LincRNA-p21 and its use

Short lincRNA-p21 sequences delivered via exosomes inhibit DDB2 expression, addressing chemotherapy resistance by enhancing cancer cell sensitivity to chemotherapeutic agents, particularly for drug-resistant cancers.

JP7882578B2Active Publication Date: 2026-06-30CHINA MEDICAL UNIVERSITY(TW)

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
CHINA MEDICAL UNIVERSITY(TW)
Filing Date
2023-07-27
Publication Date
2026-06-30

Smart Images

  • Figure 0007882578000001
    Figure 0007882578000001
  • Figure 0007882578000002
    Figure 0007882578000002
  • Figure 0007882578000003
    Figure 0007882578000003
Patent Text Reader

Abstract

A composition for treating cancer is provided, comprising a DDB2 inhibitor and a chemotherapeutic agent, wherein the DDB2 inhibitor comprises three RNA fragments derived from lincRNA-p21. Furthermore, the DDB2 inhibitor enhances the chemosensitivity of cancer to chemotherapeutic agents for the treatment of cancers that are unresponsive to chemotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a composition for treating cancer, which comprises three RNA fragments derived from lincRNA-p21 and a chemotherapeutic agent. In particular, the three RNA fragments derived from lincRNA-p21 having DDB2 targeting activity improve the cellular sensitivity of various cancers to chemotherapeutic agents.

Background Art

[0002] Description of the Prior Art

[0003] In response to treatment with chemotherapeutic agents, a DNA damage response (DDR) occurs, p53 is activated to transcriptionally control gene expression, which determines the fate of cells towards senescence, cell cycle progression, apoptosis, or DNA repair. High DNA repair activity through nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR), or non-homologous end joining (NHEJ) in cancer cells contributes to the development of drug resistance to chemotherapy. Targeting various DDR or DNA repair components has been regarded as a promising therapeutic strategy in cancer. The clinical treatment with PARP inhibitors has been successful due to the precise sensitivity of BRCA1 / 2 mutant tumors to PARP inhibition. Therefore, synthetic lethality by simultaneous targeting of various DNA repair / DDR pathways has provided a paradigm for the development of new potential clinical strategies.

[0004] Within the DNA repair mechanism, NER plays a crucial role in the removal of cisplatin or doxorubicin-induced DNA damage. Upon stimulation with chemotherapy, damaged DNA-binding protein 2 (DDB2) is upregulated by activated p53 and acts as the first protein to recognize damaged DNA. Subsequently, DDB2 bound to DNA is polyubiquitinated and proteasomal degraded, handing over the damaged DNA site to a second recognition protein, XPC, for further replenishment of other DNA repair proteins involved in NER. DDB2 expression is induced by DNA damaging agents, including doxorubicin, and confers chemotherapeutic resistance. Mutations or deficiencies in DDB2 reduce the recognition of damaged DNA and the replenishment of NER-related proteins, leading to DNA repair failure. Furthermore, PARP1 has also been reported to promote NER efficiency by interacting with and stabilizing DDB2 protein expression. Suppression of DDB2 increases cellular sensitivity to PARP inhibitors in triple-negative breast cancer by destabilizing Rad51, suggesting a further role of DDB2 in modulating HR. In addition to DNA repair, DDB2 activity occurs at several stages of tumor progression, including cancer cell proliferation, survival, epithelial-mesenchymal transition, migration and invasion, and cancer stem cell formation. Therefore, DDB2 targeting is a potential strategy to enhance chemosensibility and the anticancer activity of PARP inhibitors. However, there are no DDB2 inhibitors or modulators available for cancer therapy.

[0005] Nucleic acid therapy is also applicable to cancer treatment, but challenges related to RNA stability, delivery, and structure remain, and RNA therapy still lags behind other therapies in terms of strategies for treating cancer.

[0006] Since the majority of long non-coding RNAs (lncRNAs) are at least 200 nt in length, using lncRNAs in therapeutic strategies for RNA therapy is extremely difficult. Consequently, lncRNAs receive little attention or application in clinical practice, and most lncRNAs are considered disease markers rather than therapeutic agents. [Modes for carrying out the invention]

[0007] This invention demonstrates an inverse correlation between lincRNA-p21 and DDB2 in different subtypes of mutp53-expressing breast cancer cell lines and clinical specimens. Increased lincRNA-p21 has been shown to enhance DDB2 polyubiquitination and proteasomal degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 E3 ligase complex. Downregulation of DDB2 by lincRNA-p21 has been shown to suppress DNA repair. More importantly, three essential elements of lincRNA-p21, including 5'-CUUGUGUCCCCUUCCCACAG-3'(671nt~690nt;#3)(SEQ ID NO: 1); 5'-CAGGGAACCCCUUCAAUCCC-3'(875nt~894nt;#4)(SEQ ID NO: 2); and 5'-UGGGAGCCCCCUUCCUAAAA-3'(2,158nt~2,177nt;#9)(SEQ ID NO: 3), have been identified in different binding assays for direct interaction with and inhibition of the DDB2 protein. Structural binding ability has also been calculated, revealing the potential for short lincRNA-p21 elements to influence DDB2 stability and DNA repair. Co-treatment with short lincRNA-p21 elements or exosomes containing short lincRNA-p21 elements has been found to enhance chemotherapy-induced cytotoxicity in cancer cells.

[0008] Short lincRNA-p21 elements that utilize exosomes as a delivery system function as lncRNA-based DDB2 inhibitors, demonstrating the potential to enhance chemosensibility and potentially benefit patients with breast cancer or other cancer types that have not responded to chemotherapy.

[0009] As used herein, the terms "a" or "an" are used to describe elements and components of the present invention. This is done solely for convenience and to give a general meaning to the present invention. This description should be interpreted as including one or at least one, and unless it becomes clear that there is another meaning, the singular also includes the plural.

[0010] The term "or" may mean "and / or" as used herein.

[0011] The present invention provides a nucleic acid molecule containing a sequence of long-chain intergene non-coding RNA-p21 (lincRNA-p21), wherein the lincRNA-p21 sequence is selected from the group consisting of CUUGUGUCCCCUUCCCACAG (SEQ ID NO: 1), CAGGGAACCCCUUCAAUCCC (SEQ ID NO: 2), and UGGGAGCCCCCUUCCUAAAA (SEQ ID NO: 3).

[0012] The present invention also provides a composition comprising a sequence of lincRNA-p21, wherein the sequence of lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0013] Furthermore, the present invention provides a method for treating cancer, comprising administering a composition to a subject afflicted with cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, and the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0014] The present invention provides a use of a composition for preparing a drug for treating cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, and the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0015] The present invention also provides a composition for use in the treatment of cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, and the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0016] The term "subject" as used herein refers to an animal, in particular a mammal. In a preferred embodiment, the subject is a human.

[0017] Damaged DNA-binding protein 2 (DDB2) is a crucial protein that recognizes DNA damage, initiates DNA repair, and makes cancer cells resistant to chemotherapeutic agents. In this invention, three short sequences derived from lincRNA-p21 interfere with the DNA damage repair pathway. Furthermore, the lincRNA-p21 sequences can inhibit DDB2-induced DNA repair and enhance the anticancer effects of chemotherapeutic agents. Therefore, the lincRNA-p21 sequences inhibit DDB2 expression, reversing or reducing cancer cell resistance to chemotherapeutic agents and / or increasing the sensitivity of cancer cells to chemotherapeutic agents. In one embodiment, the lincRNA-p21 sequences enhance the sensitivity of cancer to chemotherapeutic agents by inhibiting DDB2 expression. Therefore, DDB2 can be identified as a therapeutic target for cancer. In one embodiment, cancer includes cancer with high DDB2 expression. In this invention, cancer with high DDB2 expression means that DDB2 expression in tumor tissue is 1.5 times higher than in normal tissue. In another embodiment, cancer exhibits a poor response to or resistance to chemotherapeutic agents. In a preferred embodiment, cancer with high expression of DDB2 exhibits a poor response to or resistance to chemotherapeutic agents.

[0018] In some embodiments, chemotherapeutic agents are anticancer drugs. In one embodiment, the cancer is a drug-resistant cancer. Therefore, the cancer has drug resistance to the chemotherapeutic agent. The present invention provides a method for treating cancer by reducing drug resistance to a chemotherapeutic agent, comprising administering a composition to a subject suffering from drug-resistant cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, and the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The lincRNA-p21 sequence can also reverse or reduce cancer cell resistance to the chemotherapeutic agent and / or increase the sensitivity of cancer cells to the chemotherapeutic agent.

[0019] The term “to treat” includes, but is not limited to, reducing, inhibiting, or limiting the growth of cancer cells; reducing, inhibiting, or limiting the metastasis of cancer cells or the invasiveness of cancer cells or metastases; or reducing, inhibiting, or limiting one or more symptoms of cancer or its metastases.

