Composition for preventing or treating cisplatin-resistant cancer comprising DUSP23 expression or activity inhibitor as an active ingredient

Abstract

The present invention relates to a composition for the prevention or treatment of cisplatin-resistant cancer comprising an inhibitor of DUSP23 expression or activity as an active ingredient. It was found that DUSP23 expression is upregulated in cell clusters exhibiting characteristics of cancer stem cells, and that knocking down DUSP23 significantly reduces cell cluster formation as well as decreases the expression of SOX2, a major stem cell marker. Furthermore, DUSP23 expression was increased in lung cancer cells that had developed cisplatin resistance, and it was confirmed that the downregulation of DUSP23 inhibits self-renewal and invasive capabilities during the induction of cancer cell death. In addition, it was confirmed that DUSP23 plays an important role in promoting cancer stem cell characteristics through SOX2 expression. In conclusion, it has been shown that targeting DUSP23 can be a promising therapeutic strategy to overcome anticancer drug resistance in lung cancer, and the composition of the present invention is expected to be usefully utilized as a treatment for lung cancer cells with cisplatin resistance.

Description

Technology Field

[0001] The present invention relates to a composition for the prevention or treatment of cisplatin-resistant cancer comprising a DUSP23 expression or activity inhibitor as an active ingredient. Background Technology

[0002] In cancer treatment regimens, the administration of anticancer drugs is a crucial therapeutic method for eliminating very small cancer tissues that are difficult to observe with the naked eye after surgical removal of the tumor, as well as cancer cells that have metastasized from the primary site to other tissues. However, depending on the type of cancer, there may be cases where cancer cells develop resistance to specific anticancer drugs or acquire drug resistance when a particular drug is administered over a long period, rendering the anticancer effect ineffective.

[0003] Cisplatin is known to be highly effective in treating various types of cancer, such as breast cancer, bladder cancer, stomach cancer, and cervical cancer. Cisplatin is a heavy metal compound containing platinum, in which two chlorine atoms and two ammonia molecules are bonded in a cis-type configuration around a central platinum atom. It inhibits DNA synthesis by binding to two adjacent guanines on the DNA strand to form interstrand crosslinks. In other words, it is known to exhibit an anticancer effect by attaching to the DNA double helix structure present in the nucleus of cancer cells, inhibiting DNA replication, thereby suppressing cancer cell growth and proliferation, and eliminating cancer cells.

[0004] However, although cisplatin is a highly effective anticancer drug against various types of cancer, recent studies indicate that resistance is causing increasing clinical problems. While there are various hypotheses regarding the reasons for cisplatin resistance, the general consensus is that it arises from a decrease in cisplatin uptake or an increase in efflux, or that various genes are involved. In particular, two types of proteins, MDR and MRP, have been known to be involved in cisplatin resistance.

[0005] In other words, it has been reported that in tumor cells resistant to cisplatin, the expression of the MRP2 protein increases, and that the cell's resistance to cisplatin is achieved by MRP2 releasing glutathione-conjugated cisplatin out of the cell, thus confirming that proteins other than MRP2 may also contribute to cisplatin resistance. Additionally, genes such as c-ras, c-fos, c-abl, p53, and p73 have been reported to be associated with resistance to cisplatin.

[0006] Since cisplatin was first approved by the U.S. Food and Drug Administration (FDA) in 1978, it has been an important weapon in the fight against various cancers, including testicular, breast, ovarian, lung, and oral cancers, for decades. However, its clinical utility is ultimately limited by the fact that while many patients show a successful initial response, resistance to cisplatin develops in most cases, leading to tumor recurrence, and various side effects have been reported, including severe nausea and vomiting, and renal and neurotoxicity.

[0007] Nevertheless, there have been few reports of effective treatments for cancers that have developed resistance to cisplatin. Prior art literature

[0008] (Republic of Korea Published Patent) No. 10-2008-0086027 The problem to be solved

[0009] The object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cisplatin-resistant cancer comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0010] Another objective of the present invention is to provide a kit for the prevention or treatment of cancer resistant to chemotherapy, comprising the above composition and instructions.

[0011] Another object of the present invention is to provide a method for providing information for diagnosing resistance to cisplatin in cancer, comprising the following steps:

[0012] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a subject; and

[0013] (S2) A step of determining that resistance to cisplatin is present if the protein or mRNA expression level of the above DUSP23 is increased compared to the protein or mRNA expression level of the DUSP23 in the biological sample isolated from the control group.

[0014] Another objective of the present invention is to provide a composition for determining cisplatin-resistant cancer subjects, comprising as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0015] Another objective of the present invention is to provide a kit for determining cisplatin-resistant cancer subjects, comprising the above composition and instructions.

[0016] The present invention provides a method for screening a substance for preventing or treating resistance to cisplatin in cancer, comprising the following steps:

[0017] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in biological samples isolated from a cisplatin-resistant animal model or cell model of cancer treated with the candidate substance; and

[0018] (S2) A step of selecting the candidate substance as a substance for preventing or treating resistance to cisplatin in cancer when the protein or mRNA expression level of the DUSP23 is reduced.

[0019] Another objective of the present invention is to provide a composition for screening substances for preventing or treating resistance to cisplatin in cancer, comprising as an active ingredient a preparation for measuring protein or mRNA levels of DUSP23 (Dual-specificity phosphatase 23).

[0020] Another objective of the present invention is to provide a screening kit for substances for preventing or treating resistance to cisplatin in cancer, comprising the above composition and instructions.

[0021] Another objective of the present invention is to provide a pharmaceutical composition for inhibiting or improving resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0022] Another object of the present invention is to provide a method for characterizing responders to cisplatin for cancer treatment, the method comprising the following steps:

[0023] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a cancerous individual; and

[0024] (S2) A step of determining a responder to cisplatin if the protein or mRNA expression level of the above DUSP23 is reduced compared to the protein or mRNA expression level of the DUSP23 in the biological sample isolated from the control group.

[0025] Another objective of the present invention is to provide a composition for characterizing responders to cisplatin for cancer treatment, comprising as an active ingredient a preparation for measuring protein or mRNA levels of DUSP23 (Dual-specificity phosphatase 23).

[0026] Another objective of the present invention is to provide a kit for responder characterization for cisplatin for cancer treatment, comprising the above composition and instructions.

[0028] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art to which the present invention belongs from the description below. means of solving the problem

[0029] The present invention provides a pharmaceutical composition for the prevention or treatment of cisplatin-resistant cancer, comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0030] In one embodiment of the present invention, the cancer may be one or more selected from the group consisting of lung cancer, non-small cell lung cancer, lung adenocarcinoma, large cell carcinoma, small cell lung cancer, testicular cancer, ovarian cancer, cervical cancer, bladder cancer, head and neck cancer, esophageal cancer, mesothelioma, brain tumor, neuroblastoma, head and neck squamous cell carcinoma, and lymphoma, but is not limited thereto.

[0031] In one embodiment of the present invention, the expression or activity inhibitor may be one or more selected from the group consisting of compounds, peptides, polynucleotides, antibodies, recombinant vectors, antisense nucleotides, siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats), natural products, peptidomimetic, exosomes, ribozymes, DNAzymes, PNA (peptide nucleic acids), and aptamers, but is not limited thereto.

[0032] In one embodiment of the present invention, the composition may be administered in combination with cisplatin, but is not limited thereto.

[0033] In one embodiment of the present invention, the composition may be administered simultaneously, separately, or sequentially with cisplatin, but is not limited thereto.

[0034] In one embodiment of the present invention, the composition may enhance sensitivity to cisplatin, but is not limited thereto.

[0035] In one embodiment of the present invention, the composition may be characterized by one or more selected from the group consisting of the following, but is not limited thereto:

[0036] Reduces the protein and mRNA levels of SOX2 (SRY-Box Transcription Factor 2);

[0037] Reduces SOX2 signaling and nuclear localization; and

[0038] No effect on ALDH1 (Aldehyde Dehydrogenase 1 Family Member A1) expression.

[0039] In one embodiment of the present invention, the composition may be characterized by one or more selected from the group consisting of the following for cisplatin-resistant cancer cells, but is not limited thereto:

[0040] Reduces the formation and size of resistant cancer cell clusters;

[0041] Reduces the invasive ability and survival rate of resistant cancer cells; and

[0042] Promotes apoptosis of resistant cancer cells.

[0043] The present invention provides a kit for the prevention or treatment of cisplatin-resistant cancer comprising the above composition and instructions.

[0045] The present invention provides a method for providing information for diagnosing resistance to cisplatin in cancer, comprising the following steps:

[0046] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a subject; and

[0047] (S2) A step of determining that resistance to cisplatin is present if the protein or mRNA expression level of the above DUSP23 is increased compared to the protein or mRNA expression level of the DUSP23 in the biological sample isolated from the control group.

[0048] In one embodiment of the present invention, the biological sample may be one or more selected from the group consisting of cells, tissues, serum, blood, whole blood, plasma, urine, saliva, trachea, bone marrow, fine needle aspiration specimens, core needle biopsy specimens, and vacuum aspiration biopsy specimens, but is not limited thereto.

[0049] The present invention provides a composition for determining cisplatin-resistant cancer subjects, comprising as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0050] The present invention provides a kit for determining cisplatin-resistant cancer subjects, comprising the above composition and instructions.

[0051] In one embodiment of the present invention, the description may teach the information provision method, but is not limited thereto.

[0052] The present invention provides a screening method for a substance for preventing or treating resistance to cisplatin in cancer, comprising the following steps:

[0053] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in biological samples isolated from a cisplatin-resistant animal model or cell model of cancer treated with the candidate substance; and

[0054] (S2) A step of selecting the candidate substance as a substance for preventing or treating resistance to cisplatin in cancer when the protein or mRNA expression level of the DUSP23 is reduced.

[0055] The present invention provides a composition for screening substances for preventing or treating resistance to cisplatin in cancer, comprising as an active ingredient a preparation for measuring the protein or mRNA level of DUSP23 (Dual-specificity phosphatase 23).

[0056] The present invention provides a screening kit for substances for preventing or treating resistance to cisplatin in cancer, comprising the above composition and instructions.

[0057] In one embodiment of the present invention, the description may teach the screening method, but is not limited thereto.

