2 includes a PCR primer containing, at its 3' end, a complementary nucleotide sequence of 16 or more consecutive nucleotide sequences within the nucleotide sequence 68 to 112 of sequence number 4 representing ITS320D, or the nucleotide sequence 113 to 320. (2-5) If the "sequence of 16 or more bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, and the "sequence of 16 or more bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, and the "sequence of 16 or more bases" for primer 2-3 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, and the "sequence of 16 or more bases" for primer 2-4 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, A PCR primer (primer 2-5) corresponding to primer 2 includes a PCR primer containing, at its 3' end, a complementary nucleotide sequence of 16 or more consecutive nucleotide sequences within the nucleotide sequence 68 to 112 of sequence number 5 representing ITS320E, or the nucleotide sequence 113 to 320. (2-6) If the "sequence of 16 or more bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-3 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-4 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-5 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, A PCR primer containing, at the 3'-end side, a complementary base sequence of a base sequence of 16 or more consecutive bases in the base sequence from the 68th to the 112th or from the 114th to the 321st of SEQ ID NO: 6 showing ITS321 is included as a PCR primer (primer 2-6) corresponding to the above primer 2. ; The primer set for detecting sweet potato wilt pathogen according to claim 1. [Claim 5] The above primer in the complementary strand direction (hereinafter referred to as primer 2) is a PCR primer containing, at the 3'-end side, a complementary base sequence of a base sequence of 16 or more consecutive bases at a position capable of forming a primer pair with the above primer 1 in any of the base sequences constituting the ITS320 type region of sweet potato wilt pathogen. A PCR primer containing, at the 3'-end side, a complementary base sequence of a base sequence of 16 or more consecutive bases in any of the following base sequences: (a) the base sequence from the 68th to the 111th, (b) the base sequence from the 113th to the 173rd, (c) the base sequence from the 176th to the 219th, (d) the base sequence from the 230th to the 245th, or (e) the base sequence from the 253rd to the 320th of SEQ ID NO: 1 showing ITS320A, which is a base sequence that exactly matches all of ITS320A to E and ITS321. The primer set for detecting sweet potato wilt pathogen according to claim 1. [Claim 6] The description of "a base sequence of 16 or more consecutive bases" regarding the above primer refers to "a base sequence of 19 or more consecutive bases". The primer set for detecting sweet potato wilt pathogen according to claim 1. [Claim 7] A kit for detecting sweet potato wilt pathogen, containing the primer set according to claim 1. [Claim 8] (Step 1) A step of performing a PCR reaction on a target sample using the primer set according to claim 1, and (Step 2) a step of detecting a DNA amplification fragment obtained by the above PCR reaction. A method for detecting sweet potato wilt pathogen, including these steps. [Claim 9] Using the plant body of the sweet potato plant as the target sample, perform steps (1) and (2) described in item 8; In step 2, if the DNA amplification fragment is detected, it is determined that the sweet potato plant used as the target sample is infected with the sweet potato wilt fungus; if the DNA amplification fragment is not detected, it is determined that the sweet potato plant used as the target sample is not infected with the sweet potato wilt fungus. A diagnostic method for infection of sweet potato plants with the sweet potato blight fungus. [Effects of the Invention]

[0012] This invention relates to disease diagnosis techniques for sweet potato plants with similar disease symptoms, and provides a technique for specifically detecting the presence of sweet potato wilt disease (Streptomyces ipomoeae) and for performing rapid, simple, and accurate diagnosis of sweet potato wilt disease. [Brief explanation of the drawing]

[0013] [Figure 1] This is a conceptual diagram illustrating the principle by which the nucleotide sequence containing the ITS320 type region of the sweet potato blight fungus can be specifically detected by a PCR reaction using the primer set for detecting the sweet potato blight fungus according to the present invention. The upper figure shows a conceptual diagram of the ITS320 type region and its neighboring regions of the sweet potato blight fungus. The lower figure shows a conceptual diagram of the corresponding regions of each closely related species of the genus Streptomyces. [Figure 2]This figure shows the alignment analysis results (from the first half to the middle of the sequence) of each nucleotide sequence representing the ITS320 type region of the sweet potato blight fungus and each nucleotide sequence of the corresponding region in other closely related species of the genus Streptomyces, regarding the sequence analysis in Experimental Example 1. The sequences enclosed in squares in the figure indicate the alignment of the nucleotide sequence of the ITS320 type region of the sweet potato blight fungus. The abbreviations of the sequence names in the figure, "320A", "320B", "320A", "320C", "320D", "320E", and "321", respectively, represent the nucleotide sequences (sequence numbers 1-6) of the ITS320 type region of the sweet potato blight fungus: "ITS320A", "ITS320B", "ITS320C", "ITS320D", "ITS320E", and "ITS321". Furthermore, the sequence names "Sd," "Sc," and "Sn" in the figure represent the sequences (sequence numbers 7-9) of the ITS320 type-corresponding regions in other closely related species of the genus Streptomyces: "S. dengpaensis," "S. coeruleorubidus," and "S. neyagawaensis," respectively. The numbers shown above the sequences in the figure indicate the order of the base sites, counting the first base as 1 within that alignment. The "*" symbol shown below the sequences in the figure indicates that, with respect to the corresponding base sites between sequences, they were identical across all the sequences compared. The "." symbol shown below the sequences in the figure indicates that, with respect to the corresponding base sites between sequences, the base of the sequence of the sweet potato blight fungus was identical to one of the bases of any one of the closely related species of the genus Streptomyces. The symbols S1 to S7 in the figure indicate sequences that show specificity (ranging from weak to strong specificity) to the sweet potato wilt fungus described in the embodiment, with respect to "ITS320A to E and ITS321" (sequence numbers 1 to 6). There are no sequences corresponding to symbols S1 to S7 in the corresponding regions of "Sd", "Sc", and "Sn" (sequence numbers 7 to 9). [Figure 3] This figure shows the continuation of the alignment analysis results shown in Figure 2 (results from the middle to the latter half of the sequence). The explanations for the abbreviations, numbers, and symbols in the sequence names in this figure are the same as those in Figure 2. [Figure 4]This figure shows the alignment analysis results (results from the first half to the middle of the sequence) of each base pair representing the ITS320 type region of the sweet potato blight fungus in Experimental Example 1. The explanations for the abbreviations, numbers, and symbols in the sequence names in the figure are the same as those in Figure 2, except that the symbols ".", "Sd", "Sc", and "Sn" are not present. [Figure 5] This figure shows the continuation of the alignment analysis results shown in Figure 4 (results from the middle to the latter half of the sequence). The explanations for the abbreviations, numbers, and symbols in the sequence names in this figure are the same as those in Figure 4. [Figure 6] This figure shows the results of PCR testing using DNA extracts from each strain of sweet potato wilt fungus related to Experimental Example 2, where primer-specific DNA amplification fragments were detected by gel electrophoresis and EtBr staining. In the figure, "M" in the lane column indicates the 100bp ladder marker, and "each number" indicates the number corresponding to the sample number in the table for Experimental Example 2. [Figure 7] This is a photograph of the external appearance of the stem of a sweet potato plant that exhibited symptoms of sweet potato wilt disease in soil contaminated with the disease-causing fungus, as described in Experimental Example 3. [Figure 8] This figure shows the results of a PCR test using a diluted grind of sweet potato plants from Experimental Example 3 as a sample, detecting primer-specific DNA amplification fragments by gel electrophoresis and EtBr staining. In the figure, the "Sweet Potato Lineage" column indicates "PSL" for Purple Sweet Road, "B" for Benikomachi, and "SR" for Sunny Red. In the "Appearance" column, "Disease" indicates a plant showing disease symptoms, "Mild" indicates a plant showing mild symptoms, and "Healthy" indicates a healthy plant. In the lane column, "M" indicates a 100bp ladder marker, "Each Number" indicates a number corresponding to the sample number in the table of Experimental Example 3, and "C" indicates a positive control. [Modes for carrying out the invention]

[0014] The embodiments of the present invention will be described in detail below, but the technical scope of the present invention is not limited to embodiments that include all of the configurations described below. Furthermore, the technical scope of the present invention does not exclude embodiments that include configurations other than those described below, as long as they do not substantially hinder the effects achieved by the technical features of the present invention.

[0015] 1. Explanation of Terms In this specification, "sweet potato damping-off fungus" refers to a type of actinomycete belonging to Streptomyces ipomoeae. It may also be simply referred to as "dampening-off fungus." This fungus is a prokaryotic microorganism belonging to the Gram-positive bacterial group, but it exhibits an ecological cycle of growth by extending hyphae and forming spores, showing diverse morphological differentiation similar to eukaryotic filamentous fungi. It exists in the natural environment as a soil microorganism and, when it infects sweet potato plants, becomes the causative agent of sweet potato damping-off disease. In this specification, "sweet potato wilt disease" refers to a series of symptoms that appear on the plant body of a sweet potato plant infected with the above-mentioned sweet potato wilt fungus. It may also be written as sweet potato wilt disease. It may also be simply written as "wilt disease". Seedlings infected with this fungus show symptoms of poor growth, such as the leaves turning yellow to reddish-purple and wilting about two weeks after planting, and the vines not growing and resulting in poor growth. In severe cases of poor growth, the plant will die. In cases of relatively mild poor growth, the plant will not die, but black, circular, slightly sunken, scab-like lesions will appear on the tuber, significantly reducing its commercial value as a crop. These lesions may not progress into the inside of the tuber, there may be no putrid odor, and the lesioned area may heal as the tuber enlarges, but the lesioned area often becomes constricted and deformed.

[0016] In this specification, "sweet potato plant (sweet potato)" refers to a plant belonging to Ipomoea batatas (L.) Lam. At the time of this application, sweet potato varieties such as "Beni Azuma" and "Beni Haruka" that are distributed in Japan show relatively strong resistance to sweet potato wilt, but among the currently popular varieties, no sweet potato variety with complete resistance to sweet potato wilt has been identified. In this specification, "tuber" refers to the tuber, which is the underground storage organ of the sweet potato plant. In this specification, the term "lineage" refers to a subcategory of "species" and is used to refer to a group that possesses external and / or physiological characteristics (phenotype) that distinguish it as a group from other varieties or lines (groups). In Japan, lines that meet the requirements of having sufficiently similar and uniform characteristics in the same generation and possessing the stability to maintain said characteristics across generations, and that are registered with the Ministry of Agriculture, Forestry and Fisheries, are called "varieties," but from the perspective of genetic characteristics, varieties are also included as a part of lines.