[0020] In one embodiment, cancer includes breast cancer, liver cancer, cholangiocarcinoma, lung cancer, colon cancer, head and neck squamous cell carcinoma, gastric adenocarcinoma, and esophageal cancer. In a preferred embodiment, cancer includes breast cancer and liver cancer. In a preferred embodiment, cancer includes breast cancer.

[0021] In another embodiment, cancer cells have mutant p53. In a preferred embodiment, breast cancer cells have mutant p53. In a more preferred embodiment, breast cancer cells are estrogen receptor (ER) positive and have mutant p53.

[0022] In one embodiment, breast cancer exhibits a poor response to or resistance to chemotherapy agents.

[0023] As used herein, a chemotherapeutic agent is a compound that can inhibit the growth of cancer cells or tumors. It is understood that one or more chemotherapeutic agents may be used in any of the methods shown herein. For example, two or more chemotherapeutic agents, three or more chemotherapeutic agents, four or more chemotherapeutic agents, etc., may be used in the methods provided herein. Exemplary chemotherapeutic agents include, but are not limited to, anticancer compounds such as cyclophosphamide, doxorubicin, 5-fluorouracil, docetaxel, paclitaxel, methotrexate, epirubicin, cisplatin, carboplatin, vinorelbine, capecitabine, gemcitabine, mitoxantrone, isabepilone, eribulin, carmustine, nitrogen mustard, sulfur mustard, platinum tetranitrate, vinblastine, etoposide, camptothecin, topoisomerase inhibitors, and their derivatives or combinations thereof. In one embodiment, the chemotherapeutic agent includes carboplatin, cisplatin, or doxorubicin.

[0024] In some embodiments, the lincRNA-p21 sequence is effective in enhancing the therapeutic effect of chemotherapeutic agents. As used herein, the term “enhance therapeutic effect” includes any of many subjective or objective factors that indicate a beneficial response or improvement to the condition being treated as discussed herein. For example, enhancing the therapeutic effect of a chemotherapeutic agent includes reversing or reducing cancer cell resistance to the chemotherapeutic agent and / or increasing the susceptibility of drug-resistant cancer. Also, for example, enhancing the therapeutic effect of a chemotherapeutic agent includes modifying drug-resistant cancer cells so that the cells are not resistant to the chemotherapeutic agent. Also, for example, enhancing the therapeutic effect of a chemotherapeutic agent includes additively or synergistically improving or increasing the activity of the chemotherapeutic agent.

[0025] In the present invention, the composition comprises one or more sequences of lincRNA-p21 and one or more chemotherapeutic agents. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier. The term "carrier" means a compound, composition, substance or structure that, when combined with a compound or composition, aids or facilitates the preparation, storage, administration, delivery, efficacy, selectivity, or any other characteristic of the compound or composition for the intended use or purpose. In other embodiments, the pharmaceutically acceptable carrier includes liposomes, nanoparticles, exosomes, micelles, polymeric matrices or gel matrices. In the present invention, the sequence of lincRNA-p21 is contained within or forms a complex with liposomes, nanoparticles, exosomes, micelles, polymeric matrices or gel matrices. In one embodiment, the pharmaceutically acceptable carrier includes liposomes or exosomes.

[0026] In the present invention, the sequence of lincRNA-p21 can be loaded within exosomes. In another embodiment, the pharmaceutically acceptable carrier includes exosomes and the sequence of lincRNA-p21 is contained within the exosomes. Exosomes containing the sequence of lincRNA-p21 are prepared for treating cancer. Further, the exosomes can also bind to anti-human leukocyte antigen G (HLAG) antibodies to form anti-HLAG exosomes. Since HLAG is highly expressed in a wide variety of cancers, the use of anti-HLAG antibodies is to increase the delivery efficiency of exosomes containing the sequence of lincRNA-p21 and chemotherapeutic agents to cancer cells. In one embodiment, the composition further comprises a target molecule for binding to a biomarker on cancer cells. In a preferred embodiment, the target molecule includes an anti-HLAG antibody. Thus, the anti-HLAG antibody can also bind to the sequence of lincRNA-p21 or exosomes to form a therapeutic complex for use in the treatment of cancer.

[0027] In the methods provided herein, the sequence of lincRNA-p21 may be administered to a subject before, simultaneously with, or after administration of a chemotherapeutic agent. Further, the compositions of the invention may be administered by a variety of routes including, but not limited to, injection (e.g., subcutaneous, intramuscular, intravenous, intraarterial, intraperitoneal), continuous intravenous infusion, cutaneously, dermally, transdermally, orally (e.g., tablets, capsules, solutions, edible film strips), by implanted osmotic pumps, by suppository, or by aerosol spray. Routes of administration include, but are not limited to, topical, intradermal, intrathecal, intralesional, intratumoral, intravesical, intravaginal, intraocular, intrarectal, intravesicular, intrapulmonary, intracranial, intraventricular, intraspinal, cutaneous, subcutaneous, intraarticular, placement into a body cavity, nasal inhalation, pulmonary inhalation, impression into the skin, and electroporation. Administration may be systemic or local. The pharmaceutical composition may be delivered locally to the area requiring treatment, e.g., by topical application or local injection. Multiple administrations and / or dosages may also be used.

[0028] In the present invention, a therapeutically effective amount of a composition comprising the sequence of lincRNA-p21 and a chemotherapeutic agent is administered to a subject. The term "therapeutically effective amount" is defined as any amount necessary to produce the desired physiological response. The dosage range for administration is large enough to produce the desired effect in which one or more symptoms of the disease or disorder are affected (e.g., reduced or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, etc.

[0029] The dosage of the lincRNA-p21 sequence or chemotherapeutic agent is typically in the range of about 0.0001, 0.001, or 0.01 mg / kg / day to about 1000 mg / kg / day, but may be higher or lower depending on other factors, among other factors, particularly the activity of the composition, its bioavailability, mode of administration, and the various factors discussed above. The dosage and interval may be individually adjusted to provide sufficient local and / or systemic concentrations of exosomes to maintain therapeutic or prophylactic effects. For example, depending on other factors, among other factors, particularly the mode of administration, the specific symptoms being treated, and the judgment of the prescribing physician, the composition may be administered once a week, several times a week (e.g., every other day), once a day, or multiple times a day. Those skilled in the art will be able to optimize the effective local dosage without unnecessary experimentation. In one embodiment, the therapeutically effective dose of the composition is in the range of 0.01 to 100 mg / kg body weight. In a preferred embodiment, the therapeutically effective dose of the composition is in the range of 0.1 to 50 mg / kg body weight. In a more preferred embodiment, the therapeutically effective dose of the composition is in the range of 1 to 10 mg / kg body weight.

[0030] In these cases, chemotherapy resistance is a major problem in the clinical treatment of various cancers. Among these, DNA repair induced by the DDB2 protein is one of the main reasons why cancer cells are insensitive to chemotherapy. The present invention primarily finds that lincRNA-p21 can directly bind to DDB2, induce its degradation, and therefore can be used as a primary inhibitor of DDB2, thereby improving the effectiveness of clinical chemotherapy agents such as carboplatin, cisplatin, and doxorubicin.

[0031] More importantly, using different experimental methods to discover the three fundamental short chain sequences necessary for the binding of lincRNA-p21 and DDB2 proteins, computer predictions and calculations show that these three short chain lincRNA-p21 sequences can bind to the region of DDB2 that interacts with the DDB1 protein. The molecular interface between them stabilizes the formation of the Cul-4 / DDB1 / DDB2 complex. These three sequences can also directly bind to the DDB2 protein without requiring full-length lincRNA-p21, promoting DDB2 proteolysis and increasing the sensitivity of cancer cells to chemotherapeutic agents. Since lincRNA-p21 is over 3,000 nucleotides long, if full-length lincRNA-p21 were used as an RNA therapy strategy, the synthesis, delivery, and stabilization of the product would be extremely difficult. Another important breakthrough of the present invention is that it has been proven that just three short chain lincRNA-p21 sequences, each approximately 20 nucleotides long, can directly combine with DDB2, and that the mechanism of action can be analyzed by molecular biology and molecular simulation. This can achieve functions such as DDB2 proteolysis, inhibition of DNA repair, and enhancement of chemosensitivity.

[0032] More importantly, the present invention demonstrates that, as a drug delivery model, exosomes are used to coat three short sequences of lincRNA-p21 with the chemotherapy drug doxorubicin (exoLinc-p21s), and that exoLinc-p21s can enhance doxorubicin toxicity and proliferation inhibition in cancer cells. Furthermore, anti-HLAG exosomes are further used as an RNA delivery system to identify cancer cells, and anti-HLAG antibodies loaded onto the exosomes can improve the delivery efficiency of exoLinc-p21s and chemotherapy drugs to cancer cells. The results demonstrate that anti-HLAG exosomes can not only achieve the effect of promoting the DDB2 proteolysis and tumor cytotoxicity of exoLinc-p21s, but can also increase delivery efficiency to tumors and increase sensitivity to chemotherapy drugs.

