Polymerization-inducing chimeras targeting homomeric proteins

Abstract

Provided herein a PINCH (Polymerization Inducing Chimera) compound targeting a homomeric protein of interest, wherein the PINCH compound comprises at least two protein binder groups that target the homomeric protein of interest and induces its polymerization.

Description

POLYMERIZATION-INDUCING CHIMERAS TARGETING HOMOMERICPROTEINSSEQUENCE LISTING

[0001] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on June 9, 2024, is entitled “P-629788-PC.xml”, and is 5,900 bytes in size.FIELD OF THE INVENTION

[0002] Provided herein a PINCH (Polymerization Inducing Chimera) compound targeting a homomeric protein of interest, wherein the PINCH compound comprises at least two protein binder groups that target the homomeric protein of interest and induces its polymerization.BACKGROUND OF THE INVENTION

[0003] Protein homomers are common in nature, making up over 30% of the proteome and exhibiting a variety of functionalities. Many enzymes, transcription factors and receptors are only active as homodimers.

[0004] Homomeric proteins can form symmetrical structures, and utilizing this symmetry has proved insightful in research. It was demonstrated how introducing a single point mutation to the solvent-exposed that part of a symmetric homomer is sufficient to trigger its assembly into higher-order structures [1, 2].

[0005] This approach suggested that proteins are naturally ‘ on the verge of oligomerization and formation of higher-order protein assemblies. It was also demonstrated through a rationally designed genetically encoded system how synthetically fused components of two different multimeric protein complexes are able to induce oligomerizaition into mesh-like formations including both proteins, and phase separate [3], Small-molecule inducedpolymerization of proteins was also recently demonstrated, when uncovering the mecahnism of action of a serdipitous degrader molecule of the oncogenic transcription factor B cell lymphoma 6 (BCL6) [4], In the latter case, ligand binding altered the protein’s surface in a manner that stabilized BCL6 filament formation followed by its subsequent degradation by the cellular degradation machinary.

[0006] While there are several advantages to targeted degradation over simple inhibition [5], these approaches also have a number of drawbacks. The bifunctional molecule has to bind two different molecular targets, which requires them to be co-expressed and colocalized in the relevant cellular compartment. In addition, some post-translational modifications (PTMs) have spatial restrictions, thus solely inducing proximity does not ensure successful modification or degradation of the target [6], For example, PROTAC- or molecular glue-induced degradation of the target requires a correct positioning of the different components, in such a way that there is an available lysine on the surface of the protein for the E2 unit to ubiquitinate [7],

[0007] Even though there have been fast advances in proximity -based technologies to target proteins of interest [8], a major hindrance in these drug design and development methods is the lack of generalizability in expanding their use. There is a growing need in drug design for straightforward methods that can by rationally applied to a large range of proteins, minimizing the lengthy screening campaigns that are usually required for each protein system or complex.SUMMARY OF THE INVENTION

[0008] In some embodiments provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest, wherein the protein binder groups are the same and covalently connected by a linker.

[0009] In some embodiments provided herein a method for inducing polymerization of homomeric protein of interest, the method comprises binding a PINCH compound of this invention and a protein of interest forming a polymer comprising protein-PINCH repeating units.BRIEF DESCRIPTION OF THE DRAWINGS

[0010] The subject matter regarded as the invention is particularly pointed out and distinctly claimed in the concluding portion of the specification. The invention, however, both as to organization and method of operation, together with objects, features, and advantages thereof, may best be understood by reference to the following detailed description when read with the accompanying drawings in which:

[0011] In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

[0012] Figures 1A-1F: Figure 1A. Schematic representation of homomeric protein and a protein binder. Figure IB. Schematic representation of PINCH mode of action. Figure 1C. Structure, WB and activity analyses of active BCL6-targeting PINCHs, 20h treatment in Mino cells. Figure ID. HEK-293 cells overexpressing BCL6-GFP (1-275) treated with parent ligand w8001 (left) and EL221 (right) at 5 pM. Figure IE. the quantification of BCL-GFP ‘puncta’ in each treatment. Scale bars are at 15 pm. (p<0.0001 in a two-tailed Mann-Whitney test from 223 cells analyzed in 2 independent experiments, additional representative images in Figure 11). Figure IF. Viability of different cell lines after 48h treatment with EL221, parent ligand w8001 and BCL6-polymerizer BIG 802.

[0013] Figures 2A-2H: Figure 2A. Structures of active Keapl -targeting PINCHs. Figure 2B. WB of EL229’s effect on OCI-AML2 cells’ soluble and insoluble phases, 20h treatment. Figure 2C. Additional active Keapl -targeting PINCHs WBs in OCI-AML2 cells. Figure 2D. ELI 33 affects Keapl in the soluble and insoluble cell phases, in time- and doseresponse manners. Figure 2E. Global proteomics analysis of the cell’s soluble lysate, showing significant downregulation of Keapl following treatment with 2.5pM EL133, compared to DMSO at a 20h treatment. Figure 2F. Immunostaining of U2OS cell following treatment with 250nM Bardoxolone (left) or 250nM ELI 33 (right). Scale bars are at 10 pm. Figure 2G. Quantification of Keapl ‘puncta’ in the two treatments to show significant difference in volume (p<0.0001 in a two-tailed Mann- Whitney test from 129 cells analyzed in 2 independent experiments, additional representative images Figure 12). Figure 2H. rt- PCR analysis of NQO1 expression after a 20h treatment of OCI-AML2 cells with DMSO,ELI 33 or Bardoxolone (BDX), followed by washing of the cells (representative results following 2 independent experiment replicates).

[0014] Figures 3A-3E: Figure 3A. Dynamic light scattering experiments following recombinant Keapl-BTB and EL133 over time at room temperature. Figure 3B. WB of EL133-treated cells with and without post-treatment with excess Bardoxolone (BDX) in OCI-AML2 cells. Figure 3C. Dynamic light scattering experiments following recombinant Keapl-BTB and other Keapl -targeting PINCHs over time at room temperature, and Figure 3D. WB analysis of PINCHs in OCI-AML2 cells. Figure 3E. Dynamic light scattering experiments following recombinant LDHA and its PINCH over time at room temperature with the OS-47B PINCH compound, structure is presented.

[0015] Figures 4A-4D: Figure 4A. WB of AML2 cells treated with 500nM ELI 33 for 20 h followed by washing of the cells, re-seeding and collected at different times after washout. Figure 4B. WB of Mino cells treated with 5pM EL221 for 20 h followed by washing of the cells. Figure 4C. WB of U2OS cells following treatment with Bafilomycin, EL133 or Bardoxolone (BDX), following their effect on p62 levels. Figure 4D. U2OS cells immunostained with Keapl and with p62 following treatment with either 250nM EL133, 250nM Bardoxolone, lOOnM Bafilomycin or DMSO for 20 h.

[0016] Figures 5A-5D: Figure 5A. Structures of BCL6-targeting PINCHs and their respective WB analyses in Mino cells at 20 h treatments. Figure 5B. Intact LC-MS analysis of 2pM BTB-BCL6 after incubation with DMSO / w8001 for 1 hour at room temperature. Figure 5C. Intact LC-MS analysis of 2pM BTB-BCL6 after overnight incubation with EL221 at 4°C. Figure 5D. Intact LC-MS analysis of 2pM BTB-BCL6 after overnight incubation with inactive PINCHs at 4°C.

[0017] Figures 6A-6C: Figure 6A. Structures of Keapl -targeting PINCHs and their respective WB analyses in OCI-AML2 cells at 20 h treatments. Figure 6B. Global proteomics analysis of OCI-AML2 cells treated with 2.5pM EL133 / DMSO, lysed by sonication prior to sample analysis. Figure 6C. AML2 cells pre-treated with Bortezomib or MLN4924 for 1 hour, then with EL133 or RG55, a BTK -targeting PROTAC, for an additional 7 hours.

[0018] Figures 7A-7C: Figure 7A. WB and structure of EL230, 20h treatment in Mino cells. Figure 7B. EL230 tested in a BCL6-positive cell line (OCI-AML2) and in a BCL6-absent cell line (HEK 293), to show inactivity in the latter. Figure 7C. Monomeric versions of EL230, based on BCL6- and Keapl- ligands with linkers, in Mino cells.

[0019] Figure 8: Global proteomics analysis of the cell’s soluble lysate following treatment with 5pM EL221, compared to DMSO at a 20h treatment, showing BCL6 as one of the significantly downregulated targets.

[0020] Figures 9A-9B: Figure 9A. Dose-response activity analyses of Keapl -targeting PINCHs, 20h treatment in OCI-AML2 cells, based on 3-5 independent experiment replicates. Figure 9B. rt-PCR analysis of NQO1 expression after a 20h treatment of OCI- AML2 cells with DMSO, ELI 33, Bardoxolone (BDX), or Omaveloxolone (OMVX) at 250 nM, followed by washing of the cells (representative results following 2 independent experiment replicates).

[0021] Figures 10A-10B: Figure 10A. Dynamic light scattering experiments following recombinant Keapl -BTB and EL 133 over time at room temperature, with and without preincubation of the protein with excess BDX. Figure 10B. Dynamic light scattering experiments following recombinant LDHA and its PINCH at different ratios over time at room temperature.

[0022] Figure 11: Representative images of HEK-293 cells overexpressed with BCL6- GFP(l-275), treated with w8001 (top) or EL221 (bottom), both at 5 pM. Scale bars are at 15 pm.

[0023] Figure 12: Representative images of U-2OS cells treated with Bardoxolone (top) or ELI 33 (bottom), both at 250 nM, immunostained with Keapl antibody. Scale bars are at 10 pm.

