Genome-modified silkworm producing chimeric silk yarns

JPWO2023190453A5Pending Publication Date: 2026-04-01
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Filing Date
2023-03-28
Publication Date
2026-04-01

AI Technical Summary

Technical Problem

The challenge is to produce chimeric silk with physical properties similar to bagworm silk, which is difficult due to the complexity of the full-length gene sequence of the fibroin H chain protein and the inefficiency of existing gene expression methods, such as transposons, and the need for new spinning techniques to convert recombinant fibroin protein into fibers.

Method used

The use of genome editing technology with TAL-PITCh method to introduce the bagworm-modified fibroin gene into silkworms, creating a genome-modified silkworm that produces chimeric fibroin protein with improved expression efficiency and spinning capabilities, resulting in chimeric silk with enhanced physical properties.

Benefits of technology

This approach allows for the production of chimeric silk with improved toughness, overcoming the limitations of existing methods by achieving higher expression efficiency and fiber production, resulting in silk with properties closer to bagworm silk.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The purpose of the present invention is to produce a silkworm capable of producing chimeric silk yarns with silkworm silk yarns that approximate the physical properties of bagworm silk yarns, and to obtain the target chimeric silk yarns in the fiber state from the silkworm. Provided is a genome-modified silkworm into which a gene encoding a modified bagworm fibroin protein, said gene being obtained by fusing a gene fragment encoding a bagworm-derived fibroin protein and a gene fragment encoding a silkworm-derived fibroin protein, is inserted.
Need to check novelty before this filing date? Find Prior Art

Description

Genome-modified silkworms producing chimeric silk

[0001] The present invention relates to a method and a kit for producing genome-modified silkworms that produce chimeric silk, as well as the genome-modified silkworms and chimeric silk obtained therefrom.

[0002] Bagworms are the general term for the larvae of moths belonging to the family Psychidae in the order Lepidoptera. Bagworm silk, which they spin, has superior physical properties to silk produced by silkworms, and has therefore recently attracted attention as a useful new animal-derived natural fiber (Patent Document 1 and Non-Patent Document 1).

[0003] There are several challenges that must be overcome before bagworm silk can be put to practical use as a textile material. One of these is mass production. When obtaining bagworm silk from bagworms, mass production requires the technology to mass-breed the bagworms and the technology to efficiently harvest silk from them. However, because the bagworm silk industry is in its infancy, many of these technologies are still in the development stage, and it will take some time before mass production can begin.

[0004] In addition to the method of directly obtaining silk from bagworms, as described above, mass production of bagworm silk can also be achieved by using genetic engineering to produce fibroin protein (often referred to herein as "Fib protein"), the fiber component of bagworm silk, in a host cell. Introducing a cloned fibroin gene (often referred to herein as "Fib gene") into a host and expressing it enables mass production of recombinant bagworm Fib protein within host cells. However, this technique also faces the problem of the lack of complete sequence determination of the fibroin H chain protein (often referred to herein as "Fib H protein"), a major component of bagworm silk. This is because Fib H protein contains an amino acid sequence with numerous repeated glycine and alanine residues, making sequencing extremely difficult using conventional cloning techniques. Furthermore, bagworm Fib protein (often referred to herein as "bFib protein") expressed in a host cell is liquid, and must be processed into a fibrous form before it can be used as fiber. However, this method is labor-intensive and expensive to produce, and it is difficult to spin bFib proteins into fibers using conventional spinning techniques, necessitating the development of new spinning techniques.

[0005] On the other hand, silkworms have been domesticated for over 5,000 years as domesticated insects for the purpose of harvesting silk thread, and mass-rearing and mass-production technologies and facilities have been established for them. Furthermore, in recent years, it has become possible to produce various types of genetically modified silk thread from genetically modified silkworms produced using genetic engineering technology.

[0006] Therefore, as an early solution to the problems in mass production of bagworm silk, the inventors constructed a modified fibroin gene based on partial base sequence information of the gene encoding the bagworm Fib H protein (often referred to as "bFib H protein" herein), and by introducing this gene into genetically modified silkworms and allowing them to spin silk, they succeeded in obtaining chimeric silk in which the physical properties of bagworm silk were imparted to silkworm silk (Patent Document 2). However, although the physical properties of the obtained chimeric silk possess some of the characteristics of bagworm silk, there remained a problem in obtaining silk with physical properties similar to those of bagworm silk.

[0007] Patent Publication No. 2018-197415WO2018 / 074403

[0008] Shigeyoshi Osaki, 2002, Journal of the Society of Fiber Science and Technology (Fibers and Industry), 58: 74-78

[0009] The objective of the present invention is to produce silkworms that have a high content of bagworm silk and are therefore capable of producing chimeric silk with silkworm silk that has physical properties similar to bagworm silk, and to obtain the desired chimeric silk in fiber form from the silkworms.

[0010] In Patent Document 2, a transposon-based method was used to insert a target gene into the silkworm genome to produce a transgenic silkworm. However, the expression efficiency of the exogenous gene inserted by the transposon was only a few percent of that of the endogenous gene. The inventors hypothesized that this was the cause of the inhibition of the chimeric silk thread from imparting the properties of bagworm silk to the bagworm silk. Therefore, instead of the transposon method, they attempted to knock-in the target modified fibroin gene into the silkworm genome using genome editing technology using the TAL-PITCh method. As a result, they successfully produced a genome-modified silkworm with an inserted bagworm modified fibroin gene. The resulting genome-modified silkworm not only produced a silkworm-bagworm chimeric fibroin protein (often referred to herein as "chimeric Fib protein") in the silkworm silk gland, but also produced the chimeric Fib protein in the form of silk thread by allowing the silkworm to spin silk. The present invention is based on these development results and provides the following:

[0011] (1) A kit for producing a genome-modified silkworm that produces a chimeric fibroin protein containing a silkworm-derived fibroin protein and one or more other silkworm-derived fibroin proteins, the kit including a Left-TALEN expression vector, a Right-TALEN expression vector, and a donor vector, the Left-TALEN expression vector including a Left-TALEN coding region, and the Left-TALEN coding region includes a Left-TALEN that recognizes and binds to the base sequence of a 5'-side TALE binding region located in the vicinity of the 5' side of the insertion position of the other silkworm fibroin gene in the silkworm fibroin gene. (2) The production kit according to (1), wherein the donor vector contains a 5'-side TALE corresponding region, a 3'-side TALE corresponding region, a 5'-side homology region, a 3'-side homology region, and a fibroin gene derived from the other silkworm. (3) The production kit according to (1) or (2), wherein the fibroin protein derived from the other silkworm is a fibroin H chain protein. (4) The production kit according to any one of (1) to (3), wherein the other silkworm is a bagworm. (5) The production kit according to (4), wherein the bagworm fibroin H chain protein is a modified fibroin H chain protein formed by linking three or more identical and / or different repeating units, wherein the repeating unit contains 30 or more G / A units, each consisting of two amino acid residues, a glycine residue and an alanine residue, and an alanine cluster containing 15 to 25 alanine residues on the N-terminal side, and has a total length of 120 to 178 amino acids.(6) The production kit according to (5), wherein the alanine cluster consists of the amino acid sequence shown in SEQ ID NO: 3 or 4. (7) The production kit according to (5) or (6), wherein the repeating unit is any one or more selected from the amino acid sequences shown in SEQ ID NOs: 8 to 16. (8) The production kit according to any one of (4) to (7), wherein the gene encoding the bagworm fibroin H chain protein consists of any one of the base sequences shown in SEQ ID NOs: 17 to 25.

[0012] (9) A method for producing a genome-modified silkworm that produces a chimeric fibroin protein containing a silkworm-derived fibroin protein and one or more other silkworm-derived fibroin proteins in the silk gland, the method comprising: a nucleic acid introduction step of introducing a Left-TALEN mRNA or a Left-TALEN expression vector, a Right-TALEN mRNA or a Right-TALEN expression vector, and a donor vector into silkworm eggs; a transformant selection step of selecting a transformant containing a fibroin gene derived from another silkworm from the silkworms after the nucleic acid introduction step; and a genome-insertion individual selection step of selecting an individual from the transformants in which the fibroin gene of another silkworm has been inserted at a desired position in the silkworm genome, The mRNA comprises a region encoding a Left-TALE region and a nuclease domain, the Left-TALE region encodes a Left-TALE domain that recognizes and binds to the base sequence of the 5'-side TALE binding region at the insertion position of the other silkworm fibroin gene in the silkworm fibroin gene, the Left-TALEN expression vector comprises a promoter and a region encoding the Left-TALE region and nuclease domain that are placed under the expression control of the promoter, and the Right-TALEN (10) The production method according to (9), wherein the donor vector contains a 5'-side TALE corresponding region, a 3'-side homology region, a 5'-side homology region, and a 3'-side TALE corresponding region arranged in this order from the 5' side based on the sense strand direction of the other silkworm fibroin gene.(11) The production method according to (9) or (10), wherein the fibroin protein derived from the other silkworm is a fibroin H chain protein. (12) The production method according to any one of (9) to (11), wherein the other silkworm is a bagworm. (13) The production method according to (12), wherein the bagworm fibroin H chain protein is a modified fibroin H chain protein formed by linking three or more identical and / or different repeating units, and wherein the repeating unit contains 30 or more G / A units consisting of two amino acids, a glycine residue and an alanine residue, and an alanine cluster containing 15 to 25 alanine residues at the N-terminus, and has a total length of 120 to 178 amino acids. (14) The production method according to (13), wherein the alanine cluster consists of the amino acid sequence shown in SEQ ID NO: 3 or 4. (15) The production method according to (13) or (14), wherein the repeating unit is one or more amino acid sequences selected from the amino acid sequences shown in SEQ ID NOs: 8 to 16. (16) A manufacturing method according to any one of (12) to (15), wherein the gene encoding the bagworm fibroin H chain protein consists of any one of the base sequences shown in SEQ ID NOs: 17 to 25.