[0033] In conclusion, three short sequences of lincRNA-p21 essential for binding to DDB2 (Linc-p21s) have been identified and developed as first-in-class DDB2 inhibitors, offering advantages over full-length lincRNA-p21 in terms of lower synthesis costs, higher stability, and delivery efficiency. Molecular simulation analysis has shown that Linc-p21s stabilize the molecular interface between DDB2 and DDB1 proteins and have been demonstrated to directly bind to the DDB2 protein for proteasomal degradation. Exosome-packaged Linc-p21s (exoLinc-p21s) using exosomes expressing cancer-targeting αHLAG antibodies as a delivery system have been shown to enhance the cytotoxic and proliferative inhibitory effects of doxorubicin against cancer cells in cell lines and animal models. As a first-in-class DDB2 inhibitor, exoLinc-p21s has the potential to be developed as a novel RNA-based chemosensitizer that could be beneficial to patients with a variety of cancer types. [Brief explanation of the drawing]

[0034] [Figure 1A] Figures 1A–1C show that lincRNA-p21 expression is negatively correlated with stage, tumor size, and ERα status. Figures 1A and 1B show that lincRNA-p21 expression, quantified by in situ hybridization (ISH) assay, is higher in early (stage IIA, n=12; stage IIB, n=12) human breast cancer tumors than in later (stage IIIA, n=8; stage IIIB, n=8) (Figure 1A), and negatively correlates with tumor size (Figure 1B). Figure 1C shows that lincRNA-p21 expression, quantified by ISH assay, is higher in ERα-negative (n=27) human breast cancer tumors than in ERα-positive (n=13) human breast cancer tumors. Arrows indicate the signal of lincRNA-p21 expression when calculated by the mean number of dots per nucleus. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. [Figure 1B] Figures 1A–1C show that lincRNA-p21 expression is negatively correlated with stage, tumor size, and ERα status. Figures 1A and 1B show that lincRNA-p21 expression, quantified by in situ hybridization (ISH) assay, is higher in early (stage IIA, n=12; stage IIB, n=12) human breast cancer tumors than in later (stage IIIA, n=8; stage IIIB, n=8) (Figure 1A), and negatively correlates with tumor size (Figure 1B). Figure 1C shows that lincRNA-p21 expression, quantified by ISH assay, is higher in ERα-negative (n=27) human breast cancer tumors than in ERα-positive (n=13) human breast cancer tumors. Arrows indicate the signal of lincRNA-p21 expression when calculated by the mean number of dots per nucleus. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. [Figure 1C] Figures 1A–1C show that lincRNA-p21 expression is negatively correlated with stage, tumor size, and ERα status. Figures 1A and 1B show that lincRNA-p21 expression, quantified by in situ hybridization (ISH) assay, is higher in early (stage IIA, n=12; stage IIB, n=12) human breast cancer tumors than in later (stage IIIA, n=8; stage IIIB, n=8) (Figure 1A), and negatively correlates with tumor size (Figure 1B). Figure 1C shows that lincRNA-p21 expression, quantified by ISH assay, is higher in ERα-negative (n=27) human breast cancer tumors than in ERα-positive (n=13) human breast cancer tumors. Arrows indicate the signal of lincRNA-p21 expression when calculated by the mean number of dots per nucleus. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001.

[0035] [Figure 2A]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2B]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2C]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2D]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2E]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2F]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2G]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2H]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2I]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group. [Figure 2J]Figures 2A–2J show that higher lincRNA-p21 expression is observed in early ERα-negative breast cancers with smaller tumor sizes, contributing to chemosensibility in breast cancer. Figure 2A illustrates the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. Student's t-test for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) was negatively correlated with disease stage (Figure 2B) and tumor size (n=61) (Figure 2C), and was higher in ERα-negative (n=14) human primary breast cancer tissue than in ERα-positive (n=47) human primary breast cancer tissue (Figure 2D). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E shows that induction of lincRNA-p21 expression is negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 modify carboplatin-induced apoptotic death of T-47D cancer cells in fluorescence-activated cell sorting (FACS) assays. Figure 2H shows that silencing lincRNA-p21 reduces the carboplatin-inducible expression of the apoptosis marker in MDA-MB-231 cancer cells. Figures 2I and 2J show that silencing lincRNA-p21 by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death as measured by a FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as mean ± SD.Student's t-test with *p<0.05; **p<0.01; ***p<0.001 compared to the control group.

[0036] [Figure 3A] Figures 3A and 3B show that lincRNA-p21 is an intermediate factor in ERα-related chemical resistance. Figures 3A and 3B show the raw data from Figures 2I and 2J in the FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed for the control group, with *p<0.05;**p<0.01;***p<0.001. [Figure 3B] Figures 3A and 3B show that lincRNA-p21 is an intermediate factor in ERα-related chemical resistance. Figures 3A and 3B show the raw data from Figures 2I and 2J in the FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed for the control group, with *p<0.05;**p<0.01;***p<0.001.

[0037] [Figure 4A]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4B]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4C]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4D]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4E]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4F]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4G]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4H]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4I]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4J]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 4K]Figures 4A–4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner, as observed in immunofluorescence assays. Images derived from immunofluorescence assays are quantified using ImageJ analysis. Figure 4B shows that the network of protein-coding genes associated with Erα-positive expression is analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression analyzed in the GSE18908 dataset is higher in Erα-positive tissue than in Erα-negative human breast cancer tissue. Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n=187) was worse in Erα-positive breast cancer patients receiving neoadjuvant chemotherapy in the Kaplan-Meyer survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n=14) tissue than in Erα-negative (n=14) human primary breast cancer tissue (Figure 4E) and positively correlated with tumor size (n=16) (Figure 4F), with Welch's two-sample t-test results: *p<0.05, **p<0.01, ***p<0.001. Figure 4G shows the chemotherapy response (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels. Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive cells than in Erα-negative breast cancer cell lines. Figure 4J shows, in Western blot analysis, that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose-dependent (left) and time-dependent (right) manner.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death in T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. Student's t-tests were performed relative to the control group, with *p<0.05; **p<0.01; ***p<0.001.

[0038] [Figure 5A] Figures 5A–5E demonstrate that DDB2 contributes to DNA repair function related to chemical resistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows that Kaplan-Meyer survival analysis shows that higher DDB2 expression is associated with poorer overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared to ERα-negative / mutp53 breast cancer patients. Figure 5C shows box plots of DDB2 expression in each cancer type, analyzed from the pan-cancer database, GEPIA. Figure 5D shows that the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells reacted with cisplatin (50 μM) was investigated in a time-dependent manner using immunofluorescence assays with anti-cisplatin-modified DNA antibodies. Images from the immunofluorescence assays were quantified using ImageJ analysis. Figure 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive breast cancer cells, but not in ERα-negative breast cancer cells. [Figure 5B]Figures 5A–5E demonstrate that DDB2 contributes to DNA repair function related to chemical resistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows that Kaplan-Meyer survival analysis shows that higher DDB2 expression is associated with poorer overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared to ERα-negative / mutp53 breast cancer patients. Figure 5C shows box plots of DDB2 expression in each cancer type, analyzed from the pan-cancer database, GEPIA. Figure 5D shows that the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells reacted with cisplatin (50 μM) was investigated in a time-dependent manner using immunofluorescence assays with anti-cisplatin-modified DNA antibodies. Images from the immunofluorescence assays were quantified using ImageJ analysis. Figure 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive breast cancer cells, but not in ERα-negative breast cancer cells. [Figure 5C]Figures 5A–5E demonstrate that DDB2 contributes to DNA repair function related to chemical resistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows that Kaplan-Meyer survival analysis shows that higher DDB2 expression is associated with poorer overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared to ERα-negative / mutp53 breast cancer patients. Figure 5C shows box plots of DDB2 expression in each cancer type, analyzed from the pan-cancer database, GEPIA. Figure 5D shows that the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells reacted with cisplatin (50 μM) was investigated in a time-dependent manner using immunofluorescence assays with anti-cisplatin-modified DNA antibodies. Images from the immunofluorescence assays were quantified using ImageJ analysis. Figure 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive breast cancer cells, but not in ERα-negative breast cancer cells. [Figure 5D]Figures 5A–5E demonstrate that DDB2 contributes to DNA repair function related to chemical resistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows that Kaplan-Meyer survival analysis shows that higher DDB2 expression is associated with poorer overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared to ERα-negative / mutp53 breast cancer patients. Figure 5C shows box plots of DDB2 expression in each cancer type, analyzed from the pan-cancer database, GEPIA. Figure 5D shows that the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells reacted with cisplatin (50 μM) was investigated in a time-dependent manner using immunofluorescence assays with anti-cisplatin-modified DNA antibodies. Images from the immunofluorescence assays were quantified using ImageJ analysis. Figure 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive breast cancer cells, but not in ERα-negative breast cancer cells. [Figure 5E]Figures 5A–5E demonstrate that DDB2 contributes to DNA repair function related to chemical resistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows that Kaplan-Meyer survival analysis shows that higher DDB2 expression is associated with poorer overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared to ERα-negative / mutp53 breast cancer patients. Figure 5C shows box plots of DDB2 expression in each cancer type, analyzed from the pan-cancer database, GEPIA. Figure 5D shows that the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells reacted with cisplatin (50 μM) was investigated in a time-dependent manner using immunofluorescence assays with anti-cisplatin-modified DNA antibodies. Images from the immunofluorescence assays were quantified using ImageJ analysis. Figure 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive breast cancer cells, but not in ERα-negative breast cancer cells.

