BIS(phenylmethylene)cycloalkanones and their heterocyclic analogues and their use as medicaments, for the treatment or prevention of proteinopathies

Abstract

The present invention relates to the use of bis(phenylmethylene)cycloalkanones and heterocyclic analogues thereof in human and veterinary medicine, for the treatment of diseases caused by the presence or elevated levels of metastable proteins in the cell, imbalances in protein homeostasis and proteotoxic stress, in general proteinopathy, in particular their use in the treatment of neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS), Parkinson's disease (PD), Alzheimer's disease (AD), Kennedy's disease (KD), Huntington's disease (HD), Creutzfeldt-Jakob disease (CJD), spinocerebellar ataxia (SCA), dentatorubral- pallidoluysian atrophy, transthyretin familial amyloid polyneuropathy, systemic amyloidosis, organ- confined amyloidosis, cystic fibrosis, and diabetes. Furthermore, the invention provides novel bis(phenylmethylene)cycloalkanones.

Description

[0001] BIS(PHENYLMETHYLENE)CYCLOALKANONES AND THEIR HETEROCYCLIC ANALOGUES AND THEIR USE AS MEDICAMENTS, FOR THE TREATMENT OR PREVENTION OF PROTEINOPATHIES

[0002] Field of Art

[0003] The present invention relates to bis(phenylmethylene)cycloalkanones and heterocyclic analogues thereof for use in the treatment of diseases caused by the presence or increased levels of metastable proteins in a cell, imbalances in protein homeostasis (proteostasis) and proteotoxic stress. Said diseases are referred to as proteinopathies.

[0004] Background Art

[0005] Protein degradation in the cell is a tightly regulated process that is essential for all life functions and thus for maintaining cellular homeostasis. More than 90 per cent of cytosolic proteins are degraded by the so- called ubiquitin proteasome system (UPS). Defectively synthesised or inappropriately folded proteins are removed through this pathway, and the amount of proteins in the cell is regulated in this way, which is directly related to the regulation of their activity (Kleiger et al.: Trends in cell biology, 2014, 24, 6, 352- 359; Ciechanover et al.: Experimental & molecular medicine, 2015, 47, 3, el47-el47). Central to the UPS system is the 26S proteasome, which is a complicated multiprotein catalytic complex (2500 kDa) that degrades proteins covalently tagged with a polyubiquitin chain (Uys48) into a mixture of peptides. The 26S proteasome consists of a 20S catalytic subunit with three catalytic sites exhibiting chymotrypsin-like, trypsin-like or caspase-like activity, and one or two regulatory subunits designated 19S. It is well known that the aging process and the development of neurodegenerative diseases are closely linked to the accumulation of misfolded or damaged proteins that can be toxic to cells or even directly induce apoptosis. Both aging and the onset and development of neurodegenerative diseases are accompanied by a decrease in UPS activity, which is very often accompanied by the formation of intracellular protein aggregates. For these reasons, modulation or enhancement of UPS activity is considered a very promising approach to delay the onset or to directly treat diseases associated with the accumulation of toxic protein forms, such as amyotrophic lateral sclerosis (AUS), Parkinson’s, Alzheimer’s, Kennedy’s or Huntington’s disease and others (Kleiger et al.: Trends in cell biology, 2014, 24, 6, 352-359; Ciechanover et al.: Experimental & molecular medicine, 2015, 47, 3, el47-el47; Calamini et al.: Nature chemical biology, 2012, 8.2, 185-196). Increasing the activity of the UPS can be achieved, for example, by stimulating its catalytic activity using low molecular weight compounds. Unfortunately, the compounds known so far to exhibit this activity are only very limitedly effective at the in cellulo level (Trader et al.: Biochimica et Biophysica Acta (BBA)- General Subjects, 2017, 1861.4, 892-899; Ueestemakeret al.: Cell chemical biology, 2017, 24.6, 725-736). The most promising way to increase the capacity of the UPS is to increase the synthesis of the proteasome itself, with a concomitant increase in the synthesis of heat shock proteins (HSPs). This can be done by activating the stress transcription factors NRF1 (NFE2LT) and NRF2 NFE2L2) from the so-called Cap-n- Collar (CNC) family of transcription factors (Huryn et al.: J Med Chem, 2019, 63.5, 1892-1907; Bott et al.: Human molecular genetics, 2016, 25.10, 1979-1989).

[0006] Among the compounds activating the transcription factor NRF2 it is worth mentioning dimethyl fumarate, which is clinically used in the treatment of multiple sclerosis (Y adav, et al.: Journal of Molecular Medicine, 2019, 97.4, 463-472). However, NRF2 increases the expression of a number of cytoprotective and antioxidant genes in addition to proteasomal subunits (Brandes et al.: ASN neuro, 2020, 12, 1759091419899782) and exhibits anti-inflammatory and immunomodulatory effects. Other transcription factor NRF2 activating agents include sulforaphane (Chapple et al.: The international Journal of Biochemistry & Cell Biology, 2012 44(8), 1315-1320).

[0007] Recently, activation of the transcription factor NRF1, which is responsible for triggering coordinated expression of all genes for proteasome subunits in response to proteotoxic stress, seems to be more suitable. An important finding is that the active NRF 1 pathway prevents the formation of toxic protein aggregates compared to gene knock-down. Therefore, low molecular weight compounds that selectively activate this signalling pathway while not interacting with the UPS and not causing oxidative stress are considered the most promising approach in the future therapy of neurodegenerative diseases whose development is associated with the formation of protein aggregates and proteotoxic stress (Njomen et al.: J Med Chem, 2019, 62.14, 6469-6481).

[0008] The transcription factor NRF1 preferentially induces the synthesis of all proteasome subunits when proteasome activity is inhibited or deficient; these differ in function and structure and cannot substitute for each other (Kleiger et al.: Trends in cell biology, 2014, 24, 6, 352-359; Koizumi et al.: Proceedings of the Japan Academy. Series B, 2018, 325-336). NRF1 also increases the expression of the transcription factor HSF1, which is responsible for inducing the expression of heat shock proteins, which are chaperones that ensure the cellular response to exposure to stressful conditions. Heat shock proteins help to achieve the correct spatial conformation of misfolded or stress-damaged proteins, which is currently considered to be one of the essential defence mechanisms against the formation of aggregates or toxic protein forms in cells, both at the cell culture level and in mouse models (Bose et al.: Ageing research reviews, 2017, 35, 155- 175).

[0009] Currently, the most discussed compound capable of increasing both proteasomal activity and the expression of heat shock proteins regulated by the transcription factor HSF1 is the curcumin derivative ASC-JM17 (( I / '.'.6 / '.)-4-(cyclobutylmcthyl )- 1 ,7 -bis(3,4-dimethoxyphenyl)hepta-l ,6-diene-3,5 -dione), which has been shown to be a dual activator of both of the above-mentioned signalling pathways. This compound has been approved by the European Medicines Agency for the treatment of spinal and bulbar muscular atrophy (so called Kennedy’s disease). However, its low bioavailability and relatively rapid degradation in tissues, which is a general feature of curcumin and its derivatives, are problematic.

[0010] Since very few compounds capable of targeted enhancement of the cellular response against proteotoxic stress - despite their enormous therapeutic potential - have reached the stage of clinical use, it is essential to develop new agents with higher efficacy, more narrowly targeted mechanism of action, fewer side effects, and the lowest in vivo toxicity.

[0011] Disclosure of the Invention

[0012] The present invention relates to bis(phenylmethylene)cycloalkanones and heterocyclic analogues thereof activating the synthesis of the proteasome, VCP / p97 segregase and heat shock proteins controlled by the transcription factor NRF1 (encoded by the NFE2L1 gene) for use in the treatment of diseases caused by the presence or elevated levels of metastable proteins in the cell, imbalances in protein homeostasis (proteostasis) and proteotoxic stress, in general proteinopathies. In particular, the above-mentioned compounds are relevant for use in the treatment of neurodegenerative diseases, amyloidosis, but also cystic fibrosis or diabetes. Furthermore, the invention provides novel bis(phenylmethylene)cycloalkanones.

