Method for producing genetically reassorted influenza viruses

Abstract

Methods for producing genetically reassortant influenza viruses are provided. Genetically reassortant influenza viruses produced according to the methods are also provided, as are vaccines based on the genetically reassortant influenza viruses. The present invention is within the field of genetically reassortant influenza viruses. It relates to methods for producing genetically reassortant influenza viruses, particularly genetically reassortant viruses that can be used as seed viruses in connection with the production of influenza vaccines.

Description

[Technical Field]

[0001] The present invention falls under the field of genetically reassorted influenza viruses. It relates to a method for producing genetically reassorted influenza viruses, particularly those that can be used as seed viruses in the manufacture of influenza vaccines. The genetically reassorted influenza viruses and vaccines produced by the method of the present invention are also aspects of the present invention. [Background technology]

[0002] Genetic reassortment influenza viruses have a genome that includes segments derived from two or more parent influenza strains. Such genetic reassortment viruses are useful for manufacturing influenza vaccines because their high-growth influenza strain characteristics can be utilized to increase the production of hemagglutinin (HA) and / or neuraminidase (NA) antigens from the circulating strain (HA and / or NA antigens are typical components of influenza vaccines). In vaccine manufacturing, genetic reassortment viruses (sometimes called seed viruses) typically contain the HA and NA segments of the circulating strain, and the backbone segments (i.e., PB1, PB2, PA, M, NS, and NP) of the high-growth influenza strain. This seed virus can be used to grow viruses containing HA and NA more rapidly than simply propagating a circulating strain that may have low growth characteristics within the culture host platform (such as eggs or cells) used in the influenza vaccine manufacturing process. For example, in recent years, genetic reassortment influenza A viruses containing the HA and NA of the circulating strain, as well as six backbone genes from the high-growth parent A / Puerto Rico / 8 / 34(PR8), have been shown to be preferred seed viruses for vaccine manufacturing. This is because the circulating strain HA is high-yielding in association with the PR8 backbone [1]. Two methods have been used to generate genetically reassorted influenza viruses: classical genetic reassortment and reverse genetics.

[0003] In classical gene reassortment, both parental strains (i.e., the circulating strain and the high-growth strain) are inoculated into a culture host (typically a bird egg). The gene reassortment virus containing the HA and / or NA of the circulating strain is then selected by growing the culture host in the presence of antibodies against the HA and / or NA of the high-growth strain. The gene reassortment virus containing the desired HA and NA surface genes can be isolated and used as a seed virus for vaccine production.

[0004] However, one drawback associated with classical gene recombination is the inability to control the manipulation of gene sequences, which can be problematic when attempting to generate candidate seed viruses from highly pathogenic influenza viruses. For example, the HA of some H5 or H7 influenza strains contains pathogenicity-determining factors in the form of polybasic cleavage sites that cannot be deleted by classical gene recombination. Classical gene recombination can produce a mixture of recombined viruses with gene arrangement ratios of 7:1, 6:2, 5:3, or 4:4 from each parent strain, since the culture host is inoculated with two influenza strains. This means that 16 genes are present (i.e., 8 from each parent strain). As a result, isolating the desired recombined influenza virus for use as a seed virus in vaccine production can be time-consuming. For example, currently, it takes almost 35 days from the arrival of a new influenza strain to obtaining the final high-growth gene recombination used as a seed virus in vaccine production.

[0005] In reverse genetics, the genetic information necessary to produce a desired influenza virus is delivered to cells, enabling the generation of the influenza virus. Initially, reverse genetics required in vitro assembly and transfection of cells infected with a helper virus with viral ribonucleoprotein (RNP) [2,3]. Subsequent techniques involved transfecting RNA polymerase I plasmids, which encode all of the viral RNA (vRNA), along with protein expression constructs for the polymerase and NP genes [4]. More recently, reverse genetics methods have included the use of modified RNA polymerase I systems that enable the expression of both minus-strand vRNA and plus-strand mRNA from the same template [5]. In this method, each of the desired genes is cloned into a pHW2000 plasmid, which consists of viral cDNA inserted between the RNA polymerase I promoter and termination sequence, flanked by the CMV promoter and polyadenylation signal. After transfecting cells with eight plasmids, synthesis of both vRNA and mRNA occurs, resulting in virus production. Further improvements have led to the development of systems in which linear DNA expression constructs are used instead of plasmids[6] and the use of single expression constructs[7].

[0006] In contrast to classical gene recombination, reverse genetics allows for the manipulation of the gene sequence used to produce the virus. Therefore, by manipulating the viral gene sequence before transfection of an intracellular expression construct, it is possible to produce a virus with an attenuated phenotype, and thus reverse genetics can be used to generate seed viruses for producing attenuated live influenza vaccines. Seed viruses may also be produced using synthetic DNA sequences via reverse genetics, eliminating the need to handle wild-type pandemic viruses.[8] Reverse genetics can also produce seed viruses in 4–7 days, which is significantly faster than what is offered by classical gene recombination.

[0007] However, there are several drawbacks associated with reverse genetics. For example, in reverse genetics, the sequence of each influenza gene is predetermined when the expression construct is made. This means that this method produces a more homogeneous population of reassorted viruses compared to classical reassortment. This can be problematic if the circulating HA and NA have poor compatibility with the backbone gene used as the standard in reverse genetics and therefore do not grow effectively. In this situation, HA and NA may grow more effectively with a different arrangement of the backbone gene, but it takes time to identify and test a more suitable backbone gene for use in reverse genetics. This may involve several passages of the reassorted influenza virus derived from reverse genetics to allow for the development of viruses with sequence mutations in the backbone segment and the selection of seed viruses with favorable growth characteristics. Another problem with some reverse genetics systems is that it can be difficult to introduce the required expression construct into the culture host (e.g., due to low transfection efficiency), which can make the reverse genetics system inefficient. Methods for producing genetically reassembled influenza viruses, combining elements of classical gene reassortment and reverse genetics, have been discussed. For example, a method in which host cells are infected with a first influenza strain and transfected with one or more expression constructs encoding at least one segment from a second influenza strain is discussed in reference 11. This method has only been described in a situation in which a genetically reassembled virus is generated in which no segment targeted by siRNA is present, by using an agent that inhibits the translation and / or transcription of influenza virus segments, such as siRNA. Therefore, an object of the present invention is to provide an improved method for generating genetically reassembled influenza viruses that overcomes the drawbacks associated with both classical gene reassembly methods and reverse genetics methods. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] International Publication No. 2009 / 000891 [Patent Document 2] International Publication No. 2011 / 012999 [Non-Patent Document]

[0009] [Non-Patent Document 1] Cobbin et al. (2013) J. Virol. 87(10):5577 - 5585. [Non-Patent Document 2] Luytjes et al. (1989) Cell 59(6):1107 - 1113. [Non-Patent Document 3] Enami et al. (1990) PNAS 87(10):3802 - 3805. [Non-Patent Document 4] Fodor et al. (1999) J. Virol. 73(11):9679 - 9682. [Non-Patent Document 5] Hoffmann et al. (2000) PNAS 97(11):6108 - 6113. [Non-Patent Document 6] Verity et al. (2012) Influenza Other Respir. Viruses 6(2):101 - 109 [Summary of the Invention]

[0010] In a first aspect, the present invention provides a method for producing a gene-reassorting influenza virus, the method comprising: (i) contacting a culture host with a parent influenza virus strain comprising a first hemagglutinin (HA) gene and a first neuraminidase (NA) gene; (ii) introducing one or more expression constructs comprising one or more influenza genes into the culture host, wherein the influenza genes comprise a second HA gene or a second NA gene; (iii) culturing the culture host to produce a gene-reassorting virus; (iv) selecting a gene-reassorting virus comprising a second HA gene or a second NA gene; and optionally, (v) isolating the gene-reassorting influenza virus comprising a second HA gene or a second NA gene.

[0011] The present invention also provides a population of genetically reassorted influenza viruses produced by the method of the present invention.

[0012] The present invention also provides isolated gene-reassorted influenza viruses produced by the method of the present invention.

[0013] The method of the present invention is advantageous because the parent influenza virus strain providing the first HA gene and the first NA gene contains a heterogeneous population of virions (i.e., sequence variants / quasi-species exist). This introduces sequence variability into the backbone segment delivered to the culture host, thereby enabling the method of the present invention to produce gene reassortment viruses with broader diversity than reverse genetics techniques utilizing clonal expression constructs (e.g., plasmids). In contrast to reverse genetics systems, which may require multiple passages of the initially rescued virus to introduce sequence mutations and select viruses with improved properties, the method of the present invention allows sequence variants to be immediately present in the gene reassortment viruses produced by the method of the present invention (this is due to sequence mutations that naturally accumulate during the growth of the parent influenza strain). The high diversity of gene reassortment viruses produced by this method also increases the likelihood of identifying gene reassortment viruses with one or more particularly desirable properties (e.g., high HA yield and / or high growth).

[0014] Another advantage of the present invention is that it essentially performs selection for any sequence in the viral genome that has low compatibility with the desired HA and / or NA, which would otherwise result in a non-functional gene reassortment virus. These non-functional viruses will not grow effectively in the culture host and will be eliminated by variants with the desired high growth characteristics. This is in contrast to reverse genetics techniques, where sequence incompatibility is identified only after the expression construct has been produced and delivered to the culture host, which is problematic in generating the desired gene reassortment virus. In a related advantage, the present invention also makes it easier and more frequent to identify gene reassortment viruses containing combinations of mutations that synergistically result in improved growth characteristics. In fact, even with reverse genetics, it is sometimes impossible to identify multiple mutations at all. For example, in situations where a single mutation has a negative effect, this variant may be discarded and therefore not tested for further sequence variants that could rescue the negative effect and, in combination, extract further advantages.

[0015] This invention is distinguished from classical gene recombination because, instead of infection by a second influenza virus strain, a second HA gene or a second NA gene is introduced into the cultured host as part of an expression construct. Providing a second HA gene or a second NA gene using an expression construct means that the HA gene or NA gene can be manipulated before being delivered to the cultured host in a manner not possible with classical gene recombination. This ability to manipulate the HA sequence is particularly advantageous in pandemic or potential pandemic strain (such as H5 and H7 strains) situations, as it allows for the deletion of pathogenicity-determining factors, such as polybasic cleavage sites. Another advantage of delivering the HA gene or NA gene on an expression construct is that it enables the expression of a single HA or NA clone having a given sequence. This is in contrast to the way the HA and NA genes are delivered in the context of a replicating virus (such as classical recombination), which can result in, for example, a decrease in antigenicity if there is a risk of mutations being introduced into the HA or NA gene during replication.

[0016] Thus, in this method, while the HA segment or NA segment present within the reassortant influenza virus can be controlled (as can be in reverse genetics), at the same time, by introducing a population of backbone genes into a culture host via infection with a parental influenza virus strain, a pool of backbone segments with a certain degree of variability is brought about. This is advantageous because, particularly when the backbone genes (such as PR8) typically used in reverse genetics provide suboptimal characteristics when reassorted with the HA and / or NA of epidemic strains, an optimized seed virus for use in vaccine production can be generated more rapidly. In such a situation, the virus first rescued in a reverse genetics experiment needs to be passaged multiple times in a culture host to improve virus growth. Since a reassortant virus with strong growth characteristics can be selected from the diverse pool of reassortant viruses produced by this method, in the method of the present invention, the same multiple passages are not necessarily required. In other words, the diversity of the backbone genes within the parental strain generated in the context of a replicating virus, combined with a low level of selection and elimination against non-viable or slow-growing reassortant viruses, enables more efficient generation of high-growth reassortant viruses.

[0017] The reassortant influenza virus produced by the method of the present invention can be particularly useful for the production of influenza vaccines. Thus, in a further aspect, the present invention provides a method for preparing a vaccine comprising (a) the step of preparing a reassortant influenza virus by the method of the present invention and (b) the step of preparing a vaccine from the reassortant influenza virus. A vaccine produced by the method of the present invention is also provided. In certain embodiments, for example, the following are provided: (Item 1) A method for generating a genetically reassorted influenza virus, (i) The step of contacting a cultured host with a parent influenza virus strain containing a first hemagglutinin (HA) gene and a first neuraminidase (NA) gene; (ii) The step of introducing one or more expression constructs comprising one or more influenza genes into the culture host, wherein the influenza gene comprises a second HA gene or a second NA gene; The method comprising: (iii) culturing the culture host to produce a gene reassortment virus; and (iv) selecting a gene reassortment virus comprising the second HA gene or the second NA gene. (Item 2) The method according to item 1, further comprising step (v) isolating a gene-reassorted influenza virus containing the second HA gene or the second NA gene. (Item 3) The method according to item 2, wherein the isolated gene-reassorted influenza virus is a 7:1 gene-reassorted influenza virus. (Item 4) The method according to item 1, wherein the one or more influenza genes include a second HA gene and a second NA gene, and step (iv) includes selecting a gene reassortment virus that includes the second HA gene and / or the second NA gene. (Item 5) The method according to item 4, further comprising the step of (i) isolating a gene-reassorted influenza virus comprising the second HA gene and / or (ii) the second NA gene (v). (Item 6) The method according to item 4, wherein the isolated genetically reassorted influenza virus is a 6:2 genetically reassorted influenza virus. (Item 7) The method according to item 4, wherein the one or more influenza genes include a second PB1, PB2, PA, M, NS, or NP, and step (iv) includes selecting a gene reassortment virus containing the second PB1, PB2, PA, M, NS, or NP gene. (Item 8) The method according to item 7, further comprising the step (v) isolating a gene reassortment influenza virus comprising (i) the second HA gene and / or (ii) the second NA gene and (iii) the second PB1, PB2, PA, M, NS or NP gene. (Item 9) The method according to item 8, wherein the isolated genetically reassorted influenza virus is a 5:3 genetically reassorted influenza virus. (Item 10) The method according to any of the preceding items, wherein one or more expression constructs contain seven, six, five, four, or three or fewer influenza genes. (Item 11) The method according to any one of items 1 to 6, wherein the one or more expression constructs comprises two or fewer influenza genes. (Item 12) The method according to any of the preceding items, wherein the one or more expression constructs are one or more plasmids, one or more linear DNA molecules, or one or more RNA molecules. (Item 13) The method according to item 12, wherein the one or more expression constructs include synthetic nucleic acid molecules, such as synthetic DNA molecules or synthetic RNA molecules. (Item 14) The method according to any of the preceding items, wherein one or more expression constructs are bidirectional expression constructs, and at least one gene is located between an upstream pol II promoter and a downstream non-endogenous pol I promoter. (Item 15) The method according to any of the preceding items, wherein the culture host is brought into contact with the parent influenza virus strain, and at the same time, one or more expression constructs are introduced into the culture host. (Item 16) The method according to any one of items 1 to 14, wherein the one or more expression constructs are introduced into the culture host before or after the culture host comes into contact with the parent influenza virus strain. (Item 17) The method of any of the preceding items, comprising the step of isolating a gene-reassorted influenza virus from the cultured host prior to step (iv). (Item 18) The method of any of the preceding items, wherein step (iv) includes a negative selection for the first HA. (Item 19) The method according to item 18, wherein the negative selection comprises contacting the culture host or the gene reassortment influenza virus isolated from the culture host with one or more antibodies specific to the first HA. (Item 20) The method according to item 18 or 19, wherein the negative selection comprises contacting the culture host with an inhibitor that reduces or prevents the transcription and / or translation of the first HA. (Item 21) The method according to any of the preceding items, wherein step (iv) includes a negative selection for the first NA. (Item 22) The method according to item 21, wherein the negative selection comprises contacting the culture host or the gene reassortment influenza virus isolated from the culture host with one or more antibodies specific to the first NA. (Item 23) The method according to item 21 or 22, wherein the negative selection comprises contacting the culture host with an inhibitor that reduces or prevents the transcription and / or translation of the first NA. (Item 24) The method of any of the preceding items, wherein step (iv) includes a positive selection for the second HA or the second NA. (Item 25) The method according to item 24, wherein the positive selection comprises contacting the culture host or the gene reassortment influenza virus isolated from the culture host with one or more antibodies specific to the second HA or the second NA. (Item 26) The method described in any of items 17-25, wherein step (iv) includes three or fewer selection steps. (Item 27) The method according to any one of items 2-3, 5-6, or 8-26, wherein the isolation of the gene reassortment virus comprises a limiting dilution step and / or a plaque isolation step. (Item 28) The method according to any one of items 2-3, 5-6, or 8-27, further comprising the step (vi) of purifying the virus obtained in step (v). (Item 29) The method according to any of the preceding items, wherein the second HA gene includes one or more modifications compared to a wild-type influenza virus from which the second HA gene is derived. (Item 30) The method according to item 29, wherein the modification of the second HA gene is the deletion of a polybasic cleavage site. (Item 31) The method according to any of the preceding items, wherein the gene-reassorted influenza virus produced or isolated is less virulent than the wild-type influenza virus from which the second HA gene or the second NA gene originates. (Item 32) The method according to any of the preceding items, wherein the culture host is a developing chicken egg. (Item 33) The method according to any one of items 1 to 31, wherein the culture host is a mammalian cell or an avian cell. (Item 34) The method according to item 33, wherein the culture host is MDCK, Vero, PerC6, CEF, or EB66 cells. (Item 35) The method according to item 34, wherein the aforementioned cells grow by adhesion. (Item 36) The method described in item 34, wherein the aforementioned cells grow by suspension. (Item 37) The method according to item 36, wherein the MDCK cells are cells of the cell line MDCK33016 (DSM ACC2219). (Item 38) The method according to any of the preceding items, wherein the gene-reassorted influenza virus is influenza A virus or influenza B virus. (Item 39) A population of genetically reassorted influenza viruses produced by any one of the methods described in item 1, 4, 7, 10-26, or 29-32. (Item 40) Isolated genetically reassorted influenza viruses produced by the method described in any one of items 2-3, 5-6, or 8-38. (Item 41) A method for preparing a vaccine, comprising: (a) preparing a genetically reassorted influenza virus by the method described in any one of items 1 to 38; and (b) preparing a vaccine from the genetically reassorted influenza virus. (Item 42) A vaccine produced by the method described in item 41. [Brief explanation of the drawing]