[0024] It will be appreciated that for simplicity and clarity of illustration, elements shown in the figures have not necessarily been drawn to scale. For example, the dimensions of some of the elements may be exaggerated relative to other elements for clarity. Further, where considered appropriate, reference numerals may be repeated among the figures to indicate corresponding or analogous elements.DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0025] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be understoodby those skilled in the art that the present invention may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the present invention.

[0026] The present invention provides a rational design of polymerization inducers of obligatory homomeric proteins. The polymerization inducer (a Polymerization Inducing Chimera=PINCH) comprises at least two protein binders that are covalently connected by a linker. The PINCH (Polymerization Inducing Chimera) compounds are able to take advantage of their protein binder properties and to polymerize a homomer protein target. By covalently connecting two protein binder groups by a linker, a bifunctional ligand is formed. The bifunctional ligand do not bind two monomers of the same homomer protein at the same time (a closed complex, as long as the linker is short enough such that it cannot interact with the two monomers within one homomeric unit), and each protein binder binds a monomer of a different obligatory homomer protein, it forms a potentially infinite polymer (a chain of protein-PINCH repeating units), wherein the protein is sequestered from executing its function (Figure IB).

[0027] Using shorter linkers, or a differert linker in bifunctional ligands may improve their performance, as it affects the rigidity of the compound and could introduce new energetically -favourable protein-protein interactions.

[0028] Provided herein a PINCH (Polymerization Inducing Chimera) compound which comprises at least two protein binder groups covalently connected by a linker.

[0029] The PINCH compound induces polymerization of a target homomeric protein and thereby it aggregates in the cell (as detected by its accumulation in the insoluble fraction of the cell lysate) and further precipitate in the cell. This polymerization is phenotypically different where the notion is to ‘capture’ a protein in an inactive form without having to directly target it for degradation, hence in a target-protein-only dependent manner.The PINCH compound

[0030] In some embodiments, provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest, wherein the two protein binder groups are covalently connected by a linker.

[0031] In some embodiments, provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest, wherein the two protein binder groups are the same or different and are covalently connected by a linker.

[0032] In some embodiments, provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest, wherein the two protein binder groups are the same and are covalently connected by a linker.

[0033] In some embodiments, the linker between the two protein binder groups is sufficiently short such that the two binders cannot simultaneously bind two monomeric subunits of the same homomeric unit of the target protein of interest. In another embodiment, the linker comprises an -alkylene-, -alkenylene-, -alkynylene-, -aryl-, -cycloalkyl-, - heterocycloalkyl-, -heteroaryl-, -(CH2CH2O)n-, -(CH2CH2S)n- groups, or combination thereof, wherein n is an integer 1-30; wherein the alkylene, alkenylene or alkynylene is linear or branched and optionally comprises a heteroatom and / or substituted by an alkyl, halide, amine, CN, NO2, COOH, OH, SH or a heterocycle; and wherein the aryl, cycloalkyl, heteroaryl or heterocycloalkyl, is optionally substituted by an alkyl, heterocycle, halide, amine, CN, NO2, COOH, OH or SH.

[0034] In another embodiment, the linker comprises -(CH2CH2X)m(CH2)q, -(CH2)m- heterocyclyl-(CH2)q-, -(CH2)m-piperazine-(CH2)q-, -(CH2)m-cycloalkyl-(CH2)q-, -(CH2)m- C(O)-heterocyclyl-C(O)-(CH2)q-, -(CH2)m-C(O)-cycloalkyl-C(O)-(CH2)q-; wherein X is S or O; m is an integer from 0-30; and q is an integer from 0-30; wherein n and q are not both 0.

[0035] In another embodiment, the linker comprises -NH-(CH2CH2X)m(CH2)q-NH- , - NH-(CH2)m-heterocyclyl-(CH2)q-NH-, -NH-(CH2)m-piperazine-(CH2)q-NH-, -NH-(CH2)m- cycloalkyl-(CH2)q-NH-, -NH-(CH2)m-C(O)-heterocyclyl-C(O)-(CH2)q-NH-, -NH-(CH2)m- C(O)-cycloalkyl-C(O)-(CH2)q-NH-; wherein X is S or O; m is an integer from 0-30; and q is an integer from 0-30; wherein m and q are not both 0.

[0036] In some embodiments n is an integer from 1-30. In another embodiment, n is an integer between 1-10. In another embodiment, n is an integer between 1-20. In another embodiment, n is an integer between 11 -15. In another embodiment, n is an integer between 11-20. In another embodiment, n is an integer between 11-30. In another embodiment, n is an integer between 15-20. In another embodiment, n is an integer between 15-30.

[0037] In another embodiments, m and q are each independently an integer from 0-30, wherein m and q are not both zero (0). In another embodiment, m and q are each independently an integer between 0-10. In another embodiment, m and q are each independently an integer between 1-20. In another embodiment, m and q are each independently an integer between 11-15. In another embodiment, m and q are each independently an integer between 11-20. In another embodiment, m and q are each independently an integer between 11-30. In another embodiment, m and q are each independently an integer between 15-20. In another embodiment, m and q are each independently an integer between 15-30.

[0038] In another embodiment, the linker comprises an ethylene glycol. In another embodiment, the linker comprises 8, 10, 11, 12, 13, 14, 15, 20 ethylene glycol units- or corresponding length of any other linker.

[0039] In some embodiments, provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomer protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest. In another embodiment, the homomer is a homodimer. In another embodiment, the homomer is a homotrimer. In another embodiment, the homomer is a homotetramer. In another embodiment, the homomer comprises two, three, four, five or six identical subunits.

[0040] In some embodiments, provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest. In another embodiment, the PINCH compound comprises two protein binder groups. In another embodiment, the PINCH compound comprises three protein binder groups. In another embodiment, the PINCH compound comprises four protein binder groups. In another embodiment, the protein binder groups are the same. In another embodiment, the protein binder groups are different.

[0041] In some embodiments, provided herein a polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest. In some embodiments, the protein binder and its targeted protein of interest are any known in the art. Non limiting examples of protein binder and its targeted protein is disclosed in Chweke H, et al. [9] which is incorporated herein by reference.

[0042] In one embodiment, non-limiting examples of protein binders that target homomeric protein comprise: w8001, bardoxolone, omaveloxone, benzothiazole (examples of benzothiazole protein binders are disclosed in Ward et al.

[0010] which is incorporated herein by reference) groups; or any other protein binder disclosed in Chweke H, et al. [9] which incorporated herein by reference.

[0043] In some embodiment the PINCH compound provided herein comprising at least two protein binder groups covalently attached by a linker. The term "protein binder group" refers to any protein binder that includes or is modified with a functional group enabling covalent attachment to a linker.

[0044] For example, a bardoxolone group, aw8001 group, or a protein binder comprising benzothiazol group- refers for example to the following structures having a functional group:protein binder comprising a benzothiazol group; wherein FG is a bond or a functional group which binds the linker described herein. In another embodiment the functional group comprises an amine, an alkylene, a carbonyl, an ester (-OC(O)- or -C(O)O-), a carbamate, an amide (-NHC(O)- or -C(O)NH-), an ether (-O-), a thioether (-S-) or a thioester (-OC(S)- or (-C(S)O-), or combination thereof. In another embodiment, the functional group is a bond and the protein binder group is attached directly to the linker.

[0045] In some embodiments, the PINCH compound provided herein comprises a w8001 group as a protein binder group. In another embodiment, the PINCH compound provided herein comprises two w8001 groups. In another embodiment, the PINCH compound provided herein comprises at least two w8001 groups. In another embodiment, the w8001 protein binder group targets BCL6 protein.

[0046] In some embodiments, the PINCH compound provided herein comprises a bardoxolone group as a protein binder group. In another embodiment, the PINCH compound provided herein comprises two bardoxolone groups. In another embodiment, the PINCH compound provided herein comprises at least two bardoxolone groups. In another embodiment, the bardoxolone protein binder group targets Keapl protein.

[0047] In some embodiments, the PINCH compound provided herein comprises a omaveloxone group as a protein binder group. In another embodiment, the PINCH compound provided herein comprises two omaveloxone groups. In another embodiment, the PINCH compound provided herein comprises at least two omaveloxone groups. In another embodiment, the omaveloxone protein binder group targets Keapl protein.

[0048] In some embodiments, the PINCH compound provided herein comprises a benzothiazole group as a protein binder group. In another embodiment, the PINCH compound provided herein comprises two benzothiazole groups. In another embodiment, the PINCH compound provided herein comprises at least two benzothiazole groups. In another embodiment, the benzothiazole protein binder group targets LDHA protein.

[0049] In some embodiments, the PINCH compound provided herein is represented by the following structures:

[0050] In some embodiment, provided herein a pharmaceutical composition comprising the PINCH compound of this inventionPolymerization of homomer proteins

[0051] In some embodiments, the PINCH compound provided herein induces polymerization of a targeted homomer protein of interest forming a polymer (suprastructure) comprising protein-PINCH repeating units. In another embodiment the formed polymer aggregates. In another embodiment the formed polymer is insoluble in the cell. In another embodiment the formed polymer precipitates in the cell. In another embodiment, the PINCH compound provided herein induces polymerization of a targeted homomer protein of interest and thereby the protein precipitates from the cell’s soluble phase in its polymerized form (=protein-PINCH repeating units). In another embodiment, the polymer formed comprises more than two proteins units.