[0013] The object of the present invention is the use of compounds of the general formula I as medicaments in the treatment or prevention of proteinopathies, such as neurodegenerative diseases, amyloidosis, cystic fibrosis and / or diabetes,

[0014] I wherein R1, R2, R3, and R4are independently selected from the group comprising a hydrogen atom, a fluorine atom, a hydroxy, a methoxy, a difluoromethoxy, and a trifluoromethoxy group, optionally R1and R2together form a methylenedioxy group and / or R3and R4together form a methylenedioxy group;

[0015] A is a carbon or nitrogen atom and R5is selected from the group comprising a hydrogen atom, deuterium,

[0016] C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl and a group wherein R6is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3-C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group, or

[0017] A is selected from the group comprising an oxygen atom, a sulphur atom, and an SO2 group, and R5is not present; n is 1, 2 or 3. In one aspect, the present invention relates to the use of compounds of the general formula I as medicaments in the treatment or prevention of proteinopathies, neurodegenerative diseases, amyloidosis, and / or cystic fibrosis or diabetes, wherein R1, R2, R3, and R4are independently selected from the group comprising a hydrogen atom, a fluorine atom, a hydroxy, a methoxy, a difluoromethoxy, and a trifluoromethoxy group, optionally R1and R2together form a methylenedioxy group and / or R3and R4together form a methylenedioxy group;

[0018] A is a carbon or nitrogen atom and R5is selected from the group comprising a hydrogen atom, deuterium, C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl and a group R®^0 wherein R6is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3-C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group, or

[0019] A is selected from the group comprising an oxygen atom, a sulphur atom, and an SO2 group, and R5is not present; n is 1, 2 or 3; with the proviso that when A is carbon and n is 1, then R5is not a hydrogen atom or a deuterium atom; and / or with the proviso that at least one of the substituents R1, R2, R3or R4is not a hydroxy group (at most three out of the four substituents R1to R4may be -OH).

[0020] It was observed that when R5is not a hydrogen, the compound of general formula I is more efficient in activating NRF1 transcriptional pathway. Therefore, in one embodiment the present invention relates to the use of compounds of the general formula I as medicaments in the treatment or prevention of proteinopathies, such as neurodegenerative diseases, amyloidosis, and / or cystic fibrosis or diabetes, wherein R1, R2, R3, and R4are independently selected from the group comprising a hydrogen atom, a fluorine atom, a hydroxy, a methoxy, a difluoromethoxy, and a trifluoromethoxy group, optionally R1and R2together form a methylenedioxy group and / or R3and R4together form a methylenedioxy group;

[0021] A is a carbon or nitrogen atom and R5is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl,

[0022] C6-C10 aryl, trifluoromethyl and a group wherein R6is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3-C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group, or A is selected from the group comprising an oxygen atom, a sulphur atom, and an SO2 group, and R5is not present; n is 1, 2 or 3. Preferably, at least one of the substituents R1, R2, R3or R4is not a hydroxy group.

[0023] An alkyl is a saturated linear or branched hydrocarbon. Alkyls may include, but are not limited to, methyl, ethyl, propyl, isopropyl.

[0024] Cycloalkyl is a saturated cyclic hydrocarbon residue. In some embodiments, all carbon atoms of the cycloalkyl are part of the cycle. In some embodiments, some of the carbon atoms of the cycloalkyl are part of the cycle, and some of the carbon atoms of the cycloalkyl form a linear or branched chain attached to the cycle. The cycloalkyl may comprise one or more cycles.

[0025] A heterocycloalkyl is a saturated cyclic hydrocarbon residue comprising at least one heteroatom selected from O, S, and N. In some embodiments, all carbon atoms and heteroatoms of the heterocycle are part of the cycle. In some embodiments, some of the carbon atoms and heteroatoms of the heterocycle are part of the cycle, and some of the carbon atoms, and optionally some of the heteroatoms, of the heterocycloalkyl form a linear or branched chain linked to the cycle. The heterocycloalkyl may contain one or more cycles. Preferably, the heterocycloalkyl comprises one to two heteroatoms. Examples of heterocycloalkyl include morpholinyl, piperazinyl, and morpholinyl ethyl.

[0026] Alkoxy is a group of -O-alkyl. An example of an alkoxy group is methoxy.

[0027] An aryl is an aromatic cyclic hydrocarbon containing one or two cycles. In particular, the aryl may be phenyl, naphthyl, biphenyl, preferably phenyl.

[0028] A heteroaryl is an aromatic cyclic or bicyclic hydrocarbon containing one or more heteroatoms selected from O, S, and N, preferably one, two or three heteroatoms. The heteroatoms are preferably nitrogen atoms. Examples of heteroaryl are pyridyl, imidazolyl.

[0029] The halogen is selected from the group consisting of fluorine, chlorine, bromine, iodine.

[0030] In one embodiment, the substituent R1is other than a hydroxy group.

[0031] In one embodiment, A is a carbon or nitrogen atom and R5is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl and a group , wherein R6is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3- C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group. In one embodiment, A is a carbon or nitrogen atom, R5is the group R6O , and R6is selected from the group comprising methyl, ethyl, propyl, cyclopropyl, trifluoromethyl, benzyl, dimethoxybenzyl, aminoethyl, aminopropyl, N,N-dimethylamonoethyl, N,N-dimethylamonopropyl.

[0032] In one embodiment, A is a carbon or nitrogen atom, and R5is selected from the group comprising H, CH3, CF3, and benzyl, more preferably R5is selected from the group comprising CH3, CF3, and benzyl.

[0033] In one embodiment, A is selected from the group comprising an oxygen atom, a sulphur atom, and an SO2 group, and R5is not present.

[0034] In one embodiment, R1is selected from the group comprising a hydrogen atom, a fluorine atom, a methoxy, a difluoromethoxy, and a trifluoromethoxy group, or R1and R2together form a methylenedioxy group , A is a carbon or nitrogen atom, and R5is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl and a group R®^O , wherein R6is selected from the group comprising Cl- C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3-C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group.

[0035] In one embodiment, A is selected from the group comprising an oxygen atom, a sulphur atom, and an SO2 group, R5is not present, and R1is selected from the group comprising a hydrogen atom, a fluorine atom, a methoxy, a difluoromethoxy, and a trifluoromethoxy group, or R1and R2together form a methylenedioxy group.

[0036] Preferably, R1, R2, R3and R4are independently selected from the group comprising a fluorine atom, methoxy, ethoxy, difluoromethoxy and trifluoromethoxy group.

[0037] In a preferred embodiment, n is i.

[0038] In the case where a compound of general formula I has a positive charge (is in the form of a cation), the compound includes a counterion, which may be a pharmaceutically acceptable anion of an organic or inorganic acid, thereby forming a pharmaceutically acceptable salt. Such an anion may be selected, for example, from the group comprising acetate, aspartate, benzenesulfonate, benzoate, besylate, bicarbonate, bitartrate, bromide, camsylate, carbonate, chloride, citrate, decanoate, edetate, esylate, fumarate, gluceptate, gluconate, glutamate, glycolate, hexanoate, iodide, lactate, malate, maleate, mandelate, mesylate, methansulphate, napsylate, nitrate, octanoate, oleate, palmoate, pantothenate, phosphate, polygalacturonate, propionate, salicylate, stearate, succinate, sulphate, tartarate, tosylate, trifluoroacetate. If the compound of formula I contains chiral centres, then formula I includes pure enantiomers and mixtures of enantiomers including racemate.

[0039] The general formula I includes compounds of formula I in its free form and in the form of salts, addition salts (with acids or bases) and / or solvates, including hydrates or alcohol solvates.

[0040] Another object of the present invention are compounds of general formula I for use in the treatment of diseases caused by the presence or increased levels of metastable proteins in a cell, imbalances in protein homeostasis (proteostasis) and proteotoxic stress. These diseases are called proteinopathies.