[0017] In this specification, "ITS (Internal transcribed spacer)" refers to the spacer region between the 16sRNA gene (16SrDNA) and the 23SrRNA gene (23SrDNA) in the genomic DNA of the sweet potato blight pathogen or its closely related species. The ITS region is a region with a high copy number in the genomic DNA, and polymorphisms may exist even within a single genomic DNA. It should be noted that, unlike eukaryotes, actinomycetes, including the sweet potato blight pathogen, do not possess the 5.8SrRNA gene. While the sweet potato wilt fungus may possess multiple ITS types of different sizes within its genome, the ITS type classified as "ITS320 type" is commonly found in the genomic DNA of these types. The ITS320 type of sweet potato wilt fungus has several subtypes depending on how mutations occur. Specifically, these include ITS320A (nucleotide sequence described in SEQ ID NO: 1), ITS320B (nucleotide sequence described in SEQ ID NO: 2), ITS320C (nucleotide sequence described in SEQ ID NO: 3), ITS320D (nucleotide sequence described in SEQ ID NO: 4), and ITS320E (nucleotide sequence described in SEQ ID NO: 5). The inventors have found that 13 major strains of sweet potato wilt fungus from various parts of Japan possess one of the ITS320A to E types. In addition, the US standard strain has ITS321 (nucleotide sequence described in SEQ ID NO: 6), and this ITS321 is orthologous to the Japanese strains ITS320A to E. In a broad sense, ITS321 also belongs to the ITS320 type. Here, the nucleotide sequence of ITS321 (sequence number 6) contains a specific insertion mutation in ITS320A-E, with the nucleotide "A" at position 113. In this respect, the nucleotide sequence of ITS321 (sequence number 6) from position 1 to 112 (the nucleotide sequence before the insertion mutation) corresponds to the nucleotide sequence of ITS320A-E from position 1 to 112. On the other hand, the nucleotide sequence of ITS321 (sequence number 6) from position 114 to 321 (the nucleotide sequence after the insertion mutation) corresponds to the nucleotide sequence of ITS320A-E from position 113 to 320.

[0018] In this specification, "PCR primer" refers to a primer composed of or containing an oligonucleotide (or polynucleotide) used in a PCR reaction. It can also be expressed as an oligonucleotide primer. A PCR primer is a short single-stranded DNA that binds to a specific sequence in a PCR reaction and functions as an extension starting point for thermostable DNA polymerase. In this specification, the phrase "PCR primer containing the base sequence of **" can be explained as a PCR primer comprising DNA containing the base sequence of ** as an oligonucleotide (or polynucleotide). This phrase can also be expressed as a PCR primer containing the base sequence of **, a PCR primer containing DNA containing the base sequence of **, etc. The main part of the oligonucleotide (or polynucleotide) of the PCR primer (the part that does not include molecular modifications, etc.) can also be expressed as a PCR primer composed of DNA containing the base sequence of **, a PCR primer consisting of DNA containing the base sequence of **, etc. Furthermore, the phrase "PCR primers containing the nucleotide sequence of **" in this specification may be limited to the following expressions when necessary: ​​PCR primers composed of the nucleotide sequence of **, PCR primers consisting of the nucleotide sequence of **, etc. More specifically, PCR primers containing DNA exhibiting the nucleotide sequence of **, PCR primers composed of DNA exhibiting the nucleotide sequence of **, PCR primers consisting of DNA exhibiting the nucleotide sequence of **, etc.

[0019] In this specification, the term "PCR reaction (PCR)" is used to mean polymerase chain reaction. In this specification, the term "forward strand" refers to one DNA side strand whose direction from the 16S rRNA gene to the 23S rRNA gene is 5' to 3', with respect to a continuous genomic region consisting of the 16S rRNA gene, the ITS region, and the 23S rRNA gene. A forward primer refers to a primer designed for the forward strand direction. Unless otherwise specified, the nucleotide sequences of the ITS region in this specification are given as the nucleotide sequences in the forward strand direction. On the other hand, the term "complementary strand" refers to one DNA side strand whose direction from the 16S rRNA gene to the 23S rRNA gene is 5' to 3' (the direction of the nucleotide sequence complementary to the nucleotide sequence in the forward strand direction described above). A reverse primer refers to a primer designed for the complementary strand direction.

[0020] In this specification, the expression "the nucleotide sequence from the Yth to the Zth base of sequence number X" (where X, Y, and Z are natural numbers) refers to the nucleotide sequence consisting of the nucleotide position from the Yth base to the Zth base position in the nucleotide sequence of sequence number X as shown in the sequence listing. It is also possible to express this as the nucleotide sequence consisting of the nucleotides from the Yth to the Zth base in the nucleotide sequence shown by sequence number X, the nucleotide sequence consisting of the nucleotides from the Yth to the Zth base in the nucleotide sequence shown by sequence number X, or the nucleotide sequence consisting of the nucleotides from the Yth to the Zth base in the nucleotide sequence shown by sequence number X. In this specification, unless otherwise specified, "nucleotide sequence variation" refers to a variation resulting from the substitution, deletion, and / or insertion of nucleotides that constitute a nucleotide sequence.

[0021] 2. Primer set for detecting sweet potato blight fungus The present invention relates to a technique for rapidly, simply, and accurately diagnosing the presence of sweet potato wilt disease, and specifically to a primer set for detecting sweet potato wilt disease fungus that enables the specific detection of the presence of sweet potato wilt disease fungus. More specifically, the present invention relates to a primer set for PCR amplification of a DNA fragment containing the base sequence of the ITS320 type region of the sweet potato wilt fungus (Streptomyces ipomoeae) (or a base sequence contained in said ITS320 type region), and the primer set includes a sweet potato wilt fungus-specific primer (forward primer) and a complementary strand-oriented primer (reverse primer) that forms a primer pair with the aforementioned primer.

[0022] [Sweet potato blight-specific primers] The nucleotide sequence constituting the ITS320 type region of the sweet potato blight fungus exhibits extremely high sequence identity across different strains of the sweet potato blight fungus (see alignment in Figures 2 and 3). On the other hand, while the nucleotide sequence constituting the ITS320 type region of the sweet potato blight fungus also exhibits high identity with the corresponding regions of other closely related species of the genus Streptomyces, there are regions within the conserved region that show low or only slightly low similarity with other closely related species of the genus Streptomyces. In this respect, the ITS320 type region is considered to be a region with somewhat slower sequence conservation (molecular evolutionary rate) compared to the 23S rRNA gene, which exhibits extremely high sequence conservation due to functional constraints (functions related to ribosomes common to life activities).

[0023] In this invention, in order to distinguish and detect the sweet potato wilt fungus from other closely related actinomycetes of the genus Streptomyces, it is necessary to specifically amplify and detect DNA fragments containing the ITS320 type nucleotide sequence of the sweet potato wilt fungus. For this reason, the primer set according to the present invention includes a sweet potato wilt fungus-specific primer (hereinafter referred to as primer 1) designed as a forward primer near the upstream of the ITS320 type nucleotide sequence in order to specifically amplify and detect it. More specifically, Primer 1 can be described as a PCR primer that includes a sequence of 16 or more consecutive bases at its 3' end, which is part of the base sequence that constitutes the "Sweet Potato Damping-Off Virus ITS320 Type-Specific Primer Design Region" described below.

[0024] The "type-specific primer design region for sweet potato blight fungus ITS320" according to the present invention can be defined as the region from the 1st to the 35th base sequence in the base sequences shown in SEQ ID NOs: 1 to 6 (ITS320A to E and ITS321). This region is located "near the upstream" of the ITS320 type, and is therefore considered an optimal region for designing forward primers to specifically amplify the ITS320 type nucleotide sequence. This region corresponds to the nucleotide sequence from the 1st to the 35th (the sequence indicated by the code S3) in the alignment shown in Figures 2,3 or 4,5. The region indicated by the code S3 corresponds to the 1st to 35th base sequence in the base sequences of sequence numbers 1 to 6, which represent ITS320A to E and ITS321, respectively. This sequence is also shown separately as the base sequence of sequence number 15.

[0025] The nucleotide sequence constituting the region indicated by the code S3 is a nucleotide sequence that is almost identical across all strains of the sweet potato wilt fungus (the sequence identity of the entire region is extremely high). In particular, the nucleotide sequence from the middle of this region onward (the nucleotide sequence from the 19th to the 35th nucleotide in the alignment shown in Figures 2, 3 or 4, 5: the region indicated by the code S2, which shows high specificity for the sweet potato wilt fungus) is a sequence that is completely identical across all strains of the sweet potato wilt fungus, while having low sequence identity with each closely related species of the genus Streptomyces. The region indicated by the code S2 corresponds to the nucleotide sequences from the 19th to the 35th position in the nucleotide sequences of sequence numbers 1 to 6, which represent ITS320A to E and ITS321, respectively, and is identical to the nucleotide sequences from the 19th to the 35th position in the nucleotide sequence of sequence number 1, which represents ITS320A. Furthermore, the "species-specific sequence 1 (code S1 in the alignment in Figures 2, 3 or 4, 5)" contained within the region indicated by the code S2 is a sequence that corresponds to an insertional mutation when viewed from the perspective of each closely related species of the genus Streptomyces. In light of the above, even when comparing the corresponding sequences of S. coeruleorubidus and S. dengpaensis, which show the closest relationship to the sweet potato wilt disease fungus in the alignments of Figures 2 and 3, two of the three bases at the 3' end of the region indicated by code S3 (the base sequence from the 33rd to the 35th base in the alignment shown in Figures 2 and 3) differ. Furthermore, regarding the sequence upstream of the aforementioned three bases in the region indicated by code S2, which is in the latter half of code S3, the closest match is only nine consecutive bases or less. In this respect, primer 1 according to the present invention cannot function as a primer for these closely related species.

[0026] Furthermore, the region representing the nucleotide sequence from the 1st to the 33rd base pair in the nucleotide sequences described in Sequence IDs 1-6 (ITS320A-E and ITS321) can also be cited as a type-specific primer design region for the sweet potato blight fungus ITS320. This region corresponds to the nucleotide sequence from the 1st to the 33rd base pair in the alignment shown in Figures 2,3 or 4,5. In the nucleotide sequences of Sequence IDs 1-6 representing ITS320A-E and ITS321, this region corresponds to the nucleotide sequence from the 1st to the 33rd base pair, respectively. Furthermore, the region corresponding to the nucleotide sequence from the 1st to the 29th nucleotide in the nucleotide sequences described in Sequence IDs 1-6 (ITS320A-E and ITS321) can also be used as a type-specific primer design region for the sweet potato blight fungus ITS320. This region corresponds to the nucleotide sequence from the 1st to the 29th nucleotide in the alignment shown in Figures 2,3 or 4,5. In the nucleotide sequences of Sequence IDs 1-6, which represent ITS320A-E and ITS321, this region corresponds to the nucleotide sequence from the 1st to the 29th nucleotide in each respective sequence. In the embodiment in which the primer 1 is designed in these regions, the lower limit of the 3' end of the primer design region is designed slightly upstream, making it easier for the "species-specific sequence 1" to be included in the 3' region of primer 1, which is considered a more preferable embodiment.

[0027] Primer 1 according to the present invention is a PCR primer that contains a "species-specific sequence 1" specific to sweet potato wilt fungus in its base sequence (in the base sequence of 16 bases or more). Here, "species-specific sequence 1" refers to "GGATC," which is the sequence from the 19th to the 23rd base in the base sequences described in Sequence IDs 1-6 (ITS320A-E and ITS321). This sequence corresponds to the sequence from the 19th to the 23rd base (indicated by the symbol S1) in the alignment shown in Figures 2, 3 or 4, 5. This sequence is included in the ITS320 type-specific primer design region of the sweet potato blight fungus described above, and corresponds to the 19th to 23rd base sequence in the nucleotide sequences of Sequence IDs 1 to 6, which represent ITS320A to E and ITS321, respectively. In the nucleotide sequence of Sequence ID 1, which represents ITS320A, it is the same sequence as the 19th to 23rd base sequence. The region in question is a region that is completely identical (100% identity) across a wide range of strains of the sweet potato wilt fungus (all 13 strains from various parts of Japan and a US strain), and at the same time, it is a region that is completely absent in any closely related species of the genus Streptomyces (a region containing insertional mutations from the perspective of closely related species).