[0013] (17) A genome-modified silkworm that includes a bagworm-derived fibroin H chain gene in its silkworm genome and produces the fibroin H chain protein in its silk gland. (18) The genome-modified silkworm according to (17), wherein the bagworm-derived fibroin H chain protein is a chimeric fibroin protein with a silkworm-derived fibroin protein.

[0014] (19) A chimeric silk comprising a chimeric fibroin protein in which a modified bagworm fibroin H-chain protein is linked to any position of a silkworm fibroin H-chain protein or L-chain protein, wherein the modified bagworm fibroin H-chain protein is composed of three or more identical and / or different repeating units linked together, and the repeating unit contains 30 or more G / A units consisting of two amino acid residues, a glycine residue and an alanine residue, and an alanine cluster containing 15 to 25 alanine residues on the N-terminal side, and the chimeric silk comprises a total length of 120 to 178 amino acids. (20) The chimeric silk according to (19), wherein the alanine cluster consists of the amino acid sequence shown in SEQ ID NO: 3 or 4. (21) The chimeric silk according to (19) or (20), wherein the repeating unit is one or more amino acid sequences selected from the amino acid sequences shown in SEQ ID NOs: 8 to 16. This specification incorporates the disclosure of Japanese Patent Application No. 2022-056854, from which the present application claims priority.

[0015]

[0023] Figure 1 shows a conceptual diagram of the Left-TALEN expression vector (a), Right-TALEN expression vector (b), and donor vector (c) constituting the genome-modified silkworm production kit of the present invention. Figure 2 shows a schematic diagram (A) illustrating the structure of the modified bagworm fibroin protein described in WO2018 / 074403, which served as the basis for constructing the chimeric protein of the present invention in Example 1, and its amino acid sequence (B). Figure 3 shows a schematic diagram of the donor vector pDVL-MMHX4 of the present invention constructed in Example 1. Figure 4 shows a schematic diagram (A) illustrating the structure of the chimeric protein produced by the genome-modified silkworm of the present invention, which was produced in Example 2, and its amino acid sequence (B, SEQ ID NO: 34). This chimeric protein consists of the N-terminal region (b) of the modified bagworm fibroin protein fused to the C-terminus of the silkworm L chain fibroin (a), a repeat sequence of the same fibroin protein (c: partial repeat unit + 12 repeat units), and a 6x histidine tag (d). Figure 5 shows Western blotting of cocoon shell proteins derived from chimeric silk threads, performed in Example 2. In the figure, the arrow indicates the position of the chimeric L chain prepared in Example 1. Furthermore, bands (arrowheads) were observed at the position of the wild-type silkworm L chain in the heterozygous individuals and control individuals.

[0016] 1. Genome-modified silkworm production kit 1-1. Overview A first aspect of the present invention is a genome-modified silkworm production kit. The kit of this aspect includes an expression vector and other components necessary for producing genome-modified silkworms that produce a chimeric Fib protein containing a Fib protein derived from a silkworm and a Fib protein derived from another silkworm, particularly a bagworm, using genome editing technology. The kit of this aspect allows for easy production of genome-modified silkworms that produce the chimeric Fib protein.

[0017] 1-2. Definition of Terms The following terms frequently used in the present invention are defined below. In this specification, "silkworm" is a general term for insects that have silk glands and can spin silk threads. Specifically, it refers to species of the orders Lepidoptera, Hymenoptera, Neuroptera, Trichoptera, etc. that are capable of spinning silk threads primarily during the larval stage for nesting, cocoon building, or movement. Among the orders Lepidoptera, preferred silkworms in this specification include Bombycidae, Saturniidae, Brahmaeidae, Eupterotidae, Lasiocampidae, Psychidae, Archtiidae, and Noctuidae, which are capable of spinning large amounts of silk threads.

[0018] In this specification, "other silkworms" refers to silkworms other than the silkworm moth (Bombyx mori). The type of other silkworms is not limited. It is not limited to one species, and may be multiple species. Although not limited, the other silkworms are preferably bagworms. In this specification, unless otherwise specified, the term "silkworm" is used synonymously with the term "silkworm," which is the name of the larval stage of the silkworm moth.

[0019] "Bagus" is a general term for the larvae of moths belonging to the Psychidae family. As with silkworms, unless otherwise specified, the term "bagworm," which is the name of the larval stage of bagworms that spins silk, is used herein as a synonym for bagworms. The type of bagworm used herein is not particularly limited. For example, it may be a species belonging to any genera, such as Acanthopsyche, Anatolopsyche, Bacotia, Bambalina, Canephora, Chalioides, Dahlica, Diplodoma, Eumeta, Eumasia, Kozhantshikovia, Mahasena, Nipponopsyche, Paranarychia, Proutia, Psyche, Pteroma, Siederia, Striglocyrbasia, Taleporia, Theriodopteryx, or Trigonodoma. Since the Fib gene cloned in this specification is the Fib H gene derived from the giant silkworm moth (Eumeta japonica), the preferred species are larvae of the genus Eumeta, such as the giant silkworm moth and the brown silkworm moth (Eumeta minuscula).

[0020] As used herein, "silk thread" refers to thread made from insect-derived proteins produced in the silk gland and spun by insect larvae and adults for purposes such as nest building, movement, anchoring, cocooning, and prey capture. Silk thread is typically composed of fibroin (Fib) protein, the main fiber component, and sericin protein, the glue-like component that coats it. Unless otherwise specified, the term "silk thread" used herein refers to both silk thread spun by silkworms, i.e., "raw silk" containing Fib protein and sericin protein, and "degummed silk" consisting of thread-like Fib protein obtained by removing sericin protein from raw silk through a degumming process. Furthermore, "silk thread" generally refers to a general silk thread without specifying the name of the insect of origin. When referring to silk thread derived from a specific insect, the name of the organism of origin is placed before the term "silk thread," such as silkworm silk or bagworm silk.

[0021] A "silk gland" is a tubular organ that is a modified salivary gland and has the function of producing Fib proteins and sericin proteins, accumulating them in its lumen, and then secreting them. Generally, silk glands are present in pairs along the digestive tract of insects capable of spinning silk threads, and each silk gland is composed of three regions: anterior, middle, and posterior silk glands. Fib proteins are produced in the posterior silk gland, and sericin proteins are produced in the middle silk gland. Fib proteins produced in the posterior silk gland migrate into the lumen of the middle silk gland, and in many cases, they migrate to the anterior silk gland together with sericin proteins before being excreted as silk threads from the head spinneret.

[0022] The genome-modified silkworms herein produce chimeric Fib proteins. The chimeric Fib gene encoding the chimeric Fib protein is a fusion gene with the endogenous Fib gene of the silkworm, and is, in principle, subject to the same expression control as the Fib gene of the silkworm. Therefore, unless otherwise specified, the silk gland that produces the chimeric Fib protein herein refers to the posterior silk gland.

[0023] "Fibroin (Fib) protein" refers to a protein that constitutes the fiber component of silk thread. While it usually refers to the full-length protein, in this specification it also includes peptide fragments thereof. The peptide fragment referred to here is preferably a functional fragment of Fib protein. A "functional fragment" refers to a peptide that has the function of a fibroin protein. In silkworms, for example, fibroin protein is known to be composed of three proteins: fibroin H chain (Fib H) protein, fibroin L chain (Fib L) protein, and p25 / FHX (often simply referred to as "p25" in this specification). Of these, Fib H protein is the major component of Fib protein, and the physical properties of silk thread are mainly provided by Fib H protein. In this specification, Fib protein derived from silkworms may be any of the three component proteins.