[0039] [Figure 6A] Figures 6A and 6B demonstrate that lincRNA-p21 can target DDB2 and interfere with its co-localization to the nucleus for chemosensitization. Figures 6A and 6B show that carboplatin (50 μM)-induced nuclear translocation protein accumulation (Figure 6A) and increased DDB2 levels with doxorubicin (0.5 μM) in triton-resistant (chromatin-bound) lysates (Figure 6B) are observed in ERα-positive breast cancer cell lines, but not in ERα-negative breast cancer cell lines. [Figure 6B]Figures 6A and 6B demonstrate that lincRNA-p21 can target DDB2 and interfere with its co-localization to the nucleus for chemosensitization. Figures 6A and 6B show that carboplatin (50 μM)-induced nuclear translocation protein accumulation (Figure 6A) and increased DDB2 levels with doxorubicin (0.5 μM) in triton-resistant (chromatin-bound) lysates (Figure 6B) are observed in ERα-positive breast cancer cell lines, but not in ERα-negative breast cancer cell lines.

[0040] [Figure 7A]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7B]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7C]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7D]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7E]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7F]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7G]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7H]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7I]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7J]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001. [Figure 7K]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that the nuclear transposition site of lincRNA-p21 is induced in a time-dependent manner by carboplatin in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells in qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows the doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 and DDB2 (left), and DDB1 and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-inducible complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. The dot plot reveals that biotinylated RNA is an equal input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of DDB1 and Cul-4 with lincRNA-p21 in specific regions of T-47D cancer cells, followed by RNase A digestion, as determined by RNA-IP analysis. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. Student's t-tests were performed against the control group, with *p<0.05; **p<0.01; ***p<0.001.

[0041] [Figure 8A]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8B]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8C]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8D]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8E]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8F]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8G]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8H]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8I]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8J]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8K]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8L]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8M]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element. [Figure 8N]Figures 8A–8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 decreases DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces the stability of DDB2 protein in the presence of CHX (25 μM). DDB2 protein levels examined by Western blot analysis are quantified using ImageJ and standardized with α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that in RNA-IP assays, carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) is observed in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that in a co-IP assay, knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4. Figure 8J shows that DDB2, DDB1, and Cul-4 derived from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals that biotinylated RNA is an equal input. hnRNP-K is used as a positive control for lincRNA-p21 interacting proteins.Figure 8K illustrates the use of biotinylated lincRNA-p21 deletion fragments for RNA pull-down assays and primer sets for different regions for RNA-IP. Figure 8L shows that DDB2 derived from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different biotinylated lincRNA-p21 deletion fragments. The dot plot reveals that biotinylated RNA is an equal amount of input. Figure 8M shows the RNase A digestion pattern after in vivo association of carboplatin (50 μM)-induced lincRNA-p21 and DDB2 in specific regions of T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 8N shows an example of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and the putative DDB2 binding element.

[0042] [Figure 9A]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9B]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9C]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9D]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9E]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9F]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9G]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9H]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132. [Figure 9I]Figures 9A–9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to the DDB2 protein in vitro. Figures 9A–9D show single (Figures 9A and 9B) or complex (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 being subjected to a pull-down assay using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. The dot plots reveal that biotinylated RNA is an equal input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9 to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows that the Ct value of the gradient concentration of pure short lincRNA-p21 elements is used as the standard curve. Figure 9G shows that the transfection efficiencies of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells are comparable at different concentrations. Figure 9H shows that combined simultaneous treatment with all three short lincRNA-p21 elements dramatically enhances cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. Figure 9I shows that the inhibitory effect is reversed by treatment with MG132.

[0043] [Figure 10A]Figures 10A–10C show the effects of short chain lincRNA-p21 elements #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with any one of the three short chain lincRNA-p21 elements increases cytotoxicity only in the presence of carboplatin, but has no effect on cisplatin and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 10B shows that combined simultaneous treatment with all three short chain lincRNA-p21 elements can suppress DDB2 protein expression. Figure 10C shows the raw data from Figure 9I. [Figure 10B] Figures 10A–10C show the effects of short chain lincRNA-p21 elements #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with any one of the three short chain lincRNA-p21 elements increases cytotoxicity only in the presence of carboplatin, but has no effect on cisplatin and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 10B shows that combined simultaneous treatment with all three short chain lincRNA-p21 elements can suppress DDB2 protein expression. Figure 10C shows the raw data from Figure 9I. [Figure 10C]Figures 10A–10C show the effects of short chain lincRNA-p21 elements #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with any one of the three short chain lincRNA-p21 elements increases cytotoxicity only in the presence of carboplatin, but has no effect on cisplatin and doxorubicin. Data are representative of the three experiments and are shown as mean ± SD. Student's t-tests for *p<0.05; **p<0.01; ***p<0.001 compared to the control group. Figure 10B shows that combined simultaneous treatment with all three short chain lincRNA-p21 elements can suppress DDB2 protein expression. Figure 10C shows the raw data from Figure 9I.

[0044] [Figure 11A] Figures 11A–11E show 3D structural modeling of short lincRNA-p21 elements in a complex containing the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows that three 3D structures of short lincRNA-p21 elements are computed and predicted using six RNA Composer-derived databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows that 2000 poses are computed using the ZDOCK docking program in BIOVIA Discovery Studio, generating six angles per pose. Marked dots indicate potential poses between the two macromolecules, and arrow dots are selected short lincRNA-p21 elements with the best potential interaction with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2α helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11B]Figures 11A–11E show 3D structural modeling of short lincRNA-p21 elements in a complex containing the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows that three 3D structures of short lincRNA-p21 elements are computed and predicted using six RNA Composer-derived databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows that 2000 poses are computed using the ZDOCK docking program in BIOVIA Discovery Studio, generating six angles per pose. Marked dots indicate potential poses between the two macromolecules, and arrow dots are selected short lincRNA-p21 elements with the best potential interaction with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2α helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11C]Figures 11A–11E show 3D structural modeling of short lincRNA-p21 elements in a complex containing the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows that three 3D structures of short lincRNA-p21 elements are computed and predicted using six RNA Composer-derived databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows that 2000 poses are computed using the ZDOCK docking program in BIOVIA Discovery Studio, generating six angles per pose. Marked dots indicate potential poses between the two macromolecules, and arrow dots are selected short lincRNA-p21 elements with the best potential interaction with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2α helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11D]Figures 11A–11E show 3D structural modeling of short lincRNA-p21 elements in a complex containing the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows that three 3D structures of short lincRNA-p21 elements are computed and predicted using six RNA Composer-derived databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows that 2000 poses are computed using the ZDOCK docking program in BIOVIA Discovery Studio, generating six angles per pose. Marked dots indicate potential poses between the two macromolecules, and arrow dots are selected short lincRNA-p21 elements with the best potential interaction with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2α helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11E]Figures 11A–11E show 3D structural modeling of short lincRNA-p21 elements in a complex containing the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows that three 3D structures of short lincRNA-p21 elements are computed and predicted using six RNA Composer-derived databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows that 2000 poses are computed using the ZDOCK docking program in BIOVIA Discovery Studio, generating six angles per pose. Marked dots indicate potential poses between the two macromolecules, and arrow dots are selected short lincRNA-p21 elements with the best potential interaction with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2α helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure.

[0045] [Figure 12A]Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12B] Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12C]Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12D] Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12E]Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12F] Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12G]Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12H] Figures 12A–12H show the positions of short lincRNA-p21 elements in a complex containing DDB2, obtained by computational molecular docking. Figures 12A–12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F–12H show the most likely conformational predictions between short lincRNA-p21 elements and DDB2 from other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8).