[0052] In some embodiments, provided herein a method for inducing polymerization of homomeric protein of interest, by binding the PINCH compound provided herein with a homomeric protein of interest. In another embodiment, the binding of the PINCH compound and the homomeric protein of interests is performed spontaneously, by interacting the PINCH compound and the protein in the cell.

[0053] In some embodiments, provided herein a method for inducing polymerization of homomeric protein of interest, by binding the PINCH compound provided herein with a homomeric protein of interest forming a polymer comprising protein-PINCH repeating units.

[0054] In some embodiments, provided herein a method for inducing polymerization of homomeric protein of interest, by binding the PINCH compound provided herein with a homomeric protein of interest forming interleaving polymer of the targeted homomer protein of interest and the PINCH compound provided herein.

[0055] In some embodiments, the PINCH compound comprises two different protein binders to target two different homomeric protein of interests, inducing co-polymerization of the two a homomeric proteins. In another embodiment, a PINCH compound comprising two different protein binders to target two different homomeric protein of interests is described in Example 9.

[0056] In another embodiment, the PINCH compound presented herein induces the polymerization of the targeted homomer protein of interest and thereby the protein (in its polymerized form) aggregates in the cell (as detected by its accumulation in the insoluble fraction of the cell lysate). In another embodiment, the PINCH compound presented herein induces the polymerization of the targeted homomer protein of interest and thereby the protein (in its polymerized form) precipitates in the cell (as detected by its accumulation in the insoluble fraction of the cell lysate).

[0057] In some embodiments, the PINCH compound provided herein induces polymerization of the targeted homomer protein of interest forming a polymer comprising repeating PINCH-protein units, wherein the polymerization causes precipitation of the protein of interest (in its polymer form) from the cell’s soluble phase to the insoluble phase. In another embodiment, the aggregation of the protein of interest (in its polymerized form), inhibits the activity of the protein of interest. In another embodiment, the reduced solubility of the aggregate of the protein of interest (in its polymerized form), kills cells expressing or overexpressing the target protein. In another embodiment, the aggregation of the protein of interest (in its polymerized form), sequesters protein interaction partners. In another embodiment, the aggregation of the protein of interest (in its polymerized form), activates a protein stress response. In another embodiment, the aggregation of the protein of interest (in its polymerized form), induces toxicity within the cell.

[0058] In some embodiments provided herein a method of treating, improving a disease associated with a homomeric protein of interest, wherein the method comprises administering a PINCH compound provided herein comprising at least two protein binder groups that target a protein of interest, which polymerizes the protein of interest and thereby treats or improves the disease associated with the protein of interest.

[0059] In some embodiments, provided herein a method of treating, improving, reducing the decline of a subject with cancer, kidney disease and / or diabetes, in a subject, by administering a PINCH compound comprising at least two bardoxolone groups as protein binder groups, which interacts with a Keapl protein and thereby treating, improving, reducing the decline of a subject with cancer, kidney disease and / or diabetes.

[0060] In another embodiment the cancer is selected from the group consisting of: kidney cancer, lung cancer, endometrial / uterine cancer, esophageal cancer, breast cancer, cervical cancer, liver cancer, gastric cancer, esophageal cancer, head and neck cancer, ovarian cancer, skin cancer, bile duct cancer, leukemia, lymphoma, rhabdoid, brain cancer, colon / colorectal cancer, pancreatic cancer, myeloma, Neuroblastoma, gastric cancer, sarcoma, thyroid cancer, bladder cancer, bone cancer or eye cancer. In another embodiment, the diabetes is type II diabetes. In another embodiment the kidney disease is chronic kidney disease (CKD).Definitions:

[0061] The term "alkyl" or “ alkylene refers to a branched or nonbranched saturated hydrocarbon chain having between 1 -24 carbon atoms. In another embodiments, between 1- 8 carbon atoms. In another embodiment, between 5-15 carbon atoms. The term "C1-C4 alkyl" or “an alkyl of 1 to 4 carbon atoms’" refers to carbon chains having between 1 and 4 carbon atoms. These are, for example, methyl, ethyl, propyl, isobutyl, and butyl. Alkylene groups include, but are not limited to, methylene (-CH2), ethylene (-CH2CH2-), propylene (- (CH2)3), methylenedioxy (-O-CH2-O-) and ethylenedioxy (-O-(CH2)2-O-).

[0062] The alkyl or alkylene groups may be unsubstituted or substituted with one or more of a variety of groups selected from alkyl, aryl, heterocycle, halide, amine, ester, amido, acyl, carbonyl, CN, NO2, COOH, OH, SH and alkoxy.

[0063] The term, "alkenylene" refers to a linear, branched or cyclic, in one embodiment straight or branched, divalent aliphatic hydrocarbon group, in certain embodiments having from 2 to about 20 carbon atoms and at least one double bond, in other embodiments 1 to 12carbons. There may be optionally inserted along the alkenylene group one or more oxygen, sulfur or substituted or unsubstituted nitrogen atoms, where the nitrogen substituent is alkyl. Alkenylene groups include, but are not limited to, -CH=CH-CH=CH- and - CH=CH2. The alkenylene group may be unsubstituted or substituted with one or more of a variety of groups selected from alkyl, aryl, heterocycle, halide, amine, ester, amido, acyl, carbonyl, CN, NO2, COOH, OH, SH and alkoxy.

[0064] The term, "alkynylene" refers to a straight, branched or cyclic, in certain embodiments straight or branched, a divalent aliphatic hydrocarbon group, in one embodiment having from 2 to about 20 carbon atoms and at least one triple bond, in another embodiment 1 to 12 carbons. There may be optionally inserted along the alkynylene group one or more oxygen, sulfur or substituted or unsubstituted nitrogen atoms, where the nitrogen substituent is alkyl. The alkynylene group include, but are not limited to, -C=C- C=C, -C=C- and -OC-CH2-. The alkynylene group may be unsubstituted or substituted with one or more of a variety of groups selected from alkyl, aryl, heterocycle, halide, amine, ester, amido, acyl, carbonyl, CN, NO2, COOH, OH, SH and alkoxy.

[0065] The term "aryl" as used herein refers to a group or part of a group having an aromatic system which may include a single ring or multiple aromatic rings fused or linked together where at least one part of the fused or linked rings forms the conjugated aromatic system e.g. having 6 to 24 carbon atoms. The aryl groups may for example include, but are not limited to, phenyl, naphthyl, biphenyl, anthryl, tetrahydronaphthyl, phenanthryl, indene, benzonaphthyl, fluorenyl, and carbazolyl.

[0066] The aryl group may be substituted by one or more substituents such as alkyl, aryl, heterocycle, halide, amine, ester, amido, carbonyl, CN, NO2, acyl, COOH, OH, SH and alkoxy.

[0067] The term "cycloalkyl" as used herein refers to unless otherwise mentioned, carbocyclic groups of from 3 to 20 carbon atoms having a single cyclic ring or multiple condensed rings which may be saturated or partially unsaturated. Such cycloalkyl groups include, by way of example, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclooctyl, and the like, or multiple ring structures such as adamantanyl, bicyclo[2.2. 1] heptane, bicyclo[2.2.2]octane, 1,3,3- trimethylbicyclo[2.2.1]hept"2-yl.

[0068] The chcloalkyl group may be substituted by one or more substituents such as alkyl, aryl, heterocycle, halide, amine, ester, amido, carbonyl, CN, NO2, acyl, COOH, OH, SH and alkoxy.

[0069] The term "heterocycloalkyl" or as used herein refers to saturated or partially unsaturated group having a single ring or multiple condensed rings, unless otherwise mentioned, having from 1 to 24 carbon atoms and from 1 to 5 hetero atoms, selected from nitrogen, sulphur, phosphorus, and / or oxygen within the ring. Heterocyclic groups can have a single ring or multiple condensed rings, and include di hydrofuranyl, tetrahydrofuranyl, morpholinyl, pyrrolidinyl, dihydropyrrole, dihydropyranyl, tetrahydropyranyl, pyrazolidinyl, imidazolidinyl, dihydropyridinyl, tetrahydropyridinyl, piperidinyl, dihydropyrazinyl, tetrahydropyrazinyl, piperazinyl, dihydropyridinyl, benzodioxolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, tetrahydronaphthyridinyl, tetrahydrothienopyridinyl and the like.

[0070] The heterocycloalkyl group may be substituted by one or more substituents such as alkyl, aryl, heterocycle, halide, amine, ester, amido, carbonyl, CN, NO2, acyl, COOH, OH, SH and alkoxy.

[0071] The term "heteroaryl" as used herein refers to refers to an aromatic cyclic group having 4, 5, 6, 7. 8, 9, 10. 11, 12, 13. 14, or 15 carbon atoms and 1 , 2, 3 or 4 heteroatoms selected from oxygen, nitrogen and sulfur within at least one ring. Such heteroaryl groups can have a single ring (e.g. pyridinyl or furanyl) or multiple condensed rings (e.g. indolizinyl, benzooxazolyl, benzothiazolyl, or benzothienyl). Examples of heteroaryl s include, but are not limited to, [l,2,4]oxadiazole, [l,3,4]oxadiazole, [l,2,4]thiadiazole, [l,3,4]thiadiazole, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, furan, thiophene, oxazole, thiazole, triazole, triazine and the like.

[0072] The heteroaryl group may be substituted by one or more substituents such as alkyl, aryl, heterocycle, halide, amine, ester, amido, carbonyl, CN, NO2, acyl, COOH, OH, SH and alkoxy.