[0028] When primer 1 is designed in the ITS320 type-specific primer design region of the sweet potato blight fungus to include species-specific sequence 1, even if the 5' end contains a region identical to each closely related species, the primer sequence will be designed to include species-specific sequence 1 in the 3' end from the middle of the sequence onward and to have low similarity to any closely related species, based on the sequence characteristics described above. Therefore, when primer 1 is designed in the above-mentioned region, primer-specific annealing occurs in PCR reactions using genomic DNA from each strain of the sweet potato blight fungus as a template, but primer-specific annealing does not occur in PCR reactions using genomic DNA from each closely related species of the genus Streptomyces as a template.

[0029] Design when polymorphic regions are included In the nucleotide sequences constituting the type-specific primer design region of the sweet potato blight fungus ITS320, a single nucleotide polymorphism exists at the 16th nucleotide site (the 16th nucleotide site in the alignment shown in Figures 2, 3 or 4, 5) of the nucleotide sequences described in Sequence ID No. 1-6 (ITS320A-E / ITS321) when comparing all strains of the sweet potato blight fungus. In this regard, the sequence of the specific primer design region indicated by the symbol S3 described above is identical to the sequence from the 1st to the 35th base sequence of Sequence ID No. 1, which indicates ITS320A, for sequences where the 16th polymorphic site is "T". Furthermore, for sequences where the 16th polymorphic site is "C", the sequence of the primer design region indicated by the symbol S3 described above is identical to the sequence from the 1st to the 35th base sequence of Sequence ID No. 3, which indicates ITS320C. In this regard, the primer set for detecting sweet potato wilt disease fungus according to the present invention preferably includes two types of PCR primers (primer 1-1 and primer 1-2) corresponding to each base polymorphism when the base sequence contained in the primer contains the base (polymorphic site: "Y" = "C" or "T"). Furthermore, this embodiment includes a configuration in which primer 1 is designed as a degenerate primer.

[0030] In the case of the primer 1 according to the present invention, if the base sequence contained in primer 1 is a base sequence that includes the 16th base (polymorphic site) of the base sequence described in SEQ ID NOs: 1-6 (ITS320A-E and ITS321), it is preferable that the PCR primer corresponding to primer 1 includes primer 1-1 in which the polymorphic site is "T" and primer 1-2 in which the polymorphic site is "C". Here, as primer 1-1, a PCR primer that includes a sequence of 16 or more consecutive bases containing the polymorphic region in the base sequence from the 1st to the 35th base of sequence number 1 (ITS320A) when the base of the polymorphic region is "T" can be cited as a PCR primer corresponding to primer 1 above. Primer 1-1 is a PCR primer that satisfies the sequence characteristics of primer 1 according to the present invention when the polymorphic region is specified as "T". Here, the base sequences from the 1st to the 35th base in the base sequences shown in sequence number 1 representing ITS320A, sequence number 2 representing ITS320B, and sequence number 6 representing ITS321 are the same sequence. Furthermore, as primers 1-2, a PCR primer that includes a sequence of 16 or more consecutive bases containing the polymorphic region in the base sequence from the 1st to the 35th base of sequence number 3 (ITS320C) when the base of the polymorphic region is "C" can be cited as a PCR primer corresponding to primer 1. Primers 1-2 are PCR primers that satisfy the sequence characteristics of primer 1 according to the present invention when the polymorphic region is specified as "C". Here, the base sequences from the 1st to the 35th base in the base sequences shown in sequence number 3 representing ITS320C, sequence number 4 representing ITS320D, and sequence number 5 representing ITS320E are the same sequence.

[0031] For the polymorphic primers (primer 1-1 and primer 1-2) related to primer 1 described above, it is preferable to design the primers so that their base lengths and / or setting regions are identical except for the differences in the polymorphic sites (a degenerate primer configuration). Furthermore, as long as the design conditions for primer 1 according to the present invention are met, it is also permissible to design the primers in a manner in which the base lengths and setting regions of the two primers do not match.

[0032] Design without polymorphic regions In the present invention, it is also possible to design primer 1 by selecting a nucleotide sequence that does not include the polymorphic site in the specific primer design region described above. In this case, primer design is performed in a region where the nucleotide sequences are completely identical in all of ITS320A~E and ITS321, and primer 1 can be designed as a primer 1 having only one type of nucleotide sequence, without being a degenerate primer or the like. In the design embodiment of primer 1, the consecutive nucleotide sequence of 16 or more bases related to primer 1 is a nucleotide sequence selected from the region of the nucleotide sequences described in Sequence ID Nos. 1 to 6 (ITS320A to E and ITS321) that does not include the polymorphic region (the 16th base). In this regard, from the perspective of actually performing a PCR reaction to obtain a DNA amplification fragment, a preferred embodiment is one in which the "consecutive nucleotide sequence of 16 or more bases" related to primer 1 is a nucleotide sequence included in the nucleotide sequences from the 17th to the 35th base in the nucleotide sequence described in Sequence ID No. 1 (ITS320A). This nucleotide sequence corresponds to the 17th to the 35th base in the nucleotide sequences of Sequence ID Nos. 1 to 6, which represent ITS320A to E and ITS321, respectively.

[0033] More specifically, one possible embodiment is a PCR primer in which the above-mentioned primer 1 is a PCR primer that includes at least 16 consecutive base sequences at its 3' end, which are contained in the base sequences from the 17th to the 35th of Sequence ID No. 1 that represent ITS320A, a base sequence that is a complete match for all of ITS320A~E and ITS321, and which includes a "species-specific sequence 1" (the base sequences from the 19th to the 23rd of Sequence ID No. 1) that is specific to the sweet potato wilt fungus. Here, the nucleotide sequence of the region in question corresponds to the nucleotide sequence from the 17th to the 35th nucleotide (the region indicated by the symbol S7) in the alignments of Figures 2, 3 or 4, 5. This sequence is identical to the nucleotide sequence from the 17th to the 35th nucleotide in the nucleotide sequences of sequence numbers 1 to 6, which represent ITS320A to E and ITS321.

[0034] others The primer 1 according to the present invention (including primers 1-1 and 1-2) is preferably a primer that contains at least 16 consecutive bases at its 3' end from the base sequence constituting the ITS320 type-specific primer design region of sweet potato wilt disease described above. A suitable number of consecutive bases (mer) for which the base sequence of the design region and the sequence of primer 1 are in complete agreement (indicating sequence identity) is preferably 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive bases from the base sequence included in the primer design region. There is no upper limit to the number of consecutive bases as long as the primer function is ensured, but examples include 50 bases or less, 40 bases or less, or 30 bases or less.

[0035] Furthermore, within the entire ITS320 type region, there are regions downstream of the specific primer design region that have slightly lower similarity to each closely related species (regions indicated by the code S5 in the alignments of Figures 2, 3 or 4, 5). However, these regions indicated by the code S5 (S5a~d) have slightly lower specificity and are shorter (approximately 5~12 bases excluding the gap "-") compared to the region that shows high specificity to the blight-causing fungus containing the species-specific sequence 1 related to primer 1 (the 17-base region indicated by the code S2). In addition, designing a forward primer in the middle to late region narrows the design position of the corresponding reverse primer, making it an unsuitable design position for primer 1 (forward primer).

[0036] In light of the above, the primer set according to the present invention can be described as follows, assuming embodiments that include the polymorph and embodiments that do not include the polymorph. This primer set, (1-1) A PCR primer that includes a sequence of 16 or more consecutive bases at its 3' end, which is contained in the base sequence from the 1st to the 35th base of Sequence ID No. 1 indicating ITS320A (the base sequence constituting the ITS320 type-specific primer design region of the sweet potato wilt fungus ITS320), and which includes a "species-specific sequence 1" (the base sequence from the 19th to the 23rd base of Sequence ID No. 1) that is specific to the sweet potato wilt fungus, as one of the PCR primers corresponding to Primer 1 (Primer 1-1), (1-2) If the "sequence of 16 or more consecutive bases" relating to primer 1-1 does not match the corresponding base sequence in the base sequence of sequence number 3 indicating ITS320C, A PCR primer that includes a sequence of 16 or more consecutive bases contained in the base sequence from the 1st to the 35th base of Sequence ID No. 3 (the base sequence constituting the type-specific primer design region for ITS320 type-specific primer of the sweet potato wilt fungus), and which includes a "species-specific sequence 1" (the base sequence from the 19th to the 23rd base of Sequence ID No. 3) specific to the sweet potato wilt fungus, is included as one of the PCR primers corresponding to Primer 1 (Primer 1-2).

[0037] Here, as the primer 1 according to the present invention, it is also possible to select a sequence containing the polymorphic region and design two or more types (particularly two types) of primer 1 corresponding to the polymorphism, for example, as follows. Regarding the above primer set, (1-1a) The above primer 1-1 is a PCR primer that includes at least 16 consecutive bases at its 3' end, which are included in the base sequence from the 1st to the 35th bases of Sequence ID No. 1, including the 16th base "T" of Sequence ID No. 1 (the base sequence that constitutes the ITS320 type-specific primer design region of sweet potato wilt fungus). (1-2a) Primers 1-2 described above are PCR primers that include a sequence of 16 or more consecutive bases at their 3' end, which is part of the base sequence from the 1st to the 35th base of Sequence ID No. 3 (the base sequence that constitutes the ITS320 type-specific primer design region of sweet potato wilt fungus), including the 16th base "C" of Sequence ID No. 3.

[0038] Furthermore, the primer 1 according to the present invention can also be described in the following embodiments. Regarding the above primer set, (1-1b) The above primer 1-1 is a PCR primer that contains the 16th base "T" of SEQ ID NO: 1 in the sequence of 16 or more consecutive bases, (1-2b) Primers 1-2 described above are PCR primers that contain the 16th base "C" of SEQ ID NO: 3 in the sequence of 16 or more consecutive bases.

[0039] Furthermore, as a primer 1 according to the present invention, it is also possible to design one type of primer 1 by selecting a sequence that does not contain polymorphic sites in these base sequences, for example, as follows. Regarding the above primer set, (1-1c) The above primer 1-1 is a PCR primer that includes at least 16 consecutive bases in the base sequence from the 17th to the 35th base of Sequence ID No. 1 representing ITS320A (a base sequence that is completely identical in all ITS320A~E and ITS321) at its 3' end, (1-2c) Does not contain primers 1 and 2 mentioned above.

[0040] [Complementary chain direction primer] The primer set according to the present invention includes a primer (reverse primer: hereinafter referred to as primer 2) that forms a complementary strand direction with primer 1 in order to specifically amplify and detect the base sequence of the ITS320 type region of sweet potato wilt fungus.

