Pharmaceutical composition containing elastin and method of using the same

Abstract

The present invention provides a pharmaceutical composition comprising an exosome encapsulating one or more cargo RNAs containing package RNA and one or more fusion proteins, wherein the nucleotide sequence of the package RNA is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence of an elastin (ELN) gene or elastin messenger RNA (mRNA) also containing any isoform. Additionally, the present invention provides a method for treating an elastin deficiency-related disease in a subject using the pharmaceutical composition of the present invention.

Description

Technology Field

[0001] The present invention provides a polynucleotide composition capable of upregulating the expression of elastin (ELN) and a method of using and treating with the same. Background Technology

[0002] The skin is an organ that functions as an external protective layer and is continuously damaged by external factors including burns, cuts, ultraviolet (UV) radiation, and infrared radiation (1), and over time, its structural integrity and tensile strength are lost. The skin is mainly composed of elastin and collagen, which are the major fibers that form the extracellular matrix of the skin. Elastin provides elasticity to the skin, and collagen is responsible for tensile strength. Elastin is an extracellular matrix (ECM) protein responsible for elastic recovery in many vertebrate tissues and is a long-lived protein that has a half-life of about 70 years in humans and is slowly degraded.

[0003] Humans are born with all the elastin necessary for their entire life, and this elastin is not easily replenished during the normal human life cycle. Replenishing elastin by topical application or microneedle administration to the skin can influence tissue and wound healing, and may also aid in the improvement of scars, burns, or sagging and wrinkled skin. Therefore, there is a need for therapeutically effective compositions and methods capable of upregulating elastin expression in humans while eliminating or mitigating negative effects on the skin.

[0004] References

[0005] 1. Shapiro SD, Endicott SK, Province MA, Pierce JA, Campbell EJ. Marked longevity of human lung parenchymal elastic fibers deduced from prevalence of D-aspartate and nuclear weapons-related radiocarbon. J Clin Invest. 1991;87(5):1828-34. doi: 10.1172 / JCI115204. PubMed PMID: 2022748; PMCID: PMC295305.

[0006] The present invention provides a pharmaceutical composition comprising an exosome encapsulating one or more cargo RNAs and one or more fusion proteins, wherein the fusion protein comprises an exosome-associated transmembrane protein fused to a packaging protein; the cargo RNA comprises a packaging RNA and a packaging domain; the packaging protein may bind to the packaging domain to form a fusion protein-cargo RNA complex; and the packaging RNA comprises an elastin protein-coding polynucleotide, wherein the nucleotide sequence of the elastin protein-coding polynucleotide is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence of the elastin gene or elastin messenger RNA (mRNA). Furthermore, the present invention provides a method for treating an elastin-related disease in a subject, comprising the step of administering a therapeutically effective amount of the pharmaceutical composition of the present invention to a subject. Brief explanation of the drawing

[0007] Figure 1 illustrates an elastin mRNA expression plasmid. The hygromycin-selectable mRNA expression plasmid expresses a recombinant ELN gene containing a 3' distal packaging domain that interacts with U1a RBS and CDbox-labeled L7ae and U1a downstream of the stabilized GC MorrisMotif. Figure 2 illustrates the CD63-L7ae RNA packaging plasmid p25. The blastocidin-resistant CD63-L7ae expression RNA packaging motif can bind to CD domains at the 3' tail of the ELN (p16) and package them. A CD63 exosome-specific fusion protein is expressed from this construct. Figure 3 illustrates the CD63-U1a RNA packaging plasmid p26. The blastocidin-resistant CD63-U1a expression RNA packaging motif can bind to UR domains at the 3' tail of the ELN (p16) to package it. A CD63 exosome-specific fusion protein is expressed from this construct. Figure 4 illustrates the PTGFRN-U1a RNA packaging plasmid p27. The puromycin-resistant PTGFRN-U1a expression RNA packaging motif can bind to UR domains at the 3' tail of the ELN (p16) to package it. A PTGFRN exosome-specific fusion protein is expressed from this construct. Figure 5 illustrates the CD81-U1a RNA packaging plasmid p28. The puromycin-resistant CD81-U1a expression RNA packaging motif can bind to UR domains at the 3' tail of the ELN (p16) to package it. A PTGFRN exosome-specific fusion protein is expressed from this construct. Figure 6 illustrates the EV enhancer plasmid p30. The neomycin-resistant connexin 43 and the cleaved myoferlin-expressing EV enhancer plasmid are based on the research described in our provisional patent application (title of the invention is "Low Immunogenic Exosome-Based RNA Package and Delivery System, Composition and Method of Preparation"). Figure 7 illustrates several embodiments of fusion proteins encoding plasmids of the exosome-based RNA package and delivery system of the present invention for the delivery of GFP mRNA. CD63-L7ae+PTGFRN-U1a and CD81-U1a package and deliver GFP mRNA to EVs. Recipient cells for GFP mRNA were evaluated in comparison to transiently transfected producer HEK293 cells. In a transwell assay, the relative proportion of GFP mRNA in recipient cells was determined after 48 hours of incubation with untreated recipient HEK293 cells and standardized against producer cells. The mean of three repeated values ​​of the treated cells is shown along with the standard error of the mean. A significant difference is indicated by (**) where P<0.01 in the paired T-test against unpackaged GFP control cells. The dual fusion proteins package GFP mRNA into exosomes. CD63-L7ae+PTGFRN-U1a and CD63-U1a+PTGFRN-U1a package GFP mRNA into EVs, but the efficiency is within the range of non-specific packaging of the GFP control group in which the fusion protein is not present. FIG. 8 illustrates several embodiments of the exosome-based RNA package and delivery system of the present invention, comprising two fusion protein-coding plasmids for the delivery of GFP mRNA. Specific details for implementing the invention

[0008] The singular forms "one" and "he / she" used in this specification and claims include the plural form unless the context clearly indicates otherwise. Thus, for example, "one component" is understood to include a mixture of components, and "one active pharmaceutical preparation" is understood to include two or more active pharmaceutical preparations.