[0073] As used herein, "pharmaceutical composition" means therapeutically effective amounts of a conjugate described herein, together with suitable diluents, preservatives,solubilizers, emulsifiers, adjuvant and / or carriers. Such compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g.; Tris-HCL, acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein, complexation with metal ions, or incorporation of the material into or onto particulate preparations of polymeric compounds such as polylactic acid, polglycolic acid, hydrogels, etc, or onto liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Such compositions will influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance. Controlled or sustained release compositions include formulation in lipophilic depots (e.g., fatty acids, waxes, oils).

[0074] The term ^treatment as used herein refers to the administering of a therapeutic amount of the composition of the present invention which is effective to ameliorate undesired symptoms associated with a disease, to prevent the manifestation of such symptoms before they occur, to slow down the progression of the disease, slow down the deterioration of symptoms, to enhance the onset of remission period, slow down the irreversible damage caused in the progressive chronic stage of the disease, to delay the onset of said progressive stage, to lessen the severity or cure the disease, to improve survival rate or more rapid recovery, or to prevent the disease form occurring or a combination of two or more of the above.

[0075] The terms administering, administer or administration refer to delivery of one or more compounds or compositions to a subject parenterally, enterally, or topically. Illustrative examples of parenteral administration include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracap sul ar, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion. Illustrative examples of enteral administration include, but are not limited to oral, inhalation, intranasal, sublingual, and rectal administration. Illustrative examples of topical administration include, but are not limited to, transdermal and vaginal administration. In particular embodiments, an agent orcomposition is administered parenterally, optionally by intravenous administration or oral administration to a subject.

[0076] It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.

[0077] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any integer or step or group of integers and steps.

[0078] The following Examples are representative of techniques employed by the inventors in carrying out aspects of the present invention. It should be appreciated that while these techniques are exemplary of preferred embodiments for the practice of the invention, those of skill in the art, in light of the present disclosure, will recognize that numerous modifications can be made without departing from the spirit and intended scope of the invention.EXAMPLESMethods

[0079] Western Blotting: Cells were incubated with DMSO at 0.1% or with compound in concentrations ranging 10-20,000 nM for 20 hours unless indicated differently. Following incubation, lysis was performed in RIPA buffer and the samples were measured for total protein quantification by BCA assay. 40 ug of each sample was loaded and run on an SDS- PAGE gel, then transferred onto a nitrocellulose membrane. Incubation with primary antibodies was performed at 4 °C overnight, then washed and incubated with an HRP- conjugated secondary antibody at room temperature for 1 hour. Imaging of Chemiluminescence signal was performed in a ChemiDoc XRS+ instrument (Biorad).

[0080] Label-Free Quantitative Proteomics: Cells were incubated with DMSO at 0.1% or with compound for 20 hours unless indicated differently, in quadruplicates. Followingincubation, the cells were lysed in a 5% SDS and 50mM Ammonium Bicarbonate solution, and probe-sonicated for the shearing of DNA. In samples where only soluble-phase proteomics was done, gentler RIPA-buffer lysis was performed, followed by discarding of the insoluble protein fraction. Samples were then reduced using DTT, followed by reaction with iodoacetamide. The labeled proteins were then precipitated on a dispersion of glass beads, followed by overnight trypsin digestion and purification of peptides. Label-free quantitative proteomics was applied for comparison of protein abundance between DMSO and compound-treated samples. The instrumentation includes nano flow liquid chromatography (nanoAcquity) coupled to tandem, high resolution mass spectrometry (Q Exactive HF). The data will be processed using MaxQuant.

[0081] Dynamic Light Scattering: DLS samples were prepared in the appropriate Keap 1 buffer, to which 0.01% Tween was added, along with the respective compound from a DMSO stock to obtain a final DMSO concentration of 2%. Samples were prepared in room temperature and measured at a constant temperature of 25°C. All samples were passed through 0.1 um filters, then were placed in a clear-bottom black 384-well plate. DLS data were recorded using a DynaproPlate Reader III (Wyatt Technology). Data were processed with the supplied DYNAMICS software.

[0082] Quantitative Real-Time PCR (qPCR) for NQO1 expression'. Cells were treated with either DMSO or compound at 250 nM, followed by washing out the treated media after 20 h and reseeding in fresh media. Cells were then collected at several timepoints post washout. Total RNA was extracted using RNeasy mini kit (QIAGEN, 74104). RNA concentration and purity was determined by Nanodrop, and 500 - 1000 ng RNA per sample were used for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). 73 qPCR (10 pl reaction in a 96-well plate format) was performed with Fast-SYBR Green Master Mix (Applied Biosystems, 4385612), using 1-5 ng cDNA and the following primers (ordered from IDT): NQO1 Fw:CCGTGGATCCCTTGCAGAGA (SEQ ID 1), NQO1 Rev:AGGACCCTTCCGGAGTAAGA (SEQ ID 2), GAPDH Fw:ACCCACTCCTCCACCTTTGA (SEQ ID 3), GAPDH Rev:CTGTTGCTGTAGCCAAATTCGT (SEQ ID 4). PCR amplification was carried out inStep-One Plus thermocycler (Applied Biosystems). Relative quantification was performed using standard curves, GAPDH was used for normalization.

[0083] Viability measurements: Cells were seeded in a transparent-bottom, black 96-well plate, at 15,000 cells per well in sixfold replications, in 90 pL media and let adhere for at least 4 hours. The cells were then treated with the respective compound by adding 10 pL of media-compound mixture for a final volume of 100 pL in each well. Cell-titer Blue reagent was used to measure viability according to the manufacturer’s instructions.

[0084] Immunostaining'. For spinning disk confocal, cells were allowed to adhere to a 14mm glass-bottom plate (MatTek P35G-1.5-14-C), followed by fixation with 3.7% Formaldehyde for 5 minutes and permeabilized with 0.1% Triton X-100 for 10 minutes. The cells were then blocked with 5% BSA for 60 min at room temperature. Cells were stained with primary antibody, at a concentration of 1 : 100 (CAT#) for 3 hours at room temperature, and were then subjected to a secondary antibody conjugated to Alexa Fluor, at a concentration of 1:100-500 (cat#) for 1 hour at room temperature. Lastly, cells were also stained with DAPI (cat#) for 10 minutes at room temperature.

[0085] Immunostaining Imaging'. Imaging of the cells was performed using a Dragonfly spinning disk confocal system (Andor Technology PLC) connected to an inverted Leica Dmi8 microscope (Leica Microsystems CMS GmbH). The signals were detected by an sCMOS Zyla (Andor) 2048X2048 camera, and the bit depth was 16. At the specified intervals, Z-stacks (0.17 pm) of selected cells were acquired with an HC PL APO 63x / 1.3 GLYC CORR CS2 objective (506353, Leica Microsystems CMS GmbH).

[0086] Image Analysis'. Total aggregate volume was calculated per cell using Imaris software (version 9.9.1). Automatic aggregates segmentation was done using the surface module with manual threshold fixed for all images of the same experiment (default 2 pixels smoothing, background subtraction with 0.9pm largest sphere, morphological split with 0.5pm seed point diameter). Analysis was done per cell by manually selecting regions covering the individual cell and not overlapping with neighboring cells.EXAMPLE 1Synthesis of the PINCHs CompoundsEL229

[0087] (4aS,4a 'S, 6aR, 6bS, 6a 'R, 6b 'S,8aR,8a 'R,12aS,12a 'S,14aR,14bS,14a R,14b 'S)~Na,Na'-(3,6,9,12,15,18,21,24,27,30,33,36,39-tridecaoxahentetracontane-l,41- diyl) bis(l 1 -cyano-2,2, 6a, 6b, 9, 9,12a-heptamethyl-l 0, 14-dioxo-

[0088] HATU-activation of Bardoxolone: 5 mg of Bardoxolone-COOH were dissolved in DCM, followed by 4eq of DIPEA and 2eq of HATU, and left stirring overnight at room temperature. Then, saturated NH4CI solutions was added to the reaction vile to approximately double the volume, followed by 3 times extraction of the activated Bardoxolone acid using DCM. The DCM was then evaporated, and the product dissolved in 200 pL DMF.

[0089] To the activated Bardoxolone, 5eq of DIPEA were added, followed by addition of 3,6,9,12,15,18,21,24,27,30,33,36,39-tridecaoxahentetracontane-l,41-diamine (PEG13- diamine), and dissolved in DCM. After overnight reaction in room temperature, the solvent was evaporated, the crude reaction was then dissolved in 50% ACN in H2O and purified using HPLC.

[0090] HR-MS (m / z): Calculated: 1579.00; Found: 1601.9918 [M+Na]+.EL165

[0091] (4aS,4a 'S, 6aR, 6bS, 6a R, 6b 'S,8aR,8a 'R,12aS,12a 'S,14aR,14bS,14a R,14b 'S)~ Na,Na'-(piperazine-l,4-diylbis(ethane-2,l-diyl))bis(ll-cyano-2,2,6a,6b,9,9,12a- heptamethyl-10, 14-dioxo-l, 3, 4, 5, 6, 6a, 6b, 7, 8, 8 a, 9, 10, 12a, 14, 14a, 14b- hexadecahydropicene-4a(2H)-carboxamide)

[0092] Synthetic procedure performed similar to the one described for EL229, using 2,2'- (piperazine-l,4-diyl)bis(ethan-l-amine) as the linker in the second step.