[0024] In this specification, when "Fib," "Fib H," or "Fib L" is used to refer to a gene or protein, the insect of origin is not limited. On the other hand, when referring to a gene or protein derived from a specific insect, the name of the organism of origin or its abbreviation is added before "Fib." For example, a Fib gene or Fib protein derived from a silkworm would be referred to as the silkworm Fib (silkworm Fib: sFib) gene or protein, or the bagworm Fib (bagworm Fib: bFib) gene or protein. The same applies to the Fib H gene or protein, or the FibL gene or protein.

[0025] As used herein, the term "modified fibroin heavy chain (modified Fib H) protein" (often referred to herein as "m-Fib H protein") refers to a Fib H protein obtained by artificially modifying a wild-type Fib H protein. Examples of m-Fib H include mutant Fib H proteins obtained by artificially adding, deleting, and / or substituting one or more amino acids into the amino acid sequence of a wild-type Fib H protein, and fusion Fib H proteins obtained by fusing the amino acid sequences of wild-type Fib H proteins derived from two or more different insect species. In addition, as used herein, the term "n amino acids" (n is an integer) is synonymous with "n amino acid residues" unless otherwise specified.

[0026] As used herein, the term "chimeric Fib protein" refers to a Fib protein in which full-length and / or partial Fib proteins from two or more different species are linked directly or indirectly. Examples of such Fib proteins include a Fib protein in which full-length or partial Fib H protein from one species is linked, either directly or indirectly via an intervening peptide, to any position in full-length or partial Fib L protein from another species, so as to form a single polypeptide chain; and a Fib protein in which the full-length or partial amino acid sequence of Fib H protein from one species is inserted into an appropriate position in the amino acid sequence of Fib H protein from another species. In particular, the term "chimeric Fib protein" used herein refers to a chimeric Fib protein comprising a Fib protein derived from a silkworm and a Fib protein derived from another silkworm, particularly a chimeric Fib protein comprising a Fib protein derived from a silkworm and a Fib protein derived from a bagworm (often referred to herein as a "silkworm-bagworm chimeric Fib protein (s / bFib protein)"). The Fib protein derived from bagworms is not limited, but is preferably m-bFib H protein. The Fib protein derived from silkworms is also not limited, and may be any of sFib L protein, sFib H protein, or p25 protein.

[0027] As used herein, the term "fibroin (Fib) gene" refers to a gene encoding the Fib protein. When the Fib protein is not a full-length protein but a peptide fragment thereof, the term refers to a gene fragment encoding the peptide fragment. Furthermore, the terms "Fib H gene," "Fib L gene," and "p25 gene" refer to genes encoding Fib H, Fib L, and p25, respectively.

[0028] As used herein, the term "modified fibroin heavy chain (modified Fib H) gene" (often referred to herein as "m-Fib H gene") refers to a gene encoding m-Fib H. Therefore, the term "m-bFib H gene" refers to a gene encoding modified Fib H in bagworm-derived Fib H. In this embodiment, this m-bFib H gene is the target. When the term "Fib H gene" is used, as with the above-described proteins, the insect of origin is generally not important. On the other hand, when referring to a Fib H gene derived from a specific insect, the name of the organism of origin is placed before Fib H, such as the silkworm Fib H (sFib H) gene or the bagworm Fib H (bFib H) gene.

[0029] As used herein, the term "chimeric Fib gene" refers to a gene encoding the chimeric Fib protein. The genome-modified silkworm of the present invention contains this chimeric Fib gene in its genome.

[0030] As used herein, "chimeric silk" refers to silk produced by a genome-modified silkworm harboring the chimeric Fib gene. Chimeric silk is composed entirely of silk components derived from silkworms, except for the chimeric Fib protein. For example, when the chimeric Fib gene is a fusion gene of the sFib L gene and the m-bFib H gene, the chimeric silk produced by a genome-modified silkworm harboring the chimeric Fib gene is a hybrid silk composed of the chimeric Fib protein derived from the chimeric Fib gene, silkworm-derived sFib H, p25, and sericin. In chimeric silk, part of the Fib protein, a fiber component of silkworm silk, is composed of the m-bFib H protein. Even silk produced by silkworms can be endowed with the physical properties of bagworm silk by including modified bagworm Fib H.

[0031] As used herein, the term "expression vector" refers to an expression system that contains a gene in an expressible state and can control its expression. As used herein, "expressible state" means that the gene contained in the vector is incorporated into the expression vector so that it can be expressed in a host cell. Specifically, this means that the contained gene is placed under the control of a promoter in the expression vector.

[0032] As used herein, the term "genome-modified silkworm" refers to a silkworm produced by genome editing technology, particularly a silkworm in which a bagworm-derived Fib gene, preferably the m-bFib H gene, has been inserted (knocked in) into the silkworm genome by genome editing technology.

[0033] "Genome editing technology" refers to a gene targeting technology in which an artificial DNA cleaving enzyme recognizes a specific sequence in the genome and causes a double strand break (referred to as "DSB" in this specification) in the DNA, thereby inserting a foreign gene into the specific location (knock-in) or destroying a target gene (knock-out). Genome editing technologies include the TALEN method, zinc finger nuclease (ZFN) method, and CRISPR-Cas9 method. In this specification, the term "genome editing technology" refers to the TALEN method unless otherwise specified.

[0034] The "TALEN (Transcription Activator-Like Effector Nuclease) method" is a genome editing technology that uses artificial DNA cleaving enzymes that utilize TAL effector (TALE) proteins derived from the plant pathogenic bacterium Xanthomonas (Cermak T, et al., 2011, Nucleic Acids Res 39: e82). TALEN proteins are proteins consisting of a special TALE domain and a nuclease domain, which contain repeats of DNA-binding units consisting of approximately 34 amino acid residues (LTPDQVVAIASXXGGKQALETVQRLLPVLCQDHG) as exemplified by SEQ ID NO: 1. Among these, the nuclease domain, which has the enzymatic activity of cleaving DNA, functions as a dimer. Therefore, TALEN proteins also function as a dimer consisting of a "Left-TALEN protein" that recognizes the sense strand DNA sequence near the upstream (5') side of the double-strand break (DSB) site of the target gene, and a "Right-TALEN protein" that recognizes the antisense strand DNA sequence near the downstream (3') side of the DSB site. The DNA-binding units that make up the TALE domain have variable amino acid residues at positions 12 and 13 from the N-terminus of SEQ ID NO: 1, and each pair of amino acids can specifically recognize each of the four bases that make up DNA (A: adenine, G: guanine, C: cytosine, T: thymine). For example, the amino acid residues at positions 12 and 13 recognize adenine for NI, guanine or adenine for NN, cytosine for HD, and thymine for NG. The number of repeats of the DNA-binding unit can vary depending on the base length of the target base sequence. A TALE domain is created by linking binding units that recognize each base in a given DNA sequence in the 5' to 3' direction on the genome, and by fusing this with a nuclease domain, a nuclease monomer (Left-TALEN protein) that binds to any DNA sequence on the genome is created. A TALEN that binds to the complementary strand of the genome, spaced an appropriate distance (15-30 bases) 3' from the 5' TALEN binding region, is similarly created, and this is used as the other nuclease monomer (Right-TALEN protein).By using these molecules simultaneously as a dimer, gene targeting becomes possible, whereby any DNA sequence can be targeted and cleaved.

[0035] The "Precise Integration into Target Chromosome (PITCh)" method is a knock-in technology that utilizes microhomology-mediated end joining (MMEJ) (Nakade S., et al., 2014, Nature Comm., 5, 5560). MMEJ is a DNA repair pathway that repairs DNA by ligating short homologous sequences (microhomology) of 5–25 bp that are commonly present at both ends of a DSB. Generally, foreign gene knock-in is achieved using the homologous recombination (HR) method, which uses sister chromatids as templates. However, HR-based knock-in requires very long sequences (800–several thousand bp). Furthermore, the frequency of occurrence varies significantly depending on the species, limiting the number of species in which it can be efficiently performed. The PITCh method using MMEJ is a method that can achieve knock-in with higher efficiency than conventional HR-based techniques, regardless of the species used.

[0036] As used herein, the "TAL-PITCh method" (or TALEN-PITCh method) refers to a method that uses TALEN as a genome editing tool in the PITCh method.

[0037] As used herein, the term "promoter" refers to a gene expression regulatory region that can control the expression of a gene (target gene) placed under its control.

[0038] 1-3. Configuration The genome-modified silkworm production kit of this embodiment includes a Left-TALEN expression vector, a Right-TALEN expression vector, and a donor vector as essential components. In principle, the three vectors are used as a set.

[0039] The vectors included in the genome-modified silkworm production kit do not need to be separate vectors as long as they contain the respective components. Two or three vectors may be combined into one vector. Examples include a Left / Right-TALEN expression vector that combines a Left-TALEN expression vector and a Right-TALEN expression vector, and a vector that contains all three vectors. The components of each vector are described in detail below.