[0058] The present invention provides a pharmaceutical composition for inhibiting or improving resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0059] The present invention provides a method for characterizing responders to cisplatin for cancer treatment, wherein the method comprises the following steps:

[0060] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a cancerous individual; and

[0061] (S2) A step of determining a responder to cisplatin if the protein or mRNA expression level of the above DUSP23 is reduced compared to the protein or mRNA expression level of the DUSP23 in a biological sample isolated from the control group.

[0062] The present invention provides a composition for characterizing responders to cisplatin for cancer treatment, comprising as an active ingredient a preparation for measuring the protein or mRNA level of DUSP23 (Dual-specificity phosphatase 23).

[0063] The present invention provides a kit for responder characterization for cisplatin for cancer treatment, comprising the above composition and instructions.

[0064] In one embodiment of the present invention, the description may teach the reactor characterization method, but is not limited thereto.

[0066] In addition, the present invention provides a method for treating cancer resistant to cisplatin, comprising the step of administering a composition containing an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient to an individual in need of the same in a pharmaceutically effective amount.

[0067] In addition, the present invention provides a composition comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient for the prevention or treatment of cisplatin-resistant cancer.

[0068] In addition, the present invention provides a use for manufacturing a preparation for the prevention or treatment of cisplatin-resistant cancer comprising a composition containing an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0070] In addition, the present invention provides a use for determining cisplatin-resistant cancer subjects of a composition comprising, as an active ingredient, a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0071] In addition, the present invention provides a use for preparing a preparation for determining cisplatin-resistant cancer subjects, comprising a composition containing as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0072] In addition, the present invention provides a method for treating cisplatin-resistant cancer comprising the following steps:

[0073] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a subject;

[0074] (S2) A step of determining that resistance to cisplatin is present if the protein or mRNA expression level of the DUSP23 is increased compared to the protein or mRNA expression level of the DUSP23 in a biological sample isolated from a control group; and

[0075] (S3) A step of administering a pharmaceutically effective amount of a cisplatin-resistant cancer treatment agent to a subject determined to have resistance to the above cisplatin.

[0076] In one embodiment of the present invention, the therapeutic agent may include an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23), but is not limited thereto, and refers to any substance generally administered in the art to treat cancer resistant to cisplatin.

[0078] In addition, the present invention provides a screening use for substances for preventing or treating resistance to cisplatin in cancer, comprising a composition containing as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0079] In addition, the present invention provides a use for preparing a screening agent for substances to prevent or treat resistance to cisplatin in cancer, comprising a composition containing as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0081] In addition, the present invention provides a method for inhibiting or improving resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising the step of administering a composition containing an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient in a pharmaceutically effective amount to individuals who need it.

[0082] In addition, the present invention provides a use for inhibiting or improving resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising a composition containing an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0083] In addition, the present invention provides a use for preparing a resistance-inhibiting or improving agent for reducing resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising a composition containing an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0085] In addition, the present invention provides a use for responder characterization against cisplatin for cancer treatment, comprising a composition containing as an active ingredient a preparation for measuring protein or mRNA levels of DUSP23 (Dual-specificity phosphatase 23).

[0086] In addition, the present invention provides a use for preparing a formulation for responder characterization against cisplatin for cancer treatment, comprising a composition containing as an active ingredient a formulation for measuring protein or mRNA levels of DUSP23 (Dual-specificity phosphatase 23).

[0087] In addition, the present invention provides a method for treating cancer comprising the following steps:

[0088] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a cancerous individual; and

[0089] (S2) A step of determining a responder to cisplatin if the protein or mRNA expression level of the DUSP23 is reduced compared to the protein or mRNA expression level of the DUSP23 in a biological sample isolated from the control group; and

[0090] (S3) A step of administering cisplatin in a pharmaceutically effective amount to an individual determined to be a responder to the cisplatin. Effects of the invention

[0091] According to a composition for the prevention or treatment of cisplatin-resistant cancer comprising an inhibitor of DUSP23 expression or activity as an active ingredient, DUSP23 expression is upregulated in cell clusters exhibiting characteristics of cancer stem cells, and when DUSP23 is knocked down, not only is cell cluster formation significantly reduced, but the expression of SOX2, a major stem cell marker, is also reduced. Furthermore, DUSP23 expression was increased in lung cancer cells that had developed cisplatin resistance, and it was confirmed that the downregulation of DUSP23 inhibits self-renewal and invasive capabilities during the induction of cancer cell death. In addition, it was confirmed that DUSP23 plays an important role in promoting cancer stem cell characteristics through SOX2 expression. In conclusion, targeting DUSP23 appears to be a promising therapeutic strategy for overcoming anticancer drug resistance in lung cancer, and thus the composition of the present invention is expected to be usefully utilized as a treatment for lung cancer cells with induced cisplatin resistance. Brief explanation of the drawing

[0092] Figure 1a shows the results of DUSP23 analysis from the Oncomine database, and the box plot within the graph shows the results of analyzing DUSP23 mRNA levels in LUAD compared to normal tissue obtained from the TCGA and Okayama LUAD datasets, respectively. Figure 1b shows the disease-free survival curves through Kaplan-Meier analysis, with patients with low DUSP23 expression indicated by the blue line and patients with high DUSP23 expression indicated by the red line. Figure 1c shows the results of gene set abundance analysis (GSEA) for stem pathways in TCGA-LUAD data. Figure 1d shows representative images illustrating the morphology of adherent (ADH) and suspended (SUS) A549 cells (scale bar, 250 μm). Figure 1e is a bar graph showing the mRNA expression of SOX2, ALDH1, and DUSP23 in ADH and SUS A549 cells via RT-qPCR, and the significance of the differences in the result data was analyzed using Student's t-test. Also shown are the experimental results showing the protein expression of DUSP23. Figure 2a shows the results of Western blot analysis of DUSP23 expression in DUSP23 knockdown (KD) A549 cells and doxycycline (DOX)-induced DUSP23 overexpressing H1299 cells. Figure 2b shows the results of the cell cluster formation test in DUSP23 KD A549 cells (scale bar, 250 μm), and the box plot within the graph displays the measurements of cell clusters with a diameter exceeding 50 μm from minimum to maximum. Statistical analysis was performed using one-way ANOVA with Tukey's multiple comparisons (one-way ANOVA, F2, 10758 = 798). Figure 2c shows the results of the cell cluster formation test for DOX-untreated and treated H1299 cells (scale bar, 250 μm), and the box plot within the graph displays the measurements of tumor spheres with a diameter exceeding 50 μm from minimum to maximum. Statistical analysis was performed using the Student's t-test, and data are expressed as mean ± standard deviation (**p < 0.01, ****p < 0.0001; FC, fold change; LUAD, lung adenocarcinoma; TCGA, The Cancer Genome Atlas). Figure 3a is a volcano plot of differentially expressed genes between the shMock and shDUSP23 #1 A549 clusters based on RNA-seq results, identifying 788 downregulated genes and 475 upregulated genes (Log2|FC| > 1, p < 0.05) in the shDUSP23 #1 A549 cluster. Genes with significantly decreased expression are indicated in blue, genes with significantly increased expression are indicated in red, and genes with insignificant expression are indicated in black. Figure 3b shows the GSEA results for embryonic stem cell cores, breast stem cells, and cholangiocarcinoma stem cells using RNA-seq data. Figure 3c shows the results of identifying related signaling pathways based on the NetPath database by analyzing downregulated genes in RNA-seq data using ShinyGO 0.77. Figure 3d confirms that the expression of the SOX2 target gene in shMock was significantly increased using gene set enrichment analysis (GSEA) of RNA-seq data. Figure 3e shows the RT-qPCR analysis of ALDH1 and SOX2 expression in DUSP23 KD A549 cluster cells, and statistical analysis was performed using one-way ANOVA with Tukey's multiple comparisons (one-way ANOVA, F2, 9 for ALDH1 = 37.06; F2, 9 for SOX2 = 1.581). Figure 3f shows the Western blot results representing SOX2 expression in DUSP23 KD A549 cells, and the RT-qPCR analysis results for SOX2 mRNA expression in DOX-inducible DUSP23 overexpressing H1299 cell clusters, respectively (the significance of differences between the result data was examined by comparing the two groups using Student's non-paired t-test. Data are expressed as mean ± standard deviation. ****p < 0.0001; NES; Normalized abundance score; FDR, false discovery rate; TCGA, The Cancer Genome Atlas; LUAD, lung adenocarcinoma). Figure 3g shows immunofluorescence images of SOX2, F-actin, and nuclei of cell clusters of shMock and shDUSP23 #1 A549 cells (scale bars, 10 μm), data are expressed as mean ± standard deviation (**p < 0.01, ****p < 0.0001, ns not significant; FC, fold change; NES, normalized enrichment score; FDR, false discovery rate). The bottom figures of Figures 4a and 4b show the results of gene set enrichment analysis of multiple drug resistance gene signatures and downregulated genes with cisplatin resistance in TCGA-LUAD. The top figure of Figure 4b shows the results of analyzing the association between DUSP23 and cisplatin resistance using the GSEA dataset. Figure 4c shows the IC for cisplatin treatment in lung adenocarcinoma cell lines in Genomics of Drug Sensitivity in Cancer. 50 This shows the correlation between a value of less than 20 μM and DUSP23 mRNA levels analyzed in The Human Protein Atlas. The left figure of Fig. 4d shows the morphology of H1299 parent cells and CisR cells (scale bar, 25 μm). Additionally, the right figure shows the results of examining cell viability using the WST-8 assay after treating H1299 parent cells and CisR cells with a specified dose of cisplatin for 72 hours; the bar graph represents the IC50 of cisplatin in parent cells and CisR H1299 cells. 50 It represents. Figure 4e shows the results of RT-qPCR analysis of ABCC2 mRNA expression in parent cells and cisplatin-resistant (CisR) H1299 cells. Figure 4f is a representative image showing the 3D globular infiltration assay of parent cells and CisR H1299 cells, where the yellow circles represent the distribution of infiltrating cells at 0 and 48 hours, and the box plot shows the change in the infiltration area according to the distance to the core at 48 hours (scale bar, 250 μm). Figure 4g shows the results of Western blot analysis of the specified antibody in parent cells and CisR H1299 cells. Figure 4h shows the results of RT-qPCR analysis of DUSP23 and SOX2 expression in parent cells and CisR H1299 cells (the significance of the data was tested by Student's non-paired t-test). Figure 4i shows immunofluorescence images of SOX2 and nuclei of parental cells and CisR H1299 cells (scale bars, 10 μm), and data are expressed as mean ± standard deviation (****p < 0.0001; NES, normalized enrichment score; FDR, false detection rate). Figure 5a shows the results of RT-qPCR analysis for SOX2 mRNA expression in shMock and shDUSP23 #1 H1299 CisR cells. The significance of differences between the result data was investigated by comparing the two groups using Student's non-paired t-test, and data are expressed as mean ± standard deviation (****p < 0.0001; NES, normalized enrichment score; FDR, false discovery rate; TCGA, The Cancer Genome Atlas; LUAD, lung adenocarcinoma). Figure 5b shows the results of the cell cluster formation test on DUSP23-depleted CisR H1299 cells (scale bar, 250 μm), and the box plot shows cluster diameter measurements of 50 μm or more from minimum to maximum (statistical significance was analyzed using one-way ANOVA with Tukey's multiple comparisons. One-way ANOVA, F2, 1628 = 242). Figure 5c is a representative image showing the 3D globular invasion assay of DUSP23-silenced CisR cells, where the yellow circles represent the distribution of invading cells at 0 and 48 hours, and the box plot represents the area of ​​invasion changed from minimum to maximum relative to the area at the initial time (0 hours) (scale bar, 250 μm). Statistical analysis was performed using one-way ANOVA with Tukey's multiple comparisons (one-way ANOVA, F2, 16 = 16.31). Figure 5d shows the results of cell viability analysis of DUSP23 KD CisR H1299 cells treated with 10 μM cisplatin for 72 hours using the WST-8 assay, and statistical analysis was performed using one-way ANOVA with Tukey's multiple comparisons (one-way ANOVA, F5, 18 = 258.4). Figure 5e shows the results of Western blot analysis of the labeled antibodies in DUSP23-silenced CisR H1299 cells, with data expressed as mean ± standard deviation (**p < 0.01, ****p < 0.0001). Specific details for implementing the invention