[0018] [Figure 1] Table 1 shows a graph illustrating the sequence mutations present in the M1 protein of H1N1 viruses produced by classical gene reassortment and viruses produced by reverse genetics. A 0%cf value for the consensus backbone indicates that there are no sequence variants at that position relative to the consensus backbone sequence. The M1 protein of viruses produced by reverse genetics shows no sequence mutations. [Figure 2] Table 2 shows a graph illustrating the sequence mutations present in the NP proteins of H1N1 and H3N2 viruses produced by classical gene reassortment and viruses produced by reverse genetics. A 0%cf value in the consensus backbone indicates the absence of sequence variants at that location. In viruses prepared by classical gene reassortment, the NP protein shows mutations throughout the entire sequence, while the NP protein of viruses obtained by reverse genetics shows mutations at only four sequence locations. [Figure 3] Table 3 shows a graph illustrating the sequence mutations present in the NS1 protein of H1N1 and H3N2 viruses produced by classical gene reassortment and viruses produced by reverse genetics. A 0%cf value in the consensus backbone indicates the absence of sequence variants at that location. In viruses prepared by classical gene reassortment, the NS1 protein shows mutations throughout the entire sequence, while the NS1 protein of viruses obtained by reverse genetics shows mutations at only three sequence locations. [Figure 4]Table 4 shows a graph illustrating the sequence mutations present in the PA proteins of H1N1 and H3N2 viruses produced by classical gene reassortment and viruses produced by reverse genetics. A 0%cf value in the consensus backbone indicates the absence of sequence variants at that location. In viruses prepared by classical gene reassortment, the PA protein shows mutations throughout the entire sequence, while the PA protein of viruses obtained by reverse genetics shows mutations at only two sequence locations. [Figure 5] Table 5 shows a graph illustrating the sequence mutations present in the PB2 segment of H1N1 and H3N2 viruses produced by classical gene reassortment and viruses produced by reverse genetics. A 0%cf value in the consensus backbone indicates the absence of sequence variants at that location. In viruses prepared by classical gene reassortment, the PB2 protein shows mutations throughout the entire sequence, while the PB2 protein of viruses obtained by reverse genetics shows mutations at only eight sequence locations. [Modes for carrying out the invention]

[0019] Genetic reassortment influenza virus Influenza viruses are segmented negative-strand RNA viruses. The genomes of influenza A and B viruses contain eight single-stranded viral RNA (vRNA) segments. The eight genomic segments of influenza A and B viruses are, in order of size, PB2, PB1, PA, HA, NP, NA, M, and NS. PB2, PB1, PA, NP, M, and NS encode internal and non-structural proteins and can be called backbone segments. The HA and NA segments encode surface glycoproteins. The method of the present invention can be used to produce genetically reassorted influenza A viruses. Alternatively, the method of the present invention can be used to produce genetically reassorted influenza B viruses.

[0020] In the case of influenza A virus, the eight genomic segments encode 11 proteins, as follows: hemagglutinin (HA), neuraminidase (NA), two matrix proteins (M1 and M2), heterotrimeric RNA-dependent RNA polymerase (composed of one polymerase acidic subunit (PA) and two polymerase basic subunits (PB1 and PB2)), nucleoprotein (NP), and two non-structural proteins (NS1 and NS2; NS2 is also known as the nuclear export protein (NEP)). Some influenza A viruses also express PB1-F2, a pro-apoptotic peptide. The PB2, PA, HA, NP, and NA segments each encode a single expressed protein. The PB1, M, and NS segments encode two or more proteins. The PB1 segment encodes the PB1 protein and the PB1-F2 protein (encoded in the +1 reading frame on the PB1 segment). The M segment encodes the M1 and M2 proteins. The NS segment encodes the NS1 and NS2 / NEP proteins. M2 and NS2 / NEP proteins are expressed from mRNA spliced ​​from M and NS segments.

[0021] In the case of influenza B virus, eight genomic segments also encode 11 proteins, but there are some differences from influenza A virus. In influenza A virus, the PB2, PA, HA, and NP segments each encode a single expression protein, and the NS segment encodes the NS1 and NS2 / NEP proteins. The PB1-F2 protein is not present in influenza B virus. This means that the PB1 segment encodes only the PB1 protein. In addition to the NA protein, the NA segment in influenza B virus also encodes the NB matrix protein within an alternative -1 reading frame. The NB matrix protein corresponds to the M2 protein in influenza A. The M segment encodes the M1 protein and encodes the BM2 protein within an alternative +2 reading frame.

[0022] A genetically reassorted influenza virus contains genomic segments derived from two or more parent influenza virus strains. The genetically reassorted influenza virus produced by the method of the present invention contains one or more gene segments from a first parent influenza virus strain (donor strain) and one or more gene segments from a second parent influenza virus strain (vaccine strain). The influenza donor strain is typically a strain that provides a backbone segment within the genetically reassorted influenza virus, although it may also provide the NA segment of the virus. The vaccine strain is an influenza strain that provides an HA or NA segment. Typically, both the HA and NA segments of the genetically reassorted influenza virus are derived from the vaccine strain. In the method of the present invention, the second HA gene or second NA gene introduced into the culture host as part of the expression construct is derived from the vaccine strain. The vaccine strain is typically an epidemic strain. The vaccine strain is different from the donor strain.

[0023] The genomic segments present in a reassorted virus can be described using a gene arrangement ratio that indicates the number of segments provided by each parent influenza virus strain. For example, if a reassorted virus contains genomic segments from two parent influenza virus strains (such as a donor strain and a vaccine strain), the gene arrangement ratios are 1:7, 2:6, 3:5, 4:4, 5:3, 6:2, or 7:1. A reassorted virus may also contain genomic segments from three parent influenza virus strains, if present. In these embodiments, a reassorted virus may have a gene arrangement ratio of 1:1:6, 1:2:5, 1:3:4, 1:4:3, 1:5:2, 1:6:1, 2:1:5, 2:2:4, 2:3:3, 2:4:2, 2:5:1, 3:1:2, 3:2:1, 4:1:3, 4:2:2, 4:3:1, 5:1:2, 5:2:1, or 6:1:1.

[0024] The majority of the genome segments of the reassorted virus produced by the present invention are typically derived from a donor strain. This is because it is desirable to utilize the characteristics of the donor strain by reassorting the donor strain segments with segments derived from the vaccine strain. In certain such embodiments, the reassorted influenza virus produced by the method of the present invention has a gene arrangement ratio of 5:3, 6:2, or 7:1, where the first number in this ratio indicates the number of segments derived from the donor strain, and the second number indicates the number of segments derived from the vaccine strain.

[0025] In preferred embodiments, the reassorting influenza virus has a gene arrangement ratio of 6:2. In these embodiments, the reassorting influenza virus comprises six backbone segments (i.e., PB1, PB2, PA, NP, M, and NS) derived from the donor strain and two segments (i.e., HA and NA) derived from the vaccine strain. In particularly preferred embodiments, the reassorting influenza virus is a reassorting influenza A virus having a gene arrangement ratio of 6:2.

[0026] In other embodiments, the reassorted influenza virus has a gene arrangement ratio of 7:1. In some of these embodiments, the reassorted influenza virus includes six backbone segments from the donor strain, an HA segment from the vaccine strain, and an NA segment from the donor strain. In other words, the reassorted influenza virus includes an HA segment from the vaccine strain and seven segments from the remaining donor strain. In other embodiments, the reassorted influenza virus includes six backbone segments and an HA segment from the donor strain, as well as an NA segment from the vaccine strain. In other words, the reassorted influenza virus includes an NA segment from the vaccine strain and seven segments from the remaining donor strain. A gene arrangement ratio of 7:1 is preferred for reassorted influenza B virus.

[0027] In other embodiments, the reassorted influenza virus has a gene arrangement ratio of 5:3. In these embodiments, the reassorted virus includes five backbone segments (i.e., five segments selected from the group consisting of PB1, PB2, PA, NP, M, and NS) and three segments from the vaccine strain. In these embodiments, the three segments derived from the vaccine strain are HA, NA, and one backbone segment (i.e., one segment selected from the group consisting of PB1, PB2, PA, NP, M, and NS). In preferred embodiments, the three segments derived from the vaccine strain are HA, NA, and PB1, and the remaining five backbone segments (i.e., PB2, PA, NP, M, and NS) are derived from the donor strain.

[0028] Influenza virus strains In the method of the present invention, the parent influenza virus strain that the culture host comes into contact with is a donor strain. The donor strain is replicable (i.e., the donor strain can grow within the culture host after infection). By bringing the culture host into contact with the donor strain, the genome segment of the donor strain is delivered to the culture host when the virus infects the culture host.

[0029] Any influenza virus strain having a set of desired characteristics may be used as a donor strain. In certain embodiments, the donor strain is a strain that has good growth characteristics in cells and / or eggs. Typically, good growth characteristics are measured by the yield of HA when the virus grows in the culture host. A donor strain with good growth characteristics may be called a high-growth parent (HGP) strain. Thus, in certain embodiments, the parent influenza virus strain that is contacted with the culture host is a high-growth parent. Examples of high-growth parent strains that can be used in the method of the present invention are A / Puerto Rico / 8 / 1934 (PR8), A / Texas / 1 / 1977, A / New York / 55 / 2004, A / Ann Arbor / 6 / 60, A / Leningrad / 134 / 17 / 57, B / Ann Arbor / 1 / 66, B / Florida / 4 / 2006, B / Panama / 45 / 1990, and B / Lee / 1940. In a preferred embodiment, A / Puerto Rico / 8 / 1934 is a donor strain of influenza A virus. A strain that grows to an equivalent or higher viral titer compared to a high-growth parent strain may be used as a donor strain.

[0030] In the method of the present invention, influenza strains that can be used as donor strains typically provide a population of non-homogeneous backbone segments to the cultured host. This is because the donor strain contains a population of non-homogeneous (i.e., sequence variants) virions. These variant backbone segments can arise from spontaneous mutations in the influenza virus genome. The mutation rate can be expressed as substitutions per nucleotide per cell infection (s / n / c), and in the case of influenza virus, it is 10 -5 ~10 -7This can range. This means that about 1 / 1000th of influenza virions in a population of virions contain mutations in their genomic segments. Therefore, the donor strains that can be used in the method of the present invention include a population of closely related subspecies influenza viruses. The term “subspecies” is used to refer to influenza viruses that originate from a single source but contain sequence variants. This is different from sequence differences between influenza viruses from different sources (considered to be separate species). Therefore, the method of the present invention involves contacting a culture host with a donor strain containing a population of subspecies influenza viruses (i.e., influenza viruses with sequence variants from a single source). In this way, the population of variant backbone segments is delivered to the culture host.

[0031] The variation within a population of backbone segments (e.g., NP segments) can be expressed as a percentage of the number of different sequence positions between the two most branched sequences within the population of backbone segments when the sequences of the backbone segments are aligned. Sequence differences may be substitutions, deletions, or insertions. Multiple alignment may be performed to identify the two most branched sequences within a population. Suitable tools for aligning multiple protein sequences are available (e.g., the Clustal Omega tool using default parameters, mentioned in Maderia et al. Nucleic Acids Research 2019(47)doi:10.1093 / nar / gkz268). For example, as discussed in Example 5, the NP protein has a sequence of 498 amino acids, and 44 mutations have been identified within the amino acid sequence of the NP protein of H1N1 viruses produced by classical gene reassortment. This corresponds to approximately 9% of the mutations in the NP protein when comparing the two most branched NP protein sequences within the H1N1 gene reassortment group. The percentage of sequence mutations in the backbone protein can be calculated using the following formula:

number

[0032] In some embodiments, the donor strain comprises a population of quasi-species of influenza virus containing at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, or at least 20% amino acid sequence mutations in one or more backbone segments. The quasi-species donor strain population may contain 30% or less amino acid sequence mutations in any of the backbone segments.

[0033] In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 5% amino acid sequence mutations in the M1 protein.

[0034] In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 5% amino acid sequence mutations in the NP protein. In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 8% amino acid sequence mutations in the NP protein.

[0035] In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 5% amino acid sequence mutations in the NS1 protein. In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 15% amino acid sequence mutations in the NS1 protein.

[0036] In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 5% amino acid sequence mutations in the PA protein.

[0037] In some embodiments, the donor strain comprises a population of influenza virus subspecies containing at least 5% amino acid sequence mutations in the PB2 protein.

[0038] In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 5% amino acid sequence mutations in the M1 protein, at least 5% amino acid sequence mutations in the NP protein, at least 5% amino acid sequence mutations in the NS1 protein, at least 5% amino acid sequence mutations in the PA protein, and at least 5% amino acid sequence mutations in the PB2 protein.

[0039] In some embodiments, the donor strain comprises a population of influenza virus quasi-species containing at least 5% amino acid sequence mutations in the M1 protein, at least 8% amino acid sequence mutations in the NP protein, at least 15% amino acid sequence mutations in the NS1 protein, at least 5% amino acid sequence mutations in the PA protein, and at least 5% amino acid sequence mutations in the PB2 protein.

[0040] Other donor strains can be produced for use in the method of the present invention. In order to produce donor strains for use in the method of the present invention, influenza virus strains may be grown in the culture host used in the method of the present invention. Passaging influenza virus strains in the culture host used in the method of the present invention results in the production of variant influenza strains containing sequence mutations that allow them to grow to higher viral titers (simultaneously and under the same growth conditions) compared to the influenza virus strains from which they originate. Therefore, variant influenza strains are preferred donor strains because they have improved growth characteristics in the culture host used in the method of the present invention. For example, passing the A / Puerto Rico / 8 / 1934 influenza strain several times in cell culture produces a variant influenza strain (PR8-X strain), which grows to higher viral titers in these cells compared to the original A / Puerto Rico / 8 / 1934 strain. Therefore, in certain embodiments, the PR8-X strain is a donor strain. Similarly, by passing the A / New Caledonia / 20 / 1999 strain several times in cell culture, a variant strain (105p30 strain) was produced that grew to a higher viral titer compared to the wild-type A / New Caledonia / 20 / 1999 strain under the same time and growth conditions.