[0041] Based on the principles of the PCR method, Primer 2 can be designed to target the downstream region of the ITS320 type-specific primer design region (design region of Primer 1) and the 23S rRNA gene adjacent to it. In this embodiment, in addition to the design region of Primer 2 for the ITS320 type described below, it is possible to design Primer 2 to target the 23S rRNA gene adjacent to it on the downstream side (including base sequences that include both regions across the boundary).

[0042] However, the primer set for detecting sweet potato wilt disease fungus according to the present invention is preferably a primer set that allows for easy PCR testing even when contaminants are present in the sample, assuming the use of a sample containing a ground plant extract or the like. In this regard, it is preferable that the primer 2 according to the present invention be designed as a complementary strand-oriented primer (reverse primer) that forms a primer pair with primer 1 within an ITS320 type region (region length: 320 bp or 321 bp) so that a "short DNA amplification fragment" that is easily amplified by PCR can be obtained. Here, as an example of a short DNA fragment that is easily amplified by PCR, the length of the amplified DNA fragment obtained by the PCR reaction, excluding the primer portion (the region constituting the area between primer 1 and primer 2), is 300 bp or less. Preferably, the fragment length is 290 bp or less, 280 bp or less, 250 bp or less, 200 bp or less, or 150 bp or less. Considering the embodiment in which PCR testing is performed directly from plant samples, the optimal fragment length is 100 bp or less. As for the lower limit, there is no particular restriction as long as the length that allows for a PCR reaction is ensured, but as an example, the length excluding the primer portion (the region constituting the area between primer 1 and primer 2) is 20 bp or more or 30 bp or more. In these respects, it is preferable that the primer 2 according to the present invention is designed so that the length of the amplified DNA fragment excluding the primer (the region constituting the space between primer 1 and primer 2) falls within the above range.

[0043] One design embodiment of the primer 2 according to the present invention is to design the primer 2 at a position in the base sequence that constitutes the ITS320 type region of the sweet potato wilt fungus, where it is possible to form a primer pair with the primer 1. As a specific example of primer 2 in this embodiment, it is possible to define primer 2 as a PCR primer that includes at its 3' end a complementary nucleotide sequence of 16 or more consecutive nucleotides located at a position where primer pairing with primer 1 is possible, either in the nucleotide sequences of the first half of ITS320A-E and ITS321 (the nucleotide sequence before the insertion mutation in ITS321) or in the nucleotide sequences of the middle to latter half of ITS320A-E and ITS321 (the nucleotide sequence after the insertion mutation in ITS321). When primer 2 is designed in this manner, it becomes possible to specifically and comprehensively detect the sequences of sweet potato blight fungi, including ITS320A~E (all 13 strains isolated from various parts of Japan) and ITS321 (US strain), based on the principles of PCR.

[0044] The primer set according to the present invention can be described as follows, assuming embodiments that include polymorphisms related to primer 2 and embodiments that do not include polymorphisms. This primer set, (2-1) A PCR primer containing a complementary nucleotide sequence at the 3' end of the nucleotide sequence from the 68th to the 112th base pair of Sequence ID No. 1 showing ITS320A, or a sequence of 16 or more consecutive base pairs within the nucleotide sequence from the 113th to the 320th base pair, is included as one of the PCR primers corresponding to primer 2 (primer 2-1). (2-2) If the "sequence of 16 or more consecutive bases" relating to primer 2-1 does not match the corresponding base sequence in the base sequence of sequence number 2 indicating ITS320B, A PCR primer containing a complementary nucleotide sequence at its 3' end to the nucleotide sequence from position 68 to position 112 of sequence number 2 representing ITS320B, or a sequence of 16 or more consecutive nucleotides within the nucleotide sequence from position 113 to position 320, is included as one of the PCR primers corresponding to primer 2 (primer 2-2). (2-3) If the "sequence of 16 or more consecutive bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 3 indicating ITS320C, and the "sequence of 16 or more consecutive bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 3 indicating ITS320C, A PCR primer containing a complementary nucleotide sequence at its 3' end to the nucleotide sequence from the 68th to the 112th base pair of sequence number 3 representing ITS320C, or a sequence of 16 or more consecutive base pairs within the nucleotide sequence from the 113th to the 320th base pair, is included as one of the PCR primers corresponding to primer 2 (primer 2-3). (2-4) If the "sequence of 16 or more bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 4 indicating ITS320D, and the "sequence of 16 or more bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 4 indicating ITS320D, and the "sequence of 16 or more bases" for primer 2-3 does not match the corresponding base sequence in the sequence of sequence number 4 indicating ITS320D, A PCR primer containing a complementary nucleotide sequence at its 3' end to the nucleotide sequence from position 68 to position 112 of sequence number 4 representing ITS320D, or a sequence of 16 or more consecutive nucleotides within the nucleotide sequence from position 113 to position 320, is included as one of the PCR primers corresponding to primer 2 (primer 2-4). (2-5) If the "sequence of 16 or more bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, and the "sequence of 16 or more bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, and the "sequence of 16 or more bases" for primer 2-3 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, and the "sequence of 16 or more bases" for primer 2-4 does not match the corresponding base sequence in the sequence of sequence number 5 indicating ITS320E, A PCR primer containing a complementary nucleotide sequence at its 3' end to the nucleotide sequence from position 68 to position 112 of sequence number 5 representing ITS320E, or a sequence of 16 or more consecutive nucleotides within the nucleotide sequence from position 113 to position 320, is included as one of the PCR primers corresponding to primer 2 (primer 2-5). (2-6) If the "sequence of 16 or more bases" for primer 2-1 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-2 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-3 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-4 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, and the "sequence of 16 or more bases" for primer 2-5 does not match the corresponding base sequence in the sequence of sequence number 6 indicating ITS321, A PCR primer containing a complementary nucleotide sequence at its 3' end to the nucleotide sequence from position 68 to position 112 of sequence number 6 representing ITS321, or a sequence of 16 or more consecutive nucleotides within the nucleotide sequence from position 114 to position 321, is included as one of the PCR primers corresponding to primer 2 (primer 2-6).

[0045] Here, as the primer 2 according to the present invention, it is also possible to select a sequence containing a polymorphic region and design two or more (2 to 6 types) of primer 2 corresponding to each polymorphic type. For example, it is possible to design multiple primers 2 with different amplification fragment sizes by designing primers 2 corresponding to each polymorphic type of ITS320A to E and ITS321. It is also possible to design one type of primer 2 by selecting a sequence in these base sequences that does not contain a polymorphic region.

[0046] Design when polymorphic regions are included If the nucleotide sequence contained in the above-mentioned primer 2 is a nucleotide sequence that includes complementary sites to polymorphic sites in the nucleotide sequences of ITS320A-E and ITS321 (specific polymorphic sites can be confirmed by the alignment shown in Figures 4 and 5), it is preferable to include two or more types of primers as primer 2, each containing a nucleotide sequence that includes a complementary site to the respective polymorphic site. This embodiment includes a configuration in which primer 2 is designed as a degenerate primer. In this embodiment, if the base sequence contained in primer 2 includes two or more complementary sites to the polymorphic site, it is desirable to design multiple types (two or more) of primers based on the sequences of ITS320A-E and ITS321, so that there are primers corresponding to all polymorphisms (combinations of polymorphisms) that show base sequences different from the primer designed based on the sequence of ITS320A. Furthermore, in the embodiment of designing primer 2 according to the polymorphic type described above, it is preferable to design the primer so that the base lengths and / or setting regions are the same except for the differences in the polymorphic sites (the embodiment of a degenerate primer). In addition, as long as the design conditions for primer 2 according to the present invention are met, it is also permissible to design primers in a manner in which the base lengths and setting regions of multiple primers 2 do not match.

[0047] Design without polymorphic regions In the design region of primer 2 according to the present invention, it is also possible to select a nucleotide sequence that does not contain polymorphic regions in the nucleotide sequences of ITS320A~E and ITS321 (the nucleotide sequence of the region indicated by the code S4 in the alignment in Figures 2, 3 or 4, 5), and then design primer 2 based on its complementary nucleotide sequence. In this case, the primer design is performed in a region where the nucleotide sequences completely match those of all of the nucleotide sequences of ITS320A~E and ITS321, making it possible to design only one type of primer 2. As for the design of the primer 2, the complementary base sequence of the consecutive base sequence of 16 or more bases related to the primer 2 can be the complementary base sequence of a consecutive base sequence of 16 or more bases in any of the following base sequences of Sequence ID No. 1 showing ITS320A, which is a base sequence that is a complete match in all of ITS320A~E and ITS321: (a) base sequence from position 68 to 111, (b) base sequence from position 113 to 173, (c) base sequence from position 176 to 219, (d) base sequence from position 230 to 245, or (e) base sequence from position 253 to 320. The sequences in ITS320A (Sequence ID 1) also correspond to (a) the sequence from the 68th to the 111th base, (b) the sequence from the 113th to the 173rd base, (c) the sequence from the 176th to the 219th base, (d) the sequence from the 230th to the 245th base, or (e) the sequence from the 253rd to the 320th base in Sequence ID 6, which represents ITS321. The nucleotide sequence of this region corresponds to the nucleotide sequence of the region indicated by the code S4 (S4a~e) in the alignments shown in Figures 2, 3 and 4, 5 (excluding any gaps "-").

[0048] others In the primer set of the present invention, specific amplification in the PCR reaction is ensured by the sweet potato blight fungus-specific sequence of primer 1. Therefore, primer 2 can, in principle, be designed for any of the ITS320 type regions. However, if the primer set of the present invention is designed so that the primer 2 contains a complementary nucleotide sequence of a region (a sequence region showing somewhat weak specificity for the blight-causing fungus) that is scattered in the middle to downstream side of the ITS320 type region and has a slightly lower similarity to other closely related species, then further improvement in specific amplification in the PCR reaction can be expected. The regions indicated by the symbols S5 (S5a~d) are located within the region indicated by the symbol S4 (the region where the corresponding base sequences in all of ITS320A~E and ITS321 are perfectly identical). Compared to the region that shows high specificity to the blight-causing blight blight bacterium (the 17-base region indicated by the symbol S2) containing the species-specific sequence 1 for primer 1 described above, this region has slightly lower specificity when compared to closely related species and is also shorter (approximately 5~12 bases excluding the gap "-"). However, if primer 2 is designed to include complementary sequences to at least some of the base sequences of any of these sequences, further improvement in specific amplification in the PCR reaction can be expected. The nucleotide sequence of the low-similarity region corresponds to the nucleotide sequence of the region indicated by the code S5 (S5a~d) in the alignment shown in Figures 2,3 or 4,5 (the sequence excluding any gaps "-").