[0009] The term "about" used here is a modifier for the amount, and means + or -20%, + or -15%, + or -10%, or + or -5% including the modified amount.

[0010] As used herein, the terms "protein domain" or "domain" refer to any region of the polypeptide of a protein. In one embodiment, the protein domain folds itself into a compact structure independently of the rest of the polypeptide region. In one embodiment, identical or similar domains within different proteins may share similar or identical functions. For example, the Perlin protein contains multiple C2 domains and transmembrane domains, and sometimes includes a Fer domain, a DysF domain, or a combination thereof.

[0011] As used herein, the term "nucleic acid" refers to nucleotides in single-, double-, or multi-stranded forms (e.g., deoxyribonucleotides or ribonucleotides) and their polymers or complements. The terms "polynucleotide," "oligonucleotide," "oligo," etc., refer to linear sequences of nucleotides in the general and common sense. The term "nucleotide" refers to a single unit of a polynucleotide, i.e., a monomer, in the general and common sense. A nucleotide may be a ribonucleotide, a deoxyribonucleotide, or a modified version thereof. Examples of nucleic acids considered herein include single- and double-stranded DNA, single- and double-stranded RNA, and hybrid molecules having a mixture of single- and double-stranded DNA and RNA. Examples of nucleic acids considered herein include any type of RNA (e.g., antisense RNA, mRNA, siRNA, miRNA, shRNA, guide RNA, Dicer substrate RNA, Dicer substrate siRNA (dsiRNA) (dsiRNA is cleaved by the RNase type I endoribonuclease Dicer into a 21-23 base duplex containing a 2-base 3'-overhang siRNA)), and any type of DNA, genomic DNA, plasmid DNA, and minicircle DNA, and any fragments thereof. The term "duplex" refers to double-strandedness in the general and common sense in relation to nucleic acids. Nucleic acids may be linear or branched. For example, nucleic acids may be linear chains of nucleotides, or nucleic acids may be branched, for example, nucleic acids may contain one or more nucleotide arms or branches. Optionally branched nucleic acids branch repeatedly to form higher-order structures such as dendrimers.In one embodiment, the nucleotide sequence is provided using the symbol ATCG (adenine (A), cytosine (C), guanine (G), and thymine (T)) for the DNA molecule, and the RNA molecule is provided using the symbol AUCG (adenine (A), cytosine (C), guanine (G), and uracil (U)). In one embodiment, the symbols T and U are used interchangeably in the nucleotide sequence and represent the DNA and RNA produced according to the nucleotide sequence, respectively.

[0012] The terms “polypeptide,” “peptide,” and “protein” as used herein generally refer to polymers of amino acid residues. These terms also apply to amino acid polymers where one or more amino acids are chemical analogs or modified derivatives of the corresponding naturally occurring amino acids, or are non-natural amino acids. The term “protein” generally refers to a polymer of amino acids linked together by peptide bonds to form a polypeptide of chain length sufficient to produce a tertiary and / or quaternary structure. In one embodiment, the “polypeptide,” “peptide,” or “protein” of the present invention is prepared from a plasmid encoding said “polypeptide,” “peptide,” or “protein.” Accordingly, the “polypeptide,” “peptide,” or “protein” of the present invention further comprises a nucleotide sequence encoding said “polypeptide,” “peptide,” or “protein,” which may be converted using a genetic code such as a standard genetic code, but is not limited to.

[0013] The terms "sequence identity" and "% identity" used herein refer to values ​​determined by comparing two optimally aligned sequences within a comparison interval, wherein a portion of the sequences within the comparison interval may include additions or deletions when compared to the reference sequence used for the optimal alignment of the two sequences. The number of matching positions is calculated by determining the number of locations where identical amino acid residues occur in both sequences, dividing this by the total number of locations in the comparison interval, and multiplying the result by 100 to obtain the sequence identity percentage. Unless otherwise specified, the comparison interval is the entire length of the sequence.

[0014] The "% similarity" used herein is calculated as described for "% identity," except that the hydrophobic residues Ala, Val, Phe, Pro, Leu, Ile, Trp, Met, and Cys are similar; the basic residues Lys, Arg, and His are similar; the acidic residues Glu and Asp are similar; and the hydrophilic, uncharged residues Gln, Asn, Ser, Thr, and Tyr are similar. The remaining natural amino acid Gly is not similar to any other amino acid.

[0015] As used herein, the terms “object,” “individual,” or “patient” are used interchangeably and refer to vertebrates, preferably mammals, more preferably humans. Mammals include, but are not limited to, rodents, primates, humans, farm animals, race animals, and pets.

[0016] As used herein, the terms “effective dose” or “therapeutic effective dose” of a drug, compound, pharmacological active agent, or pharmaceutical composition include administering an amount necessary to achieve a desired result. The exact amount required will vary depending on the subject and depends on the subject’s species, age, general condition, severity of the disease, specific active agent, mode of administration, desired result, etc. In a specific embodiment of the invention, the “therapeutic effective dose” of a drug, compound, pharmacological active agent, or pharmaceutical composition is an amount effective to increase protein expression by 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100%, about 200%, 400%, 600%, 800%, 1000%, or any percentage or range of percentages included in these values. In a specific embodiment of the present invention, a “therapeutic effective amount” of a drug, compound, pharmacological active agent, or pharmaceutical composition is an amount effective for increasing the expression of a protein to the extent that the amount of the corresponding protein in the subject recovers to the same level as it was about 1 year, about 2 years, about 3 years, about 5 years, about 10 years, about 12 years, about 14 years, about 16 years, about 18 years, about 20 years, about 25 years, about 30 years, about 35 years, about 40 years, about 50 years, about 60 years, about 70 years, or about 80 years ago. In a specific embodiment of the present invention, a “therapeutic effective amount” of a drug, compound, pharmacological active agent, or pharmaceutical composition is an amount effective for inhibiting or reversing the progression of the disease disclosed here in the subject or biological sample (e.g., cell). In certain embodiments, disease progression is inhibited by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 100%, or any percentage or range of percentages included in these values.In certain embodiments, the drug, compound, pharmacological active agent, or pharmaceutical composition inhibits disease progression by at least about 25%, at least about 50%, at least about 75%, at least about 90%, or at least about 100%, or any percentage or percentage range included in these values. In certain embodiments of the invention, “therapeutic effective amount” refers to an amount of the drug, compound, pharmacological active agent, or pharmaceutical composition sufficient to cause reversal of the disease. In certain embodiments, the disease is reversed by about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100%, or any percentage or percentage range included in these values.