[0041] The PR8-X gene segment has the nucleotide sequence of SEQ ID NO: 1 (PA), SEQ ID NO: 2 (PB1), SEQ ID NO: 3 (PB2), SEQ ID NO: 4 (NP), SEQ ID NO: 5 (M), SEQ ID NO: 6 (NS), SEQ ID NO: 7 (HA), or SEQ ID NO: 8 (NA). In some embodiments, influenza strains containing a gene segment encoding the same amino acid sequence as the PR8-X gene segment can be used as donor strains.

[0042] The 105p30 gene segment has the nucleotide sequence of SEQ ID NO: 9 (PA), SEQ ID NO: 10 (PB1), SEQ ID NO: 11 (PB2), SEQ ID NO: 12 (NP), SEQ ID NO: 13 (M), SEQ ID NO: 14 (NS), SEQ ID NO: 15 (HA), or SEQ ID NO: 16 (NA). In some embodiments, influenza strains containing a gene segment encoding the same amino acid sequence as the 105p30 gene segment can be used as donor strains.

[0043] A donor strain suitable for use in the method of the present invention will typically achieve improved viral titer and / or growth kinetics compared to the viral titer obtained from the influenza strain from which the donor strain is derived. In certain embodiments, when grown under the same growth conditions and for the same amount of time (e.g., 12, 24, 48, or 72 hours) as the influenza strain from which the donor strain is derived, the improved viral titer of the donor strain is at least 10%, at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, or at least 1000% higher.

[0044] In certain embodiments, the donor strain is a strain that has regulatory approval for use in vaccine manufacturing. Using a regulatory-approved donor strain is advantageous because the gene reassortment virus produced by the method of the present invention may be used to prepare a vaccine, which may be easier to market than if the donor strain does not have existing regulatory approval.

[0045] The inventors have found that the production of gene reassortment influenza is enhanced when a culture host is in contact with a purified donor strain. Purification of the donor strain may be advantageous when the donor strain is delivered to the culture host simultaneously with the transfection of a second HA gene and / or a second NA gene. This is because contaminated egg proteins or cell culture proteins (which may be present after the proliferation of the donor strain) may interfere with the transfection of the expression construct into the culture host. Therefore, in some embodiments, the culture host is brought into contact with a purified donor strain. In certain such embodiments, the culture host is brought into contact with a purified donor strain, and one or more expression constructs containing a second HA gene or a second NA gene are introduced into the culture host by transfection.

[0046] The donor strain may be grown in cell culture and / or eggs before use in this method. In some embodiments, the method includes the step of passage an influenza virus strain in a cell culture or eggs to produce a donor strain (e.g., a donor strain population) for infecting a cultured host. A pre-passage step (or two or more pre-passage steps) may be advantageous because it can increase the number of sequence variants present in the population of virions delivered to the cultured host.

[0047] The donor strain may be concentrated and purified from cell culture medium or allantoine fluid using standard methods. In some embodiments, the method includes a step of purifying the donor strain before the culture host is brought into contact with the donor strain. For example, the purification process may include centrifugation using a sucrose gradient solution or affinity chromatography. In one embodiment, the donor strain is purified by filtration and / or centrifugation. In one embodiment, the step of purifying the donor strain includes a filtration step and a subsequent centrifugation step. For example, the culture medium or allantoine fluid containing the donor strain may be filtered through a 0.45 μm filter and then purified by centrifugation using a centrifugation filter device, for example, at about 1400 x g for 1 hour. After purification, the donor strain can be suspended in a buffer, such as PBS, which allows the purified donor strain to be stored and transported before use in the method of the present invention.

[0048] Helper viruses were used in early reverse genetics techniques to facilitate the expression of influenza gene segments from expression constructs (e.g., by providing components such as RNA-dependent RNA polymerase (RdRp) or other proteins involved in viral genome replication). Typically, these early reverse genetics systems used expression constructs in the form of a ribonucleoprotein complex containing RNA encoding the viral segment, purified RNA-dependent RNA polymerase protein, and viral nucleoprotein components. These protein components delivered the mechanisms necessary for replicating the RNA-encoded viral segment to the cultured host. The protein components of the ribonucleoprotein complex (RdRp and NP) had to be purified from the influenza virus before in vitro assembly with the RNA encoding the viral segment. In addition to transfecting the cultured host with the RNP component, helper viruses were required for efficient viral production. However, the components of the helper virus were generally not intended for incorporation into the gene reassortment viruses produced by these reverse genetics techniques. The subsequent development of expression constructs used in reverse genetics systems means that later expression constructs can provide all the components necessary for viral particle production, thus eliminating the need for RNPs and helper virus components.

[0049] In the method of the present invention, the parent influenza virus strain that comes into contact with the culture host is not a helper virus. This is because the aim is to incorporate components of the parent influenza virus strain involved in viral genome replication into the gene-reassorted influenza virus produced by the method of the present invention. Therefore, in some embodiments, the method of the present invention does not contain a helper virus.

[0050] Expression construct In the method of the present invention, one or more expression constructs containing one or more influenza genes are introduced into a culture host. One or more expression constructs may be introduced into a cell culture using any method for introducing expression constructs from known reverse genetic techniques.

[0051] The method of the present invention does not require the use of exogenously added RNPs and, therefore, does not require additional viral RNA-directed RNA polymerase proteins and viral nucleoproteins provided with one or more expression constructs. Therefore, in the context of the present invention, a ribonucleoprotein complex (e.g., RNA encoding a viral segment that has formed a complex with purified RNA-dependent RNA polymerase protein and viral nucleoprotein) is not an expression construct. The expression constructs according to the present invention do not contain RNPs. The step of introducing one or more expression constructs into a culture host includes delivering one or more expression constructs to the culture host without contacting or transfecting the culture host with ribonucleoprotein complexes (e.g., without contacting or transfecting the culture host simultaneously with or separately with RNP complexes).

[0052] In the context of this invention, influenza virion is not an expression construct. This means that contacting a culture host with an influenza strain does not constitute introducing one or more expression constructs into the culture host. In other words, the step of introducing one or more expression constructs into a culture host involves delivering one or more expression constructs to the culture host using means that do not involve contact with or infection of the culture host with influenza virion. This differs from classical gene reassortment, in which all influenza genes are delivered to the culture host via infection by a parent influenza virus strain.

[0053] The expression constructs used in the present invention are typically recombinant or synthetic nucleic acid constructs, which can be assembled in vitro (e.g., using recombinant techniques known to those skilled in the art). The use of one or more expression constructs means that the sequence of the influenza gene can be precisely manipulated in a manner that is not possible when the necessary influenza gene is provided by infection with the influenza virus (as in classical gene recombination methodologies).

[0054] Expression constructs suitable for use in the method of the present invention may be unidirectional or bidirectional expression constructs. Since influenza viruses require proteins for infectivity, it is generally preferable to use bidirectional expression constructs because this reduces the total number of expression constructs required by the host cell. Therefore, the method of the present invention may utilize at least one bidirectional expression construct in which at least one gene or cDNA is located between an upstream pol II promoter and a downstream non-endogenous pol I promoter. Transcription of the gene or cDNA from the pol II promoter produces capped positive-strand viral mRNA that can be translated into a protein, while transcription from the non-endogenous pol I promoter produces negative-strand vRNA. The bidirectional expression construct may be a bidirectional expression vector.

[0055] A bidirectional expression construct includes at least two promoters that drive expression from the same construct in different directions (i.e., both 5' to 3' and 3' to 5'). The two promoters can be operably ligated to different strands of the same double-stranded DNA. Preferably, one of the promoters is a pol I promoter and at least one of the other promoters is a pol II promoter. This is useful because the pol I promoter can be used to express uncapped vRNA, while the pol II promoter can be used to transcribe mRNA, which is then translated into a protein, thus enabling simultaneous expression of RNA and protein from the same construct. When two or more expression constructs are used in the expression system, the promoters may be a mixture of endogenous and non-endogenous promoters.

[0056] The pol I and pol II promoters used in expression constructs may be endogenous to organisms of the same taxonomic order from which the host cell originates. Alternatively, the promoters may originate from organisms of a different taxonomic order than the host cell. The term "order" refers to conventional taxonomic ranks, examples of orders include primates, rodents, carnivores, marsupials, and cetaceans. Humans and chimpanzees belong to the same taxonomic order (primates), but humans and dogs belong to different orders (primates vs. carnivores). For example, the human pol I promoter can be used to express a viral segment in canine cells (e.g., MDCK cells) [9].

[0057] Expression constructs typically include RNA transcription termination sequences. These termination sequences may be endogenous or non-endogenous for the host cell. Preferred termination sequences, though not limited to those skilled in the art, include RNA polymerase I transcription termination sequences, RNA polymerase II transcription termination sequences, and ribozymes. Furthermore, expression constructs may include, in particular, one or more polyadenylation signals of mRNA at the ends of genes whose expression is controlled by a pol II promoter.

[0058] Expression constructs can be vectors, such as plasmids or other episomal constructs. Such vectors will typically contain at least one bacterial and / or eukaryotic origin of replication. Furthermore, vectors may contain selectable markers that allow selection in prokaryotic and / or eukaryotic cells. Examples of such selectable markers are genes that confer resistance to antibiotics such as ampicillin or kanamycin. Vectors may further contain one or more cloning sites to facilitate the cloning of DNA sequences.

[0059] Expression constructs can be linear expression constructs. Such linear expression constructs typically will not contain any amplification and / or selection sequences. However, linear constructs containing such amplification and / or selection sequences are also within the scope of the present invention. Reference 6 describes linear expression constructs, which describe individual linear expression constructs for each viral segment. It is also possible to include two or more, for example, two, three, four, five, or six viral segments on the same linear expression construct. Such systems are described, for example, in Reference 6.

[0060] Expression constructs can be generated using methods known in the art. Such methods are described, for example, in Reference 10. If the expression construct is a linear expression construct, it is possible to linearize it using a single restriction enzyme site before introducing it into host cells. Alternatively, it is possible to excise the expression construct from the vector using at least two restriction enzyme sites. Furthermore, it is possible to obtain a linear expression construct by amplifying it using nucleic acid amplification techniques (e.g., by PCR).

[0061] The expression constructs used in the methods of the present invention may be non-bacterial expression constructs. This means that they can drive the expression of the viral RNA segment encoded therein in eukaryotic cells, but do not contain components that would be necessary for the proliferation of the construct within bacteria. Therefore, the constructs do not contain bacterial origins of replication (oris) and typically do not contain bacterial selection markers (e.g., antibiotic resistance markers). Such expression constructs are described in Reference 7.

[0062] Expression constructs can be prepared by chemical synthesis. Expression constructs can be prepared entirely or partially by chemical synthesis. A preferred method for preparing expression constructs by chemical synthesis is described, for example, in Reference 7. Therefore, in certain embodiments, the expression construct may include a synthetic nucleic acid sequence. In some embodiments, the expression construct may include a synthetic DNA sequence. In some embodiments, the expression construct may include a synthetic RNA sequence.

[0063] The expression constructs used in the method of the present invention can be introduced into host cells using any technique known to those skilled in the art. For example, the expression constructs of the present invention can be introduced into host cells using electroporation, DEAE-dextran, calcium phosphate precipitation, liposomes, microinjection, or microparticle bombardment.

[0064] In some embodiments, the expression construct may be in the form of naked nucleic acid. Naked nucleic acid can be purified from influenza virus. In another embodiment, the expression construct may be in the form of transcription RNA. In yet another embodiment, the expression construct may be in the form of one or more shuttle vectors. Examples of shuttle vectors include non-influenza viruses and replicons, such as alphavirus-based replicons.

[0065] The nucleotide sequence of the expression construct may be manipulated to control the sequence of the influenza segment present in the gene reassortment virus produced by the method of the present invention. Therefore, the influenza HA encoded by the expression construct may be the native HA as found in wild-type viruses, or a modified HA. For example, it is known to modify HA to remove determinants that make the virus highly pathogenic (e.g., high-basic regions around the HA1 / HA2 cleavage site). In some embodiments, HA is modified to remove polybasic cleavage sites. In certain such embodiments, HA is derived from H5 or H7 influenza strains and does not contain polybasic cleavage sites. Similarly, the influenza NA encoded by the expression construct may be the NA as found in wild-type viruses, or a modified NA. For example, if a vaccine strain NA contains an existing neuraminidase inhibitor-resistant mutation, NA may be modified to confer sensitivity to antiviral neuraminidase inhibitors. The influenza gene (e.g., the HA gene or NA gene) can be modified before introduction into a culture host by introducing it into a culture host on the expression construct.

[0066] HA and / or NA sequences may also be manipulated to produce chimeric HA or chimeric NA sequences containing sequences from two or more influenza strains. For example, a chimeric HA or chimeric NA may contain the cytoplasmic portion, or cytoplasmic and transmembrane portion, of the HA or NA from one strain, as well as at least the extracellular antigenic portion of the HA or NA from another strain. This approach has been previously described as a technique for producing influenza viruses containing the antigenic portions of HA or NA in situations where unmodified HA and / or NA segments may be produced in low yields. However, the method of the present invention may avoid the need for the use of chimeric HA and / or chimeric NA segments because sequence variants present in the population of virions delivered to the culture host by infection with the influenza virus strain can result in sufficient mutation for the efficient production of gene reassortment viruses containing non-chimeric HA and / or non-chimeric NA.

[0067] Therefore, in some embodiments, the HA sequence is a non-chimeric HA sequence. In other words, the HA sequence includes the cytoplasmic, transmembrane, and extracellular domains of the same influenza strain. In some embodiments, the NA sequence is a non-chimeric NA sequence. In other words, the NA sequence includes the cytoplasmic, transmembrane, and extracellular domains of the same influenza strain. In certain such embodiments, the HA sequence and / or NA sequence are non-chimeric sequences, but they may include other modifications as described herein. For example, a non-chimeric HA sequence may be modified to remove a determinant that makes the virus highly pathogenic (e.g., a highly basic region around the HA1 / HA2 cleavage site). Similarly, if the vaccine strain NA contains a pre-existing neuraminidase inhibitor-resistant mutation, the non-chimeric NA sequence may be modified to confer susceptibility to an antiviral neuraminidase inhibitor.

[0068] The number of influenza genes delivered to the culture host can be controlled by the method of the present invention. In certain embodiments, one or more expression constructs contain seven or fewer influenza genes. Providing seven or fewer influenza genes means that fewer influenza genes are provided to the culture host than in classical gene reassortment (where eight segments are provided by the second influenza virus strain), and is therefore advantageous because it reduces the number of possible gene arrangement ratios that can exist in the gene reassortment virus produced by this method. Further limiting the number of influenza genes also limits the possible gene arrangement ratios that can exist in the gene reassortment virus produced by this method. Therefore, in certain embodiments, one or more expression constructs contain six or fewer influenza genes. In other embodiments, one or more expression constructs contain five or fewer influenza genes. In further embodiments, one or more expression constructs contain four or fewer influenza genes.

[0069] When attempting to maximize the production of gene reassortment viruses with specific gene arrangement ratios, providing fewer influenza genes can be particularly advantageous. For example, if one or more expression constructs contain only a single HA gene and a single NA gene, the likelihood of producing 7:1 and 6:2 viruses increases. This is because the only backbone segment present in the culture host for the production of gene reassortment viruses originates from the donor strain. Therefore, in preferred embodiments, one or more expression constructs contain two or fewer influenza genes. In such specific embodiments, one or more expression constructs contain one HA gene and one NA gene.

[0070] In some embodiments, one or more expression constructs include three or fewer influenza genes. In these embodiments, one or more expression constructs include one HA gene, one NA gene, and one backbone gene. The backbone gene is selected from the group consisting of PB2, PB1, PA, NP, M, and NS. Preferably, the backbone gene is PB1. By introducing a single backbone segment with the HA and NA genes into a cultured host, the production of a 5:3 gene reassortment virus is made possible. In these embodiments, negative selection for the corresponding backbone segment from a donor strain can preferably be carried out using an agent that inhibits the transcription and / or translation of the backbone segment. In certain embodiments, RNAi agents are used. The use of an agent that inhibits transcription and / or translation is advantageous because the backbone segment is less exposed on the surface of the influenza virion than HA and NA, and is therefore less suitable for selection using one or more antibodies for or against the backbone segment.

