Topical and oral preparations for the skin

Abstract

To provide a novel external agent or internal agent having excellent collagen production-promoting effect, MMP inhibitory effect and hyaluronic acid production-promoting effect.SOLUTION: Ligusticum Sinense extract has excellent collagen production-promoting effect, MMP inhibitory effect and hyaluronic acid production-promoting effect, and also has excellent stability. Ligusticum Sinense extract can be used not only for a cosmetic field such as preventing skin aging, but also a medical field such as suppression of dysfunction by aging, prevention, treatment or the like of cancer, and application to cosmetics, food products, quasi drugs and medicines or the like is expected.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a collagen production promoter, an MMP inhibitor, a hyaluronic acid production promoter, and an internal preparation.

Background Art

[0002] In the dermis, there are fibroblasts and collagen, and type I collagen accounts for 80% of the whole. In addition to type I collagen, the presence of types III, V, XII, and XIV collagen is known. A decrease in type I collagen is cited as one of the causes of wrinkles and sagging. Therefore, it is considered effective in preventing and improving wrinkles and sagging to promote the production of type I collagen. In addition, promoting the production of type I collagen is also effective in improving skin wound healing.

[0003] In addition to ultraviolet rays, the skin is daily exposed to various physical and chemical stresses such as dryness, cold, heat, and drugs. As a result, the skin function deteriorates, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles and are temporarily caused by a decrease in the water content in epidermal keratin moisture due to skin dryness. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in sunlight or aging. As the formation mechanism, there are cited a decrease in the collagen synthesis ability in dermal fibroblasts due to ultraviolet rays or aging, and an acceleration of collagen degradation due to an increase in matrix metalloproteinase (MMP).

[0004] So far, for the purpose of improving dermal wrinkles caused by ultraviolet rays, a wrinkle formation prevention and improvement agent for skin containing hydrolyzed almond as an active ingredient (Patent Document 1), and an improvement agent for wrinkles caused by ultraviolet irradiation containing extracts of Ligusticum chuanxiong, Angelica acutiloba, and Centaurea cyanus as active ingredients (Patent Document 2) have been reported.

[0005] MMPs play a major role in the interstitial infiltration of cancer cells, their invasion into blood vessels, and angiogenesis. The stroma is mainly composed of type I collagen, and the movement of cancer cells requires the destruction of the matrix by interstitial collagenases, etc. For metastasis to be completed, it is necessary to destroy the vascular endothelial basement membrane and move within the stroma, and MMPs are also involved at this stage (Non-Patent Literature 1). Therefore, substances that have inhibitory activity against MMPs are expected to have the effect of suppressing angiogenesis and cancer metastasis in cancer tissue, and are considered useful in the prevention and treatment of cancer. Thus, inhibition of MMPs is useful in the prevention, treatment, and improvement of various diseases caused by increased MMP levels, such as cancer, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0006] Collagenase (MMP-1), belonging to the MMP group, is an enzyme produced by fibroblasts and chondrocytes, and plays a major role in promoting collagen degradation. Collagen is a major structural protein that makes up about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, gums, and skin. When collagen is cleaved at one point by collagenase, the collagen molecule, which is normally stable in tissues, denatures into single-chain gelatin, which is then broken down by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer, ulcer formation, osteoporosis, and periodontitis.

[0007] Materials possessing collagenase inhibitory activity have been proposed, such as cocoa husk extract (Patent Document 3), raspberry extract (Patent Document 4), and lactoferrin (Patent Document 5). Given the increasing concern for skin aging and oral hygiene, there is a growing need to discover materials with excellent collagenase inhibitory effects that are safe, have no side effects, and are highly effective in inhibiting collagenase activity.

[0008] Gelatinase (MMP-2), belonging to the MMP group, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that make up special components of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is broken down by gelatinase, the risk of diseases such as cancer, arteriosclerosis, and rheumatoid arthritis, as well as injuries such as ligament rupture, increases.

[0009] Furthermore, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile and elastic properties.