[0041] Furthermore, the object of the present invention are compounds of general formula I for use in the treatment of neurodegenerative diseases, amyloidosis, and / or cystic fibrosis or diabetes.

[0042] The object of the present invention are compounds of general formula I, for use in the treatment of neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), Creutzfeldt-Jakob disease (CJD), spinocerebellar ataxia (SCA), dentatorubral-pallidoluysian atrophy, transthyretin familial amyloid polyneuropathy, as well as systemic amyloidosis or organ-confined amyloidosis, and / or cystic fibrosis or diabetes.

[0043] In another aspect, the present invention relates to a compound of general formula I for use in preventing genetically based forms of neurodegenerative diseases, such as familial amyotrophic lateral sclerosis (ALS), familial Parkinson’s disease (PD), familial Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), familial Creutzfeldt-Jakob disease (CJD), familial spinocerebellar ataxia (SCA), transthyretin familial amyloid polyneuropathy, familial dentatorubral-pallidoluysian atrophy, and familial systemic amyloidoses or familial organ-specific amyloidoses, and / or cystic fibrosis.

[0044] One object of the present invention is also a pharmaceutical composition comprising a therapeutically effective amount of at least one compound of the general formula I and at least one pharmaceutically acceptable carrier, filler and / or diluent and / or excipient.

[0045] One object of the present invention are also compounds of the general formula I, selected from the group comprising:

[0046] 2,6-bis(3-fluoro-4-(trifluormethoxy)benzylidene)-4-methylcyclohexanone, I-acetyl-3,5-bis(3,4-methylendioxybenzylidene)piperidin-4-one,

[0047] 3.5-bis(3,4-dimethoxybenzylidene)-I-cyclopropylkarbonylpiperidin-4-one,

[0048] 3.5-bis(3,4-dimethoxybenzylidene)-I-trifluoracetylpiperidin-4-one, 3.5-bis(3,4-dimethoxybenzylidene)-l-(3,4-dimethoxybenzoyl)piperidin-4-one, l-cyclopropankarbonyl-3,5-bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one,

[0049] 2.4-bis(3,4-dimethoxybenzylidene)-8-methyl-8-azabicyclo[3.2.1]octan-3-one,

[0050] 2.6-bis(3,4-dimethoxybenzylidene)-4-trifluormethylcyclohexanone,

[0051] 2.6-bis(4-methoxy-3-(trifluormethoxy)benzylidene)-4-methylcyclohexanone,

[0052] 3 , 5 -bis(4-methoxy-3 -(trifluormethoxy )benzylidene) - 1 -acetylpiperidin-4 -one ,

[0053] 3.5-bis(4-methoxy-3-(trifluormethoxy)benzylidene)-l-(3,4-dimethoxybenzoyl)piperidin-4-one,

[0054] 3.5-bis(3,4-di(difluormethoxy)benzylidene)-l-acetylpiperidin-4-one,

[0055] 2.6-bis(3,4-di(difluormethoxy)benzylidene)-4-methylcyklohexanone,

[0056] 2.6-bis(4-hydroxy-3-(trifluormethoxy)benzylidene)-4-methylcyklohexanone,

[0057] 3,5-bis(3,4-bis(difluoromethoxy)benzylidene)tetrahydrothiopyran-4-one.

[0058] In one aspect, the present invention relates to a method of treatment of diseases directly related to proteinopathies, such as neurodegenerative diseases, amyloidosis, cystic fibrosis or diabetes, comprising the step of administering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment.

[0059] In one aspect, the present invention relates to a method of treatment of proteinopathies, especially neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), Creutzfeldt-Jakob disease (CJD), spinocerebellar ataxia (SCA), dentatorubral-pallidoluysian atrophy, transthyretin familial amyloid polyneuropathy, as well as systemic amyloidosis or organ-confined amyloidosis, and / or cystic fibrosis or diabetes; comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment.

[0060] In one aspect, the present invention relates to a method of treatment of amyloidosis (such as familial amyloidosis without neuropathy, familial neuropathic amyloidosis, familial nervous system amyloidosis, secondary systemic amyloidosis and organ-limited amyloidosis), cystic fibrosis and diabetes, comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment.

[0061] In another aspect, the present invention relates to a method of preventing genetically based forms of neurodegenerative diseases, such as familial amyotrophic lateral sclerosis (ALS), familial Parkinson’s disease (PD), familial Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), familial Creutzfeldt-Jakob disease (CJD), familial spinocerebellar ataxia (SCA), transthyretin familial amyloid polyneuropathy, familial dentatorubral-pallidoluysian atrophy, and familial systemic amyloidoses or familial organ-specific amyloidoses, and / or cystic fibrosis, comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such prevention.

[0062] The compounds of the present invention specifically and significantly activate the pathway controlled by transcription factor NRF1 (encoded by the NFE2L1 gene) compared to the compound ASC-JM17, known in the art, as illustrated in Example 2. Further, based on the analysis disclosed in Example 3, it was surprisingly found that the compounds of the present invention do not affect proteostasis in a negative manner as observed for ASC-JM17. For the use of compounds to treat diseases caused by proteotoxic stress, in particular neurodegenerative diseases, affecting proteostasis towards prolonging the time of protein degradation is an undesirable effect. All tested compounds showed values ranging from a decrease of - 0. 15 to an increase of + 0.35-fold compared to the DMSO control, which are very favourable values in terms of possible influence on cell proteostasis. In contrast, ASC-JM17 showed a 4.24-fold increase in observed fluorescence (i.e., prolongation of degradation time) compared to the control.

[0063] Furthermore, it was proved that the compounds according to the present invention significantly increase the mRNA levels of the monitored proteasomal subunits compared to the control, significantly better compared to the compound ASC-JM17, see Example 4. It was also demonstrated that said compounds cause a surprisingly very strong increase in the levels of mRNA encoding heat shock proteins.

[0064] The protective effect of the compounds according to the present invention against proteotoxic stress is illustrated in Example 7. A cell line overproducing synuclein was subjected to the effect of rotenone, which induces proteotoxic stress, as indicated by a significant decrease in the vitality of the cell line tested. In the case of treatment of cells with all tested compounds, this toxic effect was inhibited.

[0065] A very important aspect in the treatment of not only proteinopathies is that the compounds used do not induce the formation of unwanted reactive oxygen species (ROS). As shown in Example 8, none of the tested compounds induces the formation of reactive oxygen radicals at a concentration of 5 pmol.l1or even at a concentration 5 times higher (25 pmol.l1), which is in sharp contrast to ASC-JM17, which increases ROS quite significantly compared to the DMSO control.

[0066] Another important aspect in the eventual treatment of proteinopathies is the minimal effect of the test compounds on the cell cycle. None of the tested compounds has been shown to have an effect on the cell cycle. In contrast, the control compound ASC-JM17 leaves a significant fraction of cells in the G2 / M phase compared to the control, indicating cell cycle arrest at the G2 checkpoint and significant toxicity of this comparative compound (see Example 9).

[0067] Scheme of the synthesis of bis(phenylmethylene)cycloalkanones and their heterocyclic analogues. The starting cycloalkanones or their heterocyclic analogues were converted to bis(phenylmethylene) derivatives by aldol condensation with the corresponding benzaldehydes. In the case of the 3,5- bis(benzylidene)piperidin-4-one derivatives, further acylation of the nitrogen atom with a suitable reagent was carried out.