[0040] 1-3-1. Left-TALEN Expression Vector As used herein, the term "Left-TALEN expression vector" refers to an expression vector containing a Left-TALEN region and a promoter as essential components. In the genome-modified silkworm production kit of the present invention, the Left-TALEN expression vector may be introduced into silkworm cells to be subjected to genome editing, thereby expressing a Left-TALEN protein in vivo, or may be used for in vitro transcription to prepare a Left-TALEN mRNA.

[0041] (Configuration) Each component of the Left-TALEN expression vector is explained below. (1) Left-TALEN region As used herein, the "Left-TALEN region" refers to a region encoding the Left-TALE domain and the nuclease domain located downstream thereof, which encodes the aforementioned Left-TALEN protein. Below, the Left-TALE domain and the nuclease domain, which are components of the Left-TALEN region, are explained.

[0042] (1-1) Left-TALE domain As used herein, the term "Left-TALE domain" refers to the DNA-binding domain in TALEN, and is composed of an amino acid sequence containing a repeat sequence of a DNA-binding unit consisting of the 34 amino acids shown in SEQ ID NO: 1. The number of repeats corresponds to the number of bases in the 5' TALE-binding region in the sFib gene. For example, if the 5' TALE-binding region has 15 bases, the number of repeats of the DNA-binding unit will be 15. The base sequence encoding the Left-TALE domain may contain an N-terminal domain on the 5' end and a C-terminal domain on the 3' end. The 5' end of the 5' TALE-binding region may contain thymine (T).

[0043] As used herein, the term "5'-TALE binding region" refers to a region consisting of a specific nucleotide sequence in the sFib gene on the silkworm genome, and is the target region to which the Left-TALEN protein of the present invention specifically recognizes and binds via the Left-TALE domain. The nucleotide sequence and length constituting the 5'-TALE binding region are any nucleotide sequence of 11 to 31 nucleotides, 12 to 30 nucleotides, 13 to 28 nucleotides, 14 to 26 nucleotides, or 15 to 25 nucleotides selected from the desired position in the sFib gene on the silkworm genome where the bFib gene is to be inserted, i.e., the sequence 5 to 55 nucleotides upstream from the DSB site. Therefore, the nucleotide sequence of the 5'-TALE binding region may be appropriately designed depending on the DSB site.

[0044] (1-2) Nuclease Domain As used herein, a "nuclease domain" refers to a domain consisting of an endonuclease or its active domain linked downstream of a Left-TALE domain or a Right-TALE domain (described below). The Left-TALEN protein and the Right-TALEN protein, bound to the 5'- and 3'-TALE binding regions on the silkworm Fib gene via the Left-TALE domain or the Right-TALE domain, respectively, cleave the target DSB site using the endonuclease activity of their respective nuclease domains. The type of endonuclease is not particularly limited as long as it does not have a specific recognition sequence and has DSB activity against any sequence. For example, an endonuclease obtained by removing the base sequence recognition domain from FokI can be used.

[0045] (2) Promoter As used herein, the term "promoter" refers to a transcriptional regulatory region that controls the expression of a downstream gene. The promoter used in the present invention may be derived from any gene, as long as it is operable in an environment that transcribes the downstream gene. "Operable" here means that it can function as a promoter and transcribe a target gene, etc.

[0046] The type of promoter is not critical. For example, in the case of transcription within silkworm cells, examples include constitutively expressible promoters that control the expression of housekeeping genes, constitutively active promoters, time-specifically active promoters, site-specific promoters, and inducible promoters. Constitutively expressible promoters and time-specifically active promoters are preferred, although not limited thereto. An example of a constitutive promoter is the actin promoter. An example of an inducible promoter is the hsp70 promoter. On the other hand, examples of promoters for in vitro transcription using bacteriophage-specific RNA polymerase, etc., include the SP6 promoter, T3 promoter, and T7 promoter.

[0047] A specific example of the base sequence of an in vivo promoter derived from a silkworm is the actin promoter derived from a silkworm, which contains the base sequence shown in SEQ ID NO:2.

[0048] 1-3-2. Right-TALEN Expression Vector As used herein, a "Right-TALEN expression vector" refers to an expression vector that functions in conjunction with the Left-TALEN expression vector and contains a Right-TALEN region and a promoter as essential components. Therefore, its basic configuration is similar to that of the Left-TALEN expression vector. In the genome-modified silkworm production kit of the present invention, the Right-TALEN expression vector may also be introduced into silkworm cells to be subjected to genome editing, allowing the Right-TALEN protein to be expressed in vivo, or may be used for in vitro transcription to prepare Right-TALEN mRNA.

[0049] (Configuration) Each component of the Right-TALEN expression vector will be explained below. (1) Right-TALEN region In this specification, the "Right-TALEN region" is a region encoding the Right-TALE domain and the nuclease domain located downstream thereof, which encodes the Right-TALEN protein described above. The basic configuration is similar to that of the Left-TALEN region in the Left-TALEN expression vector. Therefore, we will omit the explanation of the components common to the Left-TALEN region and focus on the different components.

[0050] (1-1) Right-TALE Domain As used herein, the term "Right-TALE domain" refers to the DNA-binding domain in TALEN, and is composed of a repeating sequence of a DNA-binding unit consisting of 34 amino acids as shown in SEQ ID NO: 1. Its basic structure is similar to that of the Left-TALE domain, but the Right-TALE domain targets the 3' TALE-binding region in the sFib gene, and the number of repeats corresponds to the number of bases in the 3' TALE-binding region in the sFib gene. A thymine (T) is typically located on the 5' side of the 3' TALE-binding region recognized by the Right-TALE domain, just like the 5' side of the 5' TALE-binding region recognized by the Left-TALE domain. However, this thymine does not necessarily have to be located.

[0051] As used herein, the term "3'-TALE binding region" refers to a region consisting of a specific nucleotide sequence in the Fib gene on the silkworm genome, which is a target region specifically recognized and bound by the Right-TALEN protein of the present invention via the Right-TALE domain. The nucleotide sequence and length constituting the 3'-TALE binding region are any nucleotide sequence of 11 to 31 nucleotides, 12 to 30 nucleotides, 13 to 28 nucleotides, 14 to 26 nucleotides, or 15 to 25 nucleotides selected from the desired position in the sFib gene on the silkworm genome where the bFib gene is to be inserted, i.e., a sequence of 5 to 55 nucleotides downstream from the DSB site. Therefore, the nucleotide sequence of the 3'-TALE binding region can be appropriately designed depending on the DSB site. The 3'-TALE binding region and the 5'-TALE binding region function as a pair, sandwiching the DSB site, but the nucleotide sequence and / or nucleotide length of the 3'-TALE binding region and the 5'-TALE binding region may be identical to or different from each other.

[0052] (1-2) Nuclease Domain The structure of the nuclease domain is similar to that of the Left-TALEN expression vector. The nuclease domain in the Right-TALEN expression vector may be the same as or different from that in the Left-TALEN expression vector, but it is preferable that they are the same. In principle, the type of nuclease should be the same as that in the Left-TALEN expression vector.

[0053] (2) Promoter The promoter configuration is the same as that of the Left-TALEN expression vector. The promoter in the Right-TALEN expression vector may be the same as or different from that of the Left-TALEN expression vector, but is preferably the same.

[0054] 1-3-3. Donor Vector As used herein, a "donor vector" is a vector that is inserted into the host silkworm genome by genome editing technology to express a Fib H gene derived from another silkworm.

[0055] (Configuration) The donor vector contains a 5' TALE corresponding region, a 3' TALE corresponding region, a 5' homologous region, a 3' homologous region, and other silkworm fibroin genes as components. Each component will be explained below.

[0056] (1) 5'-side TALE-corresponding region. As used herein, the term "5'-side TALE-corresponding region" refers to a target region that a TALEN protein specifically recognizes and binds to via a TALE domain. In order for all or part of a donor vector to be knocked into the silkworm genome using genome editing technology, it must be linearized upon insertion. The 5'-side TALE-corresponding region essentially performs the same function as the TALE-binding region on the genome. The 5'-side TALE-corresponding region is the upstream region of the pair of TALE-corresponding regions across the DSB site on the donor vector relative to the insertion direction of the fibroin gene of the other silkworm to be knocked in. Therefore, the 5'-side TALE-corresponding region does not necessarily have the same nucleotide sequence as the 5'-side TALE-binding region on the genome. For example, unlike the 5'-side TALE-binding region recognized by the Left-TALEN protein, the 5'-side TALE-corresponding region may have a sequence recognized by either the Left-TALEN protein or the Right-TALEN protein. Furthermore, if the 5' TALE corresponding region is located on the coding sequence of the protein to be expressed in silkworms or on a regulatory sequence such as a promoter inserted as a selective element, it will be subject to the constraints of that sequence.