[0093] HR-MS (m / z): Calculated: 1119.7626; Found: 1119.7657 [M+H]+.EL133(4aS, 4a 'S, 6aR, 6bS, 6a 'R, 6b 'S, 8aR, 8 a R,12aS, 12 a 'S, 14aR, 14bS,14aR,14b 'S)-Na,Na '- ((ethane-l,2-diylbis(oxy))bis(ethane-2,l-diyl))bis(ll-cyano-2,2, 6a, 6b, 9,9,12a- heptamethyl-10, 14-dioxo-l, 3, 4, 5, 6, 6a, 6b, 7, 8, 8 a, 9, 10, 12a, 14, 14a, 14b- hexadecahydropicene-4a(2H)-carboxamide)

[0094] Bardoxolone-COOH was activated using HATU according to the synthetic procedure described for compound EL229, and it was reacted with tert-butyl (2-(2-(2- aminoethoxy)ethoxy)ethyl)carbamate in DCM overnight. TFA was added to the reaction to obtain a final solvent ratio of approximately 1:2 (TFA:DCM) and the reaction was left overnight at room temperature. The deprotected intermediate was then evaporated and purified by HPLC, lyophilized and was then used directly in the following reaction. Bardoxolone-HATU was added to the intermediate amine with DIPEA in DCM. After 6h, the reaction was evaporated and the final product was purified using HPLC.EL159

[0095] (4aS,4a 'S, 6aR, 6bS, 6a 'R, 6b 'S,8aR,8a R,12aS,12a 'S,14aR,14bS,14a R,14b 'S)~Na,Na '-(cyclohexane-1, 4-diylbis(methylene))bis(l 1 -cyano-2, 2, 6a, 6b, 9, 9, 12a- heptamethyl-10, 14-dioxo-l, 3, 4, 5, 6, 6a, 6b, 7, 8, 8 a, 9, 10, 12 a, 14, 14a, 14b-

[0096] Synthetic procedure performed similar to the one described for ELI 33, using tert- butyl ((4-(aminomethyl)cyclohexyl)methyl)carbamate as the linker in the second step.

[0097] HR-MS (m / z): Calculated: 1111.7228; Found: 1111.7249 [M+Na]+.EL152

[0098] (4aS,4a 'S, 6aR, 6bS, 6a R, 6b 'S,8aR,8a 'R,12aS,12a 'S,14aR,14bS,14a R,14b 'S)~Na, Na '-(3, 6, 9,12,15,18-hexaoxaicosane-l,20-diyl)bis(l 1 -cyano-2, 2, 6a, 6b, 9, 9, 12a- heptamethyl-10, 14-dioxo-l, 3, 4, 5, 6, 6a, 6b, 7, 8, 8 a, 9, 10, 12a, 14, 14a, 14b-