[0068] Examples

[0069] List of Abbreviations PI: propidium iodide

[0070] ALS: amyotrophic lateral sclerosis ROS: reactive oxygen species

[0071] AMC: 7-amino-4-methylcoumarin RT: reverse transcription

[0072] BSA: bovine serum albumin Ub: ubiquitin

[0073] Da: Dalton UPS: ubiquitin-proteasome system

[0074] DMEM: Dulbecco's Modified Eagle Medium Renilla luciferase: enzyme from the sea pansy

[0075] DMSO: dimethyl sulfoxide Renilla reniformis

[0076] DTT: dithiothreitol Firefly luciferase: enzyme from fireflies Photinus

[0077] EDTA: ethylenediaminetetraacetic acid pyralis

[0078] ESI: electrospray ionization ACN: acetonitrile

[0079] GFP: green fluorescent protein bs: broad singlet (NMR)

[0080] HRMS: high-resolution mass spectrometry C DCI ,: deuterated chloroform

[0081] HSF1: heat shock transcription factor 1 d: doublet (NMR)

[0082] HSPs: heat shock proteins dd: doublet of doublets (NMR)

[0083] NMR: nuclear magnetic resonance ddd: doublet of doublets of doublets (NMR)

[0084] NRF1: nuclear factor erythroid 2-related factor 1 dt: doublet of triplets (NMR)

[0085] NRF2: nuclear factor erythroid 2-related factor 2 dtd: doublet of triplet of doublets (NMR)

[0086] PBS: phosphate-buffered saline dd: doublet of doublets (NMR)

[0087] PCR: polymerase chain reaction DMAP: 4-Dimethylaminopyridine

[0088] PC 12: pheochromocytoma cell line derived from DMF: dimethylformamide rat adrenal medulla DMSO-t / 6: deuterated dimethyl sulfoxide EtOAc: ethyl acetate MCPBA: meta-chloroperoxybenzoic acid

[0089] HBTU: Hexafluorophosphate Benzotriazole NMR: nuclear magnetic resonance

[0090] Tetramethyl Uronium q: quartet (NMR)

[0091] HC1: hydrochloric acid s: singlet (NMR)

[0092] HR-ESI-MS: high -resolution mass spectrometry t: triplet (NMR) with electrospray ionization td: triplet of doublets (NMR)

[0093] J: coupling constant (NMR) TFA: trifluoroacetic acid m: multiplet (NMR) 5: chemical shift (NMR) [5] - ppm

[0094] MeOH: methanol

[0095] McOD-t / - / : deuterated methanol

[0096] Example 1: Preparation of compounds

[0097] All reactions were carried out under argon in dry solvents. Revers -phase chromatography was performed using the flash chromatography Teledyne ISCO Combi Flash Rf+ system with RediSep Rf Gold Cl 8 reversed-phase columns. All starting materials were used as purchased from Sigma Aldrich, Combi-Blocks and Fluorochem. The purity of compounds and the composition of the reaction mixtures were tested on a Waters UPLC-MS Acquity with QDa Mass Detector (the flow rate of 0.5 mL / min, the gradient of 0-100% MeCN / FbO (0.1% formic acid) in 7 min) with an ACQUITY UPLC BEH C18 Column, 130A, 1.7 pm, 2.1 mm x 100 mm with a 2.1 mm x 5 mm pre-column. ESI high-resolution mass spectra were recorded using a Thermo Scientific LTQ Orbitrap XL (Thermo Fisher Scientific) controlled by MassLynx software. NMR spectra were recorded using NMR spectrometer Bruker Avance III™ HD 400 MHz Prodigy.

[0098] List of compounds

[0099] General Procedure A:

[0100] A mixture of cycloalkanone (5.0 mmol), benzaldehyde (10.0 mmol), and potassium hydroxide (0.11 g, 1.86 mmol) in ethanol (10 mL) was stirred overnight and then quenched with water (20 mL). The product was extracted with ethyl acetate (2x10 mL), and the combined organic layers were washed with water and brine. The solvent was evaporated, and the residue was recrystallized from methanol or purified by column chromatography and then recrystallized from alcohol.

[0101] 2,6-Bis(benzo[l,3]dioxol-5-ylmethylene)cyclohexan-l-one (1)

[0102] Title compound was prepared by aldol condensation of cyclohexanone and piperonal according to general procedure A. The residue after evaporation was purified by recrystallization from methanol to obtain 0.520 g of yellow solid (29% yield). ‘H NMR (400 MHz, CDCh) 5 7.73 (s, 2H), 7.02 (m, 4H), 6.88 (dd, J = 7.7, 0.7 Hz, 2H), 6.03 (s, 4H), 2.94 - 2.83 (m, 4H), 1.83 (m, 2H). HR-ESI-MS calculated for C22H19O5 (M + H)+363.1232, found 363.1235. 2.6-Bis(3,4-dimethoxybenzylidene)cyclohexan-l -one (2)

[0103] Title compound was prepared by aldol condensation of cyclohexanone and 3,4-dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by recrystallization from ethanol to obtain 1.02 g of yellow solid (51% yield).XH NMR (400 MHz, CDCE) 5 7.78 (d, J = 2.0 Hz, 2H), 7.14 (ddd, J = 8.4, 2.0, 0.7 Hz, 2H), 7.05 (d, J= 1.9 Hz, 2H), 6.94 (d, J= 8.4 Hz, 2H), 3.95 (s, 6H),

[0104] 3.94 (s, 6H), 3.11 - 2.75 (m, 4H), 1.86 (m, 2H). HR-ESI-MS calculated for C22H27O5 (M + H)+395.1853, found 395.1853.

[0105] 2.6-Bis(3,4-dimethoxybenzylidene)-4-methylcyclohexa-l-none (3)

[0106] Title compound was prepared by aldol condensation of 4-methylcyclohexanone and 3,4- dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by recrystallization from ethanol to obtain 1.66 g of yellow solid (81% yield). ’H NMR (400 MHz, CDCI3) 5 7.78 (d, J= 2.5 Hz, 2H), 7.14 (dd, J= 8.7, 1.9 Hz, 2H), 7.04 (d, J= 1.9 Hz, 2H), 6.94 (d, J= 8.4 Hz, 2H),

[0107] 3.95 (s, 3H), 3.93 (s, 3H), 3.29 - 2.94 (m, 2H), 2.54 (m, 2H), 1.93 (m, 1H), 1.13 (d, J= 6.6 Hz, 3H). HR- ESI-MS calculated for C25H29O5 (M + H)+409.2009, found 409.2009.

[0108] 2-(3,5-Bis(3,4-dimethoxybenzylidene)-4-oxopiperidine-l-carbonyl)pyridin-l-ium trifluoroacetate (4)

[0109] Title compound was prepared by aldol condensation of l-picolinoylpiperidin-4-one and 3,4- dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.11 g of yellow solid (35% yield). ’H NMR (401 MHz, CDCI3) 5 8.45 - 8.39 (m, 1H), 7.86 (s, 1H), 7.77 (s, 1H), 7.69 (td, J= 7.8, 1.7 Hz, 1H), 7.51 (dt, J= 7.7, 1.1 Hz, 1H), 7.33 (ddd, J= 7.7, 5.0, 1.2 Hz, 1H), 7.17 (d, J = 8.4 Hz, 1H), 7.09 (s, 1H), 7.00 - 6.94 (m, 1H), 6.81 - 6.74 (m, 3H), 5.11 (s, 2H), 4.85 (s, 2H), 3.95 (s, 6H), 3.90 (s, 4H), 3.84 (s, 3H). HR-ESI-MS calculated for C29H28O6N2Na (M + Na)+523.1840, found 523.1845.

[0110] 3 ,5 -Bis(3 ,4-di methoxybenzyl idcnc)tctrahydro-4 / / -thiopy ran-4-onc (5)

[0111] Title compound was prepared by aldol condensation of tetrahydro-4H-thiopyran-4-one and 3,4- dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by recrystallization from methanol to obtain 0.73 g of yellow solid (35% yield).1H NMR (400 MHz, CDCI3) 5 7.76 (s, 2H), 7.13 - 7.01 (m, 2H), 7.00 - 6.88 (m, 4H), 3.98 (m, 4H), 3.95 (s, 3H), 3.93 (s, 3H). HR-ESI- MS calculated for C23H25O5S (M + H)+413.1417, found 413.1413. l-Benzyl-3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (6)

[0112] Title compound was prepared by aldol condensation of 1 -benzyl -4-piperidone and 3,4- dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by recrystallization from methanol to obtain 0.55 g of yellow solid (22% yield).1H NMR (400 MHz, CDCh) 5 7.78 (s, 2H), 7.27 (m, 5H), 7.07 - 6.94 (m, 2H), 6.94 - 6.81 (m, 4H), 3.94 (s, 6H), 3.88 (m, 10H), 3.77 (s, 2H). HR-ESI-MS calculated for C30H32O5N (M + H)+486.2275, found 486.2274.