[0057] The base length of the base sequence constituting the 5' TALE corresponding region may be 11 to 31 bases, 12 to 30 bases, 13 to 28 bases, 14 to 26 bases, or 15 to 25 bases.

[0058] (2) 3'-side TALE-corresponding region As used herein, the "3'-side TALE-corresponding region," like the 5'-side TALE-corresponding region, refers to a target region that a TALEN protein specifically recognizes and binds to via a TALE domain. The 3'-side TALE-corresponding region also performs the same function as the TALE-binding region on the genome, and is located downstream of the TALE-corresponding regions paired across the DSB site on the donor vector with respect to the insertion direction of the fibroin gene of another silkworm to be knocked in. Therefore, the 3'-side TALE-corresponding region does not necessarily have the same base sequence as the 3'-side TALE-binding region on the genome. For example, unlike the 3'-side TALE-binding region recognized by the Right-TALEN protein, the 3'-side TALE-corresponding region may have a sequence recognized by either the Left-TALEN protein or the Right-TALEN protein.

[0059] The base length of the base sequence constituting the 3' TALE corresponding region may be 11 to 31 bases, 12 to 30 bases, 13 to 28 bases, 14 to 26 bases, or 15 to 25 bases.

[0060] In the donor vector, the 3' TALE corresponding region functions as a pair with the 5' TALE corresponding region.

[0061] (3) 5' Homology Region As used herein, the term "5' homology region" refers to a region required for knocking in the bFib H gene in a donor vector to a predetermined location in the silkworm genome. The region consists of a nucleotide sequence identical or homologous to the 5' nucleotide sequence of the insertion site on the silkworm genome, i.e., the DSB site. The length of the nucleotide sequence of the 5' homology region is not limited, but should be within the range that can be achieved by the nuclease activity of the dimer formed by the Left-TALEN protein and / or Right-TALEN protein bound to the 5' TAL-corresponding region or the 3' TALE-corresponding region. The length of the 5' homology region varies depending on the TALEN used, but may be, for example, 5 to 15 bases, 6 to 14 bases, 7 to 13 bases, 8 to 12 bases, or 9 to 11 bases. The length is preferably 8 to 10 bases. In principle, the base length of the 3' homologous region described below is the same or equivalent to that of the corresponding 5' homologous region, so the base length of the spacer sequence consisting of the 5' homologous region and the 3' homologous region between the 5' and 3' TALEN-compatible regions is twice the length of the 5' homologous region, for example, 10 to 30 bases, 12 to 28 bases, 14 to 26 bases, 16 to 24 bases, or 18 to 22 bases, preferably 16 to 20 bases.

[0062] All or part of the donor vector is knocked into the silkworm genome via the 5' homologous region and the 3' homologous region described below by homology-directed repair (HDR) (microhomology-mediated end joining (MMEJ)) or nonhomologous end joining (NHEJ) between the DSB ends of the genome and the donor.

[0063] (4) 3' Homology Region. As used herein, the "3' homology region" refers to a region required for knocking in the bFib H gene in a donor vector to a predetermined location in the silkworm genome, and functions in conjunction with the 5' homology region. The 3' homology region consists of a nucleotide sequence identical to or homologous to the nucleotide sequence adjacent to the insertion site on the silkworm genome, i.e., the 3' side of the DSB site. The length of the nucleotide sequence of the 3' homology region is not limited, but should be within the range that allows the nuclease activity of the dimer formed by the Left-TALEN protein and / or Right-TALEN protein bound to the 5' TALE corresponding region and the 3' TALE corresponding region. For example, the length may be 5 to 15 bases, 6 to 14 bases, 7 to 13 bases, 8 to 12 bases, or 9 to 11 bases. Preferably, the length is 8 to 10 bases.

[0064] (5) Fibroin Gene of Other Silkworms A "fibroin gene of other silkworms" is a gene encoding the Fib protein of a silkworm other than Bombyx mori. It may be the full-length or a portion of a single species of Fib gene, or a Fib gene formed by linking the full-length base sequences of multiple species of Fib genes, a full-length base sequence and a partial base sequence, or partial base sequences of multiple species of Fib genes. The Fib gene of other silkworms may be any of the Fib H gene, Fib L gene, and p25 gene. The Fib H gene is preferred. The type of other silkworm is not limited, but is preferably a bagworm. Therefore, although not limited, the bagworm fibroin H chain gene is particularly preferred as the Fib gene of other silkworms.

[0065] The "bagworm fibroin H chain gene (bFib H gene)" is a gene that encodes the bagworm fibroin H chain protein. The structure of the bagworm fibroin H chain protein is explained below.

[0066] The "bagworm fibroin H chain protein (bFib H protein)" may be either a wild-type fibroin H chain protein or a modified fibroin H chain protein, preferably a modified fibroin H chain protein.

[0067] The term "modified bagworm fibroin H chain protein (m-bFib H protein)" used herein refers to m-Fib H, which is based on the partial amino acid sequence of the Fib H protein of the giant silkworm moth (E. japonica) revealed by transcriptome analysis using a next-generation DNA sequencer, and includes m-Fib H in which missing amino acid sequence information has been supplemented by reference to the corresponding amino acid sequence information of silkworm Fib H.

[0068] The structure of the m-bFib H protein herein is not limited, and may include, for example, a structure including, as basic components from the N-terminus, an N-terminal region, a central region, and a C-terminal region, as shown in Figure 2A.

[0069] As used herein, the term "N-terminal region" refers to a selective amino acid region located on the N-terminal side of the central region described below in the amino acid sequence constituting the m-bFib H protein.

[0070] As used herein, the term "C-terminal region" refers to a selective amino acid region located on the C-terminal side of the central region described below in the amino acid sequence constituting the m-bFib H protein.

[0071] As used herein, the term "central region" refers to a region that exhibits the physical properties of m-bFib H protein, and is composed of three or more identical and / or different repeat units linked together.

[0072] As used herein, the term "repeated unit" refers to a unit consisting of a total of 120 to 178 amino acids, containing multiple G / A units and one alanine cluster.

[0073] A "G / A unit" is a unit consisting of two amino acid residues, a glycine (Gly: G) residue and an alanine (Ala: A) residue, and is composed of a glycine residue-alanine residue (GA) or an alanine residue-glycine residue (AG). The majority of repeating units are composed of G / A units, and each unit contains 30 or more, 35 or more, or 40 or more, or 60 or less, 55 or less, or 50 or less G / A units.

[0074] An "alanine cluster" (often referred to herein as an "Ala cluster") is a subunit of consecutive alanine (Ala) residues, located at the N-terminus of a repeating unit. One Ala cluster contains 15 to 25 alanine residues, and may contain one glutamic acid or glutamine residue in the center of the Ala cluster (for example, at position 10 from the N-terminus of the Ala cluster). Specific examples of Ala clusters in m-bFib H protein include the amino acid sequences shown in SEQ ID NOs: 3 and 4 (AAAAAAAAAEAAAAAAAAAAAA and AAAAAAAAAQAAAAAAAAA, respectively).

[0075] Furthermore, the repeat unit may contain a non-G / A portion containing 5 to 7 amino acid residues other than glycine and alanine residues. The amino acid sequence of the non-G / A portion is not limited. Specific examples of the amino acid sequence of the non-G / A portion include the amino acid sequences shown in SEQ ID NO: 5 (YGSALNS), SEQ ID NO: 6 (SALNS), and SEQ ID NO: 7 (TSVVYV), which are composed of serine (Ser: S), valine (Val: V), and tyrosine (Tyr: Y) residues.

[0076] The amino acid sequences constituting the repeat units of the m-bFib H protein herein are not particularly limited as long as they satisfy the above-mentioned requirements for each component. Specific examples include, but are not limited to, the amino acid sequences shown in SEQ ID NOS: 8 to 16 in Table 1.

[0077]

[0078] In the m-bFib H protein, each repeat unit is linked to another directly or via any other linker sequence consisting of 1 to 30 amino acids, 1 to 20 amino acids, or 1 to 10 amino acids.

[0079] Specific examples of the base sequence of the modified bagworm fibroin H chain gene encoding the repeat units of the m-bFib H protein include the base sequences shown in SEQ ID NOs: 17 to 25 in Table 2 below, which encode repeat units Nos. 1 to 9 listed in Table 1, respectively.