[0017] As used herein, the terms “target” or “targeting” of polynucleotides include regulating the expression level, biological function, or a combination thereof of said polynucleotides. In one embodiment, regulation includes direct regulation or indirect regulation. Indirect regulation includes regulating the expression level, biological function, or a combination thereof of said polynucleotides through an additional regulator. In one embodiment, the additional regulator includes antisense RNA.

[0018] The terms "ELN," "elastin," or "tropoelastin" as used herein are used interchangeably and refer to a polynucleotide or polypeptide encoding the elastin protein or any variant thereof.

[0019] The present invention provides one or more polynucleotides encoding an elastin protein or a variant thereof, wherein the nucleotide sequence of each of the one or more polynucleotides is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence of an elastin gene (ELN) or elastin messenger RNA (mRNA). In one embodiment, the elastin gene or mRNA may comprise any isoform thereof. In one embodiment, the elastin mRNA isoform is derived from alternative splicing of the ELN gene. In one embodiment, the elastin protein-coding polynucleotide of the present invention has an amino acid sequence of the elastin protein that is SEQ ID NO. It encodes an elastin protein that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to 1.

[0020]

[0021] In one embodiment, the elastin-coding polynucleotide of the present invention has a length of about 500 to about 5000 nucleotides (nt), e.g., about 500 nt, about 750 nt, about 1000 nt, about 1250 nt, about 1500 nt, about 1750 nt, about 2000 nt, about 2250 nt, about 2500 nt, about 2750 nt, about 3000 nt, about 3250 nt, about 3500 nt, about 3750 nt, about 4000 nt, about 4250 nt, about 4500 nt, about 4750 nt, or about 5000 nt. In one embodiment, the elastin-coding polynucleotide of the present invention has a length of about 500 to about 1000 nt, a length of about 1000 to about 2000 nt, a length of about 2000 to about 3000 nt, a length of about 3000 to about 4000 nt, or a length of about 4000 to about 5000 nt. In one embodiment, the nucleotide sequence of the elastin-coding polynucleotide of the present invention is ENST00000252034.12, ENST00000380575.8, ENST00000429192.5, ENST00000357036.9, ENST00000380576.9, ENST00000445912.5, ENST00000320492.11, ENST00000414324.5, ENST00000380562.8, ENST00000380584.8, ENST00000458204.5, ENST00000621115.4, or deposited in the Ensembl Genome Browser (http: / / asia.ensembl.org / index.html). The nucleotide sequence of ENST00000692049.1 is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% identical. In one embodiment, the nucleotide sequence of the elastin-coding polynucleotide of the present invention is from the NCBI CCDS database (https: / / www.ncbi.nlm.nih.gov / CCDS / CcdsBrowse.The nucleotide sequence of CCDS 5562.2, CCDS 43598.1, CCDS 43599.1, CCDS 47611.1, CCDS 47612.1, CCDS 64673.1, CCDS 64674.1, CCDS 64675.1, CCDS 64676.1, CCDS 64677.1, CCDS 64678.1, CCDS 75616.1, or CCDS 75617.1 deposited in cgi) is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% identical to that of CCDS 5562.2, CCDS 43598.1, CCDS 43599.1, CCDS 47611.1, CCDS 47612.1, CCDS 64673.1, CCDS 64674.1, CCDS 64675.1, CCDS 64676.1, CCDS 64678.1, CCDS 75616.1, or CCDS 75617.1. In one embodiment, the nucleotide sequence of the elastin-coding polynucleotide of the present invention is SEQ ID NO. The nucleotide sequence of 2 is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% identical. In one embodiment, the nucleotide sequence of the elastin-coding polynucleotide of the present invention is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence of SEQ ID NO. 3.

[0022]

[0023] SEQ ID NO. 3(ENST00000252034.12(ELN) length=3397, elastin cipher sequence is represented in uppercase, and 5' and 3' UTRs are represented in lowercase):

[0024]

[0025]

[0026] Additionally, the present invention provides a pharmaceutical composition comprising nanoparticles encapsulating any one or more embodiments of the elastin-coding polynucleotides of the present invention. In one embodiment, the nanoparticles comprise chemical nanoparticles, such as but not limited to lipid nanoparticles, polymer nanoparticles, lipid-polymer hybrid nanoparticles, and biological nanoparticles, such as but not limited to liposomes, exosomes, viruses, or virus-like particles.