[0046] [Figure 13A]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13B]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13C]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13D]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13E]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13F]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13G]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group. [Figure 13H]Figures 13A–13H show that exosome-packaged short lincRNA-p21 elements, #3, #4, and #9 (exoLinc-p21s), enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B–13F show that all three short lincRNA-p21 elements (#3+#4+#9), packaged by exosomes as an exosome-based therapy (exoLinc-p21s), exhibit DNA repair inhibition (Figure 13B), DDB2 protein inhibition (Figure 13C), proliferation inhibition (Figure 13D), cytotoxicity enhancement (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effects (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. Student's t-test, *p<0.05; **p<0.01; ***p<0.001, relative to the control group.

[0047] [Figure 14A] Figures 14A and 14B show the delivery efficiency of exosomes with and without anti-HLAG. Figure 14A shows the colony area and mean colony size in relation to the growth inhibitory function of exoLinc-p21s. Figure 14B shows the time-dependent delivery efficiency of exosomes with and without anti-HLAG, as determined by immunofluorescence assay. [Figure 14B] Figures 14A and 14B show the delivery efficiency of exosomes with and without anti-HLAG. Figure 14A shows the colony area and mean colony size in relation to the growth inhibitory function of exoLinc-p21s. Figure 14B shows the time-dependent delivery efficiency of exosomes with and without anti-HLAG, as determined by immunofluorescence assay.

[0048] [Examples]

[0049] The present invention can be implemented in many different forms and should not be considered limited to the examples shown herein. The embodiments described are not limited to the scope of the invention as described in the claims.

[0050] material and method

[0051] clinical specimen

[0052] At Chung Shan Medical University Hospital, Taichung, Taiwan, a total of 61 residual breast cancer tissue samples were collected from patients who underwent surgery for different breast cancer subtypes, after obtaining informed consent. The sample collection included non-selective subtypes and was used according to a protocol (CS2-18150) approved by the institutional ethics committee of Chung Shan Medical University, Taichung, Taiwan. The tissues were homogenized and cultured for 5 days with or without carboplatin. After processing, total RNA and protein lysates were prepared using TRIzol® reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA).

[0053] Tissue microarrays and in situ hybridization

[0054] Breast cancer tissue microarrays were purchased from SuperBioChips Laboratories (Seoul, Korea) and used to detect lincRNA-p21 for in situ hybridization experiments. The tissue microarray specimens contained different breast cancer subtypes from 40 patients. An RNAscope lincRNA-p21 (TP53COR1) probe was designed for use in the in situ hybridization assay and purchased from Advanced Cell Diagnostics, Inc. (Newark, CA, USA). This invention screened for lincRNA-p21 signaling in breast cancer tissue using the RNAscope 2.5HD Detection Kit-BROWN according to the manufacturer's protocol. Signals related to lincRNA-p21 expression were quantified in Fiji ImageJ, standardized by nucleus, and the area and probe count percentages were calculated.

[0055] cell culture

[0056] Breast cancer cell lines MCF7 (RRID: CVCL_0031), T-47D (RRID: CVCL_0553), BT-474 (RRID: CVCL_0179), SK-BR-3 (RRID: CVCL_0033), MDA-MB-468 (RRID: CVCL_0419), and MDA-MB-231 (RRID: CVCL_0062), as well as liver cancer cell line HepG2 (RRID: CVCL_0027), supplemented with 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) and HyClone® penicillin-streptomycin solution in Dulbecco's Modified Eagle Medium:Nutrient Mixture F-12 (DMEM / F12, HyClone®, Thermo Fisher Scientific Inc., Waltham, MA, USA), The cells were cultured in the USA. All cell lines were purchased from the American Type Culture Collection (ATCC), incubated at 37°C in a humidified incubator containing 5% CO2, and tested for mycoplasma contamination using the MycoAlert® mycoplasma detection kit (LT07-318, Thermo Fisher Scientific Inc., Waltham, MA, USA).

[0057] Inhibitors and reagents

[0058] Carboplatin (41575-94-4), (Z)-4-hydroxytamoxifen (68047-06-3), cycloheximide (CHX, 66-81-9), (S)-MG132 (133407-82-6), and tetracycline (hydrochloride, 64-75-5) were purchased from Cayman Chemical (Michigan, USA). Cisplatin (cis-diamine platinum(II), P4394) and doxorubicin hydrochloride (Sigma-Aldrich, D1515) were purchased from Merck KGaA (Darmstadt, Germany). Clarity® Western fluoroluminescence (ECL) substrate was purchased from Bio-Rad Laboratories, Inc., (Hercules, CA, USA).

[0059] antibody

[0060] Antibodies against DDB2 (#5416, RRID: AB_10694497), Ac-p53 (K382, #2525S, RRID: AB_330083), p-ERα (Ser118, #2511), HA-Tag (#3724, RRID: AB_1549585), PARP (#9542, RRID: AB_2160739), and histone H3 (#9715, RRID: AB_331563) were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA). Antibodies against DDB1 (sc-25367, RRID: AB_639050), Cul-4 (sc-377188), hnRNP-K (sc-28380), p53 (sc-126, RRID: AB_628082), and ERα (sc-8002, RRID: AB_627558) were purchased from Santa Cruz Biotechnology, Inc. (CA, USA). Antibodies against ubiquitin (P4D1-A11), p21WAF1 (Calbiochem, OP64, RRID: AB_2335868), α-tubulin (T5168, RRID: AB_477579), and β-actin (A2228, RRID: AB_476697) were purchased from Merck KGaA (Darmstadt, Germany). Antibodies against caspase 3 (Imgenex IMG-144A, RRID: AB_316677) were purchased from Novus Biologicals, LLC. (Centennial, CO, USA). Antibodies against p-histone H2AX (Ser139, AF2288, RRID: AB_2114989) were purchased from R&D Systems Inc. (Minneapolis, MN, USA).

[0061] Western blot assay

[0062] The total protein lysate concentration was determined using the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and 30 μg of the protein lysate was heated in sample buffer at 95°C for 5 minutes. Denatured proteins were separated in SDS-PAGE using electrophoresis buffer and transferred to PVDF membranes (0.45 μM, Millipore, Merck KGaA, Darmstadt, Germany) or NC membranes (0.22 μM, Amersh®, GE Healthcare Life Science, Pittsburgh, PA, USA) using transfer buffer. The transferred membranes were blocked with 5% milk or BSA in TBST buffer, stained overnight at 4°C with the indicated primary antibody, and then incubated with an HRP-conjugated secondary antibody. ECL signaling was detected using the ChemiDoc® Touch Imaging System (Bio-Rad).

[0063] RNA extraction and RT-PCR

[0064] After the indicated treatment, the cells were washed three times with ice-cold PBS and lysed with TRIzol® reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). Total RNA was isolated by adding 0.2 mL of chloroform per 1 mL of TRIzol® reagent and then centrifugating at 12,000 g for 15 minutes to separate the aqueous, intermediate, and organic phases. Next, the RNA was precipitated from the aqueous phase by mixing with 0.25–0.5 mL of isopropanol and then centrifugating at 12,000 g for 15 minutes. After removing the supernatant, the gel-like pellet was washed twice with 1 mL of 75% ethanol, air-dried, and then dissolved in DEPC-treated water. Reverse transcription polymerase chain reaction (RT-PCR) was performed using 1 μg of total RNA, Invitrogen® M-MLV reverse transcriptase (Thermo Fisher Scientific Inc., Waltham, MA, USA), random hexamers, dNTPs, 5x M-MLV buffer, and DTT.

[0065] Quantitative real-time PCR

[0066] For qRT-PCR, the expression of target genes was detected using specific primers with the KAPA SYBR FAST qPCR Master Mix (2X) kit (Kapa Biosystems, Wilmington, MA, USA). Threshold cycles or Ct values ​​were analyzed using the LightCycler 480 real-time PCR system (Roche Molecular Systems, Inc., Pleasanton, CA, USA) or the Applied Biosystems® QuantStudio® 5 real-time PCR system (Thermo Fisher Scientific Inc., Waltham, MA, USA). ddCt was calculated using a housekeeping gene as a reference.