[0080]

[0081] (Arrangement order) In the donor vector, the arrangement order of each component is, based on the 5' to 3' direction of the sense strand of another silkworm fibroin gene contained in the donor vector, such that the 5' homologous region and the 3' homologous region are arranged adjacent to each other across the DSB site between the two TALE corresponding regions. The order is from the 5' side to the 3' homologous region - 5' homologous region. The two TALE corresponding regions are arranged in the order of 5' TALE corresponding region and 3' TALE corresponding region based on the 5' to 3' direction, and each has a sequence recognized by either the Left-TALEN protein or the Right-TALEN protein. Specifically, based on the 5' to 3' direction, the order is 5'-side TALE corresponding region, 3'-side homologous region, 5'-side homologous region, and 3'-side TAL corresponding E region, and examples include (i) when the Left-TALEN protein recognizes the 5'-side TALE corresponding region and the 3'-side TALE corresponding region, (ii) when the Left-TALEN protein recognizes the 5'-side TALE corresponding region and the Right-TALEN protein recognizes the 3'-side homologous region, (iii) when the Right-TALEN protein recognizes the 5'-side TALE corresponding region and the Left-TALEN protein recognizes the 3'-side homologous region, and (vi) when the Right-TALEN protein recognizes the 5'-side TALE corresponding region and the 3'-side TALE corresponding region.

[0082] 2. Method for producing genome-modified silkworms 2-1. Overview A second aspect of the present invention is a method for producing genome-modified silkworms. This production method can produce genome-edited silkworms that produce a chimeric Fib protein containing a bagworm-derived fibroin protein and a silkworm-derived fibroin protein in their silk glands.

[0083] The method for producing a genome-modified silkworm of the present invention includes, as essential steps, a nucleic acid introduction step, a transformant selection step, and a genome-insertion individual selection step. Each step will be described below.

[0084] 2-2-1. Nucleic acid introduction step The "nucleic acid introduction step" is a step of introducing Left-TALEN mRNA or Left-TALEN expression vector, Right-TALEN mRNA or Right-TALEN expression vector, and donor vector into silkworm eggs.

[0085] The configurations of the Left-TALEN expression vector and the Right-TALEN expression vector are similar to those of the Left-TALEN expression vector and the Right-TALEN expression vector described in the first embodiment, respectively. However, the Left-TALEN expression vector and the Right-TALEN expression vector of this embodiment contain promoters that are expressed in early embryos. Therefore, these expression vectors express the Left-TALEN protein and the Right-TALEN protein in early embryos.

[0086] "Left-TALEN mRNA" and "Right-TALEN mRNA" are mRNAs containing a left-TALEN region and a right-TALEN region, respectively. The configurations of the left-TALEN region and the right-TALEN region are similar to those of the left-TALEN region and the right-TALEN region described in the first embodiment.

[0087] When introducing Left-TALEN mRNA or Left-TALEN expression vector and Right-TALEN mRNA or Right-TALEN expression vector into silkworm eggs, the combination is not limited. All four types may be introduced, or any three types selected may be introduced. Alternatively, a combination of Left / Right-TALEN mRNA, a combination of Left / Right-TALEN expression vector, a combination of Left-TALEN mRNA / Right-TALEN expression vector, or a combination of Left-TALEN expression vector / Right-TALEN mRNA may be used.

[0088] The configuration of the donor vector is similar to that of the donor vector described in the first embodiment.

[0089] The expression vector and / or mRNA can be introduced into silkworm eggs by methods known in the art. For example, the method of Tamura et al. (Tamura T. et al., 2000, Nature Biotechnology, 18, 81-84) can be used. Specifically, the expression vector or mRNA is diluted with a solvent such as water or a buffer to an appropriate concentration to prepare an administration solution.

[0090] Nucleic acid is introduced into silkworm fertilized eggs within six hours of laying by microinjection. Injection is typically performed using a special injection device that utilizes air pressure, although this is not limited to this method. For example, the method described in Patent No. 1654050 or the method of Tamura et al. (Tamura T, et al., 2007, J. Insect. Biotechnol. Sericol. 76: 155-159) may be used. The amount of nucleic acid to be introduced is not particularly limited and may be determined appropriately depending on the type, properties, and purpose of the nucleic acid. It is usually 1 nL to 5 nL.

[0091] 2-2-2. Transformant Selection Step The "transformant selection step" is a step of selecting transformants containing the donor vector from silkworms after the nucleic acid introduction step. The method for selecting transformants is not limited as long as it is a method known in the art. For example, when the donor vector contains a marker gene, the desired transformant can be easily selected based on the expression of the marker gene.

[0092] A "marker gene" is a polynucleotide consisting of a base sequence that encodes a marker protein, also called a selectable marker.

[0093] A "labeled protein" is a protein that can confer new traits not present in the host silkworm upon expression of a marker gene, and includes enzymes, fluorescent proteins, pigment-synthesizing proteins, and luminescent proteins. Based on the activity of the labeled protein, it is possible to identify transformants that carry the introduced nucleic acid. Here, "based on activity" means based on the results of activity detection. Activity detection may be performed by directly detecting the activity of the labeled protein itself, or indirectly via metabolites generated by the protein activity. Detection may be performed by chemical detection (including enzyme reaction detection), physical detection (including behavioral analysis detection), or sensory detection by the detector (including detection by sight, touch, smell, hearing, or taste).

[0094] The type of labeled protein is not particularly limited, as long as its activity can be detected by a method known in the art. Preferably, the labeled protein is low in invasiveness to the host carrying the transformant identification marker, i.e., the transformant, upon detection. Examples include fluorescent proteins, pigment-synthesizing proteins, luminescent proteins, exocrine proteins, and proteins that control external morphology. Fluorescent proteins and pigment-synthesizing proteins are particularly preferred because they can be visually detected under specific conditions without changing the external morphology of the transformant, are very low in invasiveness to the transformant, and allow for easy identification and selection of transformants.

[0095] As used herein, the term "fluorescent protein" refers to a protein that emits fluorescence of a specific wavelength when irradiated with excitation light of a specific wavelength. It may be either a natural or non-natural type. Furthermore, there are no particular limitations on the excitation wavelength or fluorescence wavelength. Specific examples include CFP, RFP, DsRed (including derivatives such as DsRed-monomer), YFP, PE, PerCP, APC, GFP (including derivatives such as EGFP), and the like.

[0096] As used herein, a "pigment synthesis protein" refers to a protein, typically an enzyme, involved in the biosynthesis of a pigment. The term "pigment" as used herein refers to a low-molecular-weight compound or peptide capable of imparting a pigment to a transformant, regardless of type. Preferably, the pigment is one that appears as the external color of the individual. Examples include melanin-based pigments (including dopamine melanin), ommochrome-based pigments, and pteridine-based pigments.

[0097] 2-2-3. Genome-insertion individual selection process The "genome-insertion individual selection process" is a process for selecting transformants in which another silkworm fibroin gene has been inserted (knocked in) at the desired position in the silkworm genome. Methods for confirming that the other silkworm fibroin gene has been accurately knocked in are not limited to methods known in the art. Examples include Southern hybridization using genomic DNA prepared from the transformant obtained in the transformant selection process and a control silkworm to which no nucleic acid has been introduced in the nucleic acid introduction process, and a probe consisting of a base sequence specific to the other silkworm fibroin gene; amplification of a region containing the insertion site (DSB site) on the genome by nucleic acid amplification, and confirmation of the insertion site and insertion direction by sequencing the resulting nucleic acid fragment. This process allows the selection of the desired genome-modified silkworm.

[0098] 3. Genome-modified silkworms 3-1. Overview A third aspect of the present invention is a genome-modified silkworm. The genome-modified silkworms of the present invention contain a bagworm-derived fibroin H chain gene in their silkworm genome and are capable of producing the bagworm fibroin H chain protein in their silk glands. The genome-modified silkworms of the present invention can spin chimeric silk containing a chimeric fibroin protein composed of a silkworm-derived fibroin protein and a bagworm fibroin H chain protein.

[0099] 3-2. Configuration The genome-modified silkworm of this embodiment is a silkworm obtained by the method for producing a genome-modified silkworm described in the second embodiment, when the other silkworm fibroin contained in the donor vector is the m-bFib H gene. This silkworm contains the m-bFib H gene in its genome, preferably as a chimeric Fib gene with an sFib gene. In the case of the chimeric Fib gene, the m-bFib H gene may be inserted anywhere in the coding region of the sFib gene between the 5' end and the 3' end (excluding the stop codon). The sFib gene may be the sFib H gene, sFib L gene, or sp25 gene, but is preferably the sFib H gene or the sFib L gene.

[0100] The genome modified silkworm of this embodiment can produce m-bFib H protein in the posterior silk gland during the larval stage, particularly during the late final instar stage. At this time, it is preferable to produce a chimeric Fib protein with an sFib protein.

[0101] The genome modified silkworm of this embodiment can spin chimeric silk containing a chimeric Fib protein with an m-bFib H protein, preferably an sFib protein, during the larval stage, particularly the late final instar.