[0071] In some embodiments, one or more expression constructs contain only a single influenza gene. In certain such embodiments, the single influenza gene is a second HA gene. This aspect of the invention is useful in situations where it is desirable to produce a gene-reassorting virus having an NA gene from a donor strain. Because only a single second HA gene is present in the culture host, using one or more expression constructs containing only a single HA gene increases the production of a 7:1 gene-reassorting virus. In other embodiments, the single influenza gene is a second NA gene. This aspect of the invention is useful in situations where it is desirable to produce a gene-reassorting virus having an HA gene from a donor strain. Because only a single second NA gene is present in the culture host, using one or more expression constructs containing only a single NA gene increases the production of a 7:1 gene-reassorting virus. These embodiments of the invention may be particularly useful when seeking to produce a gene-reassorting influenza B virus, since the gene-reassorting influenza B virus having desirable properties may contain the NA segment of the parent influenza B strain.

[0072] In certain embodiments, one or more expression constructs are introduced into the culture host simultaneously with contact between the culture host and the donor strain. Introducing one or more expression constructs into the culture host simultaneously with contact between the culture host and the donor strain can also be described as simultaneous delivery. The inventors have found that simultaneous delivery of expression constructs and infection by the donor strain enhances the production of genetically reassorted influenza virus. In the context of this invention, simultaneous means within 5 minutes. Consequently, contact between the culture host and the donor strain, followed by the introduction of one or more expression constructs into the culture host within a maximum of 5 minutes, is considered simultaneous delivery.

[0073] In one embodiment, the simultaneous delivery of one or more expression constructs and contact between the cultured host and the donor strain includes the simultaneous transfection of the expression constructs and the purified donor strain. In certain such embodiments, one or more expression constructs are mixed with a purified parent influenza strain and delivered to host cells using any transfection method known to those skilled in the art. Suitable transfection methods include electroporation, DEAE-dextran, calcium phosphate precipitation, liposomes, microinjection, microparticle guns, or other transfection reagents.

[0074] In other embodiments, one or more expression constructs are introduced into the culture host before the culture host is contacted with the donor strain. In other embodiments, one or more expression constructs are introduced into the culture host after the culture host has been contacted with the donor strain. In certain embodiments, the time difference between contact with the culture host and the introduction of one or more expression constructs is 10, 20, 30, 40, 50, 60, 90, 120, or 180 minutes or less. In other embodiments, the time difference between contact with the culture host and the introduction of one or more expression constructs is 3, 4, 5, 6, 8, 10, 12, 18, or 24 hours or less. In certain embodiments, the time difference between contact with the culture host and the introduction of one or more expression constructs is 1 to 3 hours. Such staggered delivery may be advantageous in situations where simultaneous delivery is not practical.

[0075] One or more expression constructs introduced into a cultured host may include influenza A virus HA subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, or H16. They may also include influenza A virus NA subtypes N1, N2, N3, N4, N5, N6, N7, N8, or N9. One or more expression constructs introduced into a cultured host may include one or more influenza genes from seasonal influenza strains. In these embodiments, one or more expression constructs may include, for example, HA having an H1 or H3 subtype. In one embodiment of the present invention, one or more expression constructs include influenza genes from a vaccine strain that is an H1N1 or H3N2 strain.

[0076] Production, selection, and isolation of gene reassortment viruses A gene reassortment virus produced by culturing a culture host in contact with a donor strain and into which one or more expression constructs including a second HA gene or a second NA gene are introduced includes the influenza gene from the donor strain and a second HA gene or a second NA gene encoded by one or more expression constructs. In a preferred embodiment, a gene reassortment virus produced by culturing a culture host in contact with a donor strain and into which one or more expression constructs including a second HA gene and a second NA gene are introduced includes the influenza gene from the donor strain and a second HA gene and a second NA gene encoded by one or more expression constructs. In a further embodiment, a gene reassortment virus produced by culturing a culture host in contact with a donor strain and into which one or more expression constructs including a second HA gene, a second NA gene, and a second backbone gene (i.e., PB1, PB2, PA, M, NS, or NP gene) are introduced includes the influenza gene from the donor strain and a second HA gene, a second NA gene, and a second backbone gene encoded by one or more expression constructs.

[0077] The method of the present invention also further comprises a selection step for enhancing the production of gene reassortment viruses containing a second HA gene (i.e., the HA gene of the vaccine strain). The selection step may include any method for improving the selection of gene reassortment viruses containing HA derived from the vaccine strain (second HA gene). In some embodiments, the selection step is performed after the culture host has been cultured to produce gene reassortment influenza viruses. Thus, in some embodiments, the method of the present invention comprises the following steps: (i) contacting the culture host with a parental influenza virus strain containing a first hemagglutinin (HA) gene and a first neuraminidase (NA) gene; (ii) introducing one or more expression constructs containing one or more influenza genes into the culture host, wherein the influenza genes include a second HA gene or a second NA gene; (iii) culturing the culture host to produce gene reassortment viruses; and then, after the reassortment viruses have been produced, (iv) selecting gene reassortment viruses containing a second HA gene or a second NA gene.

[0078] In some embodiments, the method includes a step of isolating the gene reassortment virus from the culture host before the selection step. For example, in certain embodiments, the cell culture supernatant containing the gene reassortment virus is isolated from the culture host, and the selection step is performed on the supernatant containing the gene reassortment virus.

[0079] In some embodiments, the selection step may include negative selection for HA-containing gene reassortment viruses from a donor strain. In some embodiments, the selection step may include positive selection for HA-containing gene reassortment viruses from a vaccine strain. In some embodiments, the selection step includes one or more negative selection steps and one or more positive selection steps. In other embodiments, the selection step includes one or more negative selection steps but does not include positive selection steps. In other embodiments, the selection step includes one or more positive selection steps but does not include one or more negative selection steps. One or more negative selection steps may be used to enhance the production of HA-containing gene reassortment viruses derived from the vaccine strain. Similarly, one or more positive selection steps may be used to enhance the production of HA-containing gene reassortment viruses derived from the vaccine strain.

[0080] Similarly, negative and / or positive selection steps may be used to enhance the production of gene reassortment viruses containing other segments derived from the vaccine strain. In certain embodiments, the selection step enhances the selection of gene reassortment viruses containing NA derived from the vaccine strain (second NA gene). In preferred embodiments, the selection step enhances the selection of gene reassortment viruses containing HA and NA derived from the vaccine strain. In further embodiments, the selection step enhances the selection of gene reassortment viruses containing PB1, PB2, PA, M, NS, or NP segments derived from the vaccine strain. In preferred embodiments, the selection step enhances the selection of reassortment viruses containing HA, NA, and a backbone segment selected from the group consisting of PB1, PB2, PA, M, NS, or NP segments of the vaccine strain.

[0081] In some embodiments, negative selection includes contacting a cultured host with one or more antibodies against a first HA protein. In some embodiments, negative selection includes contacting a gene reassortment virus isolated from the cultured host with one or more antibodies against a first HA protein. In certain embodiments, negative selection includes contacting a cell culture supernatant containing the gene reassortment virus produced by this method with one or more antibodies against a first HA protein. In certain embodiments, the antibodies are present in antiserum against a first HA protein. In other embodiments, one or more monoclonal antibodies against a first HA protein are used in the negative selection step.

[0082] Negative selection may also involve exposing the cultured host to an inhibitor that preferentially reduces the transcription and / or translation of the donor strain's HA gene or protein compared to the vaccine strain's HA gene or protein. A preferential reduction in the donor strain's HA gene or protein levels, either at the transcriptional or translational level, is favorable to the formation of a gene reassortment influenza virus containing the vaccine strain's HA, as the likelihood of the vaccine strain's HA gene being incorporated and proliferating increases as their relative abundance increases. Suitable inhibitors are known to those skilled in the art and have been described elsewhere

[11] . In certain embodiments, the inhibitor that preferentially reduces the transcription and / or translation of the donor strain's HA gene or protein is selected from the group consisting of short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), or small interfering DNA (siDNA) (e.g., phosphorothioate oligomers (PSO) or phosphorodiamidate morpholino oligomers (PMO)). In certain embodiments, two or more inhibitors are used that preferentially reduce the transcription and / or translation of the HA gene or protein in the donor strain.

[0083] In some embodiments, the method does not involve exposing the cultured host to an inhibitor that preferentially reduces the transcription and / or translation of the HA gene or protein of the donor strain compared to the HA gene or protein of the vaccine strain.

[0084] In preferred embodiments, one or more expression constructs include a second HA gene and a second NA gene. In these embodiments, the selection step may include contacting the culture host with one or more antibodies against the first HA protein and / or one or more antibodies against the NA protein. In particularly preferred embodiments, the antibodies are present in antiserum against the first HA and / or NA proteins. In other embodiments, one or more monoclonal antibodies against the first HA protein and / or one or more monoclonal antibodies against the first NA protein are used in the negative selection step.

[0085] In certain embodiments, one or more expression constructs include a second PB1, PB2, PA, M, NS, or NP gene. In these embodiments, the additional backbone segment (i.e., the PB1, PB2, PA, M, NS, or NP segment) is provided to the culture host by the vaccine strain. Such embodiments may include a negative selection step against the first PB1, PB2, PA, M, NS, or NP gene of the donor strain to enhance the production of a gene reassortment virus containing the second PB1, PB2, PA, M, NS, or NP gene segment. Negative selection using an inhibitor that preferentially reduces the transcription and / or translation of the donor strain's PB1, PB2, PA, M, NS, or NP gene segment compared to the vaccine strain's PB1, PB2, PA, M, NS, or NP gene segment is preferred. This is because inhibiting the translation or transcription of the backbone segment is a more effective negative selection step than exposure to one or more antibodies, since the protein encoded by the backbone segment cannot access antibodies on the surface of the influenza virion as readily as the HA and NA proteins. Nevertheless, exposure of the cultured host to one or more antibodies against a second PB1, PB2, PA, M, NS, or NP gene segment may be used as an alternative or additional negative selection step. In some embodiments, the method does not involve exposing the cultured host to an inhibitor that preferentially reduces the transcription and / or translation of the PB1, PB2, PA, M, NS, or NP gene segment of the donor strain compared to the PB1, PB2, PA, M, NS, or NP gene segment of the vaccine strain.

[0086] In some embodiments, the positive selection step includes contacting the cultured host with one or more antibodies specific to the second HA protein. In some embodiments, the positive selection step includes contacting the gene reassortment virus isolated from the cultured host with one or more antibodies specific to the second HA protein. In certain embodiments, the positive selection step includes contacting the cell culture supernatant containing the gene reassortment virus produced by this method with one or more antibodies specific to the second HA protein. Thus, positive selection of the gene reassortment virus containing the second HA gene from the cultured host is possible. In preferred embodiments, one or more antibodies used for positive selection are labeled (e.g., with magnetic beads). Labeling assists in the subsequent isolation of the gene reassortment virus containing the second HA gene.

[0087] The method of the present invention may include one or more selection steps. For example, a reassorted virus may be passaged multiple times in the presence of antiserum. Multiple selection steps are performed to improve the selection of reassorted influenza viruses containing a second HA gene. In a preferred embodiment, multiple selection steps are performed to improve the selection of reassorted influenza viruses containing a second HA gene. In a particular embodiment, the method includes two, three, four, five, or six negative selection steps. In a preferred embodiment, the method includes two negative selection steps. In another preferred embodiment, the method includes three negative selection steps.

[0088] The use of one or more expression constructs in the method of the present invention means that, when all influenza gene segments are provided by the parent influenza virus strain, the culture host contains fewer undesirable sequence variants or subspecies than are present in classical gene reassortment. As a result, the method typically requires fewer selection steps to produce the desired gene reassortment virus. Fewer selection steps mean that gene reassortment viruses can be produced more rapidly than in classical gene reassortment. Therefore, in one embodiment, the method includes one or fewer selection steps. In another embodiment, the method includes two or fewer selection steps. In a further embodiment, the method includes three or fewer selection steps. The selection steps may be performed simultaneously (i.e., at the same time) or sequentially (i.e., one after the other).

[0089] A selection step may be used to select viruses having a specific gene arrangement ratio. For example, a selection step for a single gene or a selection step for a single gene can be used only to increase the production of 7:1 viruses. In certain embodiments, negative selection is for a single influenza segment. In certain embodiments, negative selection is for the HA gene only. In other embodiments, negative selection is for the NA gene only. Similarly, when attempting to increase the production of 6:2 gene reassortment viruses, negative selection is for both influenza segments. In these embodiments, selection is typically negative selection for the HA and NA segments from the donor strain.

[0090] In some embodiments, the selection step is carried out in the same culture host used in the first step of the method. In other embodiments, the selection step is carried out in a different culture host. In these embodiments, the virus produced in step (iii) of the method is transferred from the first culture host to a second culture host, where one or more negative selection steps are carried out. The first and second culture hosts may be the same or different. In one embodiment, the first culture host is a cell, and the second culture host is a developing chicken egg.

[0091] The method of the present invention produces a pool of genetically reassembled viruses from which a specific class of genetically reassembled viruses can be isolated. Because reverse genetics techniques produce fewer variants and reduce viral diversity, this provides a greater ability to select specific viral properties than those offered by reverse genetics. Isolation of specific genetically reassembled influenza viruses means that genetically reassembled viruses with advantageous properties can be selected for further processing. For example, a genetically reassembled virus with high growth characteristics and containing the HA and NA genes of an epidemic influenza strain can be isolated for use as a seed virus in vaccine production. Therefore, the method of the present invention may further include the step of isolating a genetically reassembled influenza virus containing a second HA gene and a second NA gene.

[0092] In certain embodiments, the method produces genetically reassorted influenza A viruses or genetically reassorted viruses having influenza A HA. In some embodiments, the method produces genetically reassorted influenza A viruses or genetically reassorted viruses having influenza A HA and NA. Analysis of vaccine seed viruses has shown that 95% of influenza A seed viruses have a gene arrangement ratio of 6:2 or 5:3. Therefore, the method of the present invention is particularly effective for generating influenza A seed viruses because it provides a limited number of backbone segments, thereby increasing the likelihood of producing 6:2 or 5:3 genetically reassorted viruses.

[0093] The genetically reassorted influenza viruses produced by the method of the present invention may include influenza A virus HA subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, or H16. These genetically reassorted influenza viruses may include influenza A virus NA subtypes N1, N2, N3, N4, N5, N6, N7, N8, or N9. If the vaccine strain used in the genetically reassorted influenza viruses of the present invention is a seasonal influenza strain, the vaccine strain may have an H1 or H3 subtype. In one embodiment of the present invention, the vaccine strain is an H1N1 or H3N2 strain.

[0094] In other embodiments, the method produces a genetically reassorted influenza B virus or a genetically reassorted virus having influenza B HA. In some embodiments, the method produces a genetically reassorted influenza B virus or a genetically reassorted virus having influenza B HA and NA. The gene arrangement ratio in influenza B viruses is highly diverse and difficult to predict. The methods of the present invention are advantageous because they provide improved control over the gene arrangement ratio of genetically reassorted influenza B viruses. The genetically reassorted influenza viruses produced by the methods of the present invention may contain the HA segment of an influenza B strain.

[0095] In certain embodiments, the method of the present invention is used to produce a genetically reassorted influenza virus based on a pandemic strain or a potential pandemic strain. In certain embodiments, the genetically reassorted virus contains HA from a pandemic strain or a potential pandemic strain. The characteristics of an influenza strain that give the potential to cause a pandemic outbreak are as follows: (a) it contains a new hemagglutinin compared to the hemagglutinins of currently circulating human strains, i.e., one that has not been revealed in human populations for 10 years (e.g., H2), or one that has never been seen in human populations before (e.g., H5, H6, or H9, which is generally found only in avian populations), so that human populations are immunologically naive to the hemagglutinins of this strain; (b) it can be transmitted horizontally within human populations; and (c) it is pathogenic to humans. In certain embodiments, the method of the present invention produces a genetically reassorted influenza virus containing the H5 hemagglutinin type. The H5 hemagglutinin type is preferred when the genetically reassorted virus is used in a vaccine for immunity against pandemic influenza such as the H5N1 strain. Other possible strains include H5N3, H9N2, H2N2, H7N1, H7N7, and other potentially emerging pandemic strains. The present invention is suitable for producing genetically reassorted viruses for use in vaccines to protect against potential pandemic virus strains that may spread from non-human animal populations to humans, or that have spread, such as the H1N1 influenza strain of swine origin.