[0027] In one embodiment, the nanoparticle comprises an exosome. In one embodiment, the exosome comprises one or more fusion proteins and one or more cargo RNAs. In one embodiment, one or more fusion proteins each comprise an exosome-associated transmembrane protein fused with a packaging protein. In one embodiment, the packaging protein is endogenous to the target. In one embodiment, one or more cargo RNAs each comprise a packaging RNA and a packaging domain. In one embodiment, the packaging RNA comprises any embodiment of the elastin protein-coding polynucleotide of the present invention. In one embodiment, the nanoparticle comprises an exosome produced from an exosome-based packaging and delivery system. In one embodiment, the system is a low-immunogenic exosome-based packaging and delivery system. In one embodiment, the exosome-based RNA packaging and delivery system comprises an exosome-producing cell, a cargo RNA-coding plasmid, and one or more fusion protein-coding plasmids. In one embodiment, the cargo RNA comprises a package RNA and a packaging domain, wherein the package RNA comprises any embodiment of the elastin protein-coding polynucleotide of the present invention. In one embodiment, the fusion protein comprises an exosome-associated transmembrane protein fused with the packaging protein. In one embodiment, an exosome-producing cell may express the cargo RNA when transfected with a cargo RNA-coding plasmid. In one embodiment, an exosome-producing cell may express the fusion protein when transfected with a fusion protein-coding plasmid. In one embodiment, the exosome-associated transmembrane protein comprises CD9, CD37, CD53, CD63, CD68, CD81, CD82, LAMP-1, LAMP-2A, LAMP-2B, LAMP-2C, lactadeherin, or PTGFRN. In one embodiment, the packaging protein comprises an RNA-binding protein. In one embodiment, the packaging protein is endogenous to the target.Several embodiments of a recombinant fusion protein comprising an exosome-associated transmembrane protein and a packaging protein are disclosed in PCT application PCT / US2021 / 026892 (filed April 12, 2021) and U.S. provisional patent application US63 / 598,499, the contents of which are incorporated herein by reference in their entirety. In one embodiment, the packaging protein comprises a U1a protein.

[0028] In one embodiment, one or more fusion proteins comprise a CD63-U1a protein. In one embodiment, the nucleotide sequence of the CD63-U1a fusion protein of the present invention is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 4. In one embodiment, the amino acid sequence of the CD63-U1a fusion protein is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 5. In one embodiment, one or more fusion proteins comprise a CD81-U1a protein. In one embodiment, the nucleotide sequence of the CD81-U1a fusion protein of the present invention is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 6. In one embodiment, the amino acid sequence of the CD81-U1a fusion protein is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 7. In one embodiment, one or more fusion proteins comprise the PTGFRN-U1a protein. In one embodiment, the nucleotide sequence of the PTGFRN-U1a fusion protein of the present invention is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 8. In one embodiment, the amino acid sequence of the PTGFRN-U1a fusion protein is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 9.

[0029]

[0030] The uppercase sequence represents CD63, the lowercase sequence is the linker sequence, and the sequence in bold is U1 micronucleus ribonucleoprotein polypeptide A (U1 snRNP A).

[0031]

[0032] The uppercase sequence represents CD63, the lowercase sequence is the linker sequence, and the sequence in bold is U1 micronucleus ribonucleoprotein polypeptide A (U1 snRNP A).

[0033]

[0034]

[0035]

[0036]

[0037]

[0038] In one embodiment, the cargo RNA comprises a packaging domain capable of binding to a packaging protein of a package RNA and a fusion protein, wherein the package RNA comprises any embodiment of one or more elastin-coding polynucleotides of the present invention. In one embodiment, the packaging domain comprises a UR domain. In one embodiment, the nucleotide sequence of the UR domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 10 or SEQ ID NO. 11. In one embodiment, the cargo RNA further comprises a stabilization domain. In one embodiment, the stabilization domain comprises a MorrisMotif domain and / or an OH domain, the nucleotide sequence of the OH domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 12, and the nucleotide sequence of the MorrisMotif domain is SEQ ID NO. It is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to 13.

[0039] SEQ ID NO. 10: AATCCATTGCACTCCGGATT

[0040] SEQ ID NO. 11: AATCCATTGCACTCCGGATTT

[0041] SEQ ID NO. 12: CTGCAGATATCCAGCACAGTGGC

[0042] SEQ ID NO. 13: GCGCAGCGCGCGCAGCGC

[0043] In one embodiment, the cargo RNA further comprises a SINE-derived nuclear RNA LocalizatIoN(SIRLOIN) sequence, and the SIRLOIN sequence is located upstream of the UR sequence of the cargo RNA. In one embodiment, the nucleotide sequence of the SIRLOIN sequence is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 14.

[0044] SEQ ID NO. 14: CGCCTCCCGGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGA

[0045] In one embodiment, a cargo RNA comprising elastin mRNA, one or more UR domains and one or more stabilization domains comprises a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 15.

[0046]

[0047] In one embodiment, a pharmaceutical composition comprising a nanoparticle encapsulating any embodiment of one or more elastin protein-coding polynucleotides of the present invention further comprises a nanoparticle payload release enhancer. In one embodiment, the nanoparticle release enhancer enhances the release of the payload from the nanoparticle by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, or at least about 25-fold.

[0048] In one embodiment, the nanoparticle payload release enhancer comprises a modified myoferlin protein. In one embodiment, the modified myoferlin protein comprises C2F, C2G, a transmembrane domain, or a combination thereof. In one embodiment, the modified myoferlin protein consists of C2F, C2G, and a transmembrane domain. In one embodiment, the modified myoferlin protein consists of domains selected from the group consisting of C2F, C2G, and a transmembrane domain. In one embodiment, the amino acid sequence of the C2F domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 16. In one embodiment, the amino acid sequence of the C2G domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 17. In one embodiment, the amino acid sequence of the transmembrane domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 18.

[0049]

[0050] In one embodiment, the modified myoferlin protein comprises C2A, FerA, FerB, DysFN, a transmembrane domain, or a combination thereof. In one embodiment, the modified myoferlin protein consists of C2A, FerA, FerB, DysFN, and a transmembrane domain. In one embodiment, the modified myoferlin protein consists of domains selected from the group consisting of C2A, FerA, FerB, DysFN, and a transmembrane domain. In one embodiment, the amino acid sequence of the C2A domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 19. In one embodiment, the amino acid sequence of the FerA domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 20. In one embodiment, the amino acid sequence of FerB is SEQ ID NO. It is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to 21. In one embodiment, the DysFN domain comprises DysFN-1, DysFN-2, or a combination thereof. In one embodiment, the amino acid sequence of DysFN-1 is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 22. In one embodiment, the amino acid sequence of DysFN-2 is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 23. In one embodiment, the amino acid sequence of the transmembrane domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 18.