[0102] The method for producing chimeric silk threads of m-bFib H protein and sFib protein from the genome-modified silkworms of this embodiment may be similar to conventional methods for producing silk threads from silkworms. For example, the genome-modified silkworms may be allowed to spin cocoons, and chimeric silk threads may be prepared from the cocoons. According to the production method of the present invention, chimeric silk threads of bagworm silk threads and silkworm silk threads having the physical properties of bagworm silk threads can be mass-produced using silkworm silk production equipment, etc.

[0103] The method for producing chimeric silk thread includes the essential steps of rearing, spinning, harvesting, and reeling.

[0104] (1) Rearing Step The "rearing step" refers to the step of rearing the genome-modified silkworms of this embodiment. Rearing methods for genome-modified silkworms may be carried out in accordance with silkworm rearing techniques known in the art. For example, see "Silkworm Species General Theory" by Takami Takeo, published by the National Silkworm Seed Association. Natural leaves of food-eating tree species, such as leaves of the genus Morus, may be used as feed, or artificial feed such as Silkmate L4M or Silkworm Species for 1st to 3rd Instars (Nihon Nosan Kogyo). Artificial feed is preferred because it suppresses disease occurrence, allows for stable feeding of quality and quantity, and allows for sterile rearing as needed. An example of a simple rearing method for genome-modified silkworms is described below.

[0105] Eggs laid by an appropriate number of inbred, genome-modified female silkworms (e.g., 4-10 individuals) are used for breeding. The hatched larvae are transferred from the egg-laying mat to a container lined with dry-proof paper (paraffin-coated paper) to serve as a silkworm bed. Artificial feed such as Silkmate is laid on the dry-proof paper and fed. As a general rule, the feed is changed once for the first and second instars and once to three times for the third instar. If there is a large amount of leftover old feed, it is removed to prevent spoilage. For rearing the fourth- to fifth-instar mature silkworms, they are transferred to a large container, and the number of individuals per container is adjusted appropriately. Depending on the humidity and conditions inside the container, the container may be covered with dry-proof paper, acrylic, or mesh lids. The rearing temperature is 25-28°C throughout all instars.

[0106] (2) Cocoon-spinning process The "cocoon-spinning process" is a process in which the genome-modified silkworms of this embodiment are allowed to spin cocoons. "Cocoon-spinning" refers to the process in which final-stage (fifth-stage) silkworms form cocoons for pupation.

[0107] This process can be carried out essentially using the known cocoon-spinning method for silkworms. For example, this process can be achieved by collecting mature silkworms on the 6th to 8th day of their final instar stage and transferring them to a cage. Transferring the silkworms to a cage can be done at 25-28°C. The genome-modified silkworms then form cocoons in the cage.

[0108] (3) Cocoon harvesting process The "cocoon harvesting process" is the process of scraping and collecting the cocoons from the shack after the cocoon spinning process. This process also includes the removal of fluff that has adhered to the periphery of the cocoon. Cocoon harvesting can be carried out 6 to 8 days after hatching. Cocoon harvesting can be done manually, but it is more convenient to use a dedicated cocoon harvesting device. In addition to fluff removers that only remove fluff, fully automatic cocoon harvesting fluff removers can also be used, which scrape the cocoons from the shack and remove the fluff.

[0109] (4) Reeling Process The "reeling process" is the process of reeling chimeric silk thread from the cocoons recovered in the cocoon harvesting process. "Reeling" refers to the production of raw silk from cocoons. The recovered cocoons are "cocoon boiled" by submerging them in water at around 95°C to make them easier to unravel, and then "cording" is performed by using a cording broom to pull out the tangled cocoon threads from the surface of the cocoon. Next, "cording" is performed by extracting a single correct thread from the corded cocoon, and the thread is then reeled. These processes can be performed manually, but it is preferable to use an automatic silk-reeling machine, which is a device dedicated to reeling. Through the above processes, chimeric silk thread can be produced as raw silk.

[0110] 4. Chimeric Silk 4-1. Overview The fourth aspect of the present invention is a chimeric silk. The chimeric silk of this aspect comprises a chimeric Fib protein in which an sFib H protein or an sFib L protein is linked to a bFib H protein. The chimeric silk of this aspect can be obtained as silk spun by the genome-modified silkworm described in the third aspect.

[0111] 4-2. Composition The chimeric silk of the present invention is composed of Fib H protein, Fib L protein, and p25 protein, similar to ordinary silk, particularly silk from silkworms. After spinning, the chimeric silk before degumming further contains sericin protein, but this protein is removed by the degumming treatment.

[0112] The chimeric silk of the present invention is characterized in that the Fib H protein and / or Fib L protein has a chimeric Fib protein structure in which an m-bFib H protein is linked at any position.

[0113] Example 1: Preparation of Donor Vector (Purpose) A donor vector for use in the genome-edited silkworm production kit of the present invention was prepared. (Method) A gene (SEQ ID NO: 28) encoding a bagworm Fib H protein with 12 repeat units (SEQ ID NO: 27) was prepared based on the sequence information encoding a modified bagworm Fib H protein consisting of the amino acid sequence shown in SEQ ID NO: 26 in Figure 2. Furthermore, the genome editing donor vector (pBac[3XP3-DsRed2afm]E1LLL-EGFP: obtained from the National Agriculture and Food Research Organization) was replaced from the sFib L promoter sequence to the EGFP gene with the TALEN target sequence shown in SEQ ID NO: 29 (TAATGCTCAAAGATATATGCCAGCCAGGTGCACAAGCATTCACGTCTAAATACGAA) and the bagworm Fib H gene located 3' to it, and the DsRed2 gene was further replaced with the EGFP gene to construct the donor vector pDVL-MMHX4 shown in Figure 3.

[0114] Example 2: Production of genome-modified silkworms (Objective) The desired genome-modified silkworms were produced based on the method for producing genome-modified silkworms according to the second aspect of the present invention. (Method and Results) The w1-pnd strain was used as the host silkworm. Silkworms were reared at 29°C up to the fourth instar and at 25°C for the fifth instar, with a photoperiod of 12 hours light and 12 hours dark. Artificial feed (Silkmate original silkworm species for 1st to 3rd instars: Nippon Nosan Kogyo Co., Ltd.) was provided.

[0115] Eggs were injected within 6 hours of oviposition. Injection was performed using conventional methods, using solutions prepared to give 500 ng / μL of donor vector and 25 ng / μL of TALEN mRNA. After injection, the eggs were left at 25°C until hatching. The hatched eggs were reared to adulthood in the same manner as above. The resulting adults were designated G0 (injection generation). G0 individuals were mated between siblings, and the remaining G0 individuals were mated with the parent strain (w1-pnd) used for injection. After mating, female individuals were allowed to lay eggs, and the resulting G1 (first generation after injection) eggs were placed at 25°C and then protected at 5°C for two days.

[0116] Eleven days before the expected hatch date, the G1 eggs were placed at 25°C (released) to allow embryonic development to begin. Screening for transformants was performed on eggs 5 to 7 days after release. Eggs that showed visible green fluorescence were selected as transformed eggs.

[0117] Larvae hatched from the transformed eggs were reared and harvested 7 days after hatching. The pupae were removed from the cocoon and allowed to emerge. At this time, one leg was collected from each adult silkworm for genome extraction to confirm the genome sequence. Individual moths were managed by matching the moths with their cocoon shells. The adult silkworms were kept refrigerated in an unmated state until confirmation of knock-in by PCR and analysis of cocoon shell proteins by SDS-PAGE, as described below, were completed.

[0118] To identify individuals with successful knock-in, PCR was performed on the 5' and 3' ends of the donor vector inserted into the genome using primers that specifically bind to the silkworm Fib gene and the donor vector, respectively, to amplify only knock-in individuals. After adult silkworms (Bombyx mori) emerged from the collected legs, one leg was collected and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (QIAGEN) according to the attached protocol. PCR was performed using the extracted genomic DNA as a template under standard conditions using a KOD FX Neo (TOYOBO). The primers used were as follows: (5' side of insertion) BmFib-LF: CAGACATATAAGAGCTACGA (SEQ ID NO: 30) MMFib-HR: TGATATTCGTCAGTGTCTGCT (SEQ ID NO: 31) (3' side of insertion) SV40F: TGGTTTGTCCAAACTCATCA (SEQ ID NO: 32) BmFib-LR: CACAATTTGCATAAAATGTC (SEQ ID NO: 33) The nucleotide sequences of the obtained PCR products were determined to confirm that the donor vector had been correctly inserted into the precise position of the silkworm Fib gene.