[0113] General procedure B:

[0114] 4-Piperidone hydrochloride monohydrate (3.25 mmol) and benzaldehyde (6.50 mmol) was dissolved in glacial acetic acid (7 mb). 4 M solution of HC1 in dioxane (2 mb) was added dropwise and the reaction mixture was stirred at ambient temperature overnight. The formed suspension was fdtered, and the solid was purified by recrystallization from hot methanol to obtain the product as the hydrochloride salt.

[0115] 3 ,5 -Bis(3 ,4-dimethoxybenzylidene)piperidin-4-one (7)

[0116] Title compound was prepared by aldol condensation of 4-piperidone hydrochloride monohydrate and 3,4- dimethoxybenzaldehyde according to general procedure B. The residue after evaporation was purified by recrystallization from methanol to obtain 0.80 g of yellow solid (57% yield).1H NMR (400 MHz, MeOD- 4) 5 8.02 (s, 2H), 7.11 (m, 4H), 7.07 (d, J = 1.4 Hz, 2H), 4.67 (d, J = 1.9 Hz, 4H), 3.92 (s, 6H), 3.91 (s, 6H). HR-ESI-MS calculated for C23H26O5N (M + H)+396.1805, found 396.1801.

[0117] 3.5-Bis(3,4-methylenedioxybenzylidene)piperidin-4-one (8)

[0118] Title compound was prepared by aldol condensation of 4-piperidone hydrochloride monohydrate and piperonal according to general procedure B. The residue after evaporation was purified by recrystallization from methanol to obtain 0.70 g of yellow solid (53% yield). 'HNMR (400 MHz, DMSO-t / e) 5 9.82 (s, 2H), 7.79 (s, 2H), 7.16 (d, J= 1.1 Hz, 2H), 7.10 (d, J= 1.0 Hz, 4H), 6.14 (s, 4H), 4.76 - 4.35 (m, 4H). HR-ESI- MS calculated for C2iHi8O5N (M + H)+364.1179, found 364.1177.

[0119] 3.5-Bis(3,4-dihydroxybenzylidene)piperidin-4-one (9)

[0120] Title compound was prepared by aldol condensation of 4-piperidone hydrochloride monohydrate and 3,4- dihydroxybenzaldehyde according to general procedure B. The residue after evaporation was purified by recrystallization from methanol to obtain 0.55 g of yellow solid (45% yield).1H NMR (400 MHz, DMSO- d6) 5 9.85 (bs, 2H), 9.74 (bs, 2H), 9.44 (bs, 2H), 7.70 (s, 2H), 7.10 - 6.65 (m, 6H), 4.43 (bs, 4H). HR-ESI- MS calculated for CI9HI8O5N (M + H)+340.1180, found 340.1182.

[0121] 3.5-Bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one (10)

[0122] Title compound was prepared by aldol condensation of 4-piperidone hydrochloride monohydrate and vanillin according to general procedure B. The residue after evaporation was purified by recrystallization from methanol to obtain 0.63 g of yellow solid (48% yield). ’H NMR (400 MHz, DMSO-t / e) 5 9.91 (bs, 2H), 9.67 (bs, 2H), 7.82 (d, J= 1.8 Hz, 2H), 7.14 (d, J= 1.9 Hz, 2H), 7.07 - 6.74 (m, 4H), 4.50 (bs, 4H), 3.84 (s, 6H). HR-ESI-MS calculated for C21H22O5N (M + H)+368.1492, found 368.1491. 2.6-Bis(3,4-dihydroxybenzylidene)-4-methylcyclohexanone (11)

[0123] Title compound was prepared by aldol condensation of 4-methylcyclohexanone and 3,4- dihydroxybenzaldehyde according to general procedure B. The residue after evaporation was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.86 g of brownish green solid (55% yield). ‘H NMR (400 MHz, DMSO-6) 5 9.45 (bs, 2H), 9.16 (bs, 2H), 7.46 (d, J = 2.3 Hz, 2H), 6.99 (d, J = 2.0 Hz, 2H), 6.93 - 6.86 (m, 2H), 6.86 - 6.69 (m, 2H), 2.97 (dd, J = 16.1,

[0124] 3.7 Hz, 2H), 1.80 (dtd, J = 10.7, 6.8, 3.6 Hz, 1H), 1.07 (d, J = 6.5 Hz, 3H). HR-ESI-MS calculated for C21H21O5 (M + H)+353.1383, found 353.1385.

[0125] 2.6-Bis(3-fluor-4-(trifluoromethoxy)benzylidene)-4-methylcyclohexanone (12)

[0126] Title compound was prepared by aldol condensation of 4-methylcyclohexanone and 3-fluoro-4- (trifluoromethoxy)benzaldehyde according to general procedure B. The residue after evaporation was purified by recrystallization from methanol to obtain 0.13 g of yellow solid (15% yield). ’H NMR (400 MHz, CDCh) 5 7.71 (s, 2H), 7.43 - 7.09 (m, 6H), 3.24 - 2.96 (m, 2H), 2.52 (ddd, J = 16.1, 11.1,

[0127] 2.8 Hz, 2H), 1.94 (m, 1H), 1.14 (d, J = 6.6 Hz, 3H). HR-ESI-MS calculated for C23HI7O3F8(M + H)+493.1050, found 493.1038.

[0128] General procedure C

[0129] A mixture of bis(benzylidene)piperidin -4-one hydrochloride (1 equivalent), acylation agent (1.5 equivalent), triethylamine (3.0 equivalent) and DMAP (0.05 equivalent) in DMF was stirred overnight and then quenched with water. The product was extracted with ethyl acetate and the combined organic layers were washed with water and brine. The solvent was evaporated, and the residue was purified by column chromatography and then recrystallized from alcohol. l-Acetyl-3,5-bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one (13)

[0130] Title compound was prepared by reaction of 3,5-bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one (0.28 g, 0.69 mmol) and acetic anhydride (0.07 g, 0.69 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc:MeOH / 20: 1) and then recrystallized from ethanol to obtain 0.12 g of yellow solid (42% yield). ’H NMR (400 MHz, CDCh) 57.83 (s, 1H), 7.78 (s, 1H), 7.21 - 6.72 (m, 6H), 5.96 (s, 1H), 4.94 (s, 2H), 4.74 (s, 2H), 3.97 (s, 6H), 2.00 (s, 3H). HR-ESI-MS calculated for C23H24O6N (M + H)+410.1604, found 410.1606. l-Acetyl-3,5-bis(3,4-methylenedioxybenzylidene)piperidin-4-one (14)

[0131] Title compound was prepared by reaction of 3,5-bis(3,4-methylenedioxybenzylidene)piperidin-4-one (0.28 g, 0.69 mmol) and acetic anhydride (0.11 g, 1.04 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc) and then recrystallized from ethanol to obtain 0.15 g of yellow solid (53% yield). ’H NMR (400 MHz, CDCh) 5 7.79 (d, J = 1.8 Hz, 1H), 7.75 (s, 1H), 7.12 - 6.79 (m, 6H), 6.07 (s, 2H), 6.05 (s, 2H), 4.91 (d, J= 2.1 Hz, 2H), 4.70 (s, 2H), 2.00 (s, 3H). HR-ESI-MS calculated for C23H20O6N (M + H)+406.1285, found 406.1282. l-Acetyl-3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (15)

[0132] Title compound was prepared by reaction of 3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (0.30 g, 0.69 mmol) and acetic anhydride (0.11 g, 1.04 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc:MeOH / 10: 1) and then recrystallized from ethanol to obtain 0.25 g of yellow solid (82% yield). 'HNMR (400 MHz, CDCE) 5 7.85 (s, 1H), 7.79 (d, J= 2.1 Hz, 1H), 7.14 (dd, J= 8.4, 2.0 Hz, 1H), 7.10 - 7.04 (m, 1H), 7.02 - 6.86 (m, 4H), 4.96 (s, 2H), 4.75 (s, 2H), 3.97 (s, 3H), 3.96 (s, 3H), 3.95 (s, 6H), 2.00 (s, 3H). HR-ESI-MS calculated for C25H28O6N (M + H)+438.1911, found 438.1910.