[0051]

[0052] In one embodiment, any embodiment of the modified myoperlin protein of the present invention further comprises C2B, C2C, C2D, C2E domains, or a combination thereof. In one embodiment, the amino acid sequence of the C2B domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 24. In one embodiment, the amino acid sequence of the C2C domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 25. In one embodiment, the amino acid sequence of C2D is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 26. In one embodiment, the amino acid sequence of C2E is SEQ ID NO. 27 is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar.

[0053]

[0054] In one embodiment, the modified myoferlin protein of the present invention does not contain a C2A domain, wherein the amino acid sequence of the C2A domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 19. In one embodiment, the modified myoferlin protein of the present invention does not contain a C2B domain, wherein the amino acid sequence of the C2B domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 24. In one embodiment, the modified myoferlin protein of the present invention does not contain a C2C domain, wherein the amino acid sequence of the C2C domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 25. In one embodiment, the modified myoferlin protein of the present invention does not contain a C2D domain, wherein the amino acid sequence of the C2D domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 26. In one embodiment, the modified myoferlin protein of the present invention does not contain a C2E domain, wherein the amino acid sequence of the C2E domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 27. In one embodiment, the modified myoferlin protein of the present invention does not contain a C2F domain, wherein the amino acid sequence of the C2F domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 16. In one embodiment, the modified myoperlin protein of the present invention does not contain a C2G domain, wherein the amino acid sequence of the C2G domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 17.In one embodiment, the modified myoferlin protein of the present invention does not contain a FerA domain, wherein the amino acid sequence of the FerA domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 20. In one embodiment, the modified myoferlin protein of the present invention does not contain a FerB domain, wherein the amino acid sequence of the FerB domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 21. In one embodiment, the modified myoferlin protein of the present invention does not contain a DysFN-1 domain, wherein the amino acid sequence of the DysFN-1 domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 22. In one embodiment, the modified myoferlin protein of the present invention does not contain a DysFN-2 domain, wherein the amino acid sequence of the DysFN-2 domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 23. In one embodiment, the modified myoferlin protein of the present invention does not contain a transmembrane domain, wherein the amino acid sequence of the transmembrane domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 18.

[0055] In one embodiment, the modified myoperlin protein of the present invention comprises an amino acid sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 28.

[0056]

[0057] In one embodiment, any embodiment of the modified myoferlin protein of the present invention is in the form of a polynucleotide encoding said modified myoferlin protein. In one embodiment, any embodiment of the modified myoferlin protein of the present invention comprises a polynucleotide encoding a C2A domain, a C2B domain, a C2C domain, a C2D domain, a C2E domain, a C2F domain, a C2G domain, a FerA domain, a FerB domain, a DysFN-1 domain, a DysFN-2 domain, a transmembrane domain, or a combination thereof. In one embodiment, the C2A domain is encoded by a polynucleotide comprising a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 29. In one embodiment, the C2B domain is SEQ ID NO. It is encoded by a polynucleotide containing a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to 30. In one embodiment, the C2C domain is encoded by a polynucleotide containing a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 31. In one embodiment, the C2D domain is encoded by a polynucleotide containing a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 32. In one embodiment, the C2E domain is SEQ ID NO. 33 is encoded by a polynucleotide containing at least about 80%, about 85%, about 90%, about 95%, or about 100% identical nucleotide sequence. In one embodiment, the C2F domain is encoded by a polynucleotide containing at least about 80%, about 85%, about 90%, about 95%, or about 100% identical nucleotide sequence to SEQ ID NO.34.In one embodiment, the C2G domain is encoded by a polynucleotide containing a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 35. In one embodiment, the FerA domain is encoded by a polynucleotide containing a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 36. In one embodiment, the FerB domain is encoded by a polynucleotide containing a nucleotide sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 37. In one embodiment, the DysFN-1 domain is SEQ ID NO. It is encoded by a polynucleotide containing at least about 80%, about 85%, about 90%, about 95%, or about 100% identical nucleotide sequence to SEQ ID NO. 39. In one embodiment, the DysFN-2 domain is encoded by a polynucleotide containing at least about 80%, about 85%, about 90%, about 95%, or about 100% identical nucleotide sequence to SEQ ID NO. 39. In one embodiment, the transmembrane domain is encoded by a polynucleotide containing at least about 80%, about 85%, about 90%, about 95%, or about 100% identical nucleotide sequence to SEQ ID NO. 40.

[0058]

[0059]

[0060]

[0061]

[0062] In one embodiment, the modified myoferlin protein of the present invention further comprises a connexin 43 protein, and said dual protein comprising the modified myoferlin protein and the connexin 43 protein can substantially enhance the efficacy and delivery of an RNA or nucleic acid payload. In one embodiment, the connexin protein comprises an S368A mutation. In one embodiment, the connexin protein of the present invention comprises an amino acid sequence that is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 41.

[0063]

[0064] In one embodiment, a dual protein comprising a modified myoperlin protein fused with a connexin 43 protein is encoded by a polynucleotide whose nucleotide sequence is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 42.