[0099] Synthetic procedure performed similar to the one described for ELI 33, using tert- butyl (20-amino-3,6,9, 12, 15, 18-hexaoxaicosyl) carbamate as the linker in the second step. [000100] HR-MS (m / z): Calculated: 1270.81.; Found: 1271.8190 [M+H]+, 1293.8079 [M+Na]+EL151[000101] (4aS, 6aR, 6bS,8aR,12aS,14aR,14bS)-ll-cyano-N-(1-( (4aS, 6a R, 6bS, 8aR, 12 aS, 14aR, 14bS)-l 1 -cyano-2,2, 6a, 6b, 9, 9, 12a-heptaniethyl-l 0, 14- dioxo-1,3, 4, 5, 6, 6a, 6b, 7, 8, 8a, 9,10,12a, 14,14a, 14b-hexadecahydropicen-4a(2H)-yl)-l -oxo- 5, 8, 12-trioxa-2-azatetradecan-l 4-yl)-2,2, 6a, 6b, 9, 9, 12a-heptamethyl-l 0, 14-dioxo-1,3, 4, 5, 6, 6a, 6b, 7, 8, 8a, 9, 10, 12a, 14,14a, 14b-hexadecahydropicene-4a(2H)-carboxamide[000102] HR-MS (m / z): Calculated: 1139.7412; Found: 1139.7429 [M+H]+, 1161.7247[M+Na]+EL147[000103] (4aS,4a 'S, 6aR, 6bS, 6a R, 6b 'S,8aR,8a 'R,12aS,12a 'S,14aR,14bS,14a R,14b S)- Na,Na ’-(oxybis(ethane-2, 1 -diyl))bis(ll -cyano-2,2, 6a, 6b, 9, 9, 12a-heptamethyl-l 0, 14- dioxo-1,3, 4, 5, 6, 6a, 6b, 7, 8, 8a, 9,10,12a, 14,14a, 14b-hexadecahydropicene-4a(2H)- carboxannde)[000104] Synthetic procedure performed similar to the one described for ELI 33, using tert- butyl (2-(2-aminoethoxy) ethyl) carbamate as the linker in the second step.[000105] HR-MS (m / z): Calculated: 1051.6888; Found: 1051.6923 [M+H]+, 1073.6742 [M+Na]+EL164[000106] (4aS,4a'S,6aR,6bS,6a'R,6 b'S,8aR,8a'R, 12aS, 12a'S, 14aR,14bS,14a'R, 14b'S)- Na,Na'-((ethane-l,2-diylbis(sulfanediyl))bis(ethane-2,l-diyl))bis(l l-cyano-2,2,6a,6b,9,9,12a-heptamethyl-10,14-dioxo-l,3,4,5,6,6a,6b,7,8,8a,9, 10,12a,14,14a,14b- hexadecahydropicene-4a(2 / / )-carboxamide)[000107] Synthetic procedure performed similar to the one described for ELI 33, using tert- butyl (2-((2-((2-aminoethyl)thio)ethyl)thio)ethyl)carbamate as the linker in the second step. [000108] HR-MS (m / z): Calculated: 1127.6693; Found: 1127.6669 [M+H]+, 1149.6544 [M+Na]+EL132[000109] ( (4aS, 4a 'S, 6aR, 6bS, 6a 'R, 6b 'S, 8aR, 8a R,12aS, 12a 'S, 14aR, 14bS, 14a 'R, 14b 'S)~ Na,Na '-(hexane- 1, 6-diyl)bis(ll-cyano-2,2, 6a, 6b, 9, 9,12a-heptamethyl-l 0,14-dioxo- 1,3, 4, 5, 6, 6a, 6b, 7, 8, 8a, 9, 10, 12a, 14,14a, 14b-hexadecahydropicene-4a(2H)-carboxamide)[000110] Synthetic procedure performed similar to the one described for ELI 33, using tert- butyl (6-aminohexyl) carbamate as the linker in the second step.[000111] HR-MS (m / z): Calculated: 1085.7071; Found: 1085.7102 [M+H]+EL163(4aS, 4a 'S, 6aR, 6bS, 6a 'R, 6b 'S, 8aR, 8a 'R,12aS, 12a 'S, 14aR, 14bS,14a'R,14b 'S)-Na,Na '- (octane-1, 8-diyl) bis(l 1 -cyano-2,2, 6a, 6b, 9, 9, 12a-heptamethyl-l 0, 14-dioxo-1,3, 4, 5, 6, 6a, 6b, 7, 8, 8a, 9, 10, 12a, 14,14a, 14b-hexadecahydropicene-4a(2H)-carboxamide)[000112] Synthetic procedure performed similar to the one described for ELI 33, using tert- butyl (8-aminooctyl) carbamate as the linker in the second step.[000113] HR-MS (m / z): Calculated: 1090.75; Found: 1113.7347 [M+Na]+EL174[000114] (4aS, 4a 'S, 6aR, 6bS, 6a R, 6b 'S, 8aR, 8a' R, 12aS, 12a 'S, 14aR, 14bS,14aR,14b'S)- Na,Na '-(piperazine-1, 4-diylbis(2-oxoethane-2, 1 -diyl))bis(l 1 -cyano-2,2, 6a, 6b, 9, 9, 12a- heptamethyl-10, 14-dioxo-l, 3, 4, 5, 6, 6a, 6b, 7, 8, 8 a, 9, 10, 12a, 14, 14a, 14b- hexadecahydropicene-4a(2H)-carboxamide)[000115] Fmoc-Gly-OH was reacted with 2.5 eq of EDC, 2eq of HOBt and 4 eq of TEA in DCM for 15 min on ice. Next, 30 mg of piperazine was added to the reaction which was allowed to warm to room temperature and kept overnight. The solvent was evaporated, and the crude product was dissolved in 20% piperidine in DMF, to allow Fmoc deprotection for 2 h in room temperature. The crude deprotected product was directly used for the next reaction, where it was reacted with HATU-Bardoxolone as described in the procedure for compound EL229.[000116] HR-MS (m / z): Calculated: 1169.7031; Found: 1169.7006 [M+Na]+EL221[000117] 3,3'-(((((((2,46-dioxo-6,9,12,15,18,21,24,27,30,33,36,39,42-tridecaoxa-3,45- diazaheptatetracontane-l,47-diyl)bis(oxy))bis(8-mefhoxy-l-methyl-2-oxo-l,2- dihydroquinoline-3,6-diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(azanediyl))bis(methylene))dibenzenesulfonyl fluoridew8002 free acid was reacted with 2 eq EDC and 2 eq HOBt, along with 1.1 eq DIPEA in DCM for 15 min in room temperature. Next, 3,6,9,12,15,18,21,24,27,30,33,36,39- tridecaoxahentetracontane-l,41-diamine was dissolved in 100pL DMF, then added to the reaction mixture and allowed to react for 3 h in room temperature. The crude reaction was evaporated, dissolved in 40% ACN in H2O, and purified by HPLC.[000118] HR-MS (m / z): Calculated: 1747.5821; Found: 1747.5796 [M+H]+, 1769.5701 [M+Na]+ w80013-(((4-chloro-3-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-l,2- dihydroquinolin-6-yl)annno)phenyl)annno)methyl)benzenesulfonyl fluoride[000119] w8002 free acid was reacted with 2 eq EDC and 2 eq HOBt, along with 1.1 eq DIPEA in DCM for 15 min in room temperature. Next, 1 eq of methylamine was added to the reaction mixture and allowed to react for 3 h in room temperature. The crude reaction was evaporated, dissolved in 30% ACN in H2O, and purified by HPLC.[000120] HR-MS (m / z): Calculated: 611.1143; Found: 611.1154 [M+Na]+3,3'-(((((((2,13-dioxo-6,9-dioxa-3,12-diazatetradecane-l,14-diyl)bis(oxy))bis(8-methoxy- 1 -methyl-2-oxo-l , 2-dihydroquinoline-3, 6-diyl))bis(azanediyl))bis(4-chloro-3, 1 - phenylene))bis(azanediyl))bis(methylene))dibenzenesulfonylfluoride[000121] w8002 free acid was reacted with 2 eq EDC and 2 eq HOBt, along with 1.1 eq DIPEA in DCM for 15 min in room temperature. Next, tert-butyl (2-(2-(2- aminoethoxy)ethoxy)ethyl)carbamate was added to the reaction mixture and allowed to react for 3 h in room temperature. TFA was then added to double the solvent volume and left to deprotect overnight. The deprotected intermediate was then evaporated and purified by HPLC, lyophilized and was then used directly in the following reaction. W8002 was reacted with EDC, HOBt and DIPEA as described in the first step. The intermediate amine was dissolved in 100 μL DMF and added to the reaction mixture. After 2 h, the crude reaction was evaporated, dissolved in 40% ACN in H2O, and purified by HPLC.[000122] HR-MS (m / z): Calculated: 1285.2757; Found: 1285.2777 [M+Na]+EL218[000123] 3,3'-(((((((2,19-dioxo-6,9,12,15-tetraoxa-3,18-diazaicosane-l,20- diyl) bis(oxy) ) bis(8-methoxy-l -methyl-2-oxo-l,2-dihydroquinoline-3, 6- diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(az(inediyl))bis(methylene))dibenzenesulfonylfluoride[000124] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (14-amino-3,6,9,12-tetraoxatetradecyl)carbamate as the linker in the second step.[000125] HR-MS (m / z): Calculated: 1373.3281; Found: 1373.3314 [M+Na]+EL224[000126] 3.3'-(((((((2.37-dioxo-6,9, 12.15,18.21.24.27.30.33-decaoxa- 3.36- diazaoctatriacontane-l,38-diyl)bis(oxy))bis(8-methoxy-l-methyl-2-oxo-l,2- dihydroquinoline-3,6-diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(azanediyl))bis(metbylene))dibenzenesulfonyl fluoride[000127] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (32-amino-3, 6, 9, 12, 15, 18, 21,24,27,30-decaoxadotriacontyl) carbamate as the linker in the second step.[000128] HR-MS (m / z): Calculated: 1637.4854; Found: 1637.4777 [M+Na]+EL226[000129] 3,3 '-(((((((2,34-dioxo-6,9,12,15,18,21,24,27,30-nonaoxa-3,33- diazapentatriacontane-l,35-diyl)bis(oxy))bis(8-methoxy-l-methyl-2-oxo-l,2- dihydroquinoline-3,6-diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(azanediyl))bis(methylene))dibenzenesulfonyl fluoride[000130] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (29-amino-3,6,9, 12, 15, 18,21 ,24,27-nonaoxanonacosyl)carbamate as the linker in the second step.[000131] HR-MS (m / z): Calculated: 1570.47; Found: 1593.4633 [M+Na]+EL227[000132] 3,3 '-(((((((2,31-dioxo-6,9, 12, 15, 18,21,24, 27-octaoxa-3,30-diaz,(idotriacontane- l,32-diyl)bis(oxy))bis(8-methoxy-l-methyl-2-oxo-l,2-dihydroquinoline-3,6- diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(azanediyl))bis(metbylene))dibenzenesulfonyl fluoride[000133] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (26-amino-3,6,9,12,15,18,21,24-octaoxahexacosyl)carbamate as the linker in the second step.[000134] HR-MS (m / z): Calculated: 1549.4330; Found: 1549.4396 [M+Na]+EL225[000135] 3,3'-(((((((2,40-dioxo-6,9,12,15,18,21,24,27,30,33,36-undecaoxa-3,39- diazahentetracontane-l,41-diyl)bis(oxy))bis(8-methoxy-l-methyl-2-oxo-l,2- dihydroquinoline-3,6-diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(azanediyl))bis(methylene))dibenzenesulfonyl fluoride[000136] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (35-amino-3, 6, 9, 12, 15, 18, 21,24,27,30, 33 -undecaoxapentatriacontyl) carbamate as the linker in the second step.[000137] HR-MS (m / z): Calculated: 1681.5116; Found: 1681.5098 [M+Na]+EL228[000138] 3.3'-(((((((2.43-dioxo-6,9, 12.15.18.21.24.27.30,33.36.39-dodecaoxa- 3.42- diazatetratetracontane-l,44-diyl)bis(oxy))bis(8-methoxy-l-methyl-2-oxo-l,2- dihydroquinoline-3,6-diyl))bis(azanediyl))bis(4-chloro-3,l- phenylene))bis(azanediyl))bis(methylene))dibenzenesulfonyl fluoride[000139] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (38-amino-3, 6, 9, 12, 15, 18, 21, 24, 27,30,33, 36-dodecaoxaoctatriaconty I) carbamate as the linker in the second step.EL230[000140] 3-(((4-chloro-3-((3-((l-((4aS,6aR,6bS,8aR,12aS,14aR,14bS)-ll-cyano-2,2, 6a, 6b, 9, 9, 12a-heptamethyl-l 0, 14-dioxo-l,3, 4, 5, 6, 6a, 6b, 7, 8, 8a, 9, 10, 12a, 14,14a, 14b- hexadecahydropicen-4a(2H)-yl)-l,42-dioxo-5,8,ll,14,17,20,23,26,29,32,35,38- dodecaoxa-2,41-diazatritetracontan-43-yl)oxy)-8-methoxy-l-methyl-2-oxo-l,2- dihydroquinolin-6-yl)annno)phenyl)annno)methyl)benzenesulfonyl fluoride[000141] Synthetic procedure performed similar to the one described for EL217, using tert- butyl (38-amino-3, 6, 9, 12, 15, 18, 21, 24, 27,30,33, 36-dodecaoxaoctatriaconty I) carbamate as the linker in the second step. The intermediate deprotected amine was purified by HPLC, lyophilized and was then used directly in the following reaction. Bardoxlone-HATU, prepared as described for compound EL229 was added to the reaction along with 3 eq of DIPEA in DCM. After 2 h in room temperature, the crude reaction was evaporated, dissolved in 50% ACN in H2O, and purified by HPLC.[000142] HR-MS (m / z): Calculated: 1641.7485; Found: 1641.7552 [M+Na]+EXAMPLE 2PINCHs induce accumulation of BCL6 in the cell’s insoluble phase.[000143] BCL6 is a homodimeric transcriptional repressor that has been established as playing a crucial role in B-cell regulation, and its overexpression is correlated with several B-cell non-Hodgkin lymphomas [11,12], Several BCL6 inhibitors and degraders have been reported in recent years [13-15], In addition, a BCL6 PROTAC is currently under clinical trials and demonstrated efficacy in multiple pre-clinical models of DLBCL

[0016] , Recently, BCL6 was also recruited by a new modality of bifunctional molecuels to selectivtly repress alternative target genes

[0017] , Further, as noted, it was discovered that BCL6 was able to polymerize via a small molecule glue [4] (The glue is not rationally designed as in this invention; it induces a different polymeric form ; it is monofunctional and not bi -functional like PINCHs ; eventually the polymeric form induced by the glue is proteasomally degraded and no polymer is left in the cell.). These considerations made BCL6 a perfect model system to test the PINCH approach.[000144] Teng et al.

[0018] reported a covalent inhibitor of BCL6 that irreversibly binds a Tyrosine residue in the BTB domain dimeric interface. A close analog of this ligand, w8001 was used, which showed rapid binding to recombinant BCL6 BTB domain in intact protein LC-MS (100% labeling at 2 pM protein / 10 pM compound; 90 min; RT; Figure 1C). Since the aim was to bind two separate biological dimeric units that are not known to share a protein-protein interface, EL221 was first synthesized, a compound bearing two BCL6 binders on ends of a relatively long PEG13 linker, to avoid potential steric clashes between the proteins (Fig. 1C).[000145] The binding of EL221 to BCL6 BTB was evaluated by intact protein LC / MS. -50% labeling of monomeric BCL6 (10-fold excess compound; 24 h at 4°C; Figure 5C) was detected, and surprisingly no dimeric form connected covaletly by both ends of EL221 was detected. A shorter 1-hour incubation of BCL6 and EL221 was also tested to reveal minimal labeling (Figure 5C). It was presumed that BCL6 binding on both ligand endsresults in its polymerization and crashing out of solution, in a way that does not allow to capture the intermatiade soluble ternary complex of BCL6-ligand-BCL6 in this assay.[000146] The effects of EL221 on BCL6 levels was tested via Western Blot (WB) in Mino cells. At concentrations starting from 5 pM (20 h incubation) it showed reduction of BCL6 in the soluble fraction, and its complimentary accumulation in the insoluble fraction (Figure 2B). The reported BCL6 polymerizing agent BI-3208 [4] showed downregulation of BCL6 in the soluble fraction, however no insoluble accumulation.EXAMPLE 3BCL6 PINCH is phenotipically differentiated from its corresponding inhibitor or degrader[000147] To assess the downstream effect of this induced precipitation described in Example 2, the levels of c-Myc - a prominent downstream target of BCL6