[0049] Specifically, as an embodiment of the code S5, a preferred example is an embodiment in which the "complementary base sequence of 16 or more consecutive base sequences at a position where primer 1 and primer pair can be formed" is a base sequence that includes a base sequence contained in any of the following: (a) the base sequence from position 114 to 124 of Sequence ID No. 1, (b) the base sequence from position 137 to 147, (c) the base sequence from position 163 to 170, or (d) the base sequence from position 255 to 259. These base sequences of code S5 (and code S4 including it) are identical base sequences in all of ITS320A~E and ITS321. The sequences in ITS320A (Sequence ID 1) are the same in Sequence IDs 2-5, which represent ITS320B-E: (a) the sequence from the 114th to the 124th base, (b) the sequence from the 137th to the 147th base, (c) the sequence from the 163rd to the 170th base, or (d) the sequence from the 255th to the 259th base. In addition, in Sequence ID 6, which represents ITS321, the sequences are the same: (a) the sequence from the 115th to the 125th base, (b) the sequence from the 138th to the 148th base, (c) the sequence from the 164th to the 171st base, or (d) the sequence from the 256th to the 260th base. In the primer 2 of this embodiment, the base sequence included in the primer 2 is a complementary base sequence of a base sequence that includes at least a portion of the base sequence constituting any of the regions indicated by the symbols S5 (S5a to d). In the primer 2 of this embodiment, the complementary base sequence of the consecutive 16 or more base sequence is preferably a complementary base sequence of a base sequence that includes 5 or more consecutive bases (or 6 or more, preferably 7 or more) included in the sequence of any of the regions indicated by the symbols S5 (S5a to d).

[0050] Furthermore, the primer 2 may also be configured to include a complementary region to the insertion or deletion site (base site indicated by the symbol S6) present in the region of the symbol S5 (and the symbol S4 including it). One embodiment that includes complementary sites to the base sites indicated by these symbols S6 (S6a, b) is that the complementary base sequence of a sequence of 16 or more consecutive bases located at a position where primer 1 and primer pair formation is possible is a complementary base sequence of a base sequence containing (a) the two bases "GG" at positions 123 to 124 of Sequence ID No. 1 (a state in which the base that was present between these bases in the closely related species is deleted), or (b) the three bases "GCT" at positions 141 to 143 (a state in which these three bases are inserted in the closely related species). Furthermore, the base sequences of the code S5 (and the code S4 containing it), which include these codes S6 (S6a, b), are identical in all of ITS320A~E and ITS321. The sequence in ITS320A (Sequence No. 1) is also the same in Sequence Nos. 2-5, which represent ITS320B-E: (a) the two bases "GG" at positions 123-124, or (b) the three bases "GCT" at positions 141-143. Furthermore, in Sequence No. 6, which represents ITS321, it is either (a) the two bases "GG" at positions 124-125, or (b) the three bases "GCT" at positions 142-144.

[0051] The primer 2 according to the present invention is preferably a primer that includes at least 16 consecutive bases at the 3' end of the complementary base sequence of the base sequence constituting the primer design region described above. A suitable number of consecutive bases (mer) for which the complementary base sequence of the design region sequence and the sequence of primer 2 are in complete agreement (showing identity) is to include 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive complementary base sequences of the base sequence included in the primer design region. There is no upper limit to the number of consecutive bases as long as the primer function is ensured, but examples include 50 bases or less, 40 bases or less, or 30 bases or less. Furthermore, it is desirable that the primer 2 according to the present invention be designed such that the number of consecutive bases in the nucleotide sequence of the primer 2 that perfectly matches the complementary nucleotide sequence of the corresponding sequence of each closely related species of the genus Streptomyces with respect to the nucleotide sequence of the 3' end of the primer 2 is 14 bases or less (or 13 bases or less, preferably 12 bases or less).

[0052] [Primer Set] The primer set according to the present invention comprises (or consists of) the above-described primer 1 and primer 2. Due to the sequence characteristics of the primers, this primer set can be used as a primer set capable of specifically detecting sweet potato wilt disease fungus (a primer set for detecting sweet potato wilt disease fungus). For primer 1, from the viewpoint of ensuring distinction from similar sequences held by each closely related species of the genus Streptomyces, it is preferable that the number of consecutive bases (at least 16 bases) constituting the 3' end of the PCR primer is a nucleotide sequence that completely matches (shows identity) with the nucleotide sequence constituting the ITS320 type region of the sweet potato wilt fungus. Similarly, for primer 2, it is preferable that the number of consecutive bases (at least 16 bases) constituting the 3' end of the PCR primer is a nucleotide sequence that completely matches (shows identity) with the complementary nucleotide sequence constituting the ITS320 type region of the sweet potato wilt fungus. Furthermore, the primer set may include multiple types of primer 1 and / or primer 2.

[0053] Here, for primer 1 and primer 2, it is permissible to include any base sequence with respect to the base sequence 5' end of the aforementioned consecutive base sequence. For example, with respect to the base sequence in this portion (the base sequence upstream of the primer design region in primer 1, and the complementary strand sequence of the base sequence downstream of the primer design region in primer 2), it is permissible for the base sequence to include a mutation in the ITS320 type region. Furthermore, the nucleotide sequence 5' end to the aforementioned consecutive number of nucleotides may include a nucleotide sequence located 5' from the primer design region (for primer 1, the nucleotide sequence upstream of the primer design region; for primer 2, the complementary strand sequence of the nucleotide sequence downstream of the primer design region). Additionally, the nucleotide sequence 5' end to the aforementioned consecutive number of nucleotides may have other nucleotide sequences added to it; for example, it may include restriction enzyme sites for use in vector insertion or modified nucleotide sequences for introducing various vectors. Furthermore, primers may also be oligonucleotide (or polynucleotide) molecules to which fluorescent substances or labeling substances are attached.

[0054] 3. Various Application Inventions The present invention includes various application inventions utilizing the primer set for detecting sweet potato wilt disease fungus described in paragraph 2 above.

[0055] [Inventions related to kits] The present invention includes an invention relating to a detection kit comprising the above-described primer set for detecting sweet potato wilt disease fungus. That is, the present invention includes an invention relating to a kit for detecting sweet potato wilt disease fungus. In addition to Primer 1 and Primer 2 described above, the kit may also include various other components. For example, the kit may include various reagents, enzymes, purified ITS320 type DNA (DNA for positive control), various primer sets for control or internal standard, etc.

[0056] [Various Methods and Inventions] Method for detecting sweet potato blight fungus The present invention includes an invention relating to a method for detecting sweet potato wilt disease fungus using the primer set described above. The detection method according to the present invention makes it possible to detect the presence of sweet potato wilt disease fungus in a target sample by including the following steps (1) and (2).

[0057] In the detection method according to the present invention, (Step 1) is a step in which a PCR reaction is performed on the target sample using the primer set described above. In step 1, the target sample is placed in the PCR reaction solution and the PCR reaction is performed. While it is preferable to use a purified biological sample (DNA extract or DNA extract solution) with minimal impurities other than DNA as the target sample, any sample can be used as long as it is in a state where the PCR reaction can be performed while added to the PCR reaction solution. For example, parts of plants or processed products (crushed, cut, powdered, paste-like, pureed, ground, dried, juiced, extract, etc.) can be used as target samples. Similarly, parts of soil or processed products (crushed, cut, powdered, ground, dried, extract, etc.) can also be used as target samples. In step 1, it is desirable to perform the PCR reaction with the target sample in an appropriate amount so that the components contained in the target sample do not inhibit the PCR reaction.

[0058] Here, while it is not excluded to use plants other than sweet potatoes as target samples, it is assumed that sweet potatoes will be the primary target. Furthermore, there are no particular restrictions on the parts of the sweet potato plant used as target samples; all or some parts of the plant, and any growth stage can be used. For example, stems, tubers, leaves, vines, roots, terminal buds, lateral buds, flower buds, floral organs, seeds, and seedlings can be used. However, if the purpose is to diagnose infection with sweet potato wilt fungus or to diagnose the disease of sweet potato wilt, it is assumed that parts such as stems and tubers, where disease symptoms are expected to be manifested by pathogenic microorganisms from the soil, will be used. Furthermore, in step 1, species-specific amplification of short-chain DNA amplification fragments that are easily amplified by PCR is achieved due to the sequence characteristics of the primer set according to the present invention. Therefore, even when using plant samples containing many impurities (for example, easily prepared lysates, supernatant of lysates, supernatant of lysates, diluted lysates, etc.), the detection test can be easily performed.

[0059] The PCR reaction performed in step 1 can be carried out by any method, as long as it is a cyclic reaction that follows the principle of the PCR method using the primer set described above. Step 1 can be carried out using any conventional thermal cycler (PCR device) that is capable of rapidly adjusting and maintaining the temperature of the sample tube containing the reaction solution. There are no particular restrictions on the heat-stable DNA polymerase used in this reaction; for example, ordinary Taq polymerase can be used, and it is also possible to use other heat-stable DNA polymerases or various mutant enzymes (for example, KOD polymerase, Pfu polymerase, etc.). The composition of the reaction solution in this reaction can be adjusted according to the type of heat-resistant DNA polymerase used, including appropriate buffering components and salts. Furthermore, the enzyme concentration, primer concentration, and DNA concentration (amount of sample added) can be adjusted to conditions suitable for each method and heat-resistant DNA polymerase.

[0060] The PCR reaction can be performed using conventional PCR methods, such as a 3-step method consisting of "thermal denaturation, annealing, and extension" as one cycle, or a 2-step method consisting of "thermal denaturation, annealing, and extension" as one cycle. Specifically, one cycle involves thermal denaturation of double-stranded DNA to make it single-stranded, annealing a primer with its complementary strand to a specific sequence on the single-stranded DNA (annealing each primer in the primer set), and extending the complementary strand of the template DNA from the 3' end of the primer using a heat-resistant DNA polymerase (extending each primer in the primer set), thereby replicating the double-stranded DNA. This cycle can be repeated to exponentially amplify the DNA fragment containing the base sequence of the region sandwiched between the primer pairs in the primer set. This reaction can be adopted in step 1. Furthermore, step 1 can also be carried out by methods such as quantitative PCR for real-time detection of fluorescent substances, or multiplex PCR using a mixture of other target primers. Here, the temperature conditions for thermal denaturation, annealing, and extension during the PCR reaction can be appropriately set depending on the composition of the PCR reaction solution, the type of heat-resistant DNA polymerase, the base length and GC content of the primers, etc. For example, the thermal denaturation temperature can be 92-100°C (or 94-98°C), the annealing temperature 50-65°C (or 52-60°C), and the extension temperature 66-75°C (or 68-74°C), but the conditions are not limited to these.

[0061] After performing the above (Step 1), the method of the present invention involves (Step 2) a step of detecting the DNA amplification fragment obtained by the PCR reaction. The DNA amplification fragments in step 2 can be detected using any method capable of detecting nucleic acids. For example, PCR amplification fragments can be detected using ethidium bromide, fluorescent substances, chromogenic substances, luminescent substances, radioisotopes, etc., but there are no particular restrictions on these methods. Furthermore, in this nucleic acid detection, it is preferable to perform step 2 in a manner that involves size fractionation of the DNA amplified fragment in order to determine whether primer-specific amplified fragments have been obtained. One method for performing this size fractionation is to perform it by electrophoresis using a gel. It is also possible to perform size fractionation using capillaries or columns. Nucleic acid detection is usually performed after size fractionation, but it is also possible to perform nucleic acid detection while performing size fractionation. Furthermore, (ii) when using nucleic acid probes containing the base sequence of the target DNA, it becomes possible to determine whether primer-specific amplified fragments are obtained without size fractionation. Also, in real-time PCR, which measures the specific binding amount of the fluorescent probe or the amount of fluorescent dye incorporated into double-stranded DNA in real time during the ongoing PCR cycle, specific PCR amplification can be detected by measuring the amount of fluorescent substance without performing electrophoresis.