[0133] 3.5-Bis(3,4-dimethoxybenzylidene)-l-cyclopropylcarbonylpiperidin-4-one (16)

[0134] Title compound was prepared by reaction of 3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (0.50 g, 1.16 mmol) and cyclopropanecarbonyl chloride (0.16 g, 1.50 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc) and then recrystallized from ethanol to obtain 0.43 g of yellow solid (80% yield). ’H NMR (400 MHz, CDCI3) 57.82 (s, 2H), 7.15 - 6.84 (m, 6H), 4.97 (d, J= 1.8 Hz, 4H), 3.96 (s, 6H), 3.95 (s, 6H), 1.53 (ddd, J= 8.0, 4.7, 3.3 Hz, 1H), 1.12 - 0.83 (m, 2H), 0.77 - 0.53 (m, 2H). HR-ESI-MS calculated for C27H30O6N (M + H)+464.2073, found 464.2076.

[0135] 3.5-Bis(3,4-dimethoxybenzylidene)-l-trifluoracetylpiperidin-4-one (17)

[0136] Title compound was prepared by reaction of 3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (0.30 g, 0.69 mmol) and trifluoroacetic anhydride (0.22 g, 1.04 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1: 1) and then recrystallized from ethanol to obtain 0.21 g of yellow solid (61% yield). ’H NMR (400 MHz, CDCI3) 5 7.90 (s, 1H), 7.88 (s, 1H), 7.19 - 7.08 (m, 1H), 7.04 (d, J= 2.0 Hz, 1H), 7.02 - 6.91 (m, 1H), 5.06 - 4.97 (m, 2H), 4.94 (s, 2H), 3.98 (s, 3H), 3.97 (s, 3H), 3.96 (s, 3H), 3.94 (s, 3H). HR-ESI-MS calculated for C25H25O6NF3 (M + H)+492.1634, found 492.1636.

[0137] 3.5-Bis(3,4-dimethoxybenzylidene)-l-ethoxycarbonylpiperidin-4-one (18)

[0138] Title compound was prepared by reaction of 3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (0.43 g, 1.00 mmol) and ethyl chloroformate (0.16 g, 1.50 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1: 1) and then recrystallized from ethanol to obtain 0.40 g of yellow solid (85% yield).1H NMR (400 MHz, CDCI3) 57.79 (d, J= 1.9 Hz, 2H), 7.18 - 7.04 (m, 2H), 7.04 - 6.86 (m, 4H), 4.83 (s, 4H), 4.12 (q, J= 7.1 Hz, 2H), 3.96 (s, 6H), 3.95 (s, 6H), 1.18 (t, J= 7.1 Hz, 3H). HR-ESI-MS calculated for C26H30O7N (M + H)+468.2022, found 468.2024. l-(3,4-Dimethoxybenzoyl)-3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (19)

[0139] Title compound was prepared by reaction of 3,5-bis(3,4-dimethoxybenzylidene)piperidin-4-one (0.30 g, 0.69 mmol) and 3, 4 -dimethoxybenzoyl chloride (0.21 g, 1.10 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc) and then recrystallized from ethanol to obtain 0.34 g of yellow solid (88% yield). ’H NMR (400 MHz, CDCE) 57.86 (s, 2H), 7.13 - 6.84 (m, 7H), 6.79 (dd, J= 8.2, 1.9 Hz, 1H), 6.45 (d, J= 8.3 Hz, 1H), 4.92 (bs, 4H), 3.94 (s, 6H), 3.91 (s, 6H), 3.80 (s, 3H), 3.76 (s, 3H). HR-ESI-MS calculated for C32H34O8N (M + H)+560.2278, found 560.2280. l-Cyclopropanecarbonyl-3,5-bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one (20)

[0140] Title compound was prepared by reaction of 3,5-bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one (0.30 g, 0.74 mmol) and cyclopropanecarbonyl chloride (0.077 g, 0.74 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc) and then recrystallized from ethanol to obtain 0.15 g of yellow solid (46% yield).1H NMR (400 MHz, CDCI3) 5 9.70 (s, 2H), 7.64 (s, 2H), 7.15 (s, 2H), 7.10 - 6.97 (m, 2H), 6.90 (d, J= 8.2 Hz, 2H), 5.05 (bs, 2H), 4.85 (bs, 2H), 3.84 (s, 6H), 1.78 (ddd, J= 9.5, 6.6, 3.9 Hz, 1H), 0.62 (ddt, J= 14.2, 5.4, 3.0 Hz, 4H). HR-ESI- MS calculated for C25H26O6N (M + H)+436.1454, found 436.1455.

[0141] 2,4-Bis(3,4-dimethoxybenzylidene)-8-methyl-8-azabicyclo[3.2.1]octan-3-one (21)

[0142] Title compound was prepared by aldol condensation of tropinone and 3, 4 -dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by column chromatography (eluent EtOAc) and then recrystallized from ethanol to obtain 0.25 g of yellow solid (28% yield). ’H NMR (400 MHz, CDCE) 5 7.83 (s, 2H), 7.04 (d, J= 1.9 Hz, 2H), 7.02 - 6.86 (m, 4H), 4.66 - 4.41 (m, 2H), 3.96 (s, 6H), 3.94 (s, 6H), 2.65 (dd, J= 9.0, 4.7 Hz, 2H), 2.37 (s, 3H), 2.07 (m, 2H). HR-ESI-MS calculated for C26H30O5N (M + H)+436.2118, found 436.2117.

[0143] 2,6-Bis(3,4-dimethoxybenzylidene)-4-trifluoromethylcyclohexaneone (22)

[0144] Title compound was prepared by aldol condensation of 4-trifluoromethylcyclohexanone and 3,4- dimethoxybenzaldehyde according to general procedure A. The residue after evaporation was purified by recrystallization from methanol to obtain 0.61 g of yellow solid (26% yield). ’H NMR (400 MHz, CDCI3) 5 7.89 (m, 2H), 7.12 (dt, J = 8.4, 1.2 Hz, 2H), 7.01 (d, J= 1.9 Hz, 2H), 6.97 (d, J= 8.4 Hz, 2H), 3.96 (s, 6H), 3.94 (s, 6H), 3.39 (dd, J = 15.6, 3.6 Hz, 2H), 2.87 (ddd, J = 15.7, 12.5, 2.9 Hz, 2H), 2.50 (ddt, J = 16.3, 8.2, 4.0 Hz, 1H). HR-ESI-MS calculated for C25H26O5F3 (M + H)+463.1727, found 463.1721. 3.5-Bis(3,4-dimethoxybenzylidene)- l,l-di(oxide)tetra(hydro)-4H-thiopyran-4-one (23)

[0145] Title compound was prepared by oxidation reaction of 3,5-bis(3,4-dimethoxybenzylidene)tetrahydro-4H- thiopyran-4-one (0.30 g, 0.73 mmol) by MCPBA (0.41 g, 1.82 mmol) in DCM. The residue was purified by column chromatography (eluent EtOAc: cyclohexane / 1: 1) and then recrystallized from ethanol to obtain 0.20 g of yellow solid (21% yield). Tf NMR (400 MHz, CDCh) 5 7.95 (s, 2H), 7.12 - 7.02 (m, 4H), 6.96 (d, J= 8.3 Hz, 2H), 4.50 (s, 2H), 3.96 (s, 6H), 3.95 (s, 6H). HR-ESI-MS calculated for C23H27O7SNa (M + Na)+467. 1135, found 467.1136.