[0019] (Figure 2B) were evaluated. At EL221 concentrations where BCL6 was moved to the insoluble phase, c-Myc levels are markdly downregulated. This suggests that capturing BCL6 in a polymeric form, and / or its crashing out of the cell’s soluble fraction, hinders its cellular functions. Surprisingly, although BI-3208 downregulates BCL6, it shows no effect on c- Myc (Figure 1C).[000148] Proteomic analysis of EL221 -treated cells to assess additional effects of BCL6 polymerization, revealed BCL6 itself significantly downregulated along with dozens of additional proteins (Figure 8). This large systemic effect is attributed to the centrality of BCL6 to B-cell biology, since its downregulation is likely to result in large pertubations of many proteins.[000149] A small screen of different length PEG-based BCL6-targeting PINCHs was performed which suggested that to achieve polymerization in this system, the linker may be as short as 11 ethylene glycol units, but not less than that (Figure 5A). The similar potencies we see for the longer linkers suggest that the specific linkers we examined were not able to stabilize a specific new BCL6-BCL6 interface. Interestingly, compounds that were found inactive by WB do not seem to be able to form even a monomeric adduct with BCL6 BTBin vitro, as assessed by LC / MS (Figure 5D), perhaps suggesting steric clashes with the bifunctional ligand rahter than between the protein subunits.[000150] To shed more light on the mechanism of action of EL221, the cellular distribtution of BCL6 was explored following compound treatment. To this end, HEK-293 cells were treated overexpressing BCL6 (l-275)-GFP with EL221 for 20 h, followed by imaging. In cells treated with parent ligand w8001 faint GFP signal spread throughout the cell (Figure ID) was observed. However, cells treated with EL221 presented GFP signal which accumulated locally in ‘puncta’, suggesting localization of BCL6 in higher-order assemblies. Such puncta were significanlty overrepresented in EL221 treated cells compared to w8001( / ?< 0.001; Figure IE).[000151] Finally, following up of the phenotypic difference in c-Myc expression following BCL6 degradation, inhibition and polymerization. The viability effects of BI-3208, w8001 and EL221 were assesed on cells. Neither compound affected the viability of HEK 293 cells, lacking BCL6 expression. However in Mino and Ramos B cells expressing BCL6, EL221 showed an LD50 of 6.8 pM and 5.4 pM respectively, with the degrader and inhibitor showing no viability effects (Figure IF).EXAMPLE 4Efficient Bardxolone-based PINCHs target Keapl in cells.[000152] To demonstrate the generality of the PINCH approach, an additional homomeric system was studied. Keapl, is a substrate adapter for the E3 ubiquitin ligase Cul3-Rbxl and plays a key role in Nrf2 regulation. Nrf2 is a master regulator of the cellular anti -oxidative response. Therefore, correct functioning of the Keapl-Nrf2 system is crucial in a variety of diseases with oxidative stress and inflammation rooted in their pathologies and progression. Keapl also contains a BTB domain that mediates its intrinsic dimerization. Bardoxolone (BDX) is a natural product, reversible covalent binder of Cysl51 in the BTB domain of Keapl, and is known to activate the Nrf2 pathway. A Keapl -targeting PINCHs based on Bardoxolone was designed.[000153] Two Bardoxolone units were coupled on the ends of a PEG13 linker to obtain EL229 (Figure 2A). Testing EL229 by western blot (WB) showed it was able to reduceKeapl in the cell’s soluble fraction and induce its complementary accumulation in the insoluble fraction (Figure 2B).[000154] A linker screening was performed using shorter linker lengths (Figure 2A). This series displayed pronounced structure-activity relationship (SAR). EL133, based on aPEG2 was the most potent compound with ECso=117nM (Figure 2C; Figure 9B), and accumulation of it in the insoluble phase at concentration as low as 500 nM. EL133 showed reduction of Keapl in the soluble phase and corresponding accumulation in the insoluble phase in a dose- and time- dependent manner (Figure 2D). However, other PEG-based linkers EL147, EL151, EL152 based on PEG1, PEG3 and PEG6 respectively, showed no activity (Figure 6A). EL165 and EL164 which share a similar linker length but slightly differ from EL133 chemically, show good activity in cells, downregulating Keapl with ECso values of 342 nM and 434 nM, respectively (Figure 9A). ELI 32, based on a 6-carbon alkyl linker also downregulates Keapl with an ECso of 1024 nM. In contrast, EL 163 bearing an all-carbon linker of the same atom length as EL133, EL159 which is the same length as EL132, and EL174 which differs from EL165 by two carbonyl groups, show no activity (Figure 6A).EXAMPLE 5Keapl PINCHs are selective and independent of the ubiquitin-proteasome system [000155] To assess the selectivity of EL133, a quantitative global proteomics following compound treatment. In one experiment the cells were lysed by sonication, followed by quantifying the entire cellular protein content by proteomics. This showed no significant reduction in Keapl levels compared to the DMSO-treated cells (Figure 2B), presumably due to disassembly of the Keapl polymer in the insoluble fraction and its subsequent identification. In a second experiment, the cells were lysed using RIPA (radioimmunoprecipitation assay) buffer, proceeding to proteomics with the buffer-soluble fraction only. Here, Keapl was significantly downregulated in the lysate’s soluble phase (Figure 2E). Moreover, only very few other proteins showed down-regulation, demonstrating marked selectivity for EL133 to Keapl.[000156] Since Keapl is also a substrate adapter protein to a Culling-ring E3 ligase complex, and was shown to be able to be recruited to induce targeted degradation it waspossible that at least part of the Keapl downregulation from the soluble phase could be attributed to its self-degradation in a homo-PROTAC manner, as previously shown for other E3s. To assess this possibility, cells were treated initially with either MLN-4924, a NEDDylation inhibitor, or Bortezomib, a proteasome inhibitor, followed by ELI 33. Inhibiting either of these systems did not result in the rescue of EL133 -induced Keapl downregulation (Figure 6C), suggesting that ELI 33 is downregulating Keapl in a proteasome independent manner.[000157] To visualize Keapl distribution following PINCH treatment, the native Keapl was followed in U2OS cells after treatment by either EL133 or parent ligand Bardoxolone by immunofluorescence. Similar to BCL6, 20 hours post-treatment ‘puncta’ of Keapl forming in the EL133-treated cells, but not Bardoxolone treated cells (p<0.001; Figures 2F and 2G), suggesting localization of Keapl to higher-order assemblies.EXAMPLE 6Keapl PINCHs show longer duration of action than Keapl inhibitors [000158] To assess the phenotypic consequence of capturing the target in an insoluble inactive form the PINCH was compared to a monomeric inhibitor. NQO1 is a well- established downstream -target of Nrf2 and was expected be upregulated as Keapl ’s activity is diminished. NQO1 expression levels were gaged over time (by real-time PCR) after treatment with either DMSO, Bardoxolone or ELI 33 for 20 hours, followed by washout of the cells. At the time of washout, 20 hours post-treatment, the Bardoxlone-treated cells show higher expression levels of NQO1 compared to the EL133-treated cells. Starting at 48 h post-treatment, NQOl’s expression in the Bardoxol one-treated cells were significantly lower than those in EL133-treated cells. This suggests that in the cellular context, the new approach in this invention of target elimination by polymerization would exhibit longer durations of actions compared to the inhibition of said target. The same comparison was done with Omaveloxolone (OMVX), a derivative of Bardoxolone which has recently received FDA approval for treatment of Friedrich’s Ataxia, in which it had similar effects on NQO1 expression as Bardoxolone, further emphasizing the capability of PINCHing to be beneficial over inhibitors (Figure 9B).EXAMPLE 7In vitro characterization of PINCHs induced polymerization[000159] Dynamic Light Scattring (DLS) experiments were used to follow the polymerization of Keapl in vitro. Recombinant BTB domain of Keapl was incubated in the presence of ELI 33 and the signal was followed over time. After around four hours, large molecular speacies started forming. These did not appear in the samples containing either Keapl or EL133 alone (Figure 3A). Since Bardoxolone is a reversible covalent binder of Keapl, it was hypothesized that EL133-induced polymer formation is reversible as well. To test this, Keapl polymers were let to form and reach signal saturation, then an excess of two equivalents of Bardoxolone was added to the samples. Immediate loss of signal was observed, suggesting the disassembly of Keapl polymers (Figure 3A). Surpringly, this phenotype did not reproduce in the cellular environment. Cells with EL133 were treated for 20 h, then with a large excess of Bardoxolone for an additional 3 hours. Consecutive WB analysis showed no change in Keapl ’s levels in the soluble phase (Figure 3B).[000160] Additional Bardoxolone-based PINCHs were tested with recombinant Keapl in the same manner, and observed the formation of large strcutures over time with EL165 and EL132, but not with EL151 and EL159 (Figure 3C), reflecting these compounds’ cellular activities as assessed by WB (Figure 3D). In addition, pre-incubating Keapl with Bardoxolone prior to adding ELI 33 prevented the formation of large Keapl strcutures, showing that these were Bardoxolone-binding-site dependent (Figure 10A).[000161] LDHA is one of two subunits which comprise the LDH isoforms in the cells, and on its own form a homotetrameric structure. Using an inhibitor developed by Ward et al.