[0010] Hyaluronic acid, in particular, is known as a high-molecular-weight polysaccharide widely distributed in connective tissue, exhibiting a gel-like form in the dermis and maintaining skin elasticity. Therefore, the degradation or decrease of hyaluronic acid is considered important in skin aging. Furthermore, because hyaluronic acid is a high-molecular-weight substance, there has been a problem in that cosmetics containing it are not easily absorbed when applied directly to the skin. For this reason, there has been a search for topical skin preparations that can promote the production of collagen and hyaluronic acid by activating fibroblasts (Patent Document 6).

[0011] Hyaluronic acid is also present in joints and is known to play a role in cushioning the impact of joint loads and smoothing joint movement. The hyaluronic acid concentration in normal human synovial fluid is approximately 2.3 mg / mL, but in rheumatoid arthritis, the hyaluronic acid concentration in synovial fluid decreases to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also decreases significantly (Non-Patent Literature 2). Furthermore, it is known that a decrease in hyaluronic acid content occurs in septic arthritis and gouty arthritis, similar to the case of rheumatoid arthritis (Non-Patent Literature 3). In the above diseases, increasing the amount of hyaluronic acid in synovial fluid is considered in order to improve lubrication function, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that joint injection of sodium hyaluronate in patients with rheumatoid arthritis improves the above symptoms (Non-Patent Literature 4). However, treatment for the above diseases is long-term. Therefore, there is a need for topical skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters that can be easily used for prevention and treatment in daily life.

[0012] Floaters are a condition in which faint shadows resembling threads or mosquitoes appear in the field of vision. They are caused by opacities in the vitreous humor, which fills the inside of the eye, casting shadows on the retina. Floaters can be broadly divided into two types: physiological floaters, which are caused by factors such as aging, ultraviolet radiation, and reactive oxygen species, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous humor, and the subsequent breakdown of collagen fibers, which causes opacities in the vitreous humor. Treatment options include vitrectomy surgery and laser treatment, but these procedures are not commonly performed in Japan due to safety concerns, and treatment abroad is very expensive. Therefore, there is a need for foods and medicines containing hyaluronic acid production promoters that can be used on a daily basis to prevent and improve physiological floaters.

[0013] Ligusticum sinense is a perennial herb belonging to the Apiaceae family. The herbal medicine Kouhon is made from the dried roots and rhizomes of this plant. Until now, it has been known that extracts of Ligusticum sinense have a skin-whitening effect due to tyrosinase inhibitory activity (Patent Document 7), an effect of promoting blood circulation in the skin (Patent Document 8), and an effect of promoting lipolysis (Patent Document 9). However, it was not known that extracts of Ligusticum sinense have collagen production promoting effects, MMP inhibitory effects, and hyaluronic acid production promoting effects. [Prior art documents] [Patent Documents]

[0014] [Patent Document 1] Japanese Patent Publication No. 2000-119125 [Patent Document 2] Japanese Patent Publication No. 2006-199611 [Patent Document 3] Japanese Patent Application Publication No. 3-44331 [Patent Document 4] Japanese Patent Publication No. 2003-137801 [Patent Document 5] Japanese Patent Application Publication No. 5-186368 [Patent Document 6] Japanese Patent Publication No. 2007-1924 [Patent Document 7] Japanese Patent Application Publication No. 53-88333 [Patent Document 8] Japanese Patent Publication No. 61-103833 [Patent Document 9] Japanese Patent Publication No. 2005-60366 [Non-patent literature]

[0015] [Non-Patent Document 1] "Matrix metalloproteinases in gastrointestinal cancers," Japanese Society of Gastroenterology, Vol. 100, p. 152, 2003. [Non-Patent Document 2] "Arthritis Rheumatism", Vol.10, pp 357, 1967 [[Non - Patent Document 3]] "Combined Composition", Kanehara Publishing, p. 481, 1984 [[Non - Patent Document 4]] "Inflammation", Japanese Inflammation Society, Vol. 11, p. 16, 1991 [[Summary of the Invention]] [[Problems to be Solved by the Invention]]