[0093] The inventors have completed the present invention by elucidating the role of DUSP23 in regulating cancer stem cell characteristics by controlling SOX2 expression in NSCLC. In the embodiments of the present invention, DUSP23 is highly expressed in both cell clusters and CisR cells, and it was confirmed that knockdown of DUSP23 reduces cell cluster formation and invasion and induces apoptosis in CisR cells, which are NSCLC cells that have developed cisplatin resistance. Therefore, DUSP23 can be used as a promising therapeutic target for chemotherapy, particularly for the treatment of cisplatin-resistant cancer cells.

[0094] Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of cisplatin-resistant cancer comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0095] In the present invention, dual-specificity protein phosphatase 23, “DUSP23 (Dual Specificity Phosphatase 23),” is also known as low molecular mass dual specificity phosphatase 3 (LDP-3) and is an enzyme encoded by the DUSP23 gene in humans. DUSP23 may refer to a gene represented by a sequence generally known in the art.

[0096] In one embodiment of the present invention, resistance to cisplatin was induced using lung cancer, specifically non-small cell lung cancer cell lines, or specifically lung adenocarcinoma cell lines, and then the relationship with DUSP23 was analyzed.

[0097] Lung cancer is the most commonly diagnosed cancer worldwide and a leading cause of cancer-related deaths, with approximately 2.5 million new cases and 1.8 million deaths reported in 2022. Histopathologically, lung cancer is classified into two main types: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), with NSCLC accounting for 85% of all cases. NSCLC includes subtypes such as squamous cell carcinoma, large cell carcinoma, and adenocarcinoma, making it the most frequently diagnosed form of lung cancer. Early-stage NSCLC is often treated with surgical resection, but there are no effective surgical options for advanced or unresectable cases. In these cases, treatment typically involves a combination of chemotherapy, such as cisplatin, and radiation therapy to improve patient survival, but the prognosis remains poor. Despite advancements in targeted therapies and immunotherapy, the prognosis for advanced NSCLC remains grim, primarily due to the emergence of treatment resistance and the limited efficacy of these new approaches. A deeper understanding of the mechanisms causing treatment resistance, particularly chemotherapy resistance, is crucial for developing more effective treatment strategies.

[0098] Accordingly, the composition of the present invention may be applied to cancers in which cisplatin is applied as a central therapeutic regimen. In one embodiment of the present invention, the cancer may be one or more selected from the group consisting of lung cancer, non-small cell lung cancer, lung adenocarcinoma, large cell carcinoma, small cell lung cancer, testicular cancer, ovarian cancer, cervical cancer, bladder cancer, head and neck cancer, esophageal cancer, mesothelioma, brain tumor, neuroblastoma, head and neck squamous cell carcinoma, and lymphoma, but is not limited thereto. Although specific effects were confirmed in lung cancers such as non-small cell lung cancer and lung adenocarcinoma, this was used as an example of a cancer in which resistance develops to cisplatin-based chemotherapy agents, particularly cisplatin.

[0099] In addition, the present invention uses cisplatin to analyze various factors such as inhibition of DUSP23 resistance, cancer cell death, and anticancer activity against cisplatin-induced resistant cancer. At this time, since cisplatin can be categorized as a cisplatin-based compound, the present invention provides a pharmaceutical composition for the prevention or treatment of cancer resistant to cisplatin-based chemotherapy agents, comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0100] In the present invention, since the term “cisplatin-based chemo-anticancer agent” may have the same meaning as “platinum preparation,” both names may be used interchangeably in the present invention. Platinum preparations are a type of alkylating agent and literally refer to anticancer agents based on platinum. Representative examples include cisplatin, carboplatin, and oxaliplatin, and the structural formulas of each substance are as follows.

[0101]

[0102] It is known that platinum preparations all have a structure containing platinum in the center, and that platinum compounds penetrate the cell membrane of cells in the body, enter the cell, and then infiltrate the cell nucleus to bind to DNA, thereby blocking DNA replication ability and inducing apoptosis. It is known that all platinum preparations chelate platinum in the center and bind to DNA inside the cell nucleus through this, and thus follow the same pharmacological mechanism. Therefore, it can be understood that DUSP23 expression or activity inhibitors will exhibit the same anticancer activity against resistance in cancers to platinum preparations such as carboplatin and oxaliplatin. In one embodiment of the present invention, cisplatin was selected among platinum preparations, and various experiments were performed as an example to elucidate the use of DUSP23 as a therapeutic target in cisplatin-resistant cancer.

[0103] In one embodiment of the present invention, the expression or activity inhibitor may be one or more selected from the group consisting of compounds, peptides, polynucleotides, antibodies, recombinant vectors, antisense nucleotides, siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats), natural products, peptidomimetic, exosomes, ribozymes, DNAzymes, PNA (peptide nucleic acids), and aptamers, but is not limited thereto.

[0104] In the present invention, the compound as the active inhibitor may be a PTP inhibitor. For example, sodium orthovanadate is used, but is not limited thereto.

[0105] In one embodiment of the present invention, the composition may be administered in combination with cisplatin, but is not limited thereto.

[0106] As used herein, the term “combination therapy” may be achieved by administering individual components of a therapeutic regimen simultaneously, sequentially, or individually. A combination therapeutic effect is obtained by administering two or more drugs simultaneously or sequentially, or by administering them alternately at regular or indeterminate intervals. A combination therapy may be defined as one that provides a synergistic effect while being therapeutically superior to the efficacy obtained by administering one or the rest of the components of the combination therapy at a normal dose, provided, for example, through the degree of response, response rate, time to disease progression, or survival time.

[0107] In the present invention, since resistance was overcome and a cell death effect occurred in lung cancer cells that had developed resistance to cisplatin when the expression of DUP23 was inhibited, it can be inferred that when an inhibitor of DUP23 expression or activity is administered together with cisplatin, resistance caused by cisplatin is overcome and further anticancer activity appears. Therefore, the composition of the present invention can enhance the anticancer effect by increasing sensitivity to cisplatin-based chemotherapy agents. Here, "enhancing the anticancer effect" refers to all effects that can ultimately strengthen the function of the anticancer agent. This concept includes not only enhancing the anticancer effects of the anticancer agent, such as inhibiting tumor growth, inhibiting tumor metastasis, and inhibiting tumor recurrence, but also enhancing the anticancer effect by inhibiting the formation of resistance or tolerance in cancer cells to the anticancer agent. That is, the composition according to the present invention can be used as a compound for co-administration with known cisplatin-based chemotherapy agents for the purpose of enhancing the anticancer effect.

[0108] In one embodiment of the present invention, the composition may be administered concurrently, separately, or sequentially with cisplatin, but is not limited thereto. In this case, even when administered sequentially with an anticancer agent, the order of administration is not limited, but the administration regimen may be appropriately adjusted according to the type of cancer, the type of anticancer agent, the patient's condition, etc.

[0109] In addition, the composition according to the present invention may be administered simultaneously, separately, or sequentially with the anticancer agent or other anticancer agents before or after resistance to cisplatin-based chemotherapy agents develops in an individual.

[0110] In addition, the composition according to the present invention may be in a form in which the composition and the cisplatin-based chemotherapy agent are each formulated and administered simultaneously, separately, or sequentially. In this case, the composition may be a pharmaceutical composition for concomitant administration for simultaneous or sequential administration, comprising a first pharmaceutical composition containing a pharmaceutically effective amount of an inhibitor of the expression or activity of DUSP23 as an active ingredient; and a second pharmaceutical composition containing a pharmaceutically effective amount of the anticancer agent as an active ingredient. In this case, in the case of sequential administration, the order of administration is not limited, and the administration regimen may be appropriately adjusted according to the patient's condition, etc.

[0111] That is, if the above pharmaceutical composition is a pharmaceutical composition for concomitant administration for sequential administration, the composition may be such that the DUSP23 expression or activity inhibitor (“1st component”) is administered first, followed by the anticancer agent (“2nd component”), and the reverse order is also possible.

[0112] In one embodiment of the present invention, the composition may enhance sensitivity to cisplatin, but is not limited thereto.