[0067] RNA immunoprecipitation (RNA-IP) assay protocol

[0068] Cells were fixed with 1% formaldehyde, neutralized with 1M glycine, washed twice with ice-cold PBS, then deburred and vortexed with lysis buffer (50mM HEPES pH 7.5, 150mM NaCl, 1% Triton X-100, 0.1% SDS, 1mM DTT, cOmplete® protease inhibitor cocktail (one tablet contains enough protease inhibitor for 10mL cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA), and 200U / mL RNaseOUT® (Thermo Fisher Scientific Inc., Waltham, MA, USA)). After three freeze-thaw cycles on ice, the lysates were centrifuged at 14,000 rpm for 30 minutes, and the supernatant was collected for immunoprecipitation. Agarose protein A / G was preblocked for 1 hour, then mixed and incubated overnight with the antibody in NT2 buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM MgCl2, and 0.5% NP-40). These were then washed three times with NT2 buffer, and the lysates were incubated with NT2 buffer (1 mM DTT, 200 U / mL RNaseOUT®, and 20 mM EDTA) and rotated overnight. The immunocomplexes were washed three times and then reverse-crosslinked with 100 μL of NT2 buffer at 70°C for 5 hours. Finally, the samples were incubated with 0.25 mg / mL Sigma-Aldrich protease K (Merck KGaA, Darmstadt, Germany) at 55°C for 30 minutes and lysed with TRIzol® reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) for RNA extraction and qRT-PCR.

[0069] Preparation of in vitro transcription of biotinylated RNA

[0070] To investigate the in vitro interactions between target proteins, including DDB1, DDB2, Cul-4, and hnRNP-K, and RNA, biotinylated RNA was prepared using Invitrogen® T7 RNA polymerase (Thermo Fisher Scientific Inc., Waltham, MA, USA), and a biotinylated RNA labeling mix (Roche Molecular Systems, Inc., Pleasanton, CA, USA) was used in a biotin pull-down assay. Biotinylated lincRNA-p21, HOTAIR, and tubulin RNA were generated by using their DNA templates synthesized in PCR with a T7-containing primer set.

[0071] Biotin pull-down assay protocol

[0072] For the in vitro pull-down assay, 3 μg of biotin-labeled RNA was heated at 90°C for 2 minutes and reconstituted in structure buffer (10 mM Tris-HCl pH 7.0, 0.1 M KCl, and 10 mM MgCl2) at room temperature for 20 minutes. Cells (2 x 10) 7 The cells were treated with or without chemotherapy, and then resuspended in nuclear isolation buffer (1.28 M sucrose, 40 mM Tris-HCl pH 7.5, 20 mM MgCl2, and 4% Triton X-100). The nuclear pellets were hybridized to folded DNA or RNA for 1 hour in RIP buffer (150 mM KCl, 25 mM Tris-HCl pH 7.4, 0.5 mM DTT, 0.5% NP-40, 1 mM PMSF, and cOmplete® protease inhibitor cocktail (one tablet contains enough protease inhibitor for 10 mL of cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA)), and then the RNA-protein complexes were pulled down using Novagen streptavidin agarose beads (Novagen Corporation, San Diego, CA, USA) and analyzed by Western blotting.

[0073] Fractionation of nuclear and cytoplasmic RNA

[0074] The cells were washed twice with TD buffer (137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 25 mM Tris-HCl pH 7.4), detached with TD buffer, and then centrifuged at maximum speed for 30 seconds at room temperature. The pellet was washed with 200 μL of TD buffer, resuspended in 100 μL of vanadyl ribonucleoside complex buffer (20 mM VRC; S1402S, New England BioLabs Inc., Ipswich, MA, USA, 10 mM Tris-HCl, 0.14 M NaCl, 1.5 mM MgCl2, 1 mM DTT, and 0.5% NP-40 in TD buffer pH 8.6), vortexed for 10 seconds, and then incubated on ice for 5 minutes. Next, the cells were vortexed again and centrifuged at maximum speed for 30 seconds. The supernatant was then transferred to a new Eppendorf centrifuge tube and lysed with TRIzol® reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) to isolate cytoplasmic RNA. To isolate nuclear RNA, the pellet was washed with 200 μL of 0.5% NP-40 / TD buffer, resuspended in 100 μL of 0.5% NP-40 / TD buffer, and then lysed with Invitrogen TRIzol® reagent.

[0075] Triton Extraction Assay

[0076] After treatment with carboplatin, cells were lysed in Triton extraction buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 10 mM PIPES pH 6.8, 1 mM EGTA pH 6.8, 0.2% Triton X-100, freshly added 1 mM NaVO4, 1 mM PMSF, 10 mM NaF, and 1 ng / mL aprotinin) at 4°C for 30 minutes. The supernatant was collected as the Triton extractable fraction (chromatin-free protein), while the pellet was collected as the Triton-resistant fraction (chromatin-binding protein). Both fractions were washed twice with Triton extraction buffer and then further dissolved in NETN buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, freshly added 1 mM NaVO4, 1 mM PMSF, 10 mM NaF, and 1 ng / mL aprotinin). Both fractions were used to examine the unbound and DNA-bound forms of DDB2, respectively.

[0077] Cell viability assay protocol

[0078] Cell viability was detected using the MTT assay. Cells were grown in a 96-well plate (5x10). 3 The cells were treated with chemotherapy at different concentrations for 48 or 72 hours. The medium was then replaced with serum-free medium containing 5x Sigma-Aldrich MTT solution (Merck KGaA, Darmstadt, Germany) and incubated for 2.5 hours. The cells were then lysed with DMSO and the optical density (OD) at 570 nm was detected by an ELISA reader.

[0079] Quantification of cisplatin adducts in nuclear DNA by immunocytological assays

[0080] The effects of lincRNA-p21 and DDB2 on DNA repair were investigated by detecting cisplatin adducts in immunofluorescence staining with anti-cisplatin-modified DNA antibodies. After inducing DNA damage by treatment with cisplatin (50 μM) for the indicated time, cells were fixed with 4% paraformaldehyde, washed with PBS, and covered with 1% Triton X-100 at room temperature for 5–7 minutes. The cells were then blocked with 1% BSA in PBS at room temperature for 1 hour and stained with anti-cisplatin-modified DNA antibody (Abcam, plc., Cambridge, England) at room temperature in the dark for 1 hour. Subsequently, the cells were stained with a secondary antibody, goat anti-rat IgG H&L (Abcam, plc., Cambridge, England), at room temperature in the dark for another 1 hour. Finally, cells were mounted in DAPI mount medium (Thermo Fisher Scientific Inc., Waltham, MA, USA) and staining was observed using a fluorescence microscope (Leica DMIL LED, Leica Microsystems, Wetzlar, Germany). Cisplatin adduct signaling was quantified using ImageJ software and normalized against nuclear DAPI signaling.

[0081] Macromolecular docking

[0082] A schematic diagram of DDB2(4E54) was found in the Protein Databank (PDB). Short lincRNA-p21#3, #4, and #9 3D structures were predicted and generated using the RNAcomposer database and further used for ZDOCK docking between DDB2s via BIOVIA Discovery Studio software (RRID: SCR_015651). The docking results were presented in 3D structure using BIOVIA Discovery Studio and PyMoL software (RRID: SCR_000305).

[0083] Xenograft mouse model

[0084] Using a xenograft mouse model of mammary tumor, we demonstrated the proliferative effect of lincRNA-p21 via the Tet-On system and the synergistic effect between exoLinc-p21s and exoDox. Three days before subcutaneous inoculation, T-47D mammary cancer cells were injected into the mammary fat pads of 5-week-old female BALB / c nude mice that had been subcutaneously implanted with a 60-day release pellet containing 0.7 mg 17β-estradiol (Innovative Research of America). After allowing tumor growth in the mice for one month, the inhibitory effects of combination treatments with exoScramble, exoLinc-p21s, and exoDox on tumor growth were determined. During the treatment period, mouse activity was monitored, survival curves were calculated between the four treatment groups, and tumor diameter was continuously measured using calipers. The formula is: Volume = Length x Width 2 The tumor volume was calculated using / 2.

[0085] statistical analysis

[0086] Differences between two categorical variables were analyzed using Student's t-test or Welch's two-sample t-test, while differences between more than two categorical variables were analyzed using one-way ANOVA. Results are presented as mean ± SD, n ≥ 3. P-values ​​were calculated using a two-tail test, and statistically significant differences were defined as p < 0.05. All statistical analyses were performed using SigmaPlot 10.0, GraphPad Prism 8, or SPSS 21 software.

[0087] result

[0088] LincRNA-p21 suppresses ERα / DDB2-related DNA repair and chemical resistance.