[0010] , which was functionalized with a carboxylic acid group on its solvent-exposed region, a LDHA-targeting PINCH was synthesized, OS-47B. DLS measurements of recombinant LDHA incubated with OS-47B revealed formation of larer species over time (Figure 3E). [000162] A molar ratio of 2: 1 in favour of the PINCH (OS-47B) resulted in the largest in- vitro formations, nontheless, a polymerization effect was also observed in protein:PINCH molar ratios of 1: 1-1:4. The effect was lost when the PINCH was at sub-equivilant copmapred to the protein and when it was in large excess compared to it, possibly do to saturation of the LDHA binding sites (Figure 10B).EXAMPLE 8Autophagy is the likely clearance mechanism for PINCH induced aggregates[000163] In order to address the question - what happens to the PINCH-induced polymers that form and precipitate in the cells and how does the cell clear these formations, if it allcells with EL133 were treated for 20 hours to induce Keapl’s polymerization, followed by washing the cells and probing them in several time points (Figure 4A. After treatment with 500 nM EL133, Keapl is absent from the cell’s soluble phase and remains accumulated in the insoluble phase for up to the 96 hours that we tested. It was interesting to note that BCL6 polymers do show gradual clearance in the same time frame, in a similar washout experiment, despite soluble BCL6 levels remained undetected (Figure 4B).A canonical cellular mechanism to clear protein aggregates was through autophagy. To assess if it might be involved in the mechanism of clearance of PINCH-induced polymers, Keapl and p62, a marker of autophagy activity, were followed. As a control, Bafolimycin was used which triggers p62 to create cellular puncta, indicative of the activation of the autophagosome. Even though we did not detect clearance of Keapl polymers through WB, ELI 33 treatment induced the formation of Keapl puncta as observed before, co-localized with p62 puncta, suggesting the involvement of the autophagosome in an attempt to clear the formed polymers (Figure 4C). Bardoxolone, which does not induce Keapl polymerization has no similar effect on the co-localization of both proteins.EXAMPLE 9A Hetero-PINCH is able to simultanously downregulate Keapl and BCL6[000164] In certain scenarios, the simultaneus eliminetion of more than one target is of therapeutic or biological interest. In accodrance, if two targets of interest are both homomeric, a single PINCH can be designed to co-precipitate both at the same time. To showcase this idea, a PINCH bearing Bardoxlone and w8001 on either end were synthesized (Figure 7A), to respectively bind Keapl and BCL6 dimers. This theoretically can form a polymer consisting of Keapl and BCL6 dimers alternately, connected by hetero-PINCHs. As discussed, a longer linker will more likely allow the formation of the desired polymer asit minimizes the risk of spacial interference between the protein units, therefore a PEG- 12 linker was selected for the hetero-compund.[000165] The effect of the hetero-PINCH, EL230 in Mino cells (20 h treatment) that express high-levels of BCL6, and observed reduction of both Keapl and BCL6 levels in the soluble phase, and their corresponding accumulation in the insoluble phase, in a dosedependent manner (Figure 7A). To test the dependence of the Hetero-PINCHs acitivty on the presence of both target proteins, EL230 was tested in two addi tonal cell lines, OCI- AML2 and HEK 293T cells, as the latter does not express BCL6. In AML2 cells Keapl and BCL6 were downregulated simultaneusly, while Keapl remains untouched in HEK cells (Figure 7B). In addition, monomeric versions of the compounds comprised of one ligand attached to a linker did not induce such effects on either tartget in Mino cells (Figure 7C).References cited:1. Garcia Seisdedos, H., Levin, T., Shapira, G., Freud, S. & Levy, E. D. Mutant libraries reveal negative design shielding proteins from supramolecular self-assembly and relocalization in cells. Proc. Natl. Acad. Sci. U. S. A. 119, (2022).2. Garcia-Seisdedos, H., Empereur-Mot, C., Elad, N. & Levy, E. D. Proteins evolve on the edge of supramolecular self-assembly. Nature 548, 244-247 (2017).3. Heidenreich, M. et al. Designer protein assemblies with tunable phase diagrams in living cells. Nat. Chem. Biol. 16, 939-945 (2020).4. Slabicki, M. et al. Small-molecule-induced polymerization triggers degradation of BCL6. Nature 588, 164-168 (2020).5. Toure, M. & Crews, C. M. Small-molecule PROTACS: New approaches to protein degradation. Angew. Chem. Int. Ed Engl. 55, 1966-1973 (2016).6. Lee, J. M., Hammaren, H. M., Savitski, M. M. & Baek, S. H. Control of protein stability by post-translational modifications. Nat. Commun. 14, 201 (2023).7. Teng, M. & Gray, N. S. The rise of degrader drugs. Cell Chem Biol 30, 864-878 (2023).8. Gerry, C. J. & Schreiber, S. L. Unifying principles of bifunctional, proximity -inducing small molecules. Nat. Chem. Biol. 16, 369-378 (2020).9. Chweke H, et al. Pacesa M., et al., An atlas of protein homo-oligomerization across domains of life. Cell. 2024 Feb 15;187(4):999-1010. el5. doi:10.1016 / j.cell.2024.01.022. Epub 2024 Feb 6. PMID: 38325366).10. Ward, R. A. et al. Design and synthesis of novel lactate dehydrogenase A inhibitors by fragment-based lead generation. J. Med. Chem. 55, 3285-3306 (2012)11. Basso, K. & Dalla-Favera, R. Roles of BCL6 in normal and transformed germinal center B cells. Immunol. Rev. 247, 172-183 (2012).12. Leeman-Neill, R. J. & Bhagat, G. BCL6 as a therapeutic target for lymphoma. Expert Opin. Ther. Targets 22, 143-152 (2018).13. Guo, W. et al. Synthesis and Biological Evaluation of B-Cell Lymphoma 6 Inhibitors of N-Phenyl-4-pyrimidinamine Derivatives Bearing Potent Activities against Tumor Growth. J. Med. Chem. 63, 676-695 (2020).14. Mamai, A. et al. Discovery of OICR12694: A Novel, Potent, Selective, and Orally Bioavailable BCL6 BTB Inhibitor. ACS Med. Chem. Lett. 14, 199-210 (2023).15. Gu, H. et al. B-cell Lymphoma 6 Inhibitors: Current Advances and Prospects of Drug Development for Diffuse Large B-cell Lymphomas. J. Med. Chem. 65, 15559-15583 (2022).16. Gough, S. M. et al. Potent and Orally Bioavailable BCL6 PROTAC TM Degraders Demonstrate Efficacy in Pre-Clinical Models of Diffuse Large B-Cell Lymphoma (DLBCL). Blood 138, 2272-2272 (2021).17. Gourisankar, S. et al. Rewiring cancer drivers to activate apoptosis. Nature 620, 417- 425 (2023).18. Teng, M. et al. Rationally Designed Covalent BCL6 Inhibitor That Targets a Tyrosine Residue in the Homodimer Interface. ACS Med. Chem. Lett. 11, 1269-1273 (2020).19. Shaffer, A. L. et al. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13, 199-212 (2000).[000166] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims areintended to cover all such modifications and changes as fall within the true spirit of the invention.

Claims

CLAIMS1. A polymerization-inducing chimera (PINCH) compound targeting a homomeric protein of interest, wherein the compound comprises at least two protein binder groups that target the protein of interest, wherein the protein binder groups are the same and covalently connected by a linker.

2. The PINCH compound of claim 1, wherein the linker comprises an -alkylene-, -alkenylene-, -alkynylene-, -aryl-, -cycloalkyl-, -heterocycloalkyl-, - heteroaryl-, -(CH2CH2O)n-, -(CH2CH2S)n- groups, or combination thereof, wherein n is an integer 1-30; wherein the alkylene, alkenylene or alkynylene, is linear or branched and optionally comprises a heteroatom and / or substituted by an alkyl, halide, amine, CN, NO2, COOH, OH, SH or a heterocycle; and wherein the aryl, cycloalkyl, heteroaryl or heterocycloalkyl, is optionally substituted by an alkyl, heterocycle, halide, amine, CN, NO2, COOH, OH or SH.

3. The PINCH compound of claim 1 or claim 2 wherein the PINCH compound that targets the homomeric protein comprises two w8001 groups, two bardoxolone groups or two benzothiazole groups.

4. The PINCH compound of claim 3, wherein the w8001 protein binder groups targets BCL6.

5. The PINCH compound of claim 3, wherein the bardoxolone protein binder group targets Keap 1.

6. The PINCH compound of claim 3, wherein the benzothiazole protein binder group targets LDHA.

7. The PINCH compound of any one of claims 1-6, wherein the compound is EL 221, EL 225, EL 228, EL 229, EL 132, EL 133, EL 164, EL 165, EL 217, EL 218 EL 224, EL 226, EL 227, OS-47B, EL 230.

8. The PINCH compound of any one of claims 1-7, wherein the PINCH compound induces the polymerization of the targeted homomer protein of interest and thereby it aggregates in the cell.

9. The PINCH compound of any one of claims 1-7, wherein the PINCH compound induces the polymerization of the targeted homomer protein of interest and thereby the polymerized protein precipitates in the cell.

10. A pharmaceutical composition comprising the PINCH compound of any one of claims 1-9 and a suitable acceptable carrier.

11. A method for inducing polymerization of homomeric protein of interest, the method comprises binding a PINCH compound of any one of claims 1-9 and a protein of interest forming a polymer comprising protein-PINCH repeating units.

12. The method of claim 11, wherein the polymer comprises more than two proteins as repeating units.

Images