[0113] In one embodiment of the present invention, the composition may be characterized by one or more selected from the group consisting of the following, but is not limited thereto:

[0114] Reduces the protein and mRNA levels of SOX2 (SRY-Box Transcription Factor 2);

[0115] Reduces SOX2 signaling and nuclear localization; and

[0116] No effect on ALDH1 (Aldehyde Dehydrogenase 1 Family Member A1) expression.

[0117] In one embodiment of the present invention, the composition may be characterized by one or more selected from the group consisting of the following for cisplatin-resistant cancer cells, but is not limited thereto:

[0118] Reduces the formation and size of resistant cancer cell clusters;

[0119] Reduces the invasive ability and survival rate of resistant cancer cells; and

[0120] Promotes apoptosis of resistant cancer cells.

[0121] The pharmaceutical composition according to the present invention may further include a suitable carrier, excipient, and diluent commonly used in the manufacture of pharmaceutical compositions. The excipient may be one or more selected from the group consisting of, for example, diluents, binders, disintegrants, lubricants, adsorbents, humectants, film-coating materials, and controlled-release additives.

[0122] The pharmaceutical composition according to the present invention may be formulated and used in the form of external preparations such as powders, granules, sustained-release granules, enteric granules, liquids, eye drops, oxylic agents, emulsions, suspensions, ethanol tablets, troches, fragrances, limonene adzes, tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, warning agents, lotions, pastes, sprays, inhalants, patches, sterile injectable solutions, or aerosols, according to conventional methods, and the external preparations may have formulations such as creams, gels, patches, sprays, ointments, warning agents, lotions, liniments, pastes, or cataplasms.

[0123] Carriers, excipients, and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0124] When formulating, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0125] Excipients such as corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, D-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, calcium monohydrogen phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, refined lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethylcellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, primogel, etc., as additives to tablets, powders, granules, capsules, pills, and lozenges according to the present invention; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium casein, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin, hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, refined shellac, starch paste, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone, etc. may be used as binders, and hydroxypropylmethylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, Calcium carboxymethylcellulose, calcium citrate, sodium lauryl sulfate, anhydrous silica, 1-hydroxypropylcellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, amylopectin, pectin, sodium polyphosphate, ethylcellulose, sucrose, magnesium aluminum silicate, D-sorbitol solution, hard anhydrous silica, etc. disintegrants;Lubricants such as calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodium pods, kaolin, petroleum jelly, sodium stearate, cocoa paste, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, anhydrous silica, higher fatty acids, higher alcohols, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and hard anhydrous silica may be used.

[0126] As additives to the liquid formulation according to the present invention, water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, monostearic acid sucroses, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, lanolin esters, acetic acid, hydrochloric acid, water ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethylcellulose, sodium carboxymethylcellulose, etc. may be used.

[0127] In the syrup preparation according to the present invention, a solution of white sugar, other sugars or sweeteners, etc. may be used, and if necessary, flavorings, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, viscosity enhancers, etc. may be used.

[0128] Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

[0129] In the suspension agent according to the present invention, suspending agents such as acacia, tragacanthus, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, and HPMC 2910 may be used, and surfactants, preservatives, stabilizers, coloring agents, and fragrances may be used as needed.

[0130] The injectable preparation according to the present invention comprises solvents such as distilled water for injection, 0.9% sodium chloride injection solution, Ringer's injection solution, dextrose injection solution, dextrose + sodium chloride injection solution, PEG, lactated Ringer's injection solution, ethanol, propylene glycol, non-volatile oils—sesame oil, cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tween, nijungtinamide, hexamine, and dimethylacetamide; and buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums. It may include isotonic agents such as sodium chloride; stabilizers such as sodium bisulfite (NaHSO3), carbon dioxide gas, sodium metabisulfite (Na2S2O5), sodium sulfite (Na2SO3), nitrogen gas (N2), and ethylenediaminetetraacetic acid; sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetic acid, and sodium bisulfite acetone; non-inflammatory agents such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; and suspending agents such as sodium CMC, sodium alginate, Tween 80, and aluminum monostearate.

[0131] The suppository according to the present invention comprises cocoa dough, lanolin, Witepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cocoa butter + cholesterol, lecithin, lanette wax, glycerol monostearate, Tween or Spandex, Imhausen, monollene (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego-G, Cebes Pharma 16, hexalide base 95, Cotomar, Hydroccote SP, S-70-XXA, S-70-XX75 (S-70-XX95). Bases such as Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramount-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppository base type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), and Tegestor triglyceride base (TG-95, MA, 57) may be used.

[0132] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the extract. In addition to simple excipients, lubricants such as magnesium styrate and talc are also used.

[0133] Liquid preparations for oral administration include suspensions, oral liquids, emulsions, and syrups; in addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0134] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, a “pharmaceutically effective amount” means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient’s disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.

[0135] The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by considering all the above-mentioned factors, and this can be easily determined by a person skilled in the art to which the present invention belongs.

[0136] The pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration are expected, for example, oral administration, subcutaneous injection, intraperitoneal administration, intramuscular injection, intrathecal (intradural) injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, ear administration, nasal administration, inhalation, spray through the mouth or nose, skin administration, transdermal administration, etc.

[0137] The pharmaceutical composition of the present invention is determined by the type of active ingredient drug, along with various relevant factors such as the disease to be treated, the route of administration, the patient's age, gender, weight, and the severity of the disease. Specifically, the effective dose of the composition according to the present invention may vary depending on the patient's age, gender, and weight, and generally, 0.001 to 150 mg, preferably 0.01 to 100 mg per kg of body weight, may be administered daily or every other day, or divided into 1 to 3 doses per day. However, since the dose may be increased or decreased depending on the route of administration, the severity of the disease, gender, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

[0138] In the present invention, the term “individual” refers to a subject requiring treatment for a disease, and more specifically, to mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cattle.

[0139] In the present invention, “administration” means providing a predetermined composition of the present invention to an individual by any appropriate method.

[0140] In the present invention, “prevention” refers to any act of suppressing or delaying the onset of a target disease, “treatment” refers to any act of improving or beneficially altering the target disease and associated metabolic abnormality symptoms through the administration of a pharmaceutical composition according to the present invention, and “improvement” refers to any act of reducing parameters related to the target disease, such as the severity of symptoms, through the administration of a composition according to the present invention.

[0142] The present invention provides a kit for the prevention or treatment of cisplatin-resistant cancer comprising the above composition and instructions.

[0143] In the present invention, “kit” refers to a tool that enables the prevention, improvement, or treatment of cisplatin-resistant cancer using the composition of the present invention. In addition to the above-mentioned substances, the kit of the present invention may include other components, compositions, solutions, devices, etc., that are typically required for the storage and processing methods thereof. As a specific example, each component may be applied one or more times without limitation on the number of times, there is no restriction on the order in which each substance is applied, and the application of each substance may proceed simultaneously or sequentially.

[0144] In the present invention, the kit may include a container; instructions; etc. The container may serve to package the material and may also serve to store and secure it. The material of the container may take the form, for example, a bottle, a tub, a sachet, an envelope, a tube, an ampoule, etc., and these may be formed partially or wholly from plastic, glass, paper, foil, wax, etc. The container may be equipped with a cap that is initially part of the container or can be attached to the container by mechanical, adhesive, or other means and is completely or partially detachable, and may also be equipped with a stopper that allows access to the contents by a syringe needle. The kit may include an outer package, and the outer package may include instructions regarding the use of the components.

[0145] In the present invention, the agent for measuring the protein expression level may be one or more agents selected from the group consisting of antibodies, peptides, aptamers, proteins, and compounds that specifically bind to said protein, but is not limited thereto, and may include any agent that can be generally used in the art.

[0146] In the present invention, the agent for measuring mRNA expression levels may be one or more agents selected from the group consisting of primers, antisense oligonucleotides, and probes that specifically bind to the mRNA of the gene, but is not limited thereto, and may include any agent that can be generally used in the art.

[0148] The present invention provides a method for providing information for diagnosing resistance to cisplatin in cancer, comprising the following steps:

[0149] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a subject; and

[0150] (S2) A step of determining that resistance to cisplatin is present if the protein or mRNA expression level of the above DUSP23 is increased compared to the protein or mRNA expression level of the DUSP23 in the biological sample isolated from the control group.

[0151] In the present invention, it was confirmed that the expression level of DUSP23 in lung cancer cells that have developed resistance to cisspline is significantly increased compared to normal individuals.

[0152] In one embodiment of the present invention, the biological sample may be any one selected from the group consisting of cells, tissues, blood, serum, whole blood, plasma, urine, saliva, trachea, bone marrow, fine needle aspiration specimens, core needle biopsy specimens, and vacuum aspiration biopsy specimens, but is not limited thereto. In addition, in one embodiment of the present invention, the control group may be a normal individual or a liver cancer individual, but is not limited thereto.

[0153] The biological sample may be pretreated before use for detection or diagnosis. For example, this may include homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, etc. The sample may be prepared to increase the detection sensitivity of protein markers, for example, the sample obtained from a subject may be pretreated using methods such as anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, sequential extraction, or gel electrophoresis.

[0154] In one embodiment of the present invention, it was confirmed through mRNA level analysis and methods such as immunohistochemistry (IHC) or Western blot that the gene or protein expression of DUSP23 can be used as a marker for diagnosing lung cancer cells that have developed resistance to cisplatin. Therefore, in the present invention, the level of DUSP23 refers to both the gene and protein expression levels. That is, since both the mRNA level and the protein level of DUSP23 can be used as the information-providing method for diagnosing resistance to cisplatin according to the present invention, it can be utilized as a marker that is simple yet exhibits high accuracy.

[0155] In the present invention, the method for measuring protein levels is not subject to any particular limitations as long as it is a protein measurement method known in the art, but can be measured by methods such as protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted LaSer Desorption / Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Surface Enhanced LaSer Desorption / Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, Ouchteroni immunodiffusion method, Rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, liquid chromatography-mass spectrometry (LC-MS), LC-MS / MS (liquid chromatography-mass spectrometry / mass spectrometry), Western blotting, ELISA (enzyme linked immunosorbent assay), FACS, etc.