[0089] The role of lincRNA-p21 in regulating DDB2-mediated DNA repair and chemoresistance remains unclear. Basal levels of lincRNA-p21 were relatively higher in early (Figure 1A and 1B), smaller (Figure 1B), and ERα-negative (Figure 1C) breast tumors. Induction of lincRNA-p21 by a tetracycline-inducible expression system in ERα-positive T47D breast cancer cells suppressed tumor growth in a xenograft mouse model (Figure 2A), revealing its tumor-suppressive role in breast cancer. In response to ex vivo treatment with carboplatin, induction of lincRNA-p21 in primary human breast tumor tissue decreased with disease progression (Figure 2B), tumor size (Figure 2C), and ERα-positive status (Figure 2D). These clinical observations suggest a clinical role of lincRNA-p21 in determining chemosensibility in breast cancer patients. In fact, the levels of chemotherapy-inducible lincRNA-p21 in various cell lines were negatively correlated with their IC50 to the corresponding chemotherapeutic agents (Figure 2E). Transient overexpression of lincRNA-p21 increased carboplatin-induced apoptotic death in ERα-positive T-47D cancer cells (Figure 2F). In contrast, silencing lincRNA-p21 expression in ERα-negative MDA-MB-231 cancer cells resulted in a decrease in carboplatin-responsive cell apoptosis (Figure 2G) and PARP and caspase-3 cleavage (Figure 2H). Furthermore, silencing of lincRNA-p21 also attenuated the sensitizing effects of tamoxifen (Figure 2I and Figure 3A) and ERαshRNA (Figure 2J and Figure 3B) on carboplatin-induced apoptotic death. Therefore, overexpression of lincRNA-p21 may overcome ERα-related chemorestraint.

[0090] To further demonstrate the inhibitory effect of lincRNA-p21 on DNA repair for chemosensitization, cisplatin-DNA adducts were examined by immunocytological assay using an anti-cisplatin-modified DNA antibody. The results revealed that the induction of cisplatin-DNA adducts was suppressed in cisplatin-treated MDA-MB-231 cancer cells by silencing lincRNA-p21 with shRNA (Figure 4A), indicating that lincRNA-p21 can increase chemosensitivity by suppressing DNA repair function. To determine the mechanism by which lincRNA-p21 reduces ERα-mediated DNA repair, differential gene expression profiles between human ERα-positive and ERα-negative breast cancers were analyzed using the GSE18908 dataset. Among the ERα-related pathways analyzed in the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (Figure 5A), two crucial pathways in the regulation of DNA repair and chemosensitivity, nucleotide excision repair (NER) and p53 signaling, were upregulated in response to ERα expression. The STRING network further revealed that the expression of DDB2, a well-known p53-targeted downstream component of NER, was increased in ERα-positive breast cancer (Figure 4B) and may be involved in chemosensitivity and DNA repair functions regulated by the ERα / lincRNA-p21 axis. Furthermore, DDB2 levels were statistically higher in ER-positive breast cancer tissue (Figure 4C). More importantly, Kaplan-Meyer plot analysis revealed a correlation between higher DDB2 expression and lower overall survival in all breast cancer patients receiving neoadjuvant chemotherapy, even with p53 mutation status (Figure 5B) (Figure 4D). Furthermore, DDB2 is more highly expressed in several different cancer types, such as lung cancer (LUSC), liver cancer (LIHC), cholangiocarcinoma (CHOL), colorectal cancer (COAD), head and neck squamous cell carcinoma (HNSC), gastric adenocarcinoma (STAD), and esophageal cancer (ESCA) (Figure 5C).Ex vivo induction of DDB2 protein expression by carboplatin was also dramatically higher in ERα-positive tumor tissue than in ERα-negative tumor tissue (Figure 4E) and correlated with tumor size (Figure 4F). Furthermore, breast tumors from patients in whom lincRNA-p21 was more highly induced but DDB2 was less induced by ex vivo treatment with carboplatin correlated with a better clinical response to adjuvant chemotherapy (Figure 4G), suggesting that lincRNA-p21 negatively regulates DDB2 expression and may suppress NER due to chemosensitization in breast cancer patients.

[0091] The present invention then investigated the involvement of DDB2-dependent NER in ERα-related chemical resistance. Cisplatin-DNA adducts induced DNA damage within 2 hours of treatment with cisplatin in both ER-negative / chemosensible MDA-MB-231 and ER-positive / chemosensitive T-47D cancer cells. These DNA damages persisted for more than 18 hours in MDA-MB-231 cancer cells but rapidly disappeared in T-47D cancer cells (Figure 5D). Both carboplatin (Figures 4H and 5E) and doxorubicin (Figure 5E) increased DDB2 expression in ERα-positive (T-47D and BT-474) breast cancer cell lines but not in ERα-negative (MDA-MB-231 and SK-BR-3) breast cancer cell lines. As an essential initiator, DDB2 recognizes damaged DNA sites in the nucleus, binds to these sites to further replenish other regulatory factors involved in NER, and is subsequently proteasomal degraded for the formation of DNA repair complexes. Therefore, chemotherapy-inducible nuclear translocation (Figure 6A) and chromatin-binding activity (Figures 4I and 6B) of DDB2 were also observed in ERα-positive cancer cell lines but not in ERα-negative cancer cell lines. Furthermore, silencing DDB2 expression increased PARP or caspase-3 cleavage in a dose- and time-dependent manner (Figure 4J) and sensitized ERα-positive cancer cells to carboplatin-induced apoptotic cell death (Figure 4K). Taken together, these results suggest that DDB2 is an important NER initiator in mediating ERα-related chemoresistance, and that it may be targeted by lincRNA-p21.

[0092] LincRNA-p21 acts as a scaffold for the Cul-4 E3 ligase complex, which is responsible for DDB2 proteasome degradation.

[0093] Treatment with carboplatin or doxorubicin increased lincRNA-p21 expression in a time-dependent manner in chemosensible MDA-MB-231 cancer cells, but not in chemosensible T-47D cancer cells, and was negatively correlated with chemotherapy-inducible DDB2 mRNA expression (Figure 7A). Nuclear accumulation of lincRNA-p21 was also increased by carboplatin in MDA-MB-231 cancer cells, but not in T-47D cancer cells (Figure 7B), and was inversely correlated with the nuclear translocation of DDB2 (Figure 6A). The present invention therefore next investigated whether lincRNA-p21 regulates DDB2 expression and the underlying molecular mechanisms. Interestingly, DDB2 protein levels were dose-dependently suppressed by lincRNA-p21 overexpression in T-47D cancer cells (Figure 8A) and enhanced by silencing lincRNA-p21 in MDA-MB-231 cancer cells (Figure 8B), without being affected by its mRNA levels (Figure 7C). Similarly, lincRNA-p21 induced by the Tet-On control system also suppressed DDB2 protein but not RNA levels (Figures 7D and 8C), suggesting post-transcriptional downregulation of DDB2 by lincRNA-p21. The proteasome inhibitor MG132 enhanced DDB2 expression in lincRNA-p21-enhanced MDA-MB-231 cancer cells (Figure 7E). DDB2 protein stability was reduced by lincRNA-p21 overexpression in the presence of cycloheximide (CHX) (Figures 7F and 8D) and restored by MG132 (Figure 8E), suggesting the involvement of lincRNA-p21 in regulating DDB2 proteasomal degradation. Overexpression of lincRNA-p21 enhanced DDB2 polyubiquitination in T-47D cancer cells (Figure 8F). Therefore, we investigated the role of lincRNA-p21 in regulating the complex formation of DDB2 with the E3 ligase Cul-4 and the adapter protein DDB1. In RNA-IP assays, physical interactions between lincRNA-p21 and DDB2 in response to carboplatin (Figure 8G) and doxorubicin (Figure 7G) were observed in ERα-negative breast cancer cells but not in ERα-positive breast cancer cells.Carboplatin (Figure 8H) and doxorubicin (Figure 7G) also strongly increased the association of lincRNA-p21 with DDB1 in vivo, but only moderately increased association with Cul-4. The interaction between DDB2 and the DDB1 and Cul-4 complex was attenuated in vitro by RNase A treatment, but in vivo, it was disrupted by silencing of lincRNA-p21 in anti-DDB2 (Figure 8I), anti-DDB1, and anti-Cul-4 (Figure 7I) immune complexes. Next, specific interactions between lincRNA-p21 and DDB2, DDB1, and Cul-4 in vitro were also demonstrated in RNA pull-down assays using biotinylated oligonucleotides (Figure 8J). Taken together, these data indicate that lincRNA-p21 directly binds to DDB2 / DDB1 / Cul-4 and acts as a scaffold for E3 complex formation.

[0094] To investigate the specific and essential regions of lincRNA-p21 in relation to DDB2 binding, the present invention then synthesized different segments (S1: exon 1, S2: intron, S3: exon 2) (Figure 7J) or deletion fragments (F1-F8) (Figure 8K) of lincRNA-p21 and analyzed their binding activity to DDB2. In in vitro RNA pull-down assays, S1 and F3-F8 showed stronger binding efficacy to DDB2, suggesting that region 526-926 is required for DDB2 binding activity. In RNA-IP analysis, the pulled-down RNA in anti-DDB2 immunoprecipitation was digested in vitro with or without RNase, and then RT-qPCR was performed using diverse primer sets for amplification of different regions (P1-P10), as illustrated in Figure 8K. The regions of lincRNA-p21 at P3, P4, P6, P7, and P9 were resistant to RNase A digestion, likely due to protection by binding to DDB2, further revealing potential DDB2 binding regions in vivo (Figure 8M). Interestingly, the binding regions of lincRNA-p21 for DDB1 and Cul-4 were similar to those for DDB2 (Figure 7K). DDB2 has been reported as a transcription factor with binding affinity to specific consensus elements on the promoters of target genes. It is noteworthy that these consensus sequences are found within the regions P3, P4, and P9 of lincRNA-p21 and are foldable as secondary structures (P3, P4, and P9), suggesting these elements as potential DDB2 binding sites (Figure 8N). These results suggest that two regions of lincRNA-p21 containing elements #3, #4, and #9 (527-926 and 2099-2287) are required for interaction with DDB2.