[0062] In the detection method according to the present invention, if primer-specific DNA amplification fragments are detected after performing steps 1 and 2 above, it can be determined that DNA containing the ITS320 type nucleotide sequence of sweet potato wilt fungus is present in the target sample. That is, if the result of the PCR test is "positive", it is determined that sweet potato wilt fungus is present in the target sample. On the other hand, if no primer-specific DNA amplification fragments are detected after performing steps 1 and 2 above, it can be determined that the target sample does not contain DNA containing the ITS320 type nucleotide sequence of the sweet potato wilt fungus. In other words, if the result of the PCR test is "negative," it can be determined that the sweet potato wilt fungus is not present in the target sample.

[0063] Methods for diagnosing infection, methods for diagnosing illness The present invention includes an invention relating to a method for diagnosing infection with sweet potato wilt fungus based on the detection results of the detection method described above. Furthermore, the present invention includes an invention relating to the diagnosis of disease susceptibility to sweet potato wilt based on the detection results of the detection method described above. In this diagnostic method, it is possible to use all or part of the sweet potato plant body, and any growth stage, as the target of diagnosis. However, it is particularly intended to use parts such as stems and tubers where symptoms caused by the sweet potato wilt fungus are expected to appear. In this respect, this diagnostic method makes it possible to diagnose (determine) whether the symptoms are those of sweet potato wilt when using plant body parts that actually show symptoms.

[0064] In the diagnostic method according to the present invention, if the result of the PCR test using the above detection method is "positive," it can be diagnosed (determined) that the sweet potato plant used as the target sample is infected with the sweet potato wilt fungus. That is, based on this result, it can be diagnosed (determined) that the sweet potato plant (or its plant body) from which the target sample was collected is suffering from sweet potato wilt disease. On the other hand, in the diagnostic method according to the present invention, if the result of the PCR test using the above detection method is "negative," it can be diagnosed (determined) that the sweet potato plant used as the target sample is not infected with the sweet potato wilt fungus. In other words, based on this result, it can be diagnosed (determined) that the sweet potato plant (or its plant body) from which the target sample was collected is not suffering from sweet potato wilt disease. [Examples]

[0065] The present invention will be described below with reference to examples, but the scope of the present invention is not limited thereto.

[0066] [Experimental Method 1] In the following experimental examples, unless otherwise specified, the tests and analyses were performed using the methods and conditions described below.

[0067] (1) DNA extraction and PCR reaction For each experimental example, DNA-containing samples prepared or modified were subjected to amplification of DNA fragments by PCR using the primer set specified for each experimental example.

[0068] (PCR reaction solution) Takara Ex taq Hot Start 0.25μL 10×Ex taq buffer 5μL Forward primer solution (10 pmol / μL) 1 μL Reverse primer solution (10 pmol / μL) 1 μL 4μL of 2.5mM dNTP solution Sample DNA (20ng / μL) 1μL Sterile ultrapure water 37.75μL (Total 50μL) (PCR conditions) 95℃ 5 minutes 25 cycles × (98°C 10 seconds → 60°C 30 seconds → 72°C 30 seconds) 4℃ until sample collection

[0069] Loading dye (blue dye) was added to the reaction mixture after the above PCR reaction, and the mixture was applied to a 1.5% agarose gel. Electrophoresis was performed in 1×TAE buffer to separate DNA amplification fragments according to their size. The gel after electrophoresis was stained with ethidium bromide solution, and the separated DNA amplification fragments were detected as bands by UV irradiation.

[0070] [Experimental Example 1] Analysis of the ITS region of sweet potato blight fungus We analyzed the nucleotide sequences of the 16S-23S rRNA intergenetic spacer region (ITS region) in sweet potato blight pathogens isolated from various parts of Japan, and searched for primer design regions that can specifically detect only the sweet potato blight pathogen.

[0071] (1) Deciphering the base sequence of the ITS region DNA was extracted from the mycelium of 99 strains of Streptomyces ipomoeae, the sweet potato wilt disease fungus, isolated from various locations and fields across Japan (13 different regions and fields) owned by the applicant, the National Agriculture and Food Research Organization (NARO). Focusing on the 16S rRNA and 23S rRNA genes, which are located on either side of the ITS region and have sequences that are highly conserved across organisms, a PCR primer consisting of the nucleotide sequence described in SEQ ID NO: 13 (16S rDNA forward primer) was used as a forward primer corresponding to the region of the 16S rRNA gene near the ITS, and a PCR primer consisting of the nucleotide sequence described in SEQ ID NO: 14 (23S rDNA reverse primer) was used as a reverse primer corresponding to the region of the 23S rRNA gene near the ITS. A PCR reaction was performed according to experimental method 1 described above. Each amplified DNA fragment was recovered, its base sequence was determined using a DNA sequencer, and then a comparative analysis of the base sequences was performed together with those of a US-derived strain to classify the type of ITS region possessed by each strain. The results are shown in Table 1.

[0072] As a result, it was revealed that the ITS region of sweet potato blight fungi isolated from various parts of Japan (13 different regions and fields) possesses two types of size polymorphism: an ITS region consisting of 320 bp (ITS320 type) and an ITS region consisting of 309 bp (ITS309 type). Each size variation has subtypes (ITS320A~E, ITS309A~F) based on nucleotide mutations. In addition, the US-derived strains used as additional samples also contained subtypes (ITS321, ITS310) corresponding to these regions. Upon reviewing this information, it was found that the 99 strains from various parts of Japan could be classified into nine types based on combinations of ITS types of different sizes and subtypes resulting from variations in those types.

[0073] Among the 13 Japanese strains, some strains possessed both ITS320 and ITS309 size variations in their genomic DNA, while others possessed only the ITS320 type in their genomic DNA. The results showed that five of the 13 systems from across Japan possessed ITS309, but the ITS areas belonging to the "ITS320 type" were common to all 13 systems from across Japan.

[0074] [Table 1]

[0075] (2) Alignment analysis for the ITS320 type domain Alignment analysis was performed on the nucleotide sequences of ITS320A to ITS320E (sequence numbers 1 to 5, respectively) held by the Japanese strains of sweet potato wilt disease fungus decoded above, and the nucleotide sequence of ITS321 (sequence number 6) of the strain originating from the United States, with the nucleotide sequences of the corresponding regions of other Streptomyces actinomycetes that showed a close relationship with sweet potato wilt disease fungus. The nucleotide sequences of the ITS320 type corresponding region, which shows the closest relationship to the sweet potato wilt fungus, were obtained by performing a homology search in the NCBI database. These sequences were obtained for S. dengpaensis (accession number: CP026652), S. coeruleorubidus (accession number: CP023694), and S. neyagawaensis (accession number: AB042783), and were used as sequence numbers 7-9, respectively. The alignment analysis was performed using the analysis software GENETYX. Figures 2 and 3 show the alignment analysis results using all sequences, including closely related species. Figures 4 and 5 show the alignment analysis results using only the sequence of the sweet potato blight fungus.

[0076] Alignment analysis revealed that the nucleotide sequences of ITS320A-ITS320E from all strains of sweet potato blight fungus from across Japan (13 strains from 13 different regions and fields in Japan) and ITS321 from a US strain showed extremely high sequence identity across the entire region among the strains of sweet potato blight fungus. On the other hand, while the nucleotide sequences constituting these sweet potato blight fungus ITS320 type regions showed high identity with the corresponding regions of other closely related species of the genus Streptomyces, it was also shown that there were regions with low or slightly low similarity to other closely related species of the genus Streptomyces among the highly conserved regions (see alignment in Figures 2 and 3). In this respect, the ITS320 type region was found to be a region with somewhat slower sequence conservation (molecular evolutionary rate) compared to the 23S rRNA gene, which has extremely high sequence conservation due to functional constraints (functions related to ribosomes common in life activities).

[0077] The ITS320 type region of the sweet potato blight pathogen contained a region whose nucleotide sequence near its upstream area was identical across all strains of the sweet potato blight pathogen, while simultaneously exhibiting remarkably low sequence identity with closely related species of the genus Streptomyces (the nucleotide sequence from the 19th to the 35th position in the alignment shown in Figures 2, 3 or 4, 5: the region indicated by the code S2). This region corresponds to the region indicated by the nucleotide sequence from the 19th to the 35th position in the nucleotide sequences described in Sequence IDs 1-6 (ITS320A-E and ITS321). Furthermore, this region contained a nucleotide sequence that was consistent across all strains of the sweet potato blight fungus, but was completely absent in any closely related species of the genus Streptomyces (the nucleotide sequence from the 19th to the 23rd position in the alignment shown in Figures 2, 3 or 4, 5, indicated by the code S1, "GGATC"). This region corresponds to the nucleotide sequence from the 19th to the 23rd position in the nucleotide sequences described in Sequence IDs 1-6 (ITS320A-E and ITS321). The sequence representing this region contained an "insertion mutation" specific to the sweet potato blight fungus from the perspective of closely related species. This sequence was designated as "species-specific sequence 1".

[0078] The sequence characteristics of the upstream region, including the species-specific sequence 1 described above, were found to be characteristics that indicate it is a region suitable for designing forward primers capable of specifically amplifying the nucleotide sequence of the ITS320 type region of sweet potato blight fungus, distinguishing it from closely related species. Furthermore, within the entire ITS320 type region, there were regions downstream of the specific primer design region that showed somewhat lower similarity to each closely related species (regions indicated by the code S5 in the alignments of Figures 2 and 3). However, these regions indicated by the code S5 (S5a to S5d) showed somewhat lower species specificity compared to the region containing the species-specific sequence 1 mentioned above, which showed high specificity to the blight-causing fungus (the 17-base region indicated by the code S2), and their region length was short, approximately 5 to 12 bases excluding the gap "-". In addition, the regions indicated by the code S5 (S5a to S5d) are located in the middle to end of the ITS320 type region, and were deemed unsuitable as design locations for forward primers because they narrow the design location for reverse primers.

[0079] [Experiment Example 2] Detection of sweet potato blight fungus Focusing on the "species-specific sequence 1" specific to the sweet potato blight fungus identified above, we designed a specific primer capable of detecting only the sweet potato blight fungus and verified whether it could detect all 13 strains of the sweet potato blight fungus from various locations across Japan (13 different regions and fields).