[0156] In the present invention, the method for measuring mRNA levels is not subject to any particular limitations as long as it is based on mRNA measurement methods known in the art, but can be measured by methods such as PCR, RNase protection assay, northern blotting, southern blotting, in situ hybridization, DNA chip, and / or RNA chip.

[0157] In this specification, “the level is increased” means that something that was not previously detected is detected, or that the amount detected is relatively higher than the normal level. For example, “the level is increased” means that the level of the experimental group is at least 1%, 2%, 3%, 4%, 5%, 10% or higher, e.g., 5%, 10%, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% or higher, and / or 0.5 times, 1.1 times, 1.2 times, 1.4 times, 1.6 times, 1.8 times or higher than that of the control group. Specifically, it may mean an increase of 1 to 1.5 times, 1.5 to 2 times, 2 to 2.5 times, 2.5 to 3 times, 3 to 3.5 times, 3.5 to 4 times, 4 to 4.5 times, 4.5 to 5 times, 5 to 5.5 times, 5.5 to 6 times, 6 to 6.5 times, 6.5 to 7 times, 7 to 7.5 times, 7.5 to 8 times, 8 to 8.5 times, 8.5 to 9 times, 9 to 9.5 times, 9.5 to 10 times, or 10 times or more compared to that of the control group, but is not limited thereto. A person skilled in the art can understand the meaning of the opposite term as having the opposite meaning in accordance with the above definition.

[0158] The term “method for providing information” as used in the present invention refers to a method for providing information regarding the diagnosis of a disease, which involves obtaining information about the onset or likelihood (risk) of a disease by analyzing biological samples of an individual or by confirming increases or decreases in the expression levels of the biomarkers of the present invention. For example, it may include a method for providing information on whether there is a possibility of the disease developing in an individual, whether the likelihood of development is relatively high, or whether the disease has already developed, by measuring the level of the biomarkers according to the present invention and comparing it with a control group. Furthermore, through the method using the biomarkers of the present invention, it is possible to predict the risk of exacerbation due to the onset of the disease of the present invention, that is, whether the prognosis will be poor, and this may also be used as a method for providing information regarding the prevention and treatment of the disease of the present invention.

[0159] In the present invention, “diagnosis” includes determining the susceptibility of an object to a specific disease or condition, determining whether an object currently has a specific disease or condition, determining the prognosis of an object with a specific disease or condition (e.g., identification of tumor status, determination of tumor stage or determination of cancer responsiveness to treatment, particularly in the present invention, diagnosis of cisplatin-resistant cancer or progression of the disease), or therametrics (e.g., monitoring the condition of an object to provide information on therapeutic efficacy).

[0160] In addition, the present invention may provide a disease diagnostic device of the present invention for an individual. Specifically, the disease may be a cancer known to develop resistance to cisplatin, and in particular, may be lung cancer, specifically non-small cell lung cancer. The measuring unit of the diagnostic device of the present invention may measure the expression level of a protein or gene using a preparation that measures the mRNA or protein expression level of DUSP23, a biomarker according to the present invention, with respect to a biological sample obtained from a subject. By confirming the degree of expression of the protein or gene using the preparation in the measuring unit, the disease of the present invention may be diagnosed, or a high risk of onset may be diagnosed.

[0161] The diagnostic device of the present invention may further include a detection unit that predicts and outputs the presence or absence, stage, or type of the disease of the present invention of a subject from the degree of expression of the protein or gene obtained from the measurement unit.

[0162] In the present invention, the detection unit can diagnose the disease of the present invention by generating and classifying information regarding the disease of the present invention according to the range of the expression level of the protein or gene obtained from the measurement unit.

[0163] In the present invention, “biomarker” refers to a marker that can distinguish between normal and pathological states or predict a treatment response and can be objectively measured. It was confirmed that the levels of DUSP23, a biomarker in biological samples of individuals with the disease of the present invention, differed from the increase or decrease in each level compared to normal individuals, and thus it was proven that the biomarker of the present invention can be used as a biomarker for the diagnosis or prognosis prediction of the disease of the present invention.

[0164] In the present invention, the term “measurement” includes both detecting and confirming the presence (expression) of a target substance and detecting and confirming a change in the presence level (expression level) of the target substance. The measurement may be performed without limitation by including both qualitative methods (analysis) and quantitative methods. The types of qualitative and quantitative methods for measuring the presence of a substance according to the present invention are well known in the art, and the experimental methods described in this specification are included therein.

[0165] As used herein, the term “analysis” may preferably mean “measurement,” wherein qualitative analysis may mean measuring and confirming the presence of a target substance, and quantitative analysis may mean measuring and confirming a change in the presence level (expression level) or amount of the target substance. In the present invention, analysis or measurement may be performed without limitation by including both qualitative and quantitative methods, and preferably, quantitative measurement may be performed.

[0166] In the present invention, “prognosis prediction” may mean predicting the degree of disease progression in a patient group of the disease of the present invention. It may mean predicting the probability of progression, deterioration, recurrence, maintenance, etc. of the disease condition of the present invention through the increase or decrease in the level of the biomarker of the present invention.

[0168] The present invention provides a composition for determining cisplatin-resistant cancer subjects, comprising as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23).

[0169] In the present invention, “determination” may be used interchangeably with “discrimination” and means distinguishing subjects according to specific criteria. In the present invention, it may mean distinguishing individuals diagnosed with or likely to have cancer resistant to cisplatin-based chemotherapy drugs, particularly cisplatin. Furthermore, it may be used to mean distinguishing whether the determined individual will exhibit a therapeutic effect against cisplatin-based chemotherapy drugs, particularly cisplatin, or distinguishing whether or not they have sensitivity to the treatment of the combination said, but is not limited thereto.

[0170] In the present invention, the “responder characterization method” refers to a method for determining whether a patient is therapeutically responsive to a cisplatin-based compound according to the present invention, particularly cisplatin, and means a companion diagnostic method for determining whether to apply (administer) cisplatin to improve, prevent, and / or treat cisplatin-resistant cancer in an individual who has developed resistance to cisplatin. Accordingly, a patient determined to be a responder to cisplatin according to the responder characterization method for cisplatin according to the present invention can expect a therapeutic effect on cancer that has developed resistance to cisplatin when cisplatin is administered. In one embodiment of the present invention, the responder characterization method for cisplatin for treating cancer that has developed resistance to cisplatin may be performed in vitro.

[0171] In the present invention, “companion diagnostics” refers to one of the diagnostic tests to confirm the possibility of applying a specific therapeutic drug to a specific patient. In the present invention, in order to confirm the possibility of applying a cisplatin-based compound (e.g., cisplatin) to an individual with cancer that has developed resistance to cisplatin, the level of DUSP23 in a biological sample isolated from an individual with cancer that has developed resistance to cisplatin can be measured together as a companion diagnostic marker.

[0172] In the present invention, the “responder” may be a cancer individual that has developed resistance to cisplatin requiring cisplatin administration, a cancer individual that has developed resistance to cisplatin requiring continuous administration of the same cisplatin, or a cisplatin individual that is suitable for continuous administration of the same cisplatin, but is not limited thereto.

[0174] The present invention provides a kit for determining cisplatin-resistant cancer subjects, comprising the above composition and instructions.

[0175] In one embodiment of the present invention, the description may teach the information provision method, but is not limited thereto.

[0176] In the present invention, the “diagnosis kit” refers to a tool that includes a preparation for measuring the mRNA level or protein expression level of DUSP23, a biomarker of the present invention, and enables the diagnosis of an individual in the present invention as having cisplatin-resistant cancer. Other details may be subject to the general provisions regarding the “kit” described in the present invention.

[0178] The present invention provides a screening method for a substance for preventing or treating resistance to cisplatin in cancer, comprising the following steps:

[0179] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in biological samples isolated from a cisplatin-resistant animal model or cell model of cancer treated with the candidate substance; and

[0180] (S2) A step of selecting the candidate substance as a substance for preventing or treating resistance to cisplatin in cancer when the protein or mRNA expression level of the DUSP23 is reduced.

[0181] The present invention provides a composition for screening substances for preventing or treating resistance to cisplatin in cancer, comprising as an active ingredient a preparation for measuring the protein or mRNA level of DUSP23 (Dual-specificity phosphatase 23).

[0182] The present invention provides a screening kit for substances for preventing or treating resistance to cisplatin in cancer, comprising the above composition and instructions.

[0183] In one embodiment of the present invention, the description may teach the screening method, but is not limited thereto.

[0184] In the present invention, the “screening kit” refers to a tool capable of screening substances for preventing or treating resistance to cisplatin-based chemotherapy drugs, particularly cisplatin, by including a preparation that measures the mRNA level or protein expression level of DUSP23, which is a biomarker of the present invention. Other details may be applied to the general contents regarding the “kit” described in the present invention.

[0185] In the present invention, “screening” may mean selecting a substance having a specific desired property from a candidate group of various substances using a specific operation or evaluation method.

[0186] That is, for the purposes of the present invention, the screening method of the present invention may mean a series of processes including the step of determining the efficacy of a drug candidate substance by the said method in order to identify a cisplatin-based chemotherapy agent, particularly one that produces the best therapeutic effect on individuals resistant to cisplatin, but is not limited thereto.

[0187] The step of confirming the above therapeutic response and effect may be repeated several times depending on the therapeutic candidate substance, and may additionally include steps used in the industry as general screening methods, such as adding additional substances or steps to confirm the therapeutic response and effect, but is not limited thereto.

[0188] In the present invention, “candidate substance” refers to an unknown substance used in screening to measure the increase or decrease in expression of the marker of the present invention by administering it to an animal model or cell model of the target disease in the present invention, and may be one or more selected from the group consisting of nucleotides, DNA, RNA, amino acids, aptamers, proteins, stem cells, stem cell culture media, compounds, microbial culture media or extracts, natural products, and natural extracts, but is not limited thereto.

[0189] In the present invention, the term “treatment” refers to any act that improves or beneficially alters the target disease and the associated metabolic abnormality symptoms, and methods such as chemotherapy, surgical procedures, or biological therapy may be used.

[0190] At this time, if the mRNA or protein expression level of the above substance is increased or decreased depending on the type compared to a comparison group, for example, a normal control group, it can be determined that cancer resistant to cisplatin-based chemotherapy drugs, particularly cisplatin, has been treated (or improved). In this specification, "the level is increased" is as described above.