[0065]

[0066]

[0067] In one embodiment, any embodiment of a nanoparticle encapsulating the polynucleotide of the present invention upregulates the expression of the ELN gene in a subject by at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 500%, about 750%, or about 1000% compared to the expression level of the ELN gene in the subject before administering the polynucleotide of the present invention to the subject. In one embodiment, any embodiment of the nanoparticle encapsulating the polynucleotide of the present invention upregulates the expression of the ELN gene in the subject so that the total amount of elastin in the subject is restored to the same total amount as about 1 year, about 2 years, about 3 years, about 5 years, about 10 years, about 12 years, about 14 years, about 16 years, about 18 years, about 20 years, about 25 years, about 30 years, about 35 years, about 40 years, about 50 years, about 60 years, about 70 years, and about 80 years ago. In one embodiment, any embodiment of the nanoparticle encapsulating the polynucleotide of the present invention upregulates the expression of the ELN gene in the subject so that the total amount of elastin in the subject is restored to the same total amount of elastin as that of a normal, healthy human being of a younger age than the subject by about 1 year, about 2 years, about 3 years, about 5 years, about 10 years, about 12 years, about 14 years, about 16 years, about 18 years, about 20 years, about 25 years, about 30 years, about 35 years, about 40 years, about 50 years, about 60 years, about 70 years, and about 80 years.

[0068] In one embodiment, any embodiment of the nanoparticle encapsulating the polynucleotide of the present invention restores the expression of the ELN gene in a subject to at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the normal ELN gene expression level of a healthy subject. In one embodiment, any embodiment of the nanoparticles encapsulating the polynucleotide of the present invention restores the expression of the ELN gene to at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the normal ELN expression level of an average healthy human. In one embodiment, any embodiment of the nanoparticle encapsulating the polynucleotide of the present invention restores the expression of the ELN gene to at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the normal ELN expression level of an average healthy human with the same biological information such as age, sex, height, weight, etc.

[0069] In one embodiment, any embodiment of the nanoparticles encapsulating the polynucleotide of the present invention increases the ratio of non-mutated:mutated ELN gene transcripts in the target. In one embodiment, any embodiment of the nanoparticles encapsulating the polynucleotide of the present invention increases the ratio of non-mutated:mutated ELN gene transcripts by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, or about 500%. In one embodiment, ELN gene expression in the subject comprises disease-related deletions or mutations. In one embodiment, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 54%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of ELN gene expression in the subject comprises disease-related deletions or mutations. In one embodiment, the disease is an ELN-related disease. In one embodiment, the subject is diagnosed with an ELN-related disease. In one embodiment, ELN-related diseases include supravalveolar stenosis (SVAS), autosomal dominant cutaneous laxity, Marfan syndrome, alpha1-antitrypsin deficiency-associated emphysema, atherosclerosis, Buschke-Ohlendorff syndrome, Menkes syndrome, elastofibular pseudoxanthoma, and Williams syndrome. In one embodiment, the subject is in a state of elastin deficiency. The elastin deficiency in the subject may be the result of aging, injury, or any disease causing such deficiency. In one embodiment, the subject requires cosmetic treatment such as scar correction or correction of burnt skin, sagging skin, or wrinkled skin.In one embodiment, the object includes cells, tissues, or organs of mammals such as humans or mice.

[0070] Additionally, the present invention provides a method for altering ELN gene expression in a subject. In one embodiment, the method for altering ELN gene expression in a subject comprises upregulation of ELN gene expression, restoration of ELN gene expression, or increase in the ratio of non-mutated to mutated ELN gene transcripts in the subject. In one embodiment, the method for altering ELN gene expression of the present invention comprises the step of administering a therapeutically effective amount of any embodiment of a pharmaceutical composition comprising a polynucleotide of the present invention. In one embodiment, a method for modifying ELN gene expression in a subject according to the present invention upregulates the expression of the ELN gene in a subject by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 500%, about 750%, or about 1000% compared to the level of ELN gene expression in the subject before administering the polynucleotide of the present invention to the subject. In one embodiment, a method for changing ELN gene expression in a subject according to the present invention upregulates the expression of the ELN gene in the subject so that the total amount of elastin in the subject is restored to the same total amount as about 1 year, about 2 years, about 3 years, about 5 years, about 10 years, about 12 years, about 14 years, about 16 years, about 18 years, about 20 years, about 25 years, about 30 years, about 35 years, about 40 years, about 50 years, about 60 years, about 70 years, and about 80 years ago.In one embodiment, a method for changing ELN gene expression in a subject according to the present invention upregulates the expression of the ELN gene in the subject so that the total amount of elastin in the subject is restored to the same total amount of elastin as that of a normal, healthy human being of a younger age than the subject by about 1 year, about 2 years, about 3 years, about 5 years, about 10 years, about 12 years, about 14 years, about 16 years, about 18 years, about 20 years, about 25 years, about 30 years, about 35 years, about 40 years, about 50 years, about 60 years, about 70 years, and about 80 years.

[0071] In one embodiment, a method for altering ELN gene expression in a subject restores the expression of the ELN gene in the subject to at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the normal ELN gene expression level of the subject when healthy. In one embodiment, a method for altering ELN gene expression in a subject restores the expression of the ELN gene to at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the normal ELN expression level of an average healthy human. In one embodiment, a method for altering ELN gene expression in a subject restores the expression of ELN genes to at least about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the normal ELN expression level of an average healthy human with the same biological information such as age, sex, height, weight, etc., or a combination thereof. In one embodiment, a method for altering ELN gene expression in a subject increases the ratio of non-mutated:mutated ELN gene transcripts in the subject.In one embodiment, a method for altering ELN gene expression in a subject increases the ratio of non-mutated to mutated ELN gene transcripts by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, or about 500%. In one embodiment, ELN gene expression in a subject comprises disease-related deletions or mutations. In one embodiment, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 54%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of ELN gene expression in the subject comprises disease-related deletions or mutations. In one embodiment, the disease is an ELN-related disease. In one embodiment, the subject is diagnosed with an ELN-related disease. In one embodiment, ELN-related diseases include supravalvular aortic stenosis (SVAS), autosomal dominant cutaneous laxity, Marfan syndrome, alpha1-antitrypsin deficiency-associated emphysema, atherosclerosis, Buschke-Ohlendorff syndrome, Menkes syndrome, elastic pseudoxanthoma, and Williams syndrome. In one embodiment, the subject is in a state of elastin deficiency. The elastin deficiency in the subject may be the result of aging, injury, or any disease causing such deficiency. In one embodiment, the subject requires cosmetic treatment, such as scar correction or correction of burnt skin, sagging skin, or wrinkled skin. In one embodiment, the subject comprises cells, tissues, or organs of a mammal, such as a human or a mouse.