[0096] culture host The culture host for use in the method of the present invention may be a developing chicken egg or cells. In a preferred embodiment, the culture host is a cell culture.

[0097] One method for growing influenza viruses is to use specific pathogen-free (SPF) bred chicken eggs, inoculate the egg contents (aloulanal membrane fluid) with the virus, grow it, and then purify it. Influenza viruses can also grow in animal cell cultures, and this growth method is preferred for reasons of replication accuracy, speed, and patient allergies. When egg-based viral growth is used, one or more amino acids may be introduced into the egg's alloulanal membrane fluid along with the virus

[42] .

[0098] When using cells, the present invention typically uses cell lines, but primary cells may be used as an alternative, for example. The cells are typically mammalian. Suitable mammalian cells from which cells are derived include, but are not limited to, hamster, cattle, primates (such as humans and monkeys), and canine cells. Various cell types may be used, such as kidney cells, fibroblasts, retinal cells, and lung cells. An example of a suitable hamster cell is a cell line having the name BHK21 or HKCC. Suitable monkey cells are, for example, African green monkey cells (such as kidney cells like the Vero cell line) [12-14]. Suitable canine cells are, for example, kidney cells like the CLDK and MDCK cell lines. Thus, suitable cell lines are, but are not limited to, MDCK;CHO;293T;BHK;Vero;MRC-5;PER.C6;WI-38, etc. Mammalian cell lines preferred for influenza virus growth include MDCK cells derived from Madinderby canine kidneys [15-18]; Vero cells derived from African green monkey (Cercopithecus aethiops) kidneys [12-14]; or PER.C6 cells derived from human embryonic retinoblasts

[19] . These cell lines are widely available, for example, from the American Type Cell Culture (ATCC) Collection

[20] , Coriell Cell Repositories

[21] , or the European Collection of Cell Cultures (ECACC). For example, ATCC offers various different Vero cells under catalog numbers CCL-81, CCL-81.2, CRL-1586, and CRL-1587, and MDCK cells under catalog number CCL-34. PER.C6 is available from ECACC under deposit number 96022940. As a less suitable alternative to mammalian cell lines, viruses can be grown in avian cell lines, such as those derived from ducks (e.g., duck retina) or chickens (e.g., chicken embryonic fibroblasts (CEF)) [see, for example, references 22-24]. Examples include avian embryonic stem cells [22,25], including the EBx cell lines derived from chicken embryonic stem cells, EB45, EB14, and EB14-074

[26] .EB66 is a preferred cell line.

[0099] The cells particularly preferred for use in the present invention are Madinderby canine kidney-derived MDCK cells [15-1618]. The original MDCK cells are available from ATCC as CCL-34. Derivatives of MDCK cells may also be used. For example, reference 15 discloses an MDCK cell line adapted for growth in suspension culture ("MDCK 33016", deposited as DSM ACC2219). Similarly, reference 27 discloses an MDCK-derived cell line that grows in suspension in serum-free culture ("B-702", deposited as FERM BP-7449). Reference 28 discloses non-tumor-forming MDCK cells such as "MDCK-S" (ATCC PTA-6500), "MDCK-SF101" (ATCC PTA-6501), "MDCK-SF102" (ATCC PTA-6502), and "MDCK-SF103' (PTA-6503)". Reference 29 discloses MDCK cell lines with high susceptibility to infection, such as "MDCK.5F1" cells (ATCC CRL-12042). Any of these MDCK cell lines may be used.

[0100] When growing in cell lines such as MDCK cells, the virus can grow in suspension culture [15,30,31] or adherent culture. One preferred MDCK cell line for suspension culture is MDCK33016 (deposited as DSM ACC 2219). Alternatively, microcarrier culture can be used.

[0101] Cell lines that maintain influenza virus replication are preferably grown in serum-free and / or protein-free media. In the context of this invention, a medium that does not contain additives from human or animal serum is referred to as a serum-free medium. Protein-free is understood to mean a culture in which cell proliferation occurs without proteins, growth factors, other protein additives, and non-serum proteins, although it may optionally include proteins such as trypsin or other proteases that may be necessary for viral growth. Cells growing in such a culture naturally contain proteins themselves.

[0102] Cell lines that maintain influenza virus replication are grown, for example, during viral replication, preferably at temperatures below 37°C

[33] (e.g., 30–36°C, or around 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C).

[0103] When the virus grows on a cell line, the growth culture and the viral inoculum used to initiate the culture are preferably free from herpes simplex virus, respiratory syncytial virus, parainfluenza virus 3, SARS coronavirus, adenovirus, rhinovirus, reovirus, poliomavirus, birnavirus, circovirus, and / or parvovirus (i.e., tested for contamination and thereby obtaining a negative result)

[32] .

[0104] When the virus is grown on mammalian cell lines, the composition is advantageously free of egg proteins (e.g., ovalbumin and ovomucoid) and chicken DNA, thereby reducing allergenicity. Avoiding allergens is useful in minimizing the Th2 response. When cells are used as culture hosts in the method of the present invention, it is known that cell culture conditions (e.g., temperature, cell density, pH value, etc.) can vary widely depending on the cell line and influenza virus used and can be adapted to the requirements of the application. Therefore, the following information is merely a guideline.

[0105] Cell proliferation can be carried out according to methods known to those skilled in the art. For example, cells may be cultured in a perfusion system using conventional support methods such as centrifugation or filtration. Furthermore, cells may be grown in a fed-batch culture system according to the present invention before infection. In the context of the present invention, the culture system is referred to as a fed-batch system, in which cells are first cultured in a batch system, and depletion of nutrients (or a portion of nutrients) in the culture medium is compensated by the controlled supply of concentrated nutrients. During cell proliferation before infection, it may be advantageous to adjust the pH value of the culture medium to a value of pH 6.6 to pH 7.8, particularly pH 7.2 to pH 7.3. Cell culture is preferably carried out at a temperature of 30 to 40°C. After infection with the influenza virus, cells are preferably cultured at a temperature of 30 to 36°C or 32 to 34°C, or about 33°C. This is particularly preferred because incubation of infected cells within this temperature range has been shown to improve the efficacy of the virus when incorporated into a vaccine

[33] .

[0106] The oxygen partial pressure can be adjusted during pre-infection culture, preferably to a value of 25% to 95%, and particularly to a value of 35% to 60%. The oxygen partial pressure values ​​described in the context of this invention are based on air saturation. Cell infection is preferably about 8 to 25 x 10 in batch systems. 5 Cells / mL, preferably about 5-20x10 in perfusion systems. 6 This occurs at a cell density of cells / mL. -8 Infection can occur with a viral dose of ~10, preferably 0.0001~0.5 (MOI value, "infection multiplicity," corresponding to the number of viral units per cell at the time of infection).

[0107] The method according to the present invention may include the collection and isolation of a virus or a protein produced by a virus. During the isolation of the virus or protein, cells are separated from the culture medium by standard methods such as separation, filtration, or ultrafiltration. The virus or protein is then concentrated and purified according to methods known to those skilled in the art, such as gradient centrifugation, filtration, precipitation, or chromatography. The virus is preferably inactivated during or after purification. Virus inactivation can be performed, for example, with β-propiolactone or formaldehyde at any point in the purification process.

[0108] Host cell DNA When a virus is isolated and / or grown on a cell line, it is standard practice to minimize the amount of residual cell line DNA in the final vaccine to minimize any potential oncogenic activity of the DNA.

[0109] Therefore, the vaccine composition prepared according to the present invention may contain trace amounts of host cell DNA, but preferably contains less than 10 ng (preferably less than 1 ng, more preferably less than 100 pg) of residual host cell DNA per dose.

[0110] The average length of any remaining host cell DNA is preferably less than 500 bp, for example, less than 400 bp, less than 300 bp, less than 200 bp, or less than 100 bp.

[0111] Contaminating DNA can be removed during vaccine preparation using standard purification procedures such as chromatography. Removal of residual host cell DNA can be enhanced by nuclease treatment, for example, using DNase. A simple method for reducing host cell DNA contamination is disclosed in references 34 and 35 and involves a two-step treatment using a DNase (e.g., benzonase) which may be used during viral growth, and then a cationic washing agent (e.g., CTAB) which may be used during virion disruption. Treatment with alkylating agents such as β-propiolactone can also be used to remove host cell DNA and can be advantageously used to inactivate virions

[36] .

[0112] vaccine This invention utilizes a virus produced according to a method for manufacturing a vaccine. Influenza vaccines are typically based on either live or inactivated viruses. Inactivated vaccines may be based on whole virions, "split" virions, or purified surface antigens. Antigens may be presented in the form of virosomals. The present invention can be used to manufacture any of these types of vaccines.

[0113] When inactivated influenza viruses are used, the vaccine may contain whole virions, split virions, or purified surface antigens (containing hemagglutinins, and usually neuraminidase). Chemical means for inactivating the virus include treatment with one or more of the following agents in an effective amount: washing agents, formaldehyde, β-propiolactone, methylene blue, psoralen, carboxyfullerene (C60), secondary ethylamines, acetylethyleneimine, or combinations thereof. Non-chemical methods of virus inactivation, such as UV light or gamma ray irradiation, are known in the art.

[0114] Virions can be collected from virus-containing fluids, such as allantoic fluid or cell culture supernatant, by various methods. For example, the purification process may include zone centrifugation or affinity chromatography using a linear sucrose gradient solution (optionally including a washing agent to disrupt the virions). The antigen can then be purified by dialysfiltration after any dilution.

[0115] Split virions are obtained by treating purified virions with a washing agent (e.g., ethyl ether, polysorbate 80, deoxycholate, tri-N-butyl phosphate, Triton® X-100, Triton® N101, cetyltrimethylammonium bromide, Tergitol NP9, etc.) to produce subvirion preparations (including the "Tween® ether" splitting process). For example, methods for splitting influenza viruses are well known in the art. See, for example, references 37-42. Virus splitting is typically performed by destroying or fragmenting the entire virus using a destructive concentration of a splitting agent, whether infectious or non-infectious. Such destruction results in complete or partial solubilization of viral proteins and alters the integrity of the virus. Preferred resolving agents include nonionic and ionic (e.g., cationic) surfactants, such as alkyl glycosides, alkyl thioglycosides, acyl sugars, sulfobetaines, betaines, polyoxyethylene alkyl ethers, N,N-dialkyl-glucamides, hecameg, alkylphenoxy-polyethoxyethanol, NP9, quaternary ammonium compounds, sarcosyl, CTAB (cetyltrimethylammonium bromide), tri-N-butyl phosphate, cetabrone, myristyltrimethylammonium salts, lipofectin, lipofectamine, and DOT-MA, octyl or nonylphenoxypolyoxyethanol (e.g., Triton® surfactants such as Triton® X-100 or Triton® N101), polyoxyethylene sorbitan esters (Tween® surfactants), polyoxyethylene ethers, and polyoxyethylene esters. In one useful splitting procedure, the splitting can occur during the initial virion purification (e.g., in a sucrose density gradient solution) using the sequential effects of sodium deoxycholate and formaldehyde.Therefore, the splitting process includes clarifying the virion-containing material (to remove non-virion material), concentrating the recovered virions (e.g., using an adsorption method such as CaHPO4 adsorption), separating the virions from the non-virion material, splitting the virions using a splitting agent in a density gradient centrifugation step (e.g., using a sucrose gradient containing a splitting agent such as sodium deoxycholate), and then filtration (e.g., ultrafiltration) to remove unwanted material. The split virions can be effectively resuspended in a sodium phosphate-buffered isotonic sodium chloride solution. Examples of split influenza vaccines include products such as BEGRIVAC®, FLUARIX®, FLUZONE®, and FLUSHIELD®.

[0116] Purified influenza virus surface antigen vaccines include the surface antigens, hemagglutinins, and typically neuraminidases. Processes for preparing these proteins in purified form are well known in the art. FLUVIRIN®, AGRIPPAL®, and INFLUVAC® products are influenza subunit vaccines.

[0117] Another form of inactivated antigen is virosomes

[43] (nucleoside-free virus-like liposome particles). Virosomes can be prepared by solubilizing the virus with a washing agent, removing the nucleocapsid, and reconstituting the membrane containing the viral glycoprotein. An alternative method for preparing virosomes involves adding an excess amount of viral membrane glycoprotein to phospholipids to obtain liposomes having the viral protein in their membranes.

[0118] The method of the present invention can also be used to produce live vaccines. Such vaccines are typically prepared by purifying virions from a virion-containing liquid. For example, this liquid can be clarified by centrifugation and stabilized with a buffer (e.g., containing sucrose, potassium phosphate, and monosodium glutamate). Various forms of influenza virus vaccines are currently available (see, for example, Chapters 17 and 18 of Reference 44). Live virus vaccines include MedImmune's FLUMIST® product (a trivalent live virus vaccine).

[0119] Viruses can be attenuated. Viruses can be temperature-sensitive. Viruses can be cold-adapted. These three characteristics are particularly useful when using live viruses as antigens.

[0120] HA is the primary immunogen in current inactivated influenza vaccines, and vaccine doses are typically standardized by referencing HA levels measured by SRID. Existing vaccines typically contain about 15 μg of HA per strain, but lower doses may be used, for example, in children, pandemic situations, or when adjuvants are used. Partial doses such as 1 / 2 (i.e., 7.5 μg HA per strain), 1 / 4 and 1 / 8 are used, as well as higher doses (e.g., 3- or 9-fold doses [45,46]). Therefore, vaccines may contain 0.1 to 150 μg of HA per influenza strain, preferably 0.1 to 50 μg, e.g., 0.1 to 20 μg, 0.1 to 15 μg, 0.1 to 10 μg, 0.1 to 7.5 μg, 0.5 to 5 μg, etc. Specific dosages include approximately 45, 30, 15, 10, 7.5, 5, 3.8, 3.75, 1.9, and 1.5 per strain.

[0121] In the case of live vaccines, the dose is measured by the median tissue culture infectious dose (TCID50), not by the HA content, and is 10 per strain. 6 ~10 8 (preferably 10) 6.5 ~107.5 ) has a common TCID50.

[0122] The compositions of the present invention are suitable for immunization against pandemic-interim strains and may also be useful for immunization against pandemic or potentially pandemic strains. The present invention is suitable for vaccinating humans as well as non-human animals.

[0123] Other strains that can effectively contain the antigen in the composition are strains that are resistant to antiviral therapy (e.g., resistant to oseltamivir

[47] and / or zanamivir), including resistant pandemic strains

[48] .

[0124] The compositions of the present invention (e.g., vaccines produced according to the present invention) may contain antigen(s) from one or more (e.g., 1, 2, 3, 4 or more) influenza virus strains, such as influenza A virus and / or influenza B virus. If the vaccine contains more than one strain of influenza, the different strains may be grown separately and mixed after the virus is recovered and the antigen is prepared. Thus, the process of the present invention may include the step of mixing antigens from two or more influenza strains. Trivalent vaccines are typical, such as antigens from two influenza A virus strains and one influenza B virus strain. Quadrivalent vaccines are also useful

[49] , such as antigens from two influenza A virus strains and two influenza B virus strains, or antigens from three influenza A virus strains and one influenza B virus strain.

[0125] Pharmaceutical composition Vaccine compositions prepared in accordance with the present invention are pharmaceutically acceptable. They typically contain components in addition to the antigen, for example, they typically contain one or more pharmaceutical carriers and / or excipients. “pharmaceutically acceptable carriers” include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Preferred carriers are typically large, slowly metabolized polymers such as proteins, polysaccharides, polylactic acid, polyglycolic acid, high molecular weight amino acids, amino acid copolymers, sucrose, trehalose, lactose, and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those skilled in the art. The composition may also contain pharmaceutically acceptable diluents such as water, saline, and glycerol. Furthermore, auxiliary substances such as wetting agents or emulsifiers, pH buffers, etc., may be present. Sterile pyrogen-free phosphate-buffered saline is a typical carrier (a detailed description of such components is available in Reference 50). Adjuvants may also be included, as described below.

[0126] Vaccine compositions are generally in aqueous form. However, some vaccines may be in dry form, such as in the form of a dry or polymerized preparation on an injectable solid or patch.