[0191] In the present invention, a treatment method commonly used for treating the target disease in the present invention may be used, a commonly used therapeutic drug may be administered, and a candidate substance disclosed in the present invention may be administered, but is not limited thereto.

[0193] The present invention provides a pharmaceutical composition for inhibiting or improving resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient.

[0194] The present invention provides a method for characterizing responders to cisplatin for cancer treatment, wherein the method comprises the following steps:

[0195] (S1) A step of measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a cancerous individual; and

[0196] (S2) A step of determining a responder to cisplatin if the protein or mRNA expression level of the above DUSP23 is reduced compared to the protein or mRNA expression level of the DUSP23 in a biological sample isolated from the control group.

[0197] The present invention provides a composition for characterizing responders to cisplatin for cancer treatment, comprising as an active ingredient a preparation for measuring the protein or mRNA level of DUSP23 (Dual-specificity phosphatase 23).

[0198] The present invention provides a kit for responder characterization for cisplatin for cancer treatment, comprising the above composition and instructions.

[0199] In one embodiment of the present invention, the description may teach the reactor characterization method, but is not limited thereto.

[0200] In the present invention, the “responder characterization kit” refers to a tool that enables the characterization of responders to cisplatin for cancer treatment in the present invention, comprising a preparation that measures the mRNA level or protein expression level of DUSP23, a biomarker of the present invention. Other details may be applied according to the general provisions regarding the “kit” described in the present invention.

[0202] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by the following embodiments.

[0204] [Example]

[0206] cell culture

[0207] Human non-small cell lung adenocarcinoma cell lines A549 and H1299 were purchased from the Korean Cell Line Bank (Seoul, Korea). A549 and H1299 cells were cultured in Roswell Park Memorial Institute 1640 medium (RPMI 1640; #23400021; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine reproductive serum (FBS; #US-FBS-500; GW Vitek, Seoul, Korea), 100 units / ml penicillin, and 100 μg / ml streptomycin (#LS202-02; WelGENE, Daegu, Korea). Human embryonic kidney 293T (HEK293T) cells were obtained from the American Type Culture Collection (ATCC; #CRL-3216; Manassas, VA, USA). HEK293T cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; #12800017; Gibco) supplemented with 10% FBS, 100 units / ml penicillin, and 100 μg / ml streptomycin. All cell lines were cultured in a 37°C humidity atmosphere of 95% air and 5% CO2.

[0209] Cell cluster formation test

[0210] 2×10^4 to 1×10^5 cells per well were inoculated into ultra-low adhesion 6-well plates (SPL 3D™ Cell Floater Plate; #39706; SPL life sciences, Gyeonggi-do, Korea). Cells were cultured in Advanced Dulbecco's Modified Eagle Medium F-12 (Advanced DMEM / F-12; #12634010; Gibco) supplemented with 10 mM HEPES (pH 7.4; #7365-45-9; Sigma-Aldrich, Saint Louis, MO, USA), 1% GlutaMax supplement (#35050; Gibco), and 100 units / ml penicillin, and 20 ng / ml epidermal growth factor (EGF; #E9644; Sigma-Aldrich), 20 ng / ml human recombinant basic fibroblast growth factor (bFGF; #13256-029; Gibco), and B-27 supplement (#17504044; Gibco). Cells were cultured under these conditions for 4 days to allow tumor cluster formation. The clusters were photographed using a Nikon ECLIPSE Ti2 inverted microscopy system equipped with a digital camera (DS-Qi2; Nikon, Tokyo, Japan), and the diameter of the clusters was measured using NIS-Elements image analysis software (Nikon).

[0212] RNA extraction, reverse transcription-quantitative PCR (RT-qPCR)

[0213] Total RNA was isolated from cells using RNAiso Plus reagent (#9109; TaKaRa, Tokyo, Japan) according to the manufacturer's instructions. After adding chloroform and centrifuging, the solution was separated into three phases, and the total RNA was placed in an aqueous solution. The aqueous solution was transferred to a 1.5 ml microtube containing isopropanol for total RNA agglutination. The RNA pellet was washed with 75% ethanol in UltrdaPure diethyl pyrocarbonate (DEPC) treated water (#750023; Invitrogen, Carlsbad, CA, USA) and then completely dried. The RNA pellet was separated with DEPC treated water and quantified at 260 / 280 nm using a spectrometer. 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using 100 mM oligo (dT) and PrimeScript reverse transcriptase (#2680; TaKaRa). RT-qPCR was performed using SYBR premix Ex-Taq II (#RR820, TaKaRa) and QuantStudio 3 (Applied Biosystems, Foster City, CA, USA). Gene expression levels were calculated as 2-ΔΔCq and normalized to the Cq value of GAPDH (21). The primers used for RT-qPCR are described in Table 1.

[0215] NO. Name Sequence 1 DUSP23_F ACTGRGCTCTGGGCTTTG 2 DUSP23_R CGCTGGTAGAACTGGAAGAC 3 SOX2_F AACTTTTGTCGGAGACGGAG 4 SOX2_R GCAGCGTGTACTTATCCTTC 5 ALDH1A1_F GTGTGGGTGAATTGCTATGG 6 ALDH1A1_R TCATGGAAACCGTACTCTCC 7 ABCC2_F AAGCCTGAGGATGAATCTCG 8 ABCC2_R CTGGCCACAAAAGACTTGAG 9 GAPDH_F GACCCCTTCATTGACCTC 10 GAPDH_R TCCTGGAAGATGGTGATG

[0217] Western Blot

[0218] Cells were seeded into 35 mm culture dishes. After 72 hours, the cells were washed with cold phosphate-buffered saline (PBS). Total protein was extracted from the cells by adding a phosphate-based lysis buffer (pH 7.0) containing 1% sodium deoxycholate, 2% sodium dodecyl sulfate (SDS), 1% NP-40, 150 mM sodium chloride (NaCl), 50 mM sodium fluoride (NaF), 1 mM sodium orthovanadate (Na3VO4), 2 mM ethylenediaminetetraacetic acid (EDTA), 1 mM dithiothreitol (DTT), 1 mM phenylmethanesulfonylfluoride (PMSF), 6 mM sodium hydrogen phosphate (Na2HPO4), and 4 mM sodium dihydrogen phosphate (NaH2PO4). An equal amount of protein was electrophoresed on an SDS-polyacrylamide gel. After that, the protein was transferred to a polyvinylidene difluoride (PVDF) membrane (#IPVH00010; Millipore, Burlington, Massachusetts, USA) and blocked with 5% skim milk.The membranes are mouse anti-DUSP23 (#TA503944; Origene Technologies (Rockville, MD, USA); 1:2000), rabbit anti-α-tubulin (E-19; #sc-12462; Santa Cruz Biotechnology (Dallas, TX, USA); 1:2500), mouse anti-STAT3 (F-2; #sc-8019; Santa Cruz Biotechnology; 1:1000), mouse anti-GAPDH (6C5; #sc-32233; Santa Cruz Biotechnology; 1:2500), rabbit anti-SOX2 (#3579; Cell Signaling Technology (Danvers, MA, USA); 1:1000), mouse anti-phospho-STAT3 (Y705; #4113; Cell Signaling Technology; 1:1000), rabbit anti-cleavage caspase-3 (#9661; Cell Signaling Technology; 1:1000), rabbit anti-phospho-AKT (S473; #9271; Cell Signaling Technology; 1:1000) and rabbit anti-AKT (#9272; Cell Signaling Technology; 1:1000). Several antibodies were diluted with the SignalBoost Immunoreaction Enhancer Kit (#407207; Millipore) to amplify the antibody reactions. The membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. These included HRP-conjugated goat anti-mouse (#115-035-006; Jackson ImmunoResearch Laboratories (West Grove, PA, USA); 1:5000) or HRP-conjugated goat anti-rabbit (#111-035-006; Jackson ImmunoResearch Laboratories; 1:5000).Blotted proteins were detected using enhanced chemiluminescence (ECL) reagents (#XLS071, XLS0142, XLS3; CYANAGEN; Bologna, Italy) and a Fusion Solo S imaging system (VILBER, Collegien, France).

[0220] Short hairpin RNA (shRNA)-mediated knockdown

[0221] The DUSP23 KD human non-small cell lung adenocarcinoma cell line was generated by a lentivirus system. Target sequences (shDUSP23 #1 (seq. 11; 5'-GCTGAAATCCGACGACTA-CGA-3', shDUSP23 #2 (seq. 12); targeting the 5'-CCTATGAGCAGGAAAGCAG-3' coding sequence region (CDS)) were cloned into the pLKO.1-TRC cloning vector (#10878; Addgene, Watertown, MA, USA). The shRNA target regions were packaged by helper plasmids such as psPAX2 and pMD2.G (#12260 and #12259; Addgene) and co-transfected into HEK293T cells. Lentiviral particles were harvested from HEK293T cells after 72 hours. Lentiviral particles infected cells treated with 8 μg / ml Polybrene. DUSP23 expression was confirmed by RT-qPCR and Western blotting. Infected The cells were used for further analysis.

[0223] NO. Name Sequence 11 shDUSP23 #1 GCTGAAATCCGACGACTACGA 12 shDUSP23 #2 CCTATGAGCAGGAAAGCAG

[0225] Generation of DUSP23 overexpressing cell lines using a doxycycline-induced overexpression system

[0226] CDS of the DUSP23 sequence were cloned into pCW57.1 (#41313; Addgene) using Gateway LR Clonase II enzyme mixture (#11791020; Invitrogen) according to the manufacturer's protocol. For packaging, helper plasmids such as psPAX2 and pMD2.G (#12260 and #12259; Addgene) were co-transfected into HEK293T cells. Lentivirus particles were harvested from HEK293T cells after 72 hours. Human NSCLC cells were seeded into 100 mm cell culture dishes and allowed to attach overnight. After attachment, lentivirus particles were infected into cells treated with 8 μg / ml polybrene. After 48 hours, the infected cells were selected for growth medium containing 1 μg / ml puromycin. For DUSP23 overexpression, infected cells were treated with doxycycline (DOX). DUSP23 expression was confirmed by RT-qPCR and Western blotting. Infected cells were used for further analysis.