[0072] Additionally, the present invention provides a method for treating an ELN-related disease in a subject, comprising the step of altering ELN gene expression in the subject by administering to the subject a therapeutically effective amount of any embodiment of a pharmaceutical composition comprising the polynucleotide of the present invention. In one embodiment, the subject is diagnosed with an ELN-related disease. In one embodiment, the ELN-related disease includes supravalvular aortic stenosis (SVAS), autosomal dominant cutaneous laxity, Marfan syndrome, alpha1-antitrypsin deficiency-associated emphysema, atherosclerosis, Buschke-Ohlendorff syndrome, Menkes syndrome, elastic pseudoxanthoma, and Williams syndrome. In one embodiment, the subject is in a state of elastin deficiency. The elastin deficiency in the subject may be the result of aging, injury, or any disease causing such deficiency. In one embodiment, the subject requires cosmetic treatment, such as scar correction or correction of burnt skin, sagging skin, or wrinkled skin. In one embodiment, the object includes cells, tissues, or organs of mammals such as humans or mice.

[0073] The pharmaceutical composition of the present invention may be administered in various ways depending on whether local or systemic treatment is preferred and the area to be treated. Administration may be local (ocular, vaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal, intramuscular injection, intrathecal, intraventricular, intracerebral, or intraventricular administration. In one embodiment, administration may be a microneedle administration method, and microneedle administration may include a passive or active method. In one embodiment, microneedle administration includes a solid microneedle patch, a coated microneedle patch, a soluble microneedle patch, a hydrogel microneedle patch, a hollow microneedle patch, a detachable microneedle patch, or a swelling microneedle patch. The administration route and site may be selected to enhance delivery or targeting to a specific location of a blocker containing a site-specific targeting portion.

[0074] It should be understood that the foregoing general description and detailed description are for illustrative and illustrative purposes only and do not limit the scope of the claimed invention. Generally, the terms used in this disclosure should not be interpreted as limiting the technology to the specific embodiments disclosed in the specification unless such terms are explicitly defined in the detailed description above. Accordingly, the actual scope of the technology includes all equivalent ways of practicing or implementing the disclosed embodiments and technology.

[0075] Examples

[0076] Materials and Methods

[0077] stable elastin-exosome expression HEK293 Creation of cell lines

[0078] Several stable cell lines producing elastin mRNA-packaged exosomes were developed. These cell lines were generated by transfecting replicas of HEK293 cells (Table 1) with the following plasmid cocktails (Table 2). After transfection, cells were treated with various different concentrations of the triple drug (puromycin / blastocidin / G418-neomycin) and expanded. Elastin-packaged exosomes are continuously generated using viable cultures of the triple drug-resistant cell lines.

[0079] The generated stable cell line will be expanded and used as a parent ELN RNA-EV cell line.

[0080] cell culture

[0081] Human embryonic kidney 293T (HEK-293T) cells were cultured in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum and 1% L-glutamine and grown at 37°C in a 5% CO2 humidified incubator. Cells were cultured from frozen cell pellets into T25 flasks and expanded into T25 flasks. Cell cultures were generally subcultured after reaching 80-90% confluence to maintain healthy growth under continuous drug selection (Table 3).

[0082] RNA isolation and reverse transcription

[0083] After treatment with lysis buffer, transfected cells were collected and centrifuged at 300 xg for 5 minutes. Cell RNA was collected using the Qiagen RNeasy Mini Kit. The purity of the transfected cell-derived RNA was verified using a Nanodrop, and then reverse transcribed into cDNA using the LunaScript® RT SuperMix Kit and the associated protocol.

[0084] qRT-PCR

[0085] Promega GoTaq qPCR Sybr Green was used for the preparation of the master mix. 7 μL of Sybr Green master mix, 1.4 μL each of forward and reverse primers, 3.08 μL of RNase-free water, and 0.5 μL of cDNA (≤100 ng / rxn) were required per sample. The qRT-PCR synthesis cycling conditions were an initial denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, expansion at 72°C for 30 seconds (40 cycles), and a final expansion step at 72°C for 10 minutes. These were performed using a Qiagen Rotor-Gene PCR cycler. Housekeeping beta-actin mRNA was used as an internal control for comparison of relative RNA expression. Relative gene expression was evaluated using the 2(-ΔΔCT) method. The primers are described in Table 4.

[0086] Table 1 describes the 24-well plate of the example. The transfection treatment was repeated 4 times.

[0087]

[0088] Table 2 describes the stable ELN EV cell lines that are candidates for treatment. These were generated by performing triple / quadruple drug-antibiotic selection following co-transfection into HEK2923 producer cells. Underlined indicates RNA packaging plasmids, and italicized indicates enhancer plasmids. mRNA expression constructs are shown in bold (black).

[0089]

[0090] Table 3 describes triple / quadruple drug combinations for selecting stable ELN mRNA-EV producing cells.

[0091]

[0092] Table 4 describes the primers used to screen mRNA expression for (ELN) expression by qRT-PCR. Beta-actin qRT-PCR is used for standardization.

[0093]

[0094] result

[0095] Several stable ELN exosome-producing HEK293 cell lines were generated to express ELNs (Table 5). The ELN expression plasmid (Fig. 1), RNA-packaged L7ae-based (Fig. 2) and U1a (Figs. 3-5), and the exosome-enhancing plasmid (Fig. 6) were simultaneously transfected into the producer cells. The resulting cells were cultured with recipient cells, and ELN uptake was determined by qRT-PCR after 72–96 hours.