[0119] From individuals that appeared to have the donor vector correctly inserted based on the above base sequence, a portion of the cocoon shell was dissolved in 9M lithium bromide and SDS-PAGE of the silk proteins was performed, revealing a protein of the expected size for a chimeric Fib protein between silkworms and bagworms. These individuals were crossed and bred, and then the knock-in was confirmed by Western blotting. Homozygous individuals with two copies of the donor vector in their genome, heterozygous individuals with one copy, and wild-type individuals without the donor vector were separated from each other by SDS-PAGE in the same manner as above, and reacted with an anti-Fib-L antibody that binds to the N-terminal region of the silkworm Fib L protein. The antibody was labeled with HRP (horseradish peroxidase), and detection was performed using Amersham TM ECL TM Prime (Cytiva) was used. The cocoon shell proteins from homozygous and heterozygous individuals showed a band (arrow) at the same position as the chimeric Fib protein in the SDS-PAGE analysis. On the other hand, the cocoon shell proteins from heterozygous and wild-type individuals showed a band (arrowhead) at the position of Fib L in wild-type silkworms. Based on the above, the silkworm strain obtained in this example was determined to be a genome-modified silkworm capable of producing chimeric silk.

[0120] Example 3: Analysis of the physical properties of chimeric silk thread (Objective) To analyze the physical properties of the chimeric silk thread spun by the genome-modified silkworms produced in Example 2. (Method) Cocoons from the genome-modified silkworms produced in Example 2 were boiled using standard methods and reeled using a multi-reel reeling machine (Harada Co., Ltd.). The resulting raw silk was measured every 30 reels (33.75 m) using a measuring instrument, and left to stand in a room at a temperature of 20°C and humidity of 65% for at least 24 hours. The fineness was determined from the weighed weight. To analyze the toughness of the resulting chimeric silk thread, a sample of the reeled raw silk closest to the average fineness of the control was used. Silkworm silk prepared under the same conditions was used as a control. Breaking strength and elongation were measured 50 times per test using a Tensilon universal testing machine (RTG-1210, A&D Co., Ltd.), and toughness was calculated from the area under the SS curve for the chimeric and silkworm silks. Toughness refers to the work (energy) required to break and is expressed as the area under the stress-strain curve. Generally, a higher value indicates greater resistance to breakage. (Results) The results showed that the toughness of the chimeric silk was 1.16 times greater than that of the control silkworm silk. This indicates that the chimeric silk, a combination of bagworm silk and silkworm silk spun by the genome-modified silkworms produced in this invention, is less likely to break than conventional silkworm silk. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

1. A kit for producing genome-modified silkworms that produces chimeric fibroin proteins containing fibroin proteins derived from silkworms and fibroin proteins derived from one or more other species of silkworms, The aforementioned preparation kit includes a Left-TALEN expression vector, a Right-TALEN expression vector, and a donor vector. The Left-TALEN expression vector includes a Left-TALEN coding region. The Left-TALEN coding region codes for a Left-TALE domain that recognizes and binds to the nucleotide sequence of the 5' TALE binding region located near the 5' side of the insertion site of the other silkworm fibroin gene in the silkworm fibroin gene, and a nuclease domain downstream thereof. The Right-TALEN expression vector includes a Right-TALEN coding region. The Right-TALEN coding region encodes a Right-TALE domain that recognizes and binds to the nucleotide sequence of the 3' TALE binding region located near the 3' side of the insertion site of the other silkworm fibroin gene in the silkworm fibroin gene, and a nuclease domain downstream thereof. The donor vector includes a 5' TALE-corresponding region, a 3' TALE-corresponding region, a 5' homologous region, a 3' homologous region, and the fibroin gene derived from the other silkworm. The aforementioned kit.

2. The donor vector comprises a 5' side TALE-corresponding region, a 3' side homologous region, a 5' side homologous region, and a 3' side TALE-corresponding region, as described in claim 1.

3. The production kit according to claim 1 or 2, wherein the fibroin protein derived from the other silkworm is a fibroin H chain protein.

4. The manufacturing kit according to claim 1 or 2, wherein the other silkworm is a bagworm.

5. The bagworm fibroin H chain protein is a modified fibroin H chain protein comprising three or more identical and / or different repeat units linked together, The repeating unit contains 30 or more G / A units, each consisting of two amino acid residues: a glycine residue and an alanine residue. It also contains an alanine cluster at its N-terminus, comprising 15 to 25 alanine residues, and totaling 120 to 178 amino acids. The manufacturing kit according to claim 4.

6. The alanine cluster comprises the amino acid sequence shown in SEQ ID NO: 3 or 4, according to claim 5.

7. The manufacturing kit according to claim 5, wherein the repeating unit is one or more amino acid sequences selected from those shown in sequence numbers 8 to 16.

8. The production kit according to claim 4, wherein the gene encoding the mucronae fibroin H chain protein consists of one of the base sequences shown in Sequence ID No. 17 to 25.

9. A method for producing genome-modified silkworms that produces a chimeric fibroin protein containing fibroin protein derived from silkworms and fibroin protein derived from one or more other species of silkworms, A nucleic acid introduction process for introducing left-TALEN mRNA or left-TALEN expression vector, right-TALEN mRNA or right-TALEN expression vector, and donor vector into silkworm eggs. A transformant selection step in which a transformant containing a fibroin gene derived from another silkworm is selected from the silkworm after the nucleic acid introduction step, and Genome insertion individual selection process: Selecting individuals from the aforementioned transformants in which the other silkworm fibroin gene has been inserted at the desired location in the silkworm genome. Includes, The Left-TALEN mRNA includes a Left-TALE region. The Left-TALE region encodes a Left-TAL domain that recognizes and binds to the nucleotide sequence of the 5' TAL binding region at the insertion site of the other silkworm fibroin gene in the silkworm fibroin gene, and a nuclease domain downstream thereof. The Left-TALEN expression vector includes a promoter and the Left-TALEN region located under its expression control. The aforementioned Right-TALEN mRNA includes a Right-TALE region. The Right-TALE region encodes a Right-TAL domain and a downstream nuclease domain in the silkworm fibroin gene that recognize and bind to the base sequence of the 3' TAL binding region at the insertion site of the other silkworm fibroin gene. The Right-TALEN expression vector includes a promoter and the Right-TALEN region arranged under its expression control. The donor vector includes a 5' TAL-corresponding region, a 3' TAL-corresponding region, a 5' homologous region, a 3' homologous region, and other silkworm fibroin genes. The aforementioned manufacturing method.

10. The manufacturing method according to claim 9, wherein the donor vector is arranged in the order of 5' side TALE corresponding region, 3' side homologous region, 5' side homologous region, and 3' side TALE corresponding region from the 5' side, with reference to the sense strand direction of the other silkworm fibroin gene.

11. The manufacturing method according to claim 9 or 10, wherein the fibroin protein derived from the other silkworm is a fibroin H chain protein.

12. The manufacturing method according to claim 9 or 10, wherein the other silkworm is a bagworm.

13. The bagworm fibroin H chain protein is a modified fibroin H chain protein comprising three or more identical and / or different repeat units linked together, The repeating unit contains 30 or more G / A units, each consisting of two amino acids: a glycine residue and an alanine residue. It also contains an alanine cluster at its N-terminus, comprising 15 to 25 alanine residues, and has a total length of 120 to 178 amino acids. The manufacturing method according to claim 12.

14. The method for producing the product according to claim 13, wherein the alanine cluster consists of the amino acid sequence shown in SEQ ID NO: 3 or 4.

15. The manufacturing method according to claim 13, wherein the repeating unit is one or more amino acid sequences selected from the sequences shown in SEQ ID NOs: 8 to 16.

16. The manufacturing method according to claim 12, wherein the gene encoding the mucinous fibroin H chain protein consists of any one of the base sequences shown in SEQ ID NOs. 17 to 25.

17. A genetically modified silkworm that incorporates a fibroin H chain gene derived from a bagworm into its silkworm genome and produces that fibroin H chain protein in its silk gland.

18. The genome-modified silkworm according to claim 17, wherein the fibroin H chain protein derived from the bagworm is a chimeric fibroin protein with a fibroin protein derived from the silkworm.

19. A chimeric silk thread containing a chimeric fibroin protein in which a modified bagworm fibroin H-chain protein is linked to any position of the silkworm fibroin H-chain protein or L-chain protein, The modified mino fibroin H chain protein consists of three or more identical and / or different repeat units linked together. The repeating unit contains 30 or more G / A units, each consisting of two amino acid residues: a glycine residue and an alanine residue. The N-terminal side of each unit contains an alanine cluster with 15 to 25 alanine residues, resulting in a total length of 120 to 178 amino acids. The aforementioned chimeric silk thread.

20. The chimeric silk yarn according to claim 19, wherein the alanine cluster consists of the amino acid sequence shown in SEQ ID NO: 3 or 4.

21. The chimeric silk yarn according to claim 19 or 20, wherein the repeating unit is one or more selected from the amino acid sequences shown in SEQ ID NOs: 8 to 16.