[0127] The vaccine composition may contain preservatives such as thiomersal or 2-phenoxyethanol. However, it is preferable that the vaccine is substantially free of mercury material (i.e., less than 5 μg / ml), for example, thiomersal-free [41,51]. A mercury-free vaccine is more preferable. Alpha-tocopherol succinate can be included as a substitute for mercury compounds

[41] . A vaccine free of preservatives is particularly preferred.

[0128] To control the tonicity, it is preferable to include physiological salts such as sodium salts. Sodium chloride (NaCl) is preferred and may be present at concentrations of 1 to 20 mg / ml. Other possible salts include potassium chloride, potassium dihydrogen phosphate, disodium phosphate dihydrate, magnesium chloride, and calcium chloride.

[0129] Vaccine compositions generally have an osmotic pressure in the range of 200 mOsm / kg to 400 mOsm / kg, preferably 240 to 360 mOsm / kg, and more preferably 290 to 310 mOsm / kg. Although it has been previously reported that osmotic pressure does not affect pain caused by vaccination

[52] , it is still preferable to maintain the osmotic pressure within this range.

[0130] The vaccine composition may contain one or more buffers. Typical buffers include phosphate buffer, Tris buffer, borate buffer, succinate buffer, histidine buffer (especially those containing an aluminum hydroxide adjuvant), or citrate buffer. The buffer is typically present in a concentration ranging from 5 to 20 mM.

[0131] The pH of vaccine compositions is generally between 5.0 and 8.1, more typically between 6.0 and 8.0, for example, between 6.5 and 7.5, or between 7.0 and 7.8. Therefore, the process of the present invention may include the step of adjusting the pH of the bulk vaccine before packaging.

[0132] The vaccine composition is preferably sterile. The vaccine composition is also preferably non-pyrogenic, containing, for example, <1 EU (endotoxin units, standard specification) per dose, or for example, <0.1 EU per dose. The vaccine composition is preferably gluten-free.

[0133] The vaccine composition of the present invention, particularly in the case of split or surface antigen vaccines, may contain a cleansing agent, such as a polyoxyethylene sorbitan ester surfactant (known as "Tween®"), octoxynol (octoxynol-9 (Triton® X-100) or t-octylphenoxypolyethoxyethanol), cetyltrimethylammonium bromide ("CTAB"), or sodium deoxycholate. The cleansing agent may be present only in trace amounts. Therefore, the vaccine may contain less than 1 mg / ml each of octoxynol-10 and polysorbate 80. Trace amounts of other residual components may be antibiotics (e.g., neomycin, kanamycin, polymyxin B).

[0134] The vaccine composition may contain materials for a single immunization or materials for multiple immunizations (i.e., a “multi-dose” kit). The inclusion of preservatives is preferred in multi-dose compositions. As an alternative to (or in addition to) including preservatives in the multi-dose composition, the composition may be housed in a container having a sterile adapter for dispensing the materials.

[0135] Influenza vaccines are typically administered in doses of about 0.5 ml, but children may be given half the dose (i.e., about 0.25 ml).

[0136] The compositions and kits should preferably be stored at 2°C to 8°C. They must not be frozen. Ideally, they should be kept away from direct sunlight.

[0137] Adjuvant The compositions of the present invention (for example, a vaccine produced according to the present invention) may advantageously include adjuvants that can function to enhance the immune response (humoral and / or cellular) induced in a subject receiving the composition.

[0138] Adjuvants are preferably oil-in-water emulsion adjuvants, as they have been shown to work well with influenza antigens.

[0139] Oil-in-water emulsion adjuvant Oil-in-water emulsions have been found to be particularly suitable for use as adjuvants in influenza virus vaccines. Various such emulsions are known, and they typically contain at least one oil and at least one surfactant, where the oil(s) and surfactant(s) are biodegradable (metabolizable) and biocompatible. Oil droplets in the emulsion are generally less than 5 μm in diameter and can have submicron diameters. These small sizes are achieved in microfluidizers to provide stable emulsions. Droplets with an average size of less than 220 nm are preferred because they can be filter-sterilized.

[0140] In preferred embodiments, the oil-in-water emulsion is homogeneous. A homogeneous emulsion is characterized in that the majority of droplets (particles) dispersed therein fall within a specified size range (e.g., diameter). Preferred specified size ranges may be, for example, 50-220 nm, 50-180 nm, 80-180 nm, 100-175 nm, 120-185 nm, 130-190 nm, 135-175 nm, or 150-175 nm. In some embodiments, the homogeneous emulsion contains a number of droplets (particles) outside the specified diameter range of 10% or less. In some embodiments, the average particle size of the oil droplets in the oil-in-water emulsion preparation is 135-175 nm, e.g., 155 nm ± 20 nm, when measured by dynamic light scattering, and such a preparation has a particle size of 1 x 10¹⁶ per mL of preparation when measured by optical particle sensing. 7The following large particles are included. As used herein, “large particles” means particles having a diameter greater than 1.2 μm, typically between 1.2 and 400 μm. In preferred embodiments, a uniform emulsion contains less than 10%, less than 5%, or less than 3% of droplets outside the preferred size range. In some embodiments, the average droplet size of particles in the oil-in-water emulsion preparation is 125–185 nm, e.g., about 130 nm, about 140 nm, about 150 nm, about 155 nm, about 160 nm, about 170 nm, or about 180 nm, and the oil-in-water emulsion is uniform in that less than 5% of the number of droplets in the preparation are outside the 125–185 nm range.

[0141] The present invention can be used in combination with oils such as oils from animal (fish, etc.) or plant sources. Sources of vegetable oils include nuts, seeds, and grains. Peanut oil, soybean oil, coconut oil, and olive oil are the most commonly available, and examples include nut oils. Jojoba oil, obtained from jojoba beans, can be used, for example. Seed oils include safflower oil, cottonseed oil, sunflower seed oil, and sesame seed oil. Among grains, corn oil is the most readily available, but oils from other grains such as wheat, oats, rye, rice, teff, and rye can also be used. Glycerol and 6-10 carbon fatty acid esters of 1,2-propanediol are not naturally present in seed oils, but can be prepared by hydrolysis, separation, and esterification of suitable materials starting from nut oils and seed oils. Fatty acids from mammalian milk are metabolizable and therefore may be used in the implementation of the present invention. Procedures for separation, purification, saponification, and other means necessary to obtain pure oils from animal sources are well known in the art. Most fish contain metabolizable oils, which can be readily recovered. For example, cod liver oil, shark liver oil, and whale oil, such as whale wax, exemplify some of the fish oils that may be used herein. Multiple branched-chain oils are biochemically synthesized with 5-carbon isoprene units and are generally called terpenoids. Shark liver oil contains a branched unsaturated terpenoid known as squalene, 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexaene, which is particularly preferred herein. Squalane, a saturated analogue of squalene, is also a preferred oil. Fish oils such as squalene and squalane are readily available from commercial sources or can be obtained by methods known in the art. Other preferred oils are tocopherols (see below). Mixtures of oils can be used.

[0142] Surfactants can be classified by "HLB" (hydrophilic / lipophilic balance). Preferred surfactants of the present invention have an HLB of at least 10, preferably at least 15, and more preferably at least 16. The present invention can be used with surfactants including, but not limited to, the following: polyoxyethylene sorbitan ester surfactants (commonly called Tween®), especially polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and / or butylene oxide (BO) sold under the trade name DOWFAX®, e.g., linear EO / PO block copolymers; octoxynol, octoxynol-9 (Triton® X-100, or t-octylphenoxypolyethoxyethanol), which may have a different number of repeating ethoxy(oxy-1,2-ethanediyl) groups, are of particular importance; (octylphenoxy)polyethoxyethanol (IGEPAL) CA-630 / NP-40); phospholipids such as phosphatidylcholine (lecithin); polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl, and oleyl alcohols (known as Brij surfactants), such as triethylene glycol monolauryl ether (Brij 30); and sorbitan esters such as sorbitan trioleate (Span® 85) and sorbitan monolaurate (commonly known as SPAN®). Nonionic surfactants are preferred. Preferred surfactants to include in the emulsion are Tween® 80 (polyoxyethylene sorbitan monooleate), Span® 85 (sorbitan trioleate), lecithin, and Triton® X-100.

[0143] A mixture of surfactants, such as the Tween® 80 / Span® 85 mixture, can be used. Combinations of polyoxyethylene sorbitan esters, such as polyoxyethylene sorbitan monooleate (Tween® 80), and octoxylols, such as t-octylphenoxypolyethoxyethanol (Triton® X-100), are also suitable. Another useful combination involves laureth-9 and polyoxyethylene sorbitan esters and / or octoxylols. The preferred amounts (by weight) of surfactants are: polyoxyethylene sorbitan ester (such as Tween® 80) 0.01-1%, particularly about 0.1%; octyl or nonylphenoxy polyoxyethanol (such as Triton® X-100, or other detergents in the Triton® series) 0.001-0.1%, particularly 0.005-0.02%; and polyoxyethylene ether (such as Laureth 9) 0.1-20%, preferably 0.1-10%, particularly 0.1-1% or about 0.5%.

[0144] The most preferred oil-in-water emulsion is a squalene-containing oil-in-water emulsion, preferably a submicron squalene-containing oil-in-water emulsion.

[0145] Specific oil-in-water emulsions useful in the present invention include, but are not limited to, the following, of which squalene-containing emulsions are preferred:

[0146] A submicron emulsion of squalene, polysorbate 80, and sorbitan trioleate. The emulsion may contain citrate ions, e.g., 10 mM sodium citrate buffer, in the aqueous phase. The emulsion may contain 3.2–4.6 mg / ml of squalene, 4.1–5.3 mg / ml of polysorbate 80, and 4.1–5.3 mg / ml of sorbitan trioleate. The volume composition of the emulsion may be approximately 4.6% squalene, approximately 0.45% polysorbate 80, and approximately 0.5% sorbitan trioleate. The adjuvant known as "MF59" [53,54,55] is described in more detail in Chapter 10 of Reference 56 and Chapter 12 of Reference 57. Squalene, polysorbate 80, and sorbitan trioleate may be present in a weight ratio of 9750:1175:1175. Typical concentrations are approximately 39 mg / mL for squalene, 4.7 mg / mL for polysorbate 80, and 4.7 mg / mL for sorbitan trioleate. A Z-average droplet size of 155-185 nm with a polydispersity of less than 0.2 is preferred.

[0147] An emulsion comprising squalene, tocopherol (particularly DL-α-tocopherol), and polysorbate 80. This emulsion may contain phosphate-buffered saline. These emulsions may contain 2-10% by volume of squalene, 2-10% by volume of tocopherol, and 0.3-3% by volume of polysorbate 80, and the weight ratio of squalene:tocopherol is preferably <1 (e.g., 0.90) as this can result in a more stable emulsion. Squalene and polysorbate 80 may be present in a volume ratio of about 5:2 or a weight ratio of about 11:5. Thus, the three components (squalene, tocopherol, and polysorbate 80) may be present in a weight ratio of 1068:1186:485 or about 55:61:25. One such emulsion ("AS03") contains 4.3 wt% squalene, 4.8 wt% tocopherol, and 2 wt% polysorbate 80. Typical concentrations are approximately 42.7 mg / mL of squalene, 47.4 mg / mL of DL-α-tocopherol, and 19.4 mg / mL of polysorbate 80. A Z-average droplet size of 140–170 nm is preferred. This emulsion may also contain 3-de-O-acylated monophosphoryl lipid A (3d MPL). Another useful emulsion of this type may contain, for example, 0.5–10 mg of squalene, 0.5–11 mg of tocopherol, and 0.1–4 mg of polysorbate 80 per human dose in the ratios discussed above

[58] .

[0148] An emulsion comprising squalene, an aqueous solvent, a polyoxyethylene alkyl ether hydrophilic nonionic surfactant (e.g., polyoxyethylene(12) cetostearyl ether), and a hydrophobic nonionic surfactant (e.g., sorbitan ester or mannide ester, e.g., sorbitan monoleate or "Span 80"). The emulsion is preferably thermoreversible and / or has at least 90% by volume of oil droplets having a size of less than 200 nm

[59] . The emulsion may also comprise one or more of the following: algitol, an antifreeze (e.g., sugars such as dodecyl maltoside and / or sucrose); and / or alkyl polyglycoside. The emulsion may also comprise a TLR4 agonist

[60] . Such emulsions can be freeze-dried. Preferred emulsions include squalene, sorbitan oleate, polyoxyethylene cetostearyl ether, and mannitol (e.g., 32.5% squalene, 4.82% sorbitan oleate, 6.18% polyoxyethylene cetostearyl ether, and 6% mannitol by weight), with an average droplet size of less than 150 nm. Typical concentrations are approximately 49.6 mg / mL for squalene, 7.6 mg / mL for sorbitan oleate, 9.6 mg / mL for polyoxyethylene cetostearyl ether, and 9.2 mg / mL for mannitol.

[0149] An emulsion comprising squalene, phosphatidylcholine, poloxamer 188, glycerol, and ammonium phosphate buffer

[61] , optionally also comprising α-tocopherol ("SE"). An emulsion of squalene, tocopherol, and Triton® detergent (such as Triton® X-100). This emulsion may also contain 3d-MPL (see below). This emulsion may also contain phosphate buffer.

[0150] An emulsion comprising polysorbate (e.g., polysorbate 80), Triton® detergent (e.g., Triton® X-100), and tocopherol (e.g., α-tocopherol succinate). This emulsion may contain these three components in a mass ratio of approximately 75:11:10 (e.g., polysorbate 80 750 μg / ml, Triton® X-100 110 μg / ml, and α-tocopherol succinate 100 μg / ml), and their concentrations should account for all contributions of these components from the antigen. This emulsion may also contain squalene. The aqueous phase may contain phosphate buffer.

[0151] An emulsion of squalane, polysorbate 80, and poloxamer 401 ("Pluronic® L121"). This emulsion can be formulated in phosphate-buffered saline, pH 7.4. This emulsion is a useful delivery medium for muramyl dipeptide and is used in combination with threonyl-MDP in the "SAF-1" adjuvant

[62] (Thr-MDP 0.05-1%, squalane 5%, Pluronic L121 2.5%, and polysorbate 80 0.2%). It can also be used without Thr-MDP, such as in the "AF" adjuvant

[63] (5% squalane, 1.25% Pluronic L121, and 0.2% polysorbate 80). Microfluidization is preferred.

[0152] Emulsion of squalene, poloxamer 105, and Abil-Care

[64] . The final concentrations (by weight) of these components in the adjuvant-added vaccine were 5% squalene, 4% poloxamer 105 (Pluronic® polyol), and 2% Abil-Care 85 (Bis-PEG / PPG-16 / 16PEG / PPG-16 / 16 dimethicone; caprylic acid / capryl triglyceride).

[0153] An emulsion containing 0.5-50% oil, 0.1-10% phospholipids, and 0.05-5% nonionic surfactant. As described in Reference 65, preferred phospholipid components are phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, phosphatidic acid, sphingomyelin, and cardiolipin. Submicron droplet sizes are advantageous.

[0154] A submicron oil-in-water emulsion of a non-metabolized oil (such as light mineral oil) and at least one surfactant (such as lecithin, Tween® 80, or Span® 80). Additives may include Quil A saponin, cholesterol, saponin-lipophilic conjugates (such as GPI-0100, produced by adding an aliphatic amine to desacilsaponin via the carboxyl group of glucuronic acid (see reference 66)), dimethylidoquadecylammonium bromide, and / or N,N-dioctadecyl-N,N-bis(2-hydroxyethyl)propanediamine.

[0155] Emulsions in which saponins (e.g., QuilA or QS21) and sterols (e.g., cholesterol) associate as helical micelles

[67] .

[0156] An emulsion comprising mineral oil, a nonionic lipophilic ethoxylated fatty alcohol, and a nonionic hydrophilic surfactant (e.g., ethoxylated fatty alcohol and / or polyoxyethylene-polyoxypropylene block copolymer)

[68] .