[0096]

[0097] Example: mRNA EV delivery

[0098] Various combinations of packaging constructs, e.g., CD63-U1a, PTGFRN-U1a, CD81-U1a, CD63-L7ae, or combinations thereof, were evaluated for the delivery of GFP mRNA. All fusion constructs were found to be functional and capable of packaging GFP mRNA (Figures 7 and 8), suggesting that the CD63, CD81, and PTGFRN U1a fusions are functional components of the RNex platform and can be used to package therapeutic RNA, antisense non-coding RNA, and various combinations of mRNA or RNA. Taken together, these data suggest that our RNex packaging system is functional and superior to the control L7ae system, as the U1a / UR system uses an endogenous human protein component (e.g., U1a), whereas L7ae is an exogenous RNA-binding protein.

[0099] Those skilled in the art will understand that modifications to the embodiments described above are possible within the scope of the broad concept of the invention. Accordingly, it is understood that the present invention is not limited to the specific embodiments disclosed and is intended to include all variations made within the spirit and scope of the invention as defined by the appended claims.

Claims

Claim 1 A pharmaceutical composition comprising an exosome encapsulating one or more cargo RNAs and one or more fusion proteins, wherein the fusion protein comprises an exosome-associated transmembrane protein fused to a packaging protein; the cargo RNA comprises a packaging RNA and a packaging domain; the packaging protein can bind to the packaging domain to form a fusion protein cargo RNA complex; and the packaging RNA comprises an elastin protein-coding polynucleotide, wherein the nucleotide sequence of the elastin protein-coding polynucleotide is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence of the elastin gene or elastin messenger RNA (mRNA). Claim 2 A pharmaceutical composition according to claim 1, characterized in that the packaging protein is endogenous to the target. Claim 3 A pharmaceutical composition according to claim 1, characterized in that the packaging protein comprises U1a protein. Claim 4 A pharmaceutical composition according to claim 1, characterized in that the nucleotide sequence of the elastin protein-coding polynucleotide is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 2 or SEQ ID NO.

3. Claim 5 A pharmaceutical composition according to claim 1, characterized in that the elastin gene or elastin mRNA comprises any of its naturally occurring isoforms. Claim 6 A pharmaceutical composition according to claim 5, characterized in that the elastin mRNA isoform is derived from the replacement splicing of the elastin gene. Claim 7 A pharmaceutical composition according to claim 1, wherein the packaging domain comprises a UR domain, and the nucleotide sequence of the UR domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 10 or SEQ ID NO.

11. Claim 8 A pharmaceutical composition according to claim 1, wherein one or more Cargo RNAs further comprise one or more OH domains, MorrisMotif domains, or combinations thereof, wherein the nucleotide sequence of the OH domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 12, and the nucleotide sequence of the MorrisMotif domain is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO.

13. Claim 9 A pharmaceutical composition according to claim 8, characterized in that at least one nucleotide sequence of one or more Cargo RNAs is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO.

15. Claim 10 A pharmaceutical composition according to claim 1, characterized in that the fusion protein comprises CD63-U1a, CD81-U1a, PTGFRN-U1a, or a combination thereof. Claim 11 A pharmaceutical composition according to claim 1, characterized in that the amino acid sequence of the fusion protein is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, or a combination thereof. Claim 12 A pharmaceutical composition according to claim 1, further comprising a modified myoperlin protein. Claim 13 A pharmaceutical composition according to claim 12, characterized in that the modified myoferlin protein comprises the C2F, C2G, transmembrane domain of the myoferlin protein, or a combination thereof. Claim 14 A pharmaceutical composition according to claim 13, characterized in that the amino acid sequence of the modified myoperlin protein is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO.

28. Claim 15 A pharmaceutical composition according to claim 12, characterized in that the modified myoferlin protein comprises C2A, FerA, FerB, DysFN, a transmembrane domain of the myoferlin protein, or a combination thereof. Claim 16 A pharmaceutical composition according to claim 12, characterized in that the modified myoperlin protein further comprises connexin 43 protein. Claim 17 A pharmaceutical composition according to claim 16, characterized in that the Conexin 43 protein contains the S368A mutation. Claim 18 A pharmaceutical composition according to claim 16, characterized in that the amino acid sequence of the Conexin 43 protein is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical or similar to SEQ ID NO.

41. Claim 19 A pharmaceutical composition according to claim 1, characterized in that the exosome is prepared from an exosome-based packaging and delivery system comprising an exosome-producing cell, one or more cargo RNA-coding plasmids encoding package RNA and a packaging domain, and one or more fusion protein-coding plasmids encoding an exosome-associated transmembrane protein fused with a packaging protein. Claim 20 A pharmaceutical composition according to claim 19, wherein the exosome-based packaging and delivery system further comprises a plasmid containing a modified myoperlin protein. Claim 21 A method for treating an elastin-related disease in a subject, comprising the step of administering a therapeutically effective amount of the pharmaceutical composition of claim 1 to the subject. Claim 22 A method according to claim 21, characterized in that elastin gene expression in the subject includes disease-related deletions or mutations. Claim 23 A method according to claim 21, characterized in that elastin-related diseases include supravalvular aortic stenosis (SVAS), autosomal dominant cutaneous laxity, Marfan syndrome, alpha1-antitrypsin deficiency-associated emphysema, atherosclerosis, Buschke-Ohlendorff syndrome, Menkes syndrome, elastic pseudoxanthoma, and Williams syndrome. Claim 24 In claim 21, the subject is a method characterized by being deficient in elastin. Claim 25 A method according to claim 21, characterized in that the elastin-related disease includes scarred skin, burned skin, sagging skin, or wrinkled skin. Claim 26 A method according to claim 21, wherein the step of administering a therapeutically effective amount of the pharmaceutical composition of claim 1 to a subject comprises a local, oral, or parenteral administration form. Claim 27 A method according to claim 21, characterized in that the administration of a therapeutically effective amount of a pharmaceutical composition to a subject includes microneedle administration.

Images