[0080] (1) Design of primers specific to sweet potato blight fungus To detect the ITS320 type of sweet potato wilt fungus, we designed forward primers (primer 1) that contain a species-specific sequence 1 specific to sweet potato wilt fungus in their nucleotide sequence. Specifically, we designed two types of forward primers as primer 1: a PCR primer (Si-ITS320 forward primer 1-1) consisting of the nucleotide sequence described in Sequence ID No. 10, and a PCR primer (Si-ITS320 forward primer 1-2) consisting of the nucleotide sequence described in Sequence ID No. 11. These two types of forward primers (primer 1) are primers designed to correspond to the polymorphic region (the 16th base position in the alignment shown in Figures 2, 3 or 4, 5: "T" or "C") that contains the "species-specific sequence 1 (region indicated by symbol 1)" which is specific to sweet potato wilt fungus and is located slightly upstream of it. The design positions of these forward primers correspond to the base sequences from the 10th to the 29th base position in the alignment shown in Figures 2, 3 or 4, 5 (the base sequences from the 10th to the 29th base position of sequence numbers 1 to 6, which represent ITS320A to E and ITS321). Here, Si-ITS320 forward primer 1-1 is the primer corresponding to the case where the 16th base in the alignment shown in Figures 2,3 or 4,5 is "T", and Si-ITS320 forward primer 1-2 is the primer corresponding to the case where the base is "C". In the PCR reaction in this example, the PCR reaction is carried out with these two forward primers mixed in the reaction solution (used as degenerate primers). Furthermore, since the corresponding regions from other closely related species of the genus Streptomyces do not contain species-specific sequence 1 specific to the sweet potato wilt fungus (because it contains an insertion mutation specific to the sweet potato wilt fungus), primer-specific DNA amplification fragments cannot be obtained by performing a PCR reaction using these primers, according to the principles of PCR.

[0081] As a reverse primer (complementary strand direction primer) that pairs with the above-mentioned forward primer (forward strand direction primer), a PCR primer (Si-ITS320 reverse primer 2) consisting of the nucleotide sequence described in Sequence ID No. 12 was designed. This primer is designed so that when PCR is performed with the above-mentioned primer 1, a DNA amplification fragment of 134 bp or 135 bp (95 bp or 96 bp without the primer) is detected. Furthermore, this primer 2 is a complementary strand direction primer designed to include a complementary nucleotide sequence of a portion of the nucleotide sequence in the region downstream of sweet potato blight-specific sequence 1 that shows some specificity for sweet potato blight (indicated by the symbol S5b). The design position of the reverse primer corresponds to the nucleotide sequence from position 128 to position 146 in the alignment shown in Figures 2 and 3 (the nucleotide sequence from position 125 to position 143 of sequence numbers 1 to 5, which represent ITS320A to E, and the nucleotide sequence from position 126 to position 144 of sequence number 6, which represents ITS321).

[0082] (2) PCR amplification reaction PCR was performed on DNA samples extracted from sweet potato blight fungus (13 strains from Japan and 1 strain from the United States, taken from 13 different regions and fields) as shown in Table 1, using two types of forward primers and one type of reverse primer designed in (1) above. The PCR reaction was performed in accordance with experimental method 1 described above, except that the PCR reaction solution described below was used. The resulting electrophoretic images are shown in Figure 6, and the results of detection (positive reaction: +, negative reaction: -) are shown in Table 2.

[0083] (PCR reaction solution) Takara Ex taq Hot Start 0.25μL 10×Ex taq buffer 5μL Mixed forward primer solution (10 pmol / μL each) 2 μL Reverse primer solution (10 pmol / μL) 1 μL 4μL of 2.5mM dNTP solution Sample DNA (20ng / μL) 1μL Sterile ultrapure water 36.75μL (Total 50μL)

[0084] As a result, in all samples of sweet potato blight fungus subjected to PCR (13 strains of Japanese strains from 13 different regions and fields, and 1 strain from the United States), it was confirmed that DNA amplification fragments (primer-specific amplification fragments) with a size matching the base length (134 bp or 135 bp) of the DNA amplification fragments expected from the primer set designed above were detected in all samples. (In this experimental example, although the band was faint on the gel image, it was confirmed that specific amplification fragments with the above primers were detected in samples 2-5 as well.) The results above demonstrate that by designing forward primers focusing on "species-specific sequence 1," which is specific to sweet potato wilt disease and located upstream of the ITS320 type region of the sweet potato wilt disease fungus, a PCR primer set capable of broadly detecting various strains of sweet potato wilt disease fungus can be designed.

[0085] [Table 2]

[0086] [Experimental Example 3] Detection of sweet potato wilt fungus from a diluted grind of sweet potato plant material. We investigated whether it was possible to detect the sweet potato wilt fungus by PCR reaction using the above-designed primers with a diluted, ground solution of sweet potato plants exhibiting symptoms of sweet potato wilt disease.

[0087] (1) Cultivation of sweet potato plants in soil contaminated with fungi The mycelium of the sweet potato damping-off fungus (C-T30-2 strain) was suspended in water, diluted, and sprayed onto soil placed in pots. Seedlings of each strain of sweet potato plant shown in Table 3 were then planted and cultivated, and after two weeks, it was confirmed that symptoms of sweet potato damping-off disease had appeared on the stems of each sweet potato plant (see Figure 7).

[0088] (2) PCR detection using diluted plant material grinding solution as a sample From the sweet potato plants cultivated as described above, portions of stems showing external disease symptoms (parts with symptoms and parts with mild symptoms), and portions of stems without symptoms (parts that appear healthy) were collected. Each portion was ground with 10 times the volume of TE buffer, and the supernatant obtained by centrifugation was diluted 5 times with TE buffer to obtain a solution. Each of the obtained ground dilutions was used as a sample, and a PCR reaction was performed in the same manner as described in Experimental Example 2(2), except that the PCR reaction mixture was used, with the two forward primers and one reverse primer designed in Experimental Example 2(1) described above. As a positive control, the DNA extract of the C-T30-2 line (sample 2-1), whose primer-specific amplification had been confirmed in Experimental Example 2, was used as the sample, and a PCR reaction was performed in the same manner. The obtained electrophoretic images are shown in Figure 8, and the results of the detection status (positive reaction: +, negative reaction: -) are shown in Table 3.

[0089] (PCR reaction solution) Takara Ex taq Hot Start 0.1μL 2×Ampdirect buffer 10 μL Mixed forward primer solution (10 pmol / μL each) 0.8 μL Reverse primer solution (10 pmol / μL) 0.4 μL Sample (ground and diluted plant material) 1 μL Sterile ultrapure water 7.7μL (Total 20μL)

[0090] As a result, it was shown that in all three strains of sweet potato plants used in this study, when a diluted grind of plant tissue (stem) exhibiting symptoms of sweet potato damping-off was subjected to a PCR reaction, the test result was positive, confirming that the presence of sweet potato damping-off fungus can be easily detected. Furthermore, even in samples 3-6, which showed only mild external symptoms, the PCR reaction was positive, although the amount of DNA detected was small. On the other hand, in all three strains of sweet potato plants, when a diluted grind of plant tissue (stem) that did not exhibit symptoms of sweet potato wilt was subjected to a PCR reaction, the test result was negative, indicating that the presence of sweet potato wilt fungus was not detected.

[0091] The results above demonstrate that by performing a PCR reaction using the sweet potato wilt fungus-specific primer set designed in Experimental Example 2, the presence of sweet potato wilt fungus can be accurately and easily detected even from a sample solution obtained by grinding sweet potato plants and diluting the supernatant. This finding is considered to be useful in diagnosing diseases in sweet potato plants with similar external symptoms, as it allows for easy diagnosis of whether or not a disease is sweet potato wilt.

[0092] [Table 3]

[0093] [Information about base sequences] The following information pertains to the nucleotide sequence of this invention. The English title of this invention, as listed in the attached sequence listing, is "Primer set for detecting sweetpotato soil rot pathogen and method for diagnosing infection with the sweetpotato soil rot pathogen using the primer set."

[0094] (1) Sequence ID 1 • Sequence name: ITS320A • Base length: 320 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCATCAGGATCCCTTCGGGGGCCTGGTCAGAGGCCAGGACATCAGCGAACGTCTGATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCGGGACGACCAGGCGCTAGTACTGCCCCTGCTGGGGGCGTGGAACG CTGATCTGGTCGGCTGGTCGTGCCGGGCACGCTGTTGGGTGTCTGAGGGTGCGAGCGTTGCTCGCCCTTCACGATGCCGGCCCCGGGTGCAGCGCCGCGTGATGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0095] (2) Sequence ID 2 • Sequence name: ITS320B • Base length: 320 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCATCAGGATCCCTTCGGGGGCCTGGTCAGAGGCCAGGACATCAGCGAACGTCTAATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCGGGACGGACCAGGCGCTAGTACTGCCCCTGCTGGGGGCGTGGAACG CTGATCTGGTCGGCTGGTCGTGCCGGGCACGCTGTTGGGTGTCTGAGGGTGCGAGCGTTGCTCGCCCTTCACGATGCCGGCCCCGGGTGCAGCGCCGCGTGATGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0096] (3) Sequence ID 3 • Sequence name: ITS320C • Base length: 320 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCACCAGGATCCCTTCGGGGGCCTGGTCAGAGGCCAGGACATCAGCGAACGTCTGATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCGGGACGGACCAGGCGCTAGTACTGCCCCTGCTGGGGGCGTGGAACG CTGATCTGGTCGGCTGACCGTGCCGGGCACGCTGTTGGGTGTCTGAGGGTGCGAGCGTTGCTCGCCCTTCACGATGCCGGCCCCGGTGCAGCACCGCGTGATGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0097] (4) Sequence ID 4 • Sequence name: ITS320D • Base length: 320 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCACCAGGATCCCTTCGGGGGCCTGGTCAGAGGCCAGGACATCAGCGAACGTCTGATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCGGGACGGACCAGGCGCTAGTACTGCCCCTGCTGGGGGCGTGGAACG CTGATCTGGTCGGCTGGTCGTGCCGGGCACGCTGTTGGGTGTCTGAGGGTGCGAGCGTTGCTTGCCCTTCACGATGCCGGCCCCGGTGTAGCACCGCGTGATGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0098] (5) Sequence ID 5 • Sequence name: ITS320E • Base length: 320 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCACCAGGATCCCTTCGGGGGCCTGGTCAGAGGCCAGGACATCAGCGAACGTCTGATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCGGGACGGACCAGGCGCTAGTACTGCCCCTGCTGGGGGCGTGGAACG CTGATCTGGTCGGCTGGTCGTGCCGGGCACGCTGTTGGGTGTCTGAGGGTGCGAGCGTTGCTCGCCCTTCACGATGCCGGCCCCGGTGCAGCACCGCGTGATGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0099] (6) Sequence ID 6 • Array name: ITS321 • Base length: 321 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCATCAGGATCCCTTCGGGGGCCTGGTCAGAGGCCAGGACATCAGCGAACGTCTGATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCCAGGACGGACCAGGCGCTAGTACTGCCCCTGCTGGGGGCGTGGAAC GCTGATCTGGTCGGCTGGTCGTGCCGGGCACGCTGTTGGGTGTCTGAGGGTGCGAGCGTTGCTCGCCCTTCATGATGCCGGCCCCGGTGCAGCACTGCGTGATGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0100] (7) Sequence ID 7 • Sequence name: Sd-ITS320 homologue • Base length: 316 ·Molecular species: genomic DNA • Origin: Streptomyces dengpaensis • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTCACCAACGACCTTCGGGACTTGGTCAGAGGCCAGTACATCGGCGAACGTCCGATGCTGGTTGCTCATGGGTGGAACGTTGATTATTCGGCATCTTCAGCCAACTCGGCTTGCTAGTACTGCTCTTCGGAGTGTGGAACGCG GATCATGGGTGGTAGGGGTGTCGGGCACGCTGTTGGGTGTCTGAGGGTACGGCCGAATGTGGCTGCCTTCAGTGCCGGCCCAGTGCACTCGGACTACTGGTTCGGGGTGATGGGTGGTTGGTCGTTGTTTGAGAGAACTGCACAGTGGACGCGAGCATCTGT