[0157] To prepare injectable vaccines, these emulsions are generally mixed with aqueous immunogen preparations. This mixture typically contains the aqueous emulsion and the aqueous immunogen in a 1:1 volume ratio, in which case the ratio of the emulsion components in the final vaccine is halved. For example, an emulsion containing 5 vol% squalene can be mixed with an antigen solution in a 1:1 ratio to obtain a vaccine with a final concentration of 2.5 vol%. Naturally, other mixing ratios (e.g., using volume ratios of two liquids to mix 5:1 to 1:5) are also possible. Therefore, in the vaccine composition, the concentrations of the emulsion components can be altered by dilution (e.g., by integers (2 or 3, etc.)) while their ratios remain the same. For example, pediatric vaccines may contain lower concentrations of adjuvants, e.g., 4 vol%, 3.5 vol%, 3 vol%, 2.5 vol%, 2 vol%, 1.5 vol%, or 1 vol% squalene.

[0158] After the antigen and adjuvant are mixed, the hemagglutinin antigen generally remains in the aqueous solution, but can distribute itself around the oil / water interface. Generally, hemagglutinins rarely enter the oil phase of the emulsion.

[0159] When the composition contains tocopherol, any of α, β, γ, δ, ε, or ξ tocopherol can be used, but α-tocopherol is preferred. Tocopherol can take several forms, e.g., different salts and / or isomers. Examples of salts include organic salts such as succinate, acetate, and nicotinate. Both D-α-tocopherol and DL-α-tocopherol can be used. Tocopherol is favorably included in vaccines for use in elderly patients (e.g., over 60 years of age) because vitamin E has been reported to have a positive effect on the immune response in this patient group

[69] . They also have antioxidant properties that can help stabilize emulsions

[70] . The preferred α-tocopherol is DL-α-tocopherol, and the preferred salt of this tocopherol is succinate. Succinate has been shown to synergize with TNF-related ligands in vivo. Furthermore, alpha-tocopherol succinate is known to be compatible with influenza vaccines and is a useful preservative as a substitute for mercury compounds

[41] . Vaccines without preservatives are particularly preferred.

[0160] Packaging of vaccine composition Suitable containers for the composition (or kit components) of the present invention include vials, syringes (e.g., disposable syringes), and nasal sprays. These containers should be sterile.

[0161] If the composition / component is in a vial, the vial is preferably made of glass or plastic material. The vial is preferably sterilized before the composition is added thereto. To avoid problems with patients sensitive to latex, the vial is preferably sealed with a latex-free stopper, and preferably no latex is present in any of the packaging materials. The vial may contain a single dose of vaccine or two or more doses ("multiple dose" vial), for example, 10 doses. Preferred vials are made of colorless glass.

[0162] The vial may have a cap (e.g., a Luer lock) fitted to allow the insertion of a pre-filled syringe, thereby enabling the contents of the syringe to be pushed into the vial (e.g., to reconstitute the lyophilized material within it) and the contents of the vial to be returned to the syringe. After the syringe is removed from the vial, a needle can be attached and the composition can be administered to a patient. It is preferable that the cap be placed inside a seal or cover so that the seal or cover must be removed before the cap is used. The vial may have a cap that allows for the aseptic removal of the contents, particularly in the case of a multi-dose vial.

[0163] If the ingredients are packaged in a syringe, the syringe may have a needle attached. If a needle is not attached, another needle may be provided with the syringe for assembly and use. Such a needle may be coated. Safety needles are preferred. Typical needles are 1 inch 23 gauge, 1 inch 25 gauge, and 5 / 8 inch 25 gauge. Syringes may be provided with a peel-off label on which a lot number, influenza season, and expiration date of the contents may be printed for easier record keeping. The plunger in the syringe preferably has a stopper to prevent accidental removal of the plunger during aspiration. Syringes may have a latex rubber cap and / or plunger. Disposable syringes contain a single dose of vaccine. Syringes generally have a tip cap for sealing the tip before needle attachment, and the tip cap is preferably made of butyl rubber. If the syringe and needle are packaged separately, the needle preferably has a butyl rubber shield. The preferred syringe is the one sold under the brand name "Tip-Lok" (trademark).

[0164] The container may be marked to indicate half the volume, for example, to facilitate delivery to children. For example, a syringe containing a 0.5 ml dose may have a mark indicating a 0.25 ml volume.

[0165] When using glass containers (such as syringes or vials), it is preferable to use containers made of borosilicate glass rather than soda-lime glass.

[0166] The kit or composition may be packaged (for example, in the same box) with instructions containing vaccine details (e.g., administration instructions, details of the antigens in the vaccine). These instructions may also include warnings, such as preparing an adrenaline solution that can be readily used in case of anaphylactic reactions after vaccination.

[0167] Treatment methods and vaccine administration The present invention provides vaccines manufactured in accordance with the present invention. These vaccine compositions are suitable for administration to human or non-human animal subjects such as pigs, and the present invention provides a method for enhancing the immune response in a subject, the method comprising the step of administering the vaccine composition of the present invention to the subject. The present invention also provides compositions of the present invention for use as pharmaceuticals, and provides the use of compositions of the present invention for manufacturing pharmaceuticals to enhance the immune response in a subject.

[0168] The immune responses enhanced by these methods and their use generally include antibody responses, preferably protective antibody responses. Methods for evaluating antibody responses, neutralizing ability, and protection after influenza virus vaccination are well known in the art. Human studies have shown that antibody titers against human influenza virus hemagglutinins correlate with protection (a hemagglutination inhibitory titer of about 30–40 in a serum sample provides about 50% protection from homologous virus infection)

[71] . Antibody responses are typically measured by hemagglutination inhibition, microneutralization, single radial immunodiffusion (SRID), and / or single radial hemolysis (SRH). These assay techniques are well known in the art.

[0169] The compositions of the present invention can be administered in a variety of ways. The most preferred route of immunization is by intramuscular injection (e.g., into the arm or leg), but other available routes include subcutaneous injection, intranasal injection [72-74], oral injection

[75] , intradermal injection [76,77], transcutaneous injection, and transdermal injection

[78] .

[0170] Vaccines prepared according to the present invention can be used to treat both children and adults. Influenza vaccines are currently recommended for immunization in children and adults from 6 months of age. Therefore, human subjects may be under 1 year of age, 1–5 years, 5–15 years, 15–55 years, or at least 55 years. Preferred subjects for vaccination are the elderly (e.g., ≥50 years, ≥60 years, preferably ≥65 years), young people (e.g., ≤5 years), hospitalized subjects, healthcare workers, military personnel, pregnant women, subjects with chronic diseases, immunocompromised subjects, subjects who have taken antiviral compounds (e.g., oseltamivir or zanamivir compounds, see below) within 7 days prior to vaccination, subjects with egg allergies, and international travelers. However, the vaccine is not only suitable for these groups and may be more commonly used in the population. In the case of pandemic strains, administration to all age groups is preferable.

[0171] The preferred compositions of the present invention satisfy CPMP criteria 1, 2, or 3 for efficacy. In adults (18-60 years), these criteria are: (1) antibody presence ≥ 70%; (2) seroconversion ≥ 40%; and / or (3) a 2.5-fold or greater increase in GMT. In older adults (>60 years), these criteria are: (1) antibody presence ≥ 60%; (2) seroconversion ≥ 30%; and / or (3) a 2-fold or greater increase in GMT. These criteria are based on open-label trials involving at least 50 patients.

[0172] Treatment can be administered in a single-dose or multi-dose schedule. Multi-dose immunization may be used in a primary immunization schedule and / or booster immunization schedule. In a multi-dose schedule, various doses may be administered via the same or different routes (e.g., parenteral primary and mucosal boost, mucosal primary and parenteral boost). Two or more doses (typically two doses) are particularly useful in immunologically naive patients, e.g., those who have never received an influenza vaccine before, or in cases of vaccination against a new HA subtype (e.g., during a pandemic). Multi-dose immunization is typically administered at least one week apart (e.g., approximately 2 weeks, 3 weeks, 4 weeks, 6 weeks, 8 weeks, 10 weeks, 12 weeks, 16 weeks, etc.).

[0173] The vaccine produced by the present invention can be administered to a patient substantially simultaneously (for example, during the same medical consultation or visit to a healthcare professional or vaccination center) with other vaccines such as measles vaccine, mumps vaccine, rubella vaccine, MMR vaccine, varicella vaccine, MMRV vaccine, diphtheria vaccine, tetanus vaccine, pertussis vaccine, DTP vaccine, conjugate H. influenza b vaccine, inactivated poliovirus vaccine, hepatitis B virus vaccine, meningococcal conjugate vaccine (such as the quadrivalent AC-W135-Y vaccine), respiratory syncytial virus vaccine, pneumococcal conjugate vaccine, etc. Administering it substantially simultaneously with the pneumococcal vaccine and / or meningococcal vaccine is particularly useful in elderly patients.

[0174] Similarly, the vaccines of the present invention may be administered to patients substantially simultaneously (e.g., during the same medical consultation or visit to a healthcare professional) with antiviral compounds, particularly antiviral compounds active against influenza viruses (e.g., oseltamivir and / or zanamivir). These antiviral agents include neuraminidase inhibitors such as (3R,4R,5S)-4-acetylamino-5-amino-3(1-ethylpropoxy)-1-cyclohexene-1-carboxylic acid or 5-(acetylamino)-4-[(aminoiminomethyl)-amino]-2,6-anhydro-3,4,5-trideoxy-D-glycero-D-galactonone-2-enonic acid, their esters (e.g., ethyl esters), and their salts (e.g., phosphates). A preferred antiviral agent is (3R,4R,5S)-4-acetylamino-5-amino-3(1-ethylpropoxy)-1-cyclohexene-1-carboxylic acid, ethyl ester, phosphoric acid (1:1), also known as oseltamivir phosphate (TAMIFLU®).

[0175] definition The term "comprising" encompasses both "including" and "consisting." For example, a composition "containing" X may consist only of X, or it may include some additional element, such as X + Y.

[0176] The term "substantially" does not exclude "completely." For example, a composition that "substantially does not contain" Y does not have to contain Y completely. If necessary, the term "substantially" may be omitted from the definition of this invention.

[0177] The term "approximately" in relation to the number x is arbitrary and can mean, for example, x ± 10%. [Examples]

[0178] Materials and methods Unless otherwise specified, the following materials and methods were used in the following embodiments.

[0179] Cells, viruses, and antisera 293T cells were obtained from Melbourne University and maintained in DMEM containing 10% FBS, 1X GlutaMAX (Gibco), and 1X antibiotic / antifungal agent (Gibco). MDCK(WHO) cells were obtained from WHO and maintained in DMEM containing 10% FBS, 1X GlutaMAX (Gibco), and 1X antibiotic / antifungal agent (Gibco). MDCK33016PF cells

[79] were maintained in chemically defined medium (Lonza).

[0180] The A / Texas / 1 / 1977 high-growth parental (HGP) virus (a 5:3 gene reassembly with PR8) was obtained from D274 (Seqirus). The PR8 HGP virus was generated using reverse genetics. The virus was grown in developing chicken eggs.

[0181] Trypsin periodate-treated sheep antiserums for A / PR / 8 / 1934 and A / Texas / 1 / 1977 were generated using Seqirus.

[0182] plasmid Plasmids containing HA and NA of PR8(H1N1), A / Wyoming / 3 / 2003(H3N2), and A / Indonesia / NIHRD11771 / 2011(H5N1) in the pHW2000 vector

[80] were generated using standard molecular biology techniques. For H6N1, plasmids encoding H6(A / turkey / Massachusetts / 3740 / 1965) and N1(A / Brisbane / 59 / 2007 and A / California / 07 / 2009) were generated using standard molecular biology techniques.

[0183] Purification of HGP virus High-growth parental viruses (PR8 and A / Texas / 1 / 1977) were purified before infection of the cultured host. For each parental influenza virus strain, 2 ml of infected allantoine membrane fluid was filtered through a 0.45 μm filter and purified by centrifugation at approximately 1400 x g for 1 hour using a Microsep 300K Omega centrifuge (PALL). The retained viruses were then hydrated in phosphate-buffered saline (PBS). - The virus was diluted and centrifuged again using a clean Microsep device. The retained virus was then collected in PBS. - The mixture was diluted to 1 ml using [a specific method] and frozen in 100 μl aliquots at -80°C.

[0184] Delayed delivery of influenza virus genes to cultured hosts Delayed delivery of influenza genes to produce genetically reassorted influenza viruses was performed by transfection of 293T / MDCK cocultures with plasmid DNA, followed by infection with HGP 1–24 hours after transfection. TransIT-293(Mirus), Lipofectamine 2000(Invitrogen), or Lipofectamine 3000(Invitrogen) transfection reagents were used according to the manufacturer's instructions to transfect 293T / MDCK cells with 1–2 μg of plasmid expressing viral HA and NA.

[0185] Approximately 3 hours after transfection, the cells were placed in PBS. - The cells were washed and the supernatant was replaced with 1 ml / well of fresh OptiMEM. Next, the cells were infected with HGP. TPCK-trypsin was added on day 1 post-transfection (1 μg / ml). The supernatant was collected on day 3 post-transfection.

[0186] Co-delivery of influenza virus genes to cultured hosts Co-cultures of 293T cells and MDCK cells (WHO or MDCK 33016PF, suspension or adherent) were simultaneously transfected with purified HGP virus (10-20 μl / transfection (6-well plate) of neatly purified HGP virus) and 1-2 μg each of plasmid DNA encoding the virus's HA and NA. Transfection reagents TransIT-293 (Mirus), Lipofectamine 2000 (Invitrogen), or Lipofectamine 3000 (Invitrogen) were used according to the manufacturer's instructions. Cells transfected with TransIT-293 were washed approximately 3 hours after transfection. TPCK-trypsin (1 μg / ml) was added on day 1 after transfection, or 4-8 hours after transfection, as described above. The supernatant was collected on days 3-6 after transfection.

[0187] Selection of Gene Reassorted Influenza Viruses Subsequently, the transfection supernatant was passaged in eggs in the presence of antiserum prepared against the HGP virus. Briefly, in the first antiserum passage, developing eggs were inoculated with 200 μl / egg of neat transfection supernatant, and 1 hour later, 200 μl / egg of trypsin periodate-treated antiserum (prepared against PR8 or A / Texas / 1 / 1977 as appropriate) was inoculated. In the second antiserum passage, the infectious allanine fluid recovered from the first antiserum passage was diluted according to the HA titer, incubated with an equal volume of antiserum in RT for 1 hour, and then eggs were inoculated with 200 μl / egg. In some transfections, the virus was cloned by limiting dilution.

[0188] The HA and NA genotypes of the gene reassembled cells were determined by real-time PCR using gene-specific primers (Geneworks) and probes (Applied Biosystems or Sigma). Reactants were prepared using Taqman RT-PCR mastermix (Applied Biosystems), and PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) according to the manufacturer's instructions.

[0189] Example 1 - Generation of H5N1 (A / Indonesia / NIHRD11771 / 2011) gene reassortment virus H5N1 gene reassortment viruses were generated using a high-growth parent strain (A / Texas / 1 / 1977) and plasmids encoding the HA and NA genes of A / Indonesia / NIHRD11771 / 2011.

[0190] Co-cultures of 293T / MDCK (WHO) were transfected with plasmids encoding the HA and NA genes of A / Indonesia / NIHRD11771 / 2011, and then infected with high-growth parental strains, or co-transfected simultaneously with HA- and NA- encoding plasmids and high-growth parental strains (Table 1). [Table 1]

[0191] After transfection, cell cultures were treated with antiserum. After the first antiserum passage, HA titers were detected in both experiments, but higher HA titers were observed when the high-growth parent was delivered to the cell culture simultaneously with the plasmid. In the second antiserum passage, similar levels of viral replication were shown in both the simultaneous transfection and the experiment in which the plasmid was transfected into the cell culture before transfection with the high-growth parent strain.

[0192] RT-PCR genotyping showed that both viruses were genetically reassembled.

[0193] Example 2 - Generation of H1N1 (A / PR / 8 / 1934) gene reassortment virus The reassorted H1N1 virus (A / PR / 8 / 1934) was generated using a high-growth parent strain (A / Texas / 1 / 77) and plasmids encoding the HA and NA genes of A / PR / 8 / 1934.