[0016] There is a demand for a material that is safe, has excellent stability, and is excellent in promoting collagen production, MMP inhibitory action, and promoting hyaluronic acid production. However, at present, no material that can fully satisfy these requirements has been provided. [[Means for Solving the Problems]]

[0017] Under such circumstances, as a result of intensive studies by the present inventors, it has been found that the extract of Ligusticum sinense has excellent effects of promoting collagen production, MMP inhibitory action, and promoting hyaluronic acid production, and is also excellent in stability. Furthermore, it has been found that an external preparation or an internal preparation containing the extract is safe, stable, excellent in promoting collagen production, MMP inhibitory action, and promoting hyaluronic acid production, and can be a multi - functional beauty / health material and a pharmaceutical, thus completing the present invention.

[0018] That is, the present invention includes the following inventions. (1) A collagen production promoter characterized by containing an extract of Ligusticum sinense as an active ingredient. (2) An MMP inhibitor characterized by containing an extract of Ligusticum sinense as an active ingredient. (3) A hyaluronic acid production promoter characterized by containing an extract of Ligusticum sinense as an active ingredient. (4) A wrinkle improver characterized by containing an extract of Ligusticum sinense as an active ingredient. (5) A food composition for the prevention and improvement of various diseases caused by increased MMP, characterized by containing an extract of Ligustichodium as an active ingredient. [Effects of the Invention]

[0019] The present invention provides a collagen production promoter, an MMP inhibitor, and a hyaluronic acid production promoter containing an extract of Ligustichodium sinense as an active ingredient. [Modes for carrying out the invention]

[0020] Ligusticum sinense, used in this invention, is a perennial herb belonging to the Apiaceae family. The crude drug Kouhon is made from the dried roots and rhizomes of this plant. It is a medicinal plant native to China and is used as an analgesic for headaches and other ailments. It contains phthalides, which play a part in its medicinal effects. The flowers are arranged in a plural inflorescence characteristic of the Apiaceae family, and white, umbrella-shaped flowers bloom from summer to early autumn. In this invention, the extract of Ligusticum sinense refers to an extract of a part of the plant, such as its flowers, fruits, seeds, leaves, stems, rhizomes, or roots, or the entire plant (whole plant), or a mixture thereof. However, in this invention, the parts used as extraction raw materials are preferably the roots and rhizomes, which are used as crude drugs. Furthermore, the plant may be used as is for extraction, or it may be processed by drying, crushing, or finely chopping.

[0021] The solvent extraction method is not particularly limited and can be carried out by methods such as heat extraction (e.g., 40-100°C), room temperature extraction (e.g., 15-25°C), low temperature extraction (e.g., 0-15°C), stirring extraction, or column extraction. Examples of extraction solvents include water, lower alcohols (methyl, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are used, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used. These solvents may be used individually or as a mixture of two or more. Particularly preferred extraction solvents include a mixed polar solvent of water, water-ethanol, or water-1,3-butylene glycol. Among these, the mixed polar solvent preferably contains 20 to 100% by weight of ethanol or 1,3-butylene glycol, and most preferably contains 50 to 100% by weight. In addition, a solvent whose pH has been adjusted by adding an acid or alkali to the above extraction solvent can also be used.

[0022] There are no particular limitations on the amount of solvent used; for example, it should be 5 times or more, preferably 10 times or more, relative to the dry weight of the roots and rhizomes of Ligustichodium sinense. However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0023] The above extract may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0024] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.

[0025] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0026] For external use, the content of the above extract used in this invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, when converted to solid matter. Furthermore, 0.01 to 5% by weight is most preferable. Below 0.0001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.

[0027] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0028] Next, in order to describe the present invention in detail, examples of the production, experimental, and formulation of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. In the production examples, % refers to weight %, and in the formulation examples, parts refer to parts by weight. [Examples]

[0029] Example of preparation of Ligustrum sinense extract Extracts of Ligustichum sinense were prepared as follows. In preparation examples 1 to 4, the roots and rhizomes of Ligustichum sinense were used as the extraction material.