[0228] RNA sequencing (RNA-seq)

[0229] Total RNA was extracted from A549 shMock and shDUSP23 tumor cluster cells. RNA quality was evaluated using a bioanalyzer (RNA 600 Nano kit; Agilent Technologies, Santa Clara, CA, USA). Library construction was performed using the mRNA-seq Library prep kit (Illumina, San Diego, CA, USA) according to the manufacturer's instructions. High-throughput sequencing was performed using the NovaSeq 6000 platform (Illumina). For pathway analysis, NetPath analysis was performed using ShinyGo 0.77 (http: / / bioinformatics.sdstate.edu / go / ).

[0231] Immunocytochemistry

[0232] Cells were seeded onto 50 μg / ml collagen-coated 12 mm coverslips for 24 hours. Cells were fixed with cold 3.7% paraformaldehyde for 15 minutes, followed by permeation with 0.5% Triton X-100 in PBS for 10 minutes. After blocking with 2% bovine serum albumin containing 0.1% Triton X-100 in PBS for 1 hour, the samples were incubated with the primary antibody for 1 hour. The antibody used was mouse anti-SOX2 (E-4; #sc-365823; Santa Cruz Biotechnology; 1:200). Subsequently, the coverslips were washed three times with 0.1% Triton X-100 in PBS and then incubated with the Alexa flour-conjugated secondary antibody Alexa Fluor (#A-11001; Invitrogen; 1:100) at room temperature for 1 hour. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). Coverslips were mounted on glass slides using Fluoromount-G (#0100-01; Southern Biotechnology Associates, Birmingham, AL, USA). Images were acquired using an Eclipse 80i fluorescence microscope with a DS-Qi2 (Nikon). Tumor clusters were fixed in 3.7% paraformaldehyde for 15 minutes and then mounted on adhesive microscope slides (HistoBond microscope slides; #08110001; MARIGNFELD, Lauda K It was transferred to Nigshofen, Germany. Subsequently, the immunocytochemistry procedures were performed as mentioned above. Images were captured using a DS-Qi2 camera (Nikon). 2+ It was acquired using a confocal microscope.

[0234] Analysis of Water-soluble Tetrazolium (WST)-8

[0235] 5×10^3 cells / 100 μl were cloned and seeded into 96-well culture plates. To quantify cell viability, 10 μl of WST-8 reagent (#W0200; GenDEPOT, Barker, Texas, USA) was added to each well of the plate. The plates were incubated at 37°C for 2 hours. Subsequently, absorbance was measured at 450 nm using an epoch spectrometer (BioTek Instruments, Winooski, VT, USA).

[0237] Generation of cisplatin-resistant H1299 cell line

[0238] Cisplatin-resistant cell lines were derived by continuously exposing original parent cell lines to a concentration of 16 μM cisplatin (#P4394, Sigma-Aldrich). Initially, cisplatin-resistant cell lines were treated with 6 μM cisplatin for 72 hours. Subsequently, the cells were maintained while increasing the cisplatin concentration. This development period was carried out for approximately 6 months. IC50 concentrations were re-evaluated using the WST-8 assay in resistant cell lines with concentrations increased to a maximum of 16 μM over 72 hours.

[0240] 3D Spherical Penetration Analysis

[0241] 5 × 10^3 cells were seeded into an ultra-low adhesion 96-well plate (SPL 3D™ Cell Floater Plate; #34896; SPL life sciences) and cultured for 24 hours. Subsequently, the cells were coated with a growth factor-reduced Matrigel matrix (#356231; CORNING, Bedford, MA, USA) for 24 hours. Next, a mixture of 1 mg / ml rat tail type I collagen (#ALX-522-435-0100, Enzo Life Sciences, Farmingdale, NY, USA) was poured into an ultra-low adhesion 24-well plate (SPL 3D™ Cell Floater Plate; #39724; SPL life sciences) and cultured for 1 hour for polymerization. After 1 hour of culture, RPMI 1640 containing serum was added. The spheres were allowed to infiltrate for 48 hours. Penetration was determined by measuring the area of ​​the sphere normalized to the original area of ​​the sphere using NIS-Elements image analysis software (Nikon). For live imaging, images were captured for 30 msec at 30-minute intervals using a Nikon ECLIPSE Ti2 inverted microscopy system (Nikon, Tokyo, Japan) equipped with a digital camera DS-Qi2 (Nikon) for live cell imaging analysis.

[0243] Bioinformatics Analysis

[0244] To analyze DUPS23 mRNA expression, The Cancer Genome Atlas (TCGA) cohort and the Okayama lung cohort were analyzed in the Oncomine database (https: / / www.oncomine.com / ). Kaplan-Meier analysis was performed on the TCGA cohort. Gene Set Enrichment Analysis (GSEA) was conducted using TCGA and RNA-seq data. Gene sets were searchable on GSEA (https: / / www.gsea-msigdb.org / gsea / ). DUPS23 expression in various cell lines was downloaded from The Human Protein Atlas (https: / / www.proteinatlas.org / ), and cisplatin's IC 50 The values ​​were obtained from Genomics of Drug Sensitivity in Cancer (https: / / www.cancerrxgene.org / ).

[0246] Statistical analysis

[0247] All data were expressed as mean ± standard deviation (SD) obtained from two or three independent experiments. Statistical analysis was performed using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). The significance of differences between the resulting data was examined by comparing the two groups using Student's non-paired t-test. For all one-way ANOVAs, Tukey's multiple comparison test was performed as a post-hoc test. The F-value for one-way ANOVA is expressed as F(DFn, DFd) in the figure description, where DFn was considered as the df parameter and DFd as the df denominator. P-values ​​less than 0.05 were considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

[0249] Example 1. Confirmation of a positive correlation between lung cancer onset, progression, prognosis, cancer stem cell characteristics, and high DUSP23 expression

[0250] Example 1-1. Confirmation of lung cancer incidence, progression, and poor prognosis due to increased DUSP23 expression

[0251] To investigate the relationship between DUSP23 and lung cancer onset, progression, and prognosis, mRNA levels of DUSP23 in normal and lung cancer tissues were analyzed using two independent datasets from the Oncomine database.

[0253] As a result, in the TCGA cohort, DUSP23 was upregulated in lung adenocarcinoma (LUAD) compared to normal tissue, and DUSP23 expression in the Okayama lung cohort was also significantly increased in LUAD (Fig. 1a). In addition, Kaplan-Meier analysis showed that LUAD patients with high expression of DUSP23 had shorter disease-free survival (Fig. 1b).

[0255] This suggests that DUSP23 may play an important role in the development, progression, and recurrence of lung cancer.

[0257] Example 1-2. Confirmation of Increased Cancer Stem Cell Characteristics Following Increased DUSP23 Expression

[0258] Based on the fact that cancer stem cells (CSCs) are a major factor in cancer recurrence, a gene set enrichment analysis (GSEA) was performed using the TCGA-LUAD cohort to investigate whether DUSP23 is associated with cancer stem cell characteristics.

[0260] As a result, it was confirmed that GSEA is associated with the upregulation of genes associated with stem cell pathways, including those associated with embryonic stem cells and cancer stem cells, due to high DUSP23 expression (Fig. 1c).

[0262] For a more detailed analysis, A549 non-small-cell lung cancer (NSCLC) cells were cultured with EGF and bFGF in the absence of serum to form cell clusters, and the expression levels of SOX2, ALDH1, and DUSP23 in adherent (ADH) or superfluent (SUS) A549 NSCLC cells were measured (Fig. 1d).

[0264] As a result, the expression of cancer stem cell markers SOX2 and ALDH1 was increased in cell clusters (SUS) compared to adherent cells (ADH). Additionally, DUSP23 expression in cell clusters (SUS) was found to be increased compared to adherent cells (ADH) at both mRNA and protein levels (Fig. 1e).

[0266] This indicates that DUSP23 is associated with cell cluster formation under stem cell promotion conditions.

[0268] Example 2. Confirmation of cancer cell proliferation and size increase due to increased DUSP23 expression

[0269] We evaluated whether DUSP23 affects the proliferative capacity of cells under conditions that promote stem cell-like behavior in cancer stem cell-like cells. For the evaluation, a cell cluster formation assay was performed using A549 cells with DUSP23 KD (knock down) (Fig. 2a).

[0271] As a result, KD of DUSP23 was found to significantly reduce cell cluster formation and decrease the diameter of cell clusters compared to shMock (Fig. 2b). On the other hand, overexpression of DUSP23 in H1299 cells, an NSCLC cell line with relatively low DUSP23 levels, was found to increase cell cluster formation and diameter (Figs. 2a and 2c).

[0273] These results suggest that as the expression level of DUSP23 increases, cell proliferation and size increase are promoted in lung cancer cells under non-adherent, stem cell-promoting conditions.

[0275] Example 3. Confirmation of the cancer stem cell-like growth activity of DUSP23 through the promotion of SOX2 expression

[0276] Example 3-1. Confirmation of the correlation between DUSP23 and cancer stem cell-related gene expression

[0277] To further analyze the role of DUSP23 in promoting characteristics similar to cancer stem cells, RNA-seq analysis was performed on A549 cell clusters with DUSP23 KD (shDUSP23) compared to control (shMock) cells.

[0279] Using larger fold changes and p-values ​​less than 0.05, 788 genes were downregulated and 475 genes were upregulated in the DUSP23 KD cell cluster (Fig. 3a). Additionally, according to the GSEA of differentially expressed genes, stem cell-related gene signatures were found to be significantly more abundant in shMock compared to shDUSP23 (Fig. 3b).

[0281] Example 3-2. Confirmation of the correlation between DUSP23 and signal transduction related to SOX2, a cancer stem cell marker.

[0282] NetPath analysis was performed based on RNA-seq data to further explain the signaling pathway regulated by DUSP23 KD.

[0284] As a result, it was confirmed that various signal transmission pathways are downregulated when DUSP23 is depleted.

[0285] Specifically, the downregulated signaling pathways included those associated with genes upregulated by the epidermal growth factor receptor (EGFR), T cell receptor, and interleukin-4. Additionally, signaling pathways linked to genes downregulated by nuclear factor κB ligand receptor activators and interleukin-1, as well as those associated with transforming growth factor β and thyroid-stimulating hormone, were also found to decrease after DUSP23 depletion (Fig. 3c).