[0146] 2,7-Bis(3,4-dimethoxybenzyliden)cycloheptanone (24)

[0147] Title compound was prepared by aldol condensation of cycloheptanone and 3, 4 -dimethoxybenzaldehyde according to general procedure A. Reaction mixture was refluxed overnight. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1:2) and then recrystallized from ethanol to obtain 0.50 g of yellow solid (60% yield). ’H NMR (400 MHz, CDCE) 5 7.37 (s, 2H), 7.18 - 7.06 (m, 2H), 7.04 (d, J= 2A Hz, 2H), 6.93 (d, J= 8.4 Hz, 2H), 3.94 (s, 6H), 3.93 (s, 6H), 2.88 - 2.52 (m, 4H), 2.80 - 1.86 (m, 4H). HR-ESI-MS calculated for C25H29O5 (M + H)+409.2009, found 409.2010.

[0148] 2.6-Bis(4-methoxy-3 -(trifluoromethoxy)benzylidene)-4-methylcyclohexan- 1 -one (25)

[0149] Title compound was prepared by aldol condensation of 4-methylcyclohexan-l-one and 4-methoxy-3- (trifluoromethoxy)benzaldehyde according to general procedure A. Reaction mixture was refluxed overnight. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1:3) and then recrystallized from methanol to obtain 0.43 g of yellow solid (36% yield). ’H NMR (400 MHz, CDCE) 5 7.77 - 7.65 (m, 2H), 7.43 (m, 1H), 7.41 (m, 3H), 7.06 (d, J= 9.1 Hz, 2H), 3.95 (s, 6H), 3.15 - 2.91 (m, 2H), 2.52 (ddd, J= 16.0, 11.2, 2.7 Hz, 2H), 2.19 - 1.83 (m, 1H), 1.13 (d, J= 6.6 Hz, 3H). HR-ESI-MS calculated for C25H23O5F6 (M + H)+517.1444, found 517.1444. l-Acetyl-3,5-bis(4-methoxy-3-(trifluoromethoxy)benzylidene)piperidin-4-one (26)

[0150] Title compound was prepared by reaction of 3,5-bis(4-methoxy-3- (trifhroromethoxy)benzylidene)piperidin-4-one (0.21 g, 0.39 mmol) and acetic anhydride (0.06 g, 0.58 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1: 1) and then recrystallized from methanol to obtain 0.12 g of yellow solid (56% yield).1H NMR (400 MHz, CDCI3) 5 7.80 (s, 1H), 7.74 (s, 1H), 7.51 - 7.32 (m, 3H), 7.30 (s, 1H), 7.09 (dd, J= 13.2, 8.6 Hz, 2H), 5.21 - 4.80 (m, 2H), 4.72 (s, 2H), 3.98 (s, 3H), 3.96 (s, 3H), 1.99 (s, 3H). HR-ESI-MS calculated for C25H22O6NF6(M + H)+546.1345, found 546.1341. l-(3,4-Dimethoxybenzoyl)-3,5-bis(4-methoxy-3-(trifluoromethoxy)benzylidene) piperidin-4-one (27) Title compound was prepared by reaction of 3,5-bis(4-methoxy-3- (trifluoromethoxy)benzylidene)piperidin-4-one (0.21 g, 0.39 mmol) and 3, 4 -dimethoxybenzoyl chloride (0.12 g, 0.58 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc) and then recrystallized from methanol to obtain 0.15 g of yellow solid (57% yield). ’H NMR (400 MHz, CDCh) 5 7.80 (d, J= 1.9 Hz, 2H), 7.42 -7.20 (m, 4H), 7.03 (d, J = 8.4 Hz, 2H), 6.92 (d, J= 2.0 Hz, 2H), 6.77 (dd, J= 8.2, 2.0 Hz, 1H), 6.47 (d, J= 8.3 Hz, 1H), 4.88 (bs, 4H), 3.95 (s, 6H), 3.79 (s, 3H), 3.76 (s, 3H). HR-ESI-MS calculated for C32H28O8NF6(M + H)+668.1713, found 668.1711. l-Acetyl-3,5-bis(3,4-bis(difluoromethoxy)benzylidene)piperidin-4-one (28)

[0151] Title compound was prepared by reaction of 3,5-bis(3,4-bis(difluoromethoxy)benzylidene)piperidin-4-one (0.25 g, 0.44 mmol) and acetic anhydride (0.07 g, 0.65 mmol) according to general procedure C. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1: 1) and then recrystallized from methanol to obtain 0. 18 g of yellow solid (71% yield). 'HNMR (400 MHz, CDC13) 5 7.80 (s, 1H), 7.75 (s, 1H), 7.55 - 7.21 (m, 6H), 6.62 (t, J= 73.1 Hz, 4H), 4.93 - 4.76 (m, 2H), 4.78 - 4.63 (m, 2H), 2.00 (s, 3H). HR-ESI-MS calculated for C25H2o06NF8(M + H)+582.1155, found 582.1155.

[0152] 2.6-Bis(3,4-bis(difluoromethoxy)benzylidene)-4-methylcyclohexan-l-one (29)

[0153] Title compound was prepared by aldol condensation of 4-methylcyclohexan-l-one and 3,4- bis(difluoromethoxy)benzaldehyde according to general procedure A. The residue after evaporation was purified by column chromatography (eluent EtOAc: cyclohexane / 1:3) and then recrystallized from methanol to obtain 0.31 g of yellow solid (26% yield).1H NMR (400 MHz, CDC13) 5 7.84 - 7.66 (m, 2H), 7.43 - 7.37 (m, 2H), 7.37 - 7.31 (m, 4H), 6.59 (td, J = 73.3, 4.5 Hz, 4H), 3.15 - 2.90 (m, 2H), 2.52 (m, 2H), 1.94 (m, 1H), 1.12 (d, J = 6.6 Hz, 3H). HR-ESI-MS calculated for C25H2IO5F8(M + H)+553.1255, found 553.1253.

[0154] 2.6-Bis(4-hydroxy-3-(trifluormethoxy)benzyliden)-4-methylcyclohexan-l-one (30)

[0155] Title compound was prepared by aldol condensation of 4 -methylcyclohexanone and 4-hydroxy-3- (trifluoromethoxy)benzaldehyde according to general procedure B. The residue after evaporation was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.42 g of yellow solid (71% yield). ‘H NMR (400 MHz, CDCh) 5 7.77 - 7.63 (m, 2H), 7.47 - 7.30 (m, 4H), 7.11 (d, J= 8.4 Hz, 2H), 5.67 (bs, 2H), 3.16 - 2.95 (m, 2H), 2.51 (ddd, J = 16.0, 11.2, 2.7 Hz, 2H), 1.93 (dtd, J= 11.0, 7.0, 3.8 Hz, 1H), 1.13 (d, J= 6.5 Hz, 3H). HR-ESI-MS calculated for C .H|9ChF(, (M + H)+489.1131, found 489.1123.

[0156] 3.5-Bis(3.4-bis(difluoromcthoxy)bcnzylidcnc)tctrahydro-4 / / -thiopyran-4-onc (31)

[0157] Title compound was prepared by aldol condensation of tctrahydro-4 / / -thiopyran-4-onc and 3,4- bis(difluoromethoxy)benzaldehyde according to general procedure A. The residue after evaporation was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.36 g of yellow solid (62% yield). ‘H NMR (400 MHz, CDCh) 5 7.80 - 7.59 (m, 2H), 7.43 - 7.27 (m, 6H), 6.59 (td, J= 73.1, 4.2 Hz, 4H), 3.90 (d, J= 1.3 Hz, 4H). HR-ESI-MS calculated for C23Hi6O5F8NaS (M + Na)+579.0483, found 579.0482.