[0030] (Preparation Example 1) Preparation of a hot water extract of Ligustichodium sinense 10 g of dried Ligustichum sinense was added to 200 mL of water and extracted at 95-100°C for 2 hours. The resulting extract was filtered, the filtrate was concentrated, and freeze-dried to obtain 3.3 g of hot water extract of Ligustichum sinense.

[0031] (Manufacturing Example 2) Preparation of a 50% ethanol extract of Ligustrum sinense 10 g of dried Ligustichodium sinense was immersed in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days to extract the extract. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 3.1 g of 50% ethanol extract of Ligustichodium sinense.

[0032] (Manufacturing Example 3) Preparation of ethanol extract of Ligustrum sinense 10 g of dried Ligustichodium sinense was immersed in 200 mL of ethanol at room temperature for 7 days to extract the solution. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.88 g of Ligustichodium sinense ethanol extract.

[0033] (Preparation Example 4) Preparation of 1,3-butylene glycoside extract of Ligustichodium sinense 10 g of dried Ligustichum sinense was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to extract the extract. The resulting extract was filtered to obtain 194 g of 1,3-butylene glycol extract of Ligustichum sinense. [Examples]

[0034] (Example prescription 1) Lotion Formulation Content (per portion) 1. Hot water extract of Ligustrum sinense (Production Example 1) 0.1 2,1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0035] (Comparative formulation example 1) Conventional lotion In Formula Example 1, the hot water extract of Ligustrum sinense was replaced with purified water to create the conventional lotion.

[0036] (Prescription example 2) Cream Formulation Content (per portion) 1. 50% ethanol extract of Ligustrum sinense (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene Glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. Add component 10 at 45°C, and further cool to 30°C to obtain the final product.

[0037] (Example prescription 3) Emulsion Formulation Content (per portion) 1. Ethanol extract of Ligustrum sinense (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0038] (Prescription example 4) Gel Formulation Content (per portion) 1. Rigustycum sinense 1,3-Butylene Glycol Extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer - 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0039] (Prescription example 5) pack Formulation Content (per portion) 1. Hot water extract of Ligustichodium sinense (Production Example 1) 1.0 2. Rigustycum sinense 1,3-Butylene Glycol Extract (Production Example 4) 5.0 3. Polyvinyl alcohol 2.0 4. Ethanol 5.0 5.1,3-Butylene Glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance 0.3 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0040] (Formulation example 6) Foundation Formulation Content (per portion) 1. 50% ethanol extract of Ligustrum sinense (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Carboxymethylcellulose sodium 0.1 10. Bentonite 0.5 11. Propylene Glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0041] (Prescription example 7) Bath additive Formulation Content (per portion) 1. Ethanol extract of Ligustrum sinense (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0042] (Prescription example 8) Ointment Formulation Content (per portion) 1. Hot water extract of Ligustrum sinense (Production Example 1) 5.0 2. Rigustycum sinense 1,3-Butylene Glycol Extract (Production Example 4) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene Glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0043] (Prescription example 9) Powder Formulation Content (per portion) 1. Hot water extract of Ligustichodium sinense (Production Example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline Cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.

[0044] (Prescription example 10) Tablets Formulation Content (per portion) 1. Ethanol extract of Ligustrum sinense (Production Example 3) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline Cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0045] (Prescription example 11) Tablet confectionery Formulation Content (per portion) 1. Ethanol extract of Ligustrum sinense (Production Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.