[0287] In particular, GSEA analysis confirmed that the SOX2 target gene is significantly downregulated in DUSP23 KD cells (Fig. 3d).

[0288] A significant decrease in SOX2 expression in DUSP23 KD was detected by RT-qPCR, but it did not affect ALDH1 expression (Fig. 3e). Similarly, protein levels of SOX2 decreased after DUSP23 depletion, whereas SOX2 expression was upregulated when DUSP23 was overexpressed (Fig. 3f).

[0289] In addition, immunofluorescence analysis showed reduced nuclear localization of SOX2 in DUSP23 KD cell clusters (Fig. 3g).

[0291] These results suggest that DUSP23 plays a role in regulating SOX2 mRNA and protein levels, which enhances the nuclear localization of SOX2, a cancer stem cell marker, and may contribute to cancer stem-like characteristics.

[0293] Example 4. Confirmation of increased expression of DUSP23 in cisplatin-resistant cells

[0294] Example 4-1. Confirmation of the correlation between cisplatin resistance and DUSP23 expression levels

[0295] Since cancer stem cells (CSCs) are known to contribute to chemotherapy resistance, the role of DUSP23 in the process of resistance formation was investigated.

[0297] As a result, GSEA showed a positive correlation between DUSP23 expression and genes associated with multiple drug resistance in patients with lung adenocarcinoma (LUAD) (Fig. 4a).

[0299] Since cisplatin is one of the most commonly used chemotherapy agents for NSCLC, we further analyzed whether DUSP23 expression is associated with resistance.

[0301] As a result, it was confirmed that patients with high DUSP23 levels were rich in gene signatures upregulated for cisplatin resistance, while signatures downregulated for cisplatin resistance were depleted (Fig. 4b).

[0302] In addition, DUSP23 mRNA expression in lung cancer cell lines from the Human Protein Atlas, based on data from the Genomics of Drug Sensitivity database, IC50 for cisplatin 50 It showed a positive correlation with the value (less than 20 μM) (Fig. 4c).

[0304] Example 4-2. Confirmation of Significant High Expression of DUSP23 in Cisplatin-Resistant Cell Lines

[0305] Based on the results of Example 4-1, it was analyzed whether DUSP23 forms cisplatin resistance in NSCLC and, as a result, whether it is highly expressed in cisplatin-resistant cell lines.

[0307] First, a cisplatin-resistant (CisR) cell line was established by exposing H1299 cells to progressively increasing concentrations of cisplatin, and various characteristics of the cell line were confirmed.

[0308] As a result, CisR cells showed morphological differences from progenitor cells, and IC for cisplatin 50The value was found to be approximately four times higher than that of parent cells (Fig. 4d). ABCC2, an ABC transporter known to contribute to cisplatin resistance, was highly expressed in CisR cells compared to parent cells (Fig. 4e). Additionally, CisR cells showed increased invasive capacity in the 3D globular invasion assay, which was consistent with the characteristics of known cisplatin-resistant cell lines (Fig. 4f). Furthermore, increased phosphorylation of STAT3 (tyr705) and AKT (ser473), which are downstream of EGFR signaling, was also observed in CisR cells (Fig. 4g).

[0310] These various analysis results characterize CisR cells and highlight their association with cisplatin resistance, proving that a cisplatin-resistant cell line has been produced.

[0312] DUSP23 expression was investigated in the cisplatin-resistant cell line prepared above.

[0313] As a result, DUSP23 expression was found to be significantly upregulated in CisR cells compared to parent cells at both protein and mRNA levels (Fig. 4g and Fig. 4h). In addition, SOX2 expression was increased, and nuclear localization was confirmed to be enhanced in CisR cells (Fig. 4h and Fig. 4i).

[0315] These experimental results suggest that DUSP23 mediates cisplatin resistance, and it was confirmed that it is highly expressed at both protein and mRNA levels in cisplatin-resistant cell lines at statistically significant levels.

[0317] Example 5. Confirmation of therapeutic effect on cisplatin-resistant non-small cell lung cancer by reducing DUSP23 expression

[0318] Since DUSP23 expression is upregulated in both cancer stem cells and CisR cells, Example 5 analyzed whether cisplatin-resistant cells could be treated by inhibiting DUSP23.

[0320] As a result, DUSP23 KD was found to induce downregulation of SOX2 expression in CisR cells (Fig. 5a).

[0321] In addition, DUSP23 KD reduced cell cluster formation and size in CisR H1299 cells (Fig. 5b) and was found to significantly reduce the invasive ability of CisR cells (Fig. 5c).

[0322] Above all, DUSP23 KD was shown to reduce the viability of CisR cells regardless of the presence or absence of cisplatin (Fig. 5d).

[0323] In addition, Western blotting results showed that the levels of cleaved capase-3, a marker of apoptosis, increased in DUSP23 KD CisR cells, and that the phosphorylation of STAT3 and AKT decreased in DUSP23 KD cells (Fig. 5e).

[0325] Taken together, these results demonstrate that downregulation of DUSP23 reduces cancer stem-like characteristics and invasion in cisplatin-resistant cells and promotes apoptosis, proving that DUSP23 can treat chemotherapy-resistant NSCLC.

[0327] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

Claim 1 A pharmaceutical composition for the prevention or treatment of cisplatin-resistant cancer, comprising an inhibitor of the expression or activity of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient. Claim 2 A pharmaceutical composition according to claim 1, wherein the cancer is one or more selected from the group consisting of lung cancer, non-small cell lung cancer, lung adenocarcinoma, large cell carcinoma, small cell lung cancer, testicular cancer, ovarian cancer, cervical cancer, bladder cancer, head and neck cancer, esophageal cancer, mesothelioma, brain tumor, neuroblastoma, head and neck squamous cell carcinoma, and lymphoma. Claim 3 A pharmaceutical composition according to claim 1, wherein the expression or activity inhibitor is one or more selected from the group consisting of compounds, peptides, polynucleotides, antibodies, recombinant vectors, antisense nucleotides, siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats), natural products, peptidomimetic, exosomes, ribozymes, DNAzymes, PNA (peptide nucleic acids), and aptamers. Claim 4 A pharmaceutical composition according to claim 1, wherein the composition is administered in combination with cisplatin. Claim 5 A pharmaceutical composition according to claim 4, wherein the composition is administered concurrently, separately, or sequentially with cisplatin. Claim 6 A pharmaceutical composition according to claim 1, wherein the composition enhances sensitivity to cisplatin. Claim 7 The pharmaceutical composition of claim 1, wherein the composition is characterized by one or more selected from the group consisting of: reducing protein and mRNA levels of SOX2 (SRY-Box Transcription Factor 2); reducing signal transduction and nuclear localization of SOX2; and having no effect on ALDH1 (Aldehyde Dehydrogenase 1 Family Member A1) expression. Claim 8 A pharmaceutical composition according to claim 1, wherein the composition is characterized by having one or more selected from the group consisting of the following with respect to cisplatin-resistant cancer cells: reducing the formation and size of resistant cancer cell clusters; reducing the invasive ability and survival rate of resistant cancer cells; and promoting apoptosis of resistant cancer cells. Claim 9 A kit for the prevention or treatment of cisplatin-resistant cancer, comprising the composition of claim 1 and instructions. Claim 10 A method for providing information for diagnosing resistance to cisplatin in cancer, comprising the following steps: (S1) measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a subject; and (S2) determining that resistance to cisplatin is present if the protein or mRNA expression level of DUSP23 is increased compared to the protein or mRNA expression level of DUSP23 in a biological sample isolated from a control. Claim 11 A method of providing information, wherein the biological sample is one or more selected from the group consisting of cells, tissues, serum, blood, whole blood, plasma, urine, saliva, trachea, bone marrow, fine needle aspiration specimens, core needle biopsy specimens, and vacuum aspiration biopsy specimens. Claim 12 A composition for determining cisplatin-resistant cancer subjects, comprising as an active ingredient a preparation for measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23). Claim 13 A kit for determining cisplatin-resistant cancer subjects, comprising the composition of claim 12 and instructions. Claim 14 In Clause 13, the above instruction manual is a judgment kit in which the information provision method of Clause 10 is taught. Claim 15 A screening method for a substance for preventing or treating resistance to cisplatin in cancer, comprising the following steps: (S1) measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a cisplatin-resistant animal model or cell model of cancer treated with the candidate substance; and (S2) selecting the candidate substance as a substance for preventing or treating resistance to cisplatin in cancer if the protein or mRNA expression level of DUSP23 is reduced. Claim 16 A composition for screening substances for preventing or treating resistance to cisplatin in cancer, comprising as an active ingredient a preparation for measuring protein or mRNA levels of DUSP23 (Dual-specificity phosphatase 23). Claim 17 A kit for screening substances for preventing or treating resistance to cisplatin in cancer, comprising the composition of claim 16 and instructions. Claim 18 In paragraph 17, the above instruction manual is a screening kit in which the screening method of paragraph 15 is taught. Claim 19 A pharmaceutical composition for inhibiting or improving resistance to cisplatin in individuals who have or are expected to have resistance to cisplatin in cancer, comprising an expression or activity inhibitor of DUSP23 (Dual-specificity phosphatase 23) as an active ingredient. Claim 20 A method for characterizing a responder to cisplatin for cancer treatment, the method comprising the following steps: (S1) measuring the protein or mRNA expression level of DUSP23 (Dual-specificity phosphatase 23) in a biological sample isolated from a cancer subject; and (S2) determining a responder to cisplatin if the protein or mRNA expression level of DUSP23 is reduced compared to the protein or mRNA expression level of DUSP23 in a biological sample isolated from a control. Claim 21 A composition for responder characterization to cisplatin for cancer treatment, comprising as an active ingredient a preparation for measuring protein or mRNA levels of DUSP23 (Dual-specificity phosphatase 23). Claim 22 A kit for responder characterization to cisplatin for cancer treatment, comprising the composition of claim 21 and instructions. Claim 23 In paragraph 22, the above description is a reactor characterization kit in which the reactor characterization method of paragraph 20 is taught.

Images