[0101] (8) Sequence ID 8 • Sequence name: Sc-ITS320 homologue • Base length: 308 ·Molecular species: genomic DNA • Origin: Streptomyces coeruleorubidus • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTTACCGATCCCCTCGGGGTGAGGTCAGAGGCCAGTACATCAGCGAATGTCTGATGCTGGTTGCTCATGGGTGGAACGTTGACTATTCGGCATCTTCAGCCAACTCGGGCTGCTAGTACTGCTCTTCGGAGCGTGGAACG CGGACCACGAGAGGCCAGGGGTGGTCGGGCACGCTGTTGGGTGTCTGAGGGAATGGATTTTTCCTAGTCGCCGGCCCCAGTGAACTCGGATCGAAGGTCCGGGGTGATGGGTGGCTGGTCGTTGTTTGAGAACTGCACAGTGGACGCGAGCATCTGT

[0102] (9) Sequence ID 9 • Sequence name: Sn-ITS320 homologue • Base length: 307 ·Molecular species: genomic DNA • Origin: Streptomyces neyagawaensis • Sequence characteristics: As described herein Base sequence: AAGGAGCACTTCTAGCCGGGCTTCGGCCTGGTTCAGAGGCCAGAACATCAGCGAATGTCTGATGCTGGTAGCTCATGGGTGGAACGTTGATTATTCGGCACGGTCGGTATGGGTGAGAGCGCTAGTACTGCTTCGGCGTGGAACGCGAAG CTCATCAACTGACCGGGTCGGGCACGCTGTTGGGTATCTGAGGGTGCGAGCGTTGCTCGCTCTTCACGATGCCGGCCCCGGTGTAGCACCGCTTAGGTGGTGTGACGGGTGGTTGGTCGTTGTTTGAGAACTGCACAGTGGACGCGAGCATCTGT

[0103] (10) Sequence ID 10 • Sequence name: Si-ITS320 forward primer 1-1 • Base length: 20 ·Molecular species: other DNA • Origin: synthetic construct • Sequence characteristics: PCR primer (fwd), details are described herein. • Nucleotide sequence: TTCTCATCAGGATCCCTTCG

[0104] (11) Sequence ID 11 • Sequence name: Si-ITS320 forward primer 1-2 • Base length: 20 ·Molecular species: other DNA • Origin: synthetic construct • Sequence characteristics: PCR primer (fwd), details are described herein. • Nucleotide sequence: TTCTCACCAGGATCCCTTCG

[0105] (12) Sequence ID 12 • Sequence name: Si-ITS320 reverse primer 2 • Base length: 19 ·Molecular species: other DNA • Origin: synthetic construct • Sequence characteristics: PCR primer (rev), details are described herein. • Base sequence: AGCAGGGGCAGTACTAGCG

[0106] (13) Sequence ID 13 • Sequence name: 16S rDNA forward primer • Base length: 20 ·Molecular species: other DNA • Origin: synthetic construct • Sequence characteristics: PCR primer (fwd), details are described herein. • Base sequence: CCGGTCTCAGTTCGGATTGG

[0107] (14) Sequence ID 14 • Sequence name: 23S rDNA reverse primer • Base length: 26 ·Molecular species: other DNA • Origin: synthetic construct • Sequence characteristics: PCR primer (rev), details are described herein. • Nucleotide sequence: CACGTCCTTCATCGGTTCCTGGTGCC

[0108] (15) Sequence ID 15 • Sequence name: S3 region sequence • Base length: 35 ·Molecular species: genomic DNA • Origin: Streptomyces ipomoeae • Sequence characteristics: Position 16 C or T, details are described in this specification. • Base sequence: AAGGAGCACTTCTCAYCAGGATCCCTTCGGGGGCC [Industrial applicability]

[0109] The Japan Society for Plant Medicine has established a plant hospital network and is engaged in activities to diagnose and treat plant diseases. The University of Tokyo has also established a plant hospital and accepts requests for diagnoses. This invention is expected to be used in the field of plant disease diagnosis, specifically for diagnosing diseases in sweet potato plants. [Explanation of Symbols]

[0110] 30a: ITS320 type region of sweet potato blight fungus 31: Region showing "species-specific sequence 1" specific to sweet potato blight fungus. 41a: 16S rRNA gene adjacent to the upstream side of the ITS320 type region of sweet potato blight fungus 42a: 23S rRNA gene adjacent to the downstream side of the ITS320 type region of sweet potato blight fungus 51: Forward primers constituting the primer set for detecting sweet potato wilt disease fungus (Primer 1: Sweet potato wilt disease fungus-specific primer) 52: Reverse primer (Primer 2: Complementary chain direction primer) that constitutes the primer set for detecting sweet potato blight.

[0111] 30b: Regions corresponding to the ITS320 type region in each closely related species of the genus Streptomyces. 41b: 16S rRNA genes adjacent to the upstream side of the region corresponding to the ITS320 type region in each closely related species of the genus Streptomyces. 42b: 23S rRNA genes adjacent to the downstream side of the region corresponding to the ITS320 type region in each closely related species of the genus Streptomyces.

[0112] 60: Stems of sweet potato plants grown in soil contaminated with sweet potato wilt fungus. 61: Parts of the sweet potato plant showing symptoms of wilt disease.

[0113] S1: Region showing "species-specific sequence 1" specific to sweet potato blight fungus (region essential for primer 1) S2: Regarding the first half of the ITS320 type sweet potato blight fungus, this region, which includes species-specific sequence 1, shows high specificity to the blight fungus (a region included in the primer 1 design region). S3: Design area for type-specific primers for ITS320, a type of sweet potato blight-causing fungus (Primer 1 design area) S7: Regarding the first half of the ITS320 type of sweet potato blight fungus, this region has the same base sequence in all of ITS320A-E and ITS321 types of sweet potato blight fungus (a region relating to one aspect of primer 1).

[0114] S4 (S4a~e): Regarding the middle to late region of the sweet potato blight fungus ITS320 type, this region has the same base sequence in all of the sweet potato blight fungi ITS320A~E and ITS321 (a region relating to one aspect of primer 2). S5 (S5a~d): Regarding the mid-to-late range of the sweet potato damping-off pathogen ITS320 type, this region shows some specificity to the damping-off pathogen (a region relating to one aspect of primer 2). S6 (S6a, b): Regions in the middle to late part of the ITS320 type sweet potato damping-off fungus that show insertions or deletions specific to damping-off fungus (regions relating to one aspect of primer 2).

Claims

1. A primer set for PCR amplification of DNA fragments containing the base sequence of the ITS320 type region of the sweet potato blight fungus, comprising a sweet potato blight fungus-specific primer (forward primer) and a complementary-strand-oriented primer (reverse primer) that forms a primer pair with the aforementioned primer. ; This primer set, A PCR primer that includes a sequence of 16 or more consecutive bases at its 3' end, which is contained in the base sequence from the 1st to the 35th base of Sequence ID No. 1 indicating ITS320A (the base sequence constituting the ITS320 type-specific primer design region of the sweet potato wilt fungus ITS320), and which includes a PCR primer that contains a "species-specific sequence 1" (the base sequence from the 19th to the 23rd base of Sequence ID No. 1) specific to the sweet potato wilt fungus, as the PCR primer (primer 1-1) corresponding to the sweet potato wilt fungus-specific primer. ; If the "sequence of 16 or more consecutive bases" relating to the above primer 1-1 includes the 16th base "T" of sequence number 1, The primer set includes primer 1-1 and primer 1-2 described below as PCR primers corresponding to the above-mentioned primers specific to sweet potato blight fungus. The primers 1-2 are PCR primers that include at their 3' end a sequence of 16 or more consecutive bases contained in the base sequence from the 1st to the 35th base of Sequence ID No. 3, which represents ITS320C (the base sequence constituting the ITS320 type-specific primer design region of the sweet potato wilt fungus), and the PCR primers that include a "species-specific sequence 1" (the base sequence from the 19th to the 23rd base of Sequence ID No. 3) that is specific to the sweet potato wilt fungus. The "sequence of 16 or more consecutive bases" relating to primer 1-2 includes the 16th base "C" of sequence number 3. ; Primer set for detecting sweet potato wilt disease fungus.

2. Regarding the above primer set, The above primer 1-1 is a PCR primer that contains the 16th base "T" of SEQ ID NO: 1 in the sequence of 16 or more consecutive bases, The above primers 1-2 are PCR primers that contain the 16th base "C" of SEQ ID NO: 3 in the sequence of 16 or more consecutive bases. A primer set for detecting sweet potato wilt disease fungus according to claim 1.

3. Regarding the above primer set, The above primer 1-1 is a PCR primer that includes a sequence of 16 or more consecutive bases contained in the base sequence from the 17th to the 35th base of Sequence ID No. 1 representing ITS320A (a base sequence that is completely identical in all of ITS320A-E and ITS321) at its 3' end. The above primer set does not include the above primers 1-2. A primer set for detecting sweet potato wilt disease fungus according to claim 1.

4. The primers in the complementary chain direction (reverse primers) described above, A PCR primer that includes at its 3' end a complementary base sequence of 16 or more consecutive bases at a position in the base sequence constituting ITS320A (the base sequence described in Sequence ID No. 1) where it can form a primer pair with the sweet potato blight-specific primer, A PCR primer containing, at its 3' end, a complementary sequence of 16 or more consecutive bases within any of the following base sequences of Sequence ID No. 1, which represents ITS320A, a base sequence that is completely identical to all of ITS320A-E and ITS321: (a) base sequence from 68 to 111, (b) base sequence from 113 to 173, (c) base sequence from 176 to 219, (d) base sequence from 230 to 245, or (e) base sequence from 253 to 320. A primer set for detecting sweet potato wilt disease fungus according to claim 1.

5. The description of the above primer as "a sequence of 16 or more consecutive bases" actually refers to "a sequence of 19 or more consecutive bases." A primer set for detecting sweet potato wilt disease fungus according to claim 1.

6. A kit for detecting sweet potato wilt disease fungus, comprising the primer set described in claim 1.

7. A method for detecting sweet potato wilt fungus, comprising: (Step 1) performing a PCR reaction on a target sample using the primer set described in claim 1; and (Step 2) detecting the DNA amplification fragment obtained by the PCR reaction.

8. Using a sweet potato plant as the target sample, perform steps (1) and (2) described in claim 7; In step 2, if the DNA amplification fragment is detected, it is determined that the sweet potato plant used as the target sample is infected with the sweet potato wilt fungus; if the DNA amplification fragment is not detected, it is determined that the sweet potato plant used as the target sample is not infected with the sweet potato wilt fungus. A diagnostic method for infection of sweet potato plants with the sweet potato blight fungus.