[0046] (Prescription example 12) Beverages Formulation Content (per portion) 1. Hot water extract of Ligustichodium sinense (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0047] Next, to explain the effects of the present invention in detail, experimental examples will be given. [Examples]

[0048] Experimental Example 1: Measurement of mRNA expression levels of type I collagen (COL1A1), MMP-1, MMP-2, and hyaluronic acid synthase 2 (HAS2) COL1A1, MMP-1, MMP-2, and HAS2 mRNA expression levels were measured. Human dermal fibroblasts were placed in a 60 mm dish at a rate of 1 × 10⁶. 5Cells were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, each sample was cultured for 24 hours in DMEM(-) culture medium to a final concentration of 10 μg / mL, and then total RNA was extracted. Total RNA was extracted from cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from cells. The High Capacity RNA-to-cDNA Kit (Aplied Biosystems) was used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of COL1A1, MMP-1, MMP-2, and HAS2 mRNA were determined as a percentage of the expression level of the internal standard, GAPDH mRNA. The COL1A1 expression enhancement rate was calculated as the ratio of the COL1A1 mRNA expression level in the control (no sample added) group. The MMP-1 expression suppression rate, MMP-2 expression suppression rate, and HAS2 expression enhancement rate were calculated similarly. The primers used to measure the expression levels of each gene are as follows.

[0049] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT(Sequence ID 1) TTGCAGTGGTAGGTGATGTTCTG(Sequence ID 2) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (Sequence ID 3) TGAGCATCCCCTCCAATACC(Sequence ID 4) Primer set for MMP-2 CCGTCGCCCATCATCAA (Sequence ID 5) CTTCTGCATCTTCTTTAGTGTGTCCTT(Sequence No. 6) Primer set for HAS2 TGGATGACCTACGAAGCGATTA(Sequence ID 7) GCTGGATTACTGTGGCAATGAG(Sequence No. 8) Primer set for GAPDH TGCACCACCAACTGCTTAGC (Sequence ID 9) TCTTCTGGGTGGCAGTGATG (Sequence ID 10)

[0050] The results of these experiments are shown in Tables 1-4. As a result, the Ligustichodium extract of the present invention exhibited excellent COL1A1 expression promoting effects (collagen production promoting effect), MMP-1 expression suppressing effects (MMP-1 inhibitory effect), MMP-2 expression suppressing effects (MMP-2 inhibitory effect), and HAS2 expression promoting effects (hyaluronic acid production promoting effect). In particular, the ethanol extract of Ligustichodium (Production Example 3) showed significantly higher efficacy in promoting COL1A1 expression, suppressing MMP-1 expression, and suppressing MMP-2 expression, while the hot water extract of Ligustichodium (Production Example 1) showed significantly higher efficacy in promoting HAS2 expression.

[0051] [Table 1]

[0052] [Table 2]

[0053] [Table 3]

[0054] [Table 4]

[0055] Experimental Example 2: Usage Test We conducted usage tests on Formulation Example 1 and Comparative Formulation Example 1 of the present invention, and evaluated the feel of the lotion containing the Ligustichodium extract of the present invention.

[0056] Five male and female panelists were blindly given each sample to use, and their experience of use and the presence or absence of skin problems were evaluated for Formula Example 1 and Comparative Formula Example 1.

[0057] As a result, the lotion obtained using formulation example 1 had a better feel to it than comparative formulation example 1, and could be used safely without causing any skin problems. Furthermore, there were no issues with the degradation of the formulation ingredients. [Industrial applicability]

[0058] Based on the above, the Ligustichodium extract of the present invention possesses excellent collagen production promoting, MMP inhibitory, and hyaluronic acid production promoting effects, as well as excellent stability. Therefore, the Ligustichodium extract of the present invention can be used not only in the field of beauty, such as for skin aging, but also in the field of medicine, such as for suppressing functional decline due to aging, and for cancer prevention and treatment, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A collagen production promoter characterized by containing a water extract of Ligustrum sinense as an active ingredient.

2. An MMP-2 inhibitor characterized by containing a water extract of Ligustrum sinense as an active ingredient.

3. A hyaluronic acid production promoter characterized by containing, as an active ingredient, an extract of Ligustrum sinense in water or aqueous ethanol containing 50% by weight or more of water.

4. A dermal wrinkle-improving agent characterized by containing a water extract of Ligustrum sinense as an active ingredient.

5. A food composition for the prevention and improvement of various diseases caused by increased levels of MMP-2, characterized by containing an aqueous extract of Ligustrum sinense as an active ingredient.

Images