[0194] Co-cultures of 293T / MDCK (WHO) were simultaneously transfected with HA and NA coding plasmids and HGP (Table 2). [Table 2]

[0195] To confirm the isolation of the virus, a third antiserum passage was performed, and pre-incubation of the virus and antiserum was carried out for the second antiserum passage. After this third antiserum passage, the HA titer of the progeny virus increased to a level typical of wild-type A / PR / 8 / 1934. Genotyping of the virus after the third antiserum passage showed the HA and NA genes of A / PR / 8 / 1934, indicating the successful generation of a 6:2 gene reassembly.

[0196] Example 3 - Generation of H3N1 (A / Wyoming / 3 / 2003) gene reassortment virus The reassorted H3N1 virus was generated using the H1N1 HGP virus (A / PR / 8 / 1934) and plasmids encoding the HA and NA genes of A / Wyoming / 3 / 2003.

[0197] Co-cultures of 293T / MDCK (WHO) were transfected with plasmids encoding the HA and NA genes of A / Wyoming / 3 / 2003, and then infected with HGP approximately 3.5 hours after transfection, or co-transfected simultaneously with the HA- and NA encoding plasmids and HGP (Table 3). [Table 3]

[0198] After the first antiserum passage, HA titers were detected in both time-delayed HGP gene reassembled and co-delivered HGP gene reassembled viruses. In the second antiserum passage, similar levels of viral replication were observed in both hybrid gene reassembled methods. Genotyping by real-time PCR indicated that both viruses were gene reassembled viruses.

[0199] Example 4 - Generation of H6N1 gene reassortment virus The reassorted H6N1 virus was generated using the H3N2 HGP virus (A / Texas / 1 / 1977) and plasmids encoding the H6 (A / Turkey / Massachusetts / 3740 / 1965) and N1 (A / Brisbane / 59 / 2007 and A / California / 07 / 2009) genes. Co-cultures of 293T / adherent MDCK 33016PF cells were simultaneously transfected with HA and NA coding plasmids and HGP (Table 4). [Table 4]

[0200] Genotyping using real-time PCR showed that both H6N1 progeny viruses were genetically reassembled.

[0201] Example 5 - Evaluation of Genetic Diversity The genetic diversity that can occur in the context of replicating influenza viruses to generate quasispecies was evaluated by comparing the sequences of non-surface influenza proteins present in influenza A viruses obtained by classical gene reassortment or reverse genetics (RG). Nucleic acid sequences of backbone genes from a pool of 10 RG viruses (originally rescued by Seqirus, CDC, and NIBSC) were sequenced and then translated to determine the protein sequences. These sequences were compared to the corresponding sequences of 16 H1N1 and 32 H3N2 viruses obtained by classical gene reassortment (gene reassortants generated by Seqirus, NYMC, and NIBSC).

[0202] Analysis of the M1, NP, NS1, PA, and PB2 protein sequences showed that the level of sequence variation present within the gene reassortant viruses was higher than that within the RG rescue viruses. The differences in sequences within each dataset were consistently greater in the gene reassortant virus datasets than in the RG rescue virus datasets.

[0203] Amino acid sequence variations for each backbone segment are shown in Tables 1 - 5 below. The frequency of amino acids at the specified positions is represented as a percentage of the number of sequences analyzed for each source. The same data are presented in Figures 1 - 5.

Table 1A

Table 2A-1

Table 2A-2

Table 2A-3

Table 2A-4

Table 2A-5

Table 4A-5

[0204] These data demonstrate sequence variability in the backbone gene segment delivered to the culture host when the parental influenza virus strain containing the subspecies comes into contact with the culture host. These data also show that the backbone segment does not exhibit sequence variability in viruses initially delivered via expression constructs such as plasmids used in reverse genetics techniques.

[0205] The sequence diversity present in viruses produced by classical gene recombination and reverse genetics was also analyzed by evaluating the number of mutations present in the sequenced backbone genes. These analyses are shown in Tables 6-10 and demonstrate increased backbone gene sequence diversity in viruses produced by delivering influenza gene segments to culture hosts via infection of a population of influenza virion (e.g., in classical gene recombination). When used in the hybrid gene recombination method of the present invention, it can be predicted that sequence mutations of a similarly enhanced degree will occur in the backbone gene segments of the parent influenza virus strain compared to those in RG gene recombinations. [Table 6] [Table 7] [Table 8] [Table 9] [Table 10] array Sequence ID 1 (PA, PR8-X) Sequence ID 2 (PB1, PR8-X) Sequence ID 3 (PB2, PR8-X) Sequence ID 4 (NP, PR8-X) Sequence ID 5 (M, PR8-X) Accession No. 6 (NS, PR8-X) AGCAAAAGCAGGGTGACAAAAACATAATGGATCCAAACACTGTGTCAAGCTTTCAGGTAGATTGCTTTCTTTGGCATGTCCGCAAACGAGTTGCAGACCAAGAACTAGGTGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAAATCCCTAAGAGGAAGGGGCAGTACTCTCGGTCTGGACATCAAGACAGCCACACGTGCTGGAAAGCAGATAGTGGAGCGGATTCTGAAAGAAGAATCCGATGAGGCACTTAAAATGACCATGGCCTCTGTACCTGCGTCGCGTTACCTAACTGACATGACTCTTGAGGAAATGTCAAGGGACTGGTCCATGCTCATACCCAAGCAGAAAGTGGCAGGCCCTCTTTGTATCAGAATGGACCAGGCGATCATGGATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGCTGGAGACTCTAATATTGCTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATTTCACCATTGCCTTCTCTTCCAGGACATACTGCTGAGGATGTCAAAAATGCAGTTGGAGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGAGACCTCCACTCACTCCAAAACAGAAACGAGAAATGGCGGGAACAATTAGGTCAGAAGTTTGAAGAAATAAGATGGTTGATTGAAGAAGTGAGACACAAACTGAAGATAACAGAGAATAGTTTTGAGCAAATAACATTTATGCAAGCCTTACATCTATTGCTTGAAGTGGAGCAAGAGATAAGAACTTTCTCGTTTCAGCTTATTTAGTACTAAAAAACACCCTTGTTTCTACT Accession No. 7 (HA, PR8-X) Sequence ID 8 (NA, PR8-X) Sequence ID 9 (PA, 105p30) Sequence ID 10 (PB1, 105p30) Sequence ID 11 (PB2, 105p30) Sequence ID 12 (NP, 105p30) Sequence ID 13 (M, 105p30) Accession number 14 (NS, 105p30) AGCAAAAGCAGGGTGGCAAAGACATAATGGATTCCCACACTGTGTCAAGCTTTCAGGTAGATTGTTTCCTTTGGCATGTCCGCAAACAAGTTGCAGACCAAGATCTAGGCGATGCCCCCTTCCTTGATCGGCTTCGCCGAGATCAGAAGTCTCTAAAGGGACGAGGCAACACTCTCGGTCTGAACATCGAAACAGCCACTTGTGTTGGAAAGCAAATAGTAGAGAGGATTCTGAAAGAAGAATCCGATGAGACATTTAGAATGACCATGGCCTCCGCACTTGCTTCGCGGTACCTAACTGACATGACTGTTGAAGAAATGTCAAGGGACTGGTTCATGCTCATGCCCAAGCAGAAAGTGGCTGGCCCTCTTTGTGTCAGAATGGACCAGGCGATAATGGATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGTTGGAGAATCTGACATTACTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATTTCACCATTGCCTTCTTTTCCAGGACATACTAATGAGGATGTCAAAAATGCAATTGGGGTCCTCATCGGGGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAGCTCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGACTGGGGGACCTCCATTCACTACAACACAGAAACGGAAAATGGCGGGAACAATTAGGTCAGAAGTTTGAAGAAATAAGATGGCTGATTGAAGAAGTGAGGCATAAATTGAAGACGACAGAGAGTAGTTTTGAACAAATAACATTTATGCAAGCATTACAGCTATTGTTTGAAGTGGAACAAGAGATTAGAACGTTCTCGTTTCAGCTTATTTAATGATAAAAACACCCTTGTTTCTACT Accession number 15 (HA, 105p30) Sequence ID 16 (NA, 105p30) See document [1] Cobbin et al. (2013) J. Virol. 87(10): 5577-5585. [2] Luytjes et al. (1989) Cell 59(6):1107-1113. [3] Enami et al. (1990) PNAS 87(10):3802-3805. [4] Fodor et al. (1999) J. Virol.73(11):9679-9682. [5] Hoffman et al. (2000) PNAS 97(11):6108-6113. [6]WO2009 / 000891 [7]WO2011 / 012999 [8]Verity et al.(2012) Influenza Other Respir.Viruses 6(2):101-109 [9]WO2010 / 133964

[10] Sambrook et al, Molecular Cloning: A Laboratory Manual, 2 ed., 1989, Cold Spring Harbor Press, Cold Spring Harbor, NY

[11] WO2011 / 145081

[12] Kistner et al. (1998) Vaccine 16:960-8.

[13] Kistner et al. (1999) Dev Biol Stand 98:101-110.

[14] Bruhl et al. (2000) Vaccine 19:1149-58.

[15] WO97 / 37000.

[16] Brands et al. (1999) Dev Biol Stand 98:93-100.

[17] Halperin et al. (2002) Vaccine 20:1240-7.

[18] Tree et al. (2001) Vaccine 19:3444-50.

[19] Pau et al.(2001)Vaccine 19:2716-21.

[20] http: / / www.atcc.org /

[21] http: / / locus.umdnj.edu /

[22] WO03 / 076601.

[23] WO2005 / 042728.

[24] WO03 / 043415.

[25] WO01 / 85938.

[26] WO2006 / 108846.

[27] EP-A-1260581(WO01 / 64846).

[28] WO2006 / 071563.

[29] WO2005 / 113758.

[30] WO03 / 023021.

[31] WO03 / 023025.

[32] WO2006 / 027698.

[33] WO97 / 37001.

[34] EP-B-0870508.

[35] US 5948410.

[36] WO2007 / 052163.

[37] WO02 / 28422.

[38] WO02 / 067983.

[39] WO02 / 074336.

[40] WO01 / 21151.

[41] WO02 / 097072.

[42] WO2005 / 113756.

[43] Huckriede et al.(2003)Methods Enzymol 373:74-91.

[44] Vaccines.(eds.Plotkins & Orenstein).4th edition,2004,ISBN:0-7216-9688-0.

[45] Treanor et al.(1996)J Infect Dis 173:1467-70.

[46] Keitel et al.(1996)Clin Diagn Lab Immunol 3:507-10.

[47] Herlocher et al.(2004)J Infect Dis 190(9):1627-30.

[48] Le et al.(2005)Nature 437(7062):1108.

[49] WO2008 / 068631.

[50] Gennaro(2000)Remington:The Science and Practice of Pharmacy.20th edition,ISBN:0683306472.

[51] Banzhoff(2000)Immunology Letters 71:91-96.

[52] Nony et al.(2001)Vaccine 27:3645-51.

[53] WO90 / 14837

[54] Podda & Del Giudice(2003)Expert Rev Vaccines 2:197-203

[55] Podda(2001)Vaccine 19: 2673-2680

[56] Vaccine Design:The Subunit and Adjuvant Approach(eds.Powell & Newman)Plenum Press 1995(ISBN 0-306-44867-X)

[57] Vaccine Adjuvants: Preparation Methods and Research Protocols(Volume 42 of Methods in Molecular Medicine series).ISBN:1-59259-083-7.Ed.O’Hagan

[58] WO 2008 / 043774

[59] US 2007 / 014805

[60] US 2007 / 0191314

[61] Fox et al.(2013)Vaccine 31:1633-1640

[62] Allison & Byars(1992)Res Immunol 143:519-25

[63] Hariharan et al.(1995)Cancer Res 55:3486-9

[64] Suli et al.(2004)Vaccine 22(25-26):3464-9

[65] WO 95 / 11700

[66] US Patent 6,080,725

[67] WO 2005 / 097181

[68] WO 2006 / 113373

[69] Han et al.(2005)Impact of Vitamin E on Immune Function and Infectious Diseases in the Aged at Nutrition,Immune Functions and Health EuroConference, Paris,9-10 JUNE 2005

[70] US Patent 6,630,161

[71] Potter & Oxford(1979)Br Med Bull 35:69-75.

[72] Greenbaum et al.(2004)Vaccine 22:2566-77.

[73] Zurbriggen et al.(2003)Expert Rev Vaccines 2:295-304.

[74] Piascik(2003)J Am Pharm Assoc(Wash DC).43:728-30.

[75] Mann et al.(2004)Vaccine 22:2425-9.

[76] Halperin et al.(1979)Am J Public Health 69:1247-50.

[77] Herbert et al.(1979)J Infect Dis 140:234-8.

[78] Chen et al.(2003)Vaccine 21:2830-6.

[79] Dormitzer et al.(2013)Sci Trans Med 5(185):185ra68

[80] Hoffmann et al. (2002) Vaccine 20(25-26):3165-70.

Claims

1. A method for generating a genetically reassorted influenza virus, (i) The step of contacting a cultured host with a parental influenza virus strain containing a first hemagglutinin (HA) gene and a first neuraminidase (NA) gene; (ii) The step of introducing one or more expression constructs comprising one or more influenza genes into the culture host, wherein the influenza gene comprises a second HA gene or a second NA gene; (iii) the step of culturing the culture host to produce a gene reassortment virus; (iv) the step of selecting a gene reassortment virus comprising the second HA gene or the second NA gene; Here: The method, wherein step (iv) includes negative selection for the first HA, the negative selection comprising contacting the culture host or the gene reassortment influenza virus isolated from the culture host with one or more antibodies specific to the first HA.

2. The method according to claim 1, further comprising the step (v) of isolating a gene-reassorted influenza virus containing the second HA gene or the second NA gene.

3. The method according to claim 1, wherein the one or more influenza genes include a second HA gene and a second NA gene, and step (iv) includes selecting a gene reassortment virus that includes the second HA gene and / or the second NA gene.

4. The method according to claim 3, further comprising the step of (i) isolating a gene-reassorted influenza virus comprising the second HA gene and / or (ii) the second NA gene (v).

5. The method according to claim 3, wherein the one or more influenza genes include a second PB1, PB2, PA, M, NS, or NP, and step (iv) includes selecting a gene reassortment virus that includes the second PB1, PB2, PA, M, NS, or NP gene.

6. The method according to claim 5, further comprising the step of (i) isolating a gene reassortment influenza virus comprising the second HA gene and / or (ii) the second NA gene and (iii) the second PB1, PB2, PA, M, NS, or NP gene (v).

7. The method according to any one of claims 1 to 6, wherein the one or more expression constructs comprises seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two or fewer influenza genes.

8. The method according to any one of claims 1 to 7, wherein the one or more expression constructs are one or more plasmids, one or more linear DNA molecules, or one or more RNA molecules.

9. The method according to any one of claims 1 to 8, wherein the one or more expression constructs are bidirectional expression constructs, and at least one gene is located between an upstream poll II promoter and a downstream non-endogenous poll I promoter.

10. The method according to any one of claims 1 to 9, wherein the one or more expression constructs are introduced into the culture host at the same time as or before the culture host is brought into contact with the parent influenza virus strain.

11. The method according to any one of claims 1 to 9, wherein the culture host is introduced into the culture host after contact with the parent influenza virus strain.

12. The method according to any one of claims 1 to 11, wherein step (iv) includes a negative selection for the first HA.

13. The method according to any one of claims 1 to 12, wherein step (iv) includes a negative selection for the first NA.

14. The method according to any one of claims 1 to 13, wherein step (iv) includes a positive selection for the second HA or the second NA.

15. The method according to any one of claims 1 to 14, wherein the second HA gene includes one or more modifications compared to a wild-type influenza virus from which the second HA gene is derived.

16. The method according to any one of claims 1 to 15, wherein the culture host is selected from a developing chicken egg, mammalian cells, or avian cells.

17. The method according to claim 16, wherein the culture host is MDCK, Vero, PerC6, CEF, or EB66 cells.

18. The method according to claim 16, wherein the cells grow by adhesion.

19. The method according to claim 16, wherein the cells grow by suspension.

20. The method according to any one of claims 1 to 19, wherein the gene-reassorted influenza virus is influenza A virus or influenza B virus.

21. A method for preparing a vaccine, comprising: (a) preparing a genetically reassorted influenza virus by the method described in any one of claims 1 to 20; and (b) preparing a vaccine from the genetically reassorted influenza virus.

Images