[0095] Potential short lincRNA-p21 elements act as DDB2 inhibitors for chemosensitization.

[0096] To demonstrate the necessity of the putative elements of lincRNA-p21 (P3, P4, and P9) interacting with DDB2 in vitro, these essential elements, indicated by asterisks in Figures 9A and 9C, were deleted. Protein levels of DDB2 pulled down by a biotinylated lincRNA-p21 full-length probe were slightly attenuated by individual deletions of P3, P4, or P9 (Del1, Del2, or Del3) (Figure 9B) and almost completely eliminated by a combination mutation in all three elements (Del 1+2+3) (Figure 9D). Furthermore, synthetic RNA oligonucleotides corresponding to these DDB2-binding elements of lincRNA-p21 (#3, #4, and #9) showed a 10% reduction in SPR analysis. -9 ~10 -8 M's K D The synthesized short lincRNA-p21 elements showed strong binding activity to recombinant DDB2 protein in a dose-dependent manner (Figure 9E). The synthesized short lincRNA-p21 elements showed dose-dependent levels in vitro that were comparable to the scrambled control (Figure 9F). Next, the present invention transiently transfected T-47D cancer cells with the short lincRNA-p21 elements, and delivery efficiency was detected by qRT-PCR analysis (Figure 9G). Compared to the scrambled control, the mixed three short lincRNA-p21 elements (#3+#4+#9) (Linc-p21s) increased the chemosensibility of ER-positive / chemosensitive T-47D cancer cells in a dose-dependent manner in response to platinum and doxorubicin (Figure 9H), while single short lincRNA-p21 elements (#3, #4, and #9 alone) showed only slight chemosensation effects (Figure 10A). Furthermore, the DDB2 targeting effect of Linc-p21s was evident from the downregulation of DDB2 protein expression 24 hours after treatment (Figure 10B), which was prevented by pretreatment with MG132 (Figures 9I and 10C).

[0097] To further investigate the potential conformations between these three short lincRNA-p21 elements and DDB2 in silico, we predicted the 3D structures of the short lincRNA-p21 elements (Linc-p21s) using RNAComposer, including six databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Interestingly, we obtained the same structural conformations predicted by at least four databases (CentroidFold, CONTRAfold, IPknot, and RNAfold) (Figure 11A) and used them for further molecular docking analysis with the DDB2 protein (PDB:4E54). We computed macromolecular docking by using the ZDOCK docking program and considered the potential DDB2 binding poses of short lincRNAs from different prediction databases that had lower Z-rank scores and higher Z-DOCK cores (Figures 11B and 12A-12E). Next, these potential poses were classified into different clusters (Figure 11C), presenting different interaction models within similar binding regions. Furthermore, the pose most likely to have the optimal Z rank and Z-docus core, demonstrating the interaction between the short lincRNA-p21 element and DDB2, was selected from the largest cluster (Figures 11D and 12F-12H). The interaction sites and distances between the short lincRNA-p21 element and DDB2 were also calculated (Figure 11E). In the 3D structure, the central nucleotides of the short lincRNA-p21 element (C8, C9, C10, C11, U12, and U13) interacted with the amino acids most likely to involve DDB2 (Lys-35, Pro-44, Cys-48, Cys-52, and Leu-53) or other amino acids, respectively, through hydrogen bonding and Pi-alkyl interactions (Figure 11E). In the resulting complex structure, all three short lincRNA-p21 elements form a coil with the α-helix at the N-terminus of DDB2, which is important and involved in interacting with DDB1 and fitting it to the E3 ligase Cul-4 (Figure 11D).It was reasonable to conclude that short-chain lincRNA-p21 coils with DDB2, stabilizing the formation of the DDB2 / DDB1 / Cul-4 E3 ligase complex and promoting polyubiquitination and degradation of DDB2.

[0098] Short-chain lincRNAp21s packaged with chemotherapeutic agents in exosomes showed promising chemosensitization effects.

[0099] The delivery efficiency, tumor targeting specificity, and stability of Linc-p21s in vivo are crucial for the development of RNA-based therapeutic strategies for cancer patients. To increase the delivery efficiency of Linc-p21s in the human body, exosomes were used as a delivery system for therapeutic strategies. Transmission electron microscopy (TEM) analysis showed no differences in size or shape between empty exosomes and exosomes packaged with lincRNAp21 (Figure 13A). To demonstrate the function of exosome-packaged Linc-p21s (exoLinc-p21s) in DNA repair, a cisplatin-DNA adduct assay was performed, showing that exoLinc-p21s extended the presence of cisplatin-DNA adducts from 3 hours to 24 hours, suggesting that exoLinc-p21s may be able to increase chemosensibility by reducing DNA repair (Figure 13B). Western blot analysis confirmed the ability of exoLinc-p21s to inhibit doxorubicin-inducible DDB2 expression in exosomes packaged with or without doxorubicin (exoDox) (Figure 13C). Furthermore, exoLinc-p21s reduced the proliferation of T-47D breast cancer cells and HepG2 (high DDB2 expression) hepatocellular carcinoma cells in colony formation assays (Figures 13D and 14A), and exoLinc-p21s containing 1 ng of short-chain Linc-p21s synergized with the cytotoxicity of doxorubicin, similar to results from a transient transfection system (Figure 13E). In a xenograft mouse model, Exo-Linc-p21s also enhanced the antitumor activity of doxorubicin in vivo (Figure 13F). To enhance the tumor targeting specificity of exoLinc-p21s, antibodies against HLAG, which is highly expressed in most tumors, were engineered onto the surface of exoLinc-p21s to increase tumor specificity. Indeed, exoLinc-p21s with anti-HLAG showed earlier and longer-lasting accumulation in T-47D cancer cells (Figure 14B).Importantly, anti-HLAG-modified exoLinc-p21s showed superior cytotoxicity (Figure 13G) and stronger suppression of DDB2 protein expression (Figure 13H) compared to exoLinc-p21s without anti-HLAG modification.

[0100] In summary, the data from this invention demonstrate that Linc-p21s packaged with chemotherapeutic agents in exosomes (exoLinc-p21s) can effectively target the DDB2 protein, suppressing DNA repair for chemosensitization, and thus potentially be a novel RNA-based DDB2 inhibitor that enhances chemosensitization in patients with diverse DDB2-expressing tumors.

[0101] A person skilled in the art will recognize the above outline as a description of a method for communicating with hosted application information. A person skilled in the art will recognize that these are illustrative only and that many equivalents are possible.

Claims

1. A composition comprising a sequence of long intergene non-coding RNA-p21 (lincRNA-p21), wherein the sequence of lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

2. The use of a composition for preparing a drug for treating cancer, wherein the composition comprises a sequence of long intergene non-coding RNA-p21 (lincRNA-p21) and a chemotherapeutic agent, wherein the sequence of lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

3. The use of claim 2, wherein the sequence of lincRNA-p21 enhances the sensitivity of the cancer to the chemotherapeutic agent by inhibiting the expression of DDB2.

4. The use of claim 2, wherein the cancer is a cancer accompanied by high expression of DDB2.

5. The use of claim 2, wherein the cancer has an inferior response to or drug resistance to the chemotherapeutic agent.

6. Claim 2 use, wherein the cancer includes breast cancer and liver cancer.

7. The use of claim 6, wherein the breast cancer cells have the mutant p53.

8. The use of claim 7, wherein the cancer cells of the breast cancer are estrogen receptor positive and have mutant p53.

9. The use of claim 2, wherein the chemotherapeutic agent comprises carboplatin, cisplatin, or doxorubicin.

10. The use of claim 2, wherein the composition further comprises a pharmaceutically acceptable carrier.

11. The use of claim 10, wherein the pharmaceutically acceptable carrier comprises liposomes, nanoparticles, exosomes, micelles, polymeric matrices, or gel matrices.

12. The use of claim 11, wherein the sequence of lincRNA-p21 is contained in the exosome.

13. The use of claim 2, wherein the composition further comprises a target molecule for binding to a biomarker on cancer cells.

14. The use of claim 13, wherein the target molecule comprises an anti-HLAG antibody.