[0158] 3,5-Bis(3,4-dihydroxybenzylidene)tetrahydro-4H-thiopyran-4-one (32)

[0159] Title compound was prepared by aldol condensation of tetrahydro-4H-thiopyran-4-one and 3,4- dihydroxybenzaldehyde according to general procedure B. The residue after evaporation was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.32 g of yellow solid (27% yield). ‘H NMR (400 MHz, CDCh) 5 9.51 (s, 2H), 9.19 (s, 2H), 7.45 (s, 2H), 6.95 (d, J = 2.0 Hz, 2H), 6.87 (dd, J= 8.4, 2.0 Hz, 2H), 6.82 (d, J= 8.2 Hz, 2H), 3.96 (d, J= 1.3 Hz, 4H). HR-ESI- MS calculated for C19H17O5S (M + H)+357.0791, found 357.0787.

[0160] 2-(3,5-Bis(3,4-dimethoxybenzylidene)-4-oxopiperidine- 1 -carbonyl)-3 -methylpyridin- 1 -ium trifluoroacetate (33)

[0161] To a mixture of 3,5-bis(3,4-dimethoxybenzylidene)-4-oxopiperidin-l-ium hydrochloride (0.090 g, 0.21 mmol) and triethylamine (0.10 mb, 0.75 mmol) in DMF (3 mb) was added HBTU (0.119 g, 0.31 mmol) and 3 -methylpicolinic acid (0.043 g, 0.31 mmol). The reaction mixture was stirred for 2 hours at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.105 g of yellow solid (80% yield). ‘H NMR (401 MHz, CDCh) 5 8.40 - 8.34 (m, 1H), 7.86 (t, J= 2.2 Hz, 1H), 7.73 - 7.68 (m, 1H), 7.54 - 7.46 (m, 1H), 7.30 - 7.22 (m, 1H), 7.17 (dd, J= 8.5, 2.0 Hz, 1H), 7.06 (d, J = 2.0 Hz, 1H), 6.98 (d, J= 8.4 Hz, 1H), 6.74 (d, J= 8.4 Hz, 1H), 6.68 (dd, J= 8.4, 2.0 Hz, 1H), 6.62 (d, J = 2.0 Hz, 1H), 5.14 (d, J = 2.2 Hz, 2H), 4.48 (s, 2H), 3.95 (s, 6H), 3.88 (s, 3H), 3.79 (s, 3H), 2.15 (s, 3H). HR-ESI-MS calculated for C30H31O6N2 (M + H)+515.2177, found 515.2174.

[0162] 3 -(3 ,5 -Bis(3 ,4-dimethoxybenzylidene)-4-oxopiperidin- 1 -yl )- '. '-di methyl -3 -oxopropan- 1 -amonium trifluoroacetate (34)

[0163] To a mixture of 3,5-bis(3,4-dimethoxybenzylidene)-4-oxopiperidin-l-ium hydrochloride (0.090 g, 0.21 mmol) and triethylamine (0.13 mb, 0.94 mmol) in DMF (3 mb) was added HBTU (0.119 g, 0.31 mmol) and 3-(dimethylamino)propanoic acid hydrochloride (0.048 g, 0.31 mmol). The reaction mixture was stirred for 2 hours at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) to obtain 0.102 g of yellow solid (85% yield). ’H NMR (401 MHz, CDCh) 5 7.81 - 7.74 (m, 2H), 7.11 - 7.01 (m, 2H), 7.01 - 6.95 (m, 2H), 6.92 (dd, J= 5.2, 3.2 Hz, 2H), 4.90 (s, 2H), 4.79 (s, 2H), 3.93 (s, 3H), 3.92 (s, 3H), 3.91 (s, 6H), 3.32 (t, J= 6.5 Hz, 2H), 2.88 (t, J= 6.6 Hz, 2H), 2.73 (s, 6H). HR- ESI-MS calculated for ChsFUOs^ (M + H)+495.2490, found 495.2485. Example 2: Efficacy of bis(phenylmethylene)cycloalkanones and their heterocyclic analogues in activation of NRF1 (NFE2L1) transcriptional pathway monitored by cell-based reporter assay

[0164] A stable cell line derived from HEK293 cells, containing a 3xPSMA4-ARE / minP / luc2P / reporter derived from an ARE (antioxidant response element) response element from the promoter of the human PSMA4 gene that allows monitoring of NRF1 pathway activation, was cultured in DMEM (Dulbecco’s Modified Eagle Medium) containing 10% FBS, 2 mmol.l1L-glutamine, and 50 pg / ml penicillin, and 50 pg / ml streptomycin. Cells were cultured in a CO2 incubator at 37 °C in an atmosphere containing 5% CO2. This reporter line was transfected with the normalisation Renilla reporter pRL-TK (catalogue number E2241; Promega, Hercules, CA) at approximately 70% confluence. For transfection alone, polyethylenimine (PEI) was used at a PEI / DNA ratio of 3: 1 dissolved in OptiMEM medium. Cells were subsequently seeded in 384-well plates at a concentration of 10xl03in a volume of 25 pL / well and treated with the test compounds dissolved in dimethyl sulfoxide (DMSO) at a concentration of 10 pmol.l116 hours after equilibration. The experiment was repeated in technical quadruplicates and biological duplicate. After a 16-hour incubation, the medium was removed and cells were lysed in 5 pL of IX lysis buffer (25 mmol.l1, Tris-phosphate pH 7.8; 2 mmol.l1dithiothreitol (DTT); 2 mmol.l12,2',2'',2'"-(ethane-l,2-diyldinitrile)tetraacetic acid; 10% (henceforth, percent by volume is always given) glycerol and 1% Triton X-100). After a 10-minute incubation on a shaker, the substrate for Firefly / photinus luciferase (200 mM Tris-HCl; 15 mmol.l1MgSOp 0.1 mmol.l1EDTA; 25 mmol.l1DTT; 1 mmol.l1ATP; 0.2 mmol.l1coenzyme A; and 200 mmol.l1D- luciferin, pH 8.0) was added at a volume of 20 pL per well and luminescence was measured. Firefly luciferase activity was measured, followed by the addition of buffer (25 mmol.l1Na^CE; 10 mmol.l1AcONa; 15 mmol.l1EDTA; 500 mmol.l1Na2SCE; 500 mmol. I1NaCl; 25 pmol.l1phenyl-benzothiazole; 4 pmol.l1coelenterazine and 0.04% BSA, pH 5.0) in the same volume and, after shaking, Renilla luciferase activity was measured. The measurement results (Table 1) are the ratio of Renilla luciferase to Firefly luciferase activity and represent the mean values from two biological replicates with technical quadruplicates with standard deviations.

[0165] The activation of the pathway controlled by the transcription factor NRF 1 for the tested compounds ranged from 1 to 19, i.e. an increase of up to 1900 percent over the control, which was observed for compound 19. A total of 13 test compounds showed higher NRF1 pathway activation values than the control compound ASC-JM17. The EC50 values are in the sub -micromolar range.

[0166] Table 1: Efficacy of NRF1 (NFE2L1) transcriptional pathway activation monitored by cell-based reporter assay

[0167] Emax [10 Jimol.l1]

[0168] COMPOUND EC50[pmol.1-1] > _ _

[0169] X s

[0170] ASC-JM17 6A5 6X0 ± 0.50

[0171] 2 3.88 4.43 ± 0.69

[0172] 3 7.24 8.61 ± 0.26 5 2.34 5.14 ± 0.39

[0173] 6 4.87 10.94 ± 4.39

[0174] 7 2.53 9.83 ± 3.52

[0175] 8 5.59 12.67 ± 3.48

[0176] 12 3.87 11.9* ± 1.20

[0177] 13 5.18 10.1* ± 1.70

[0178] 14 6.35 7.67 ± 3.64

[0179] 15 7.47 11.13 ± 0.76

[0180] 16 4.75 10.11 ± 1.15

[0181] 17 3.71 15.53 ± 5.54

[0182] 18 4.47 14.87 ± 6.54

[0183] 19 4.75 18.96 ± 2.42

[0184] 21 2.42 3.97 ± 1.27

[0185] 22 3.09 5.48 ± 2.01

[0186] 23 N 3.20 ± 0.81

[0187] 25 N 6.02 ± 1.08

[0188] 26 N 4.38 ± 0.34

[0189] 27 7.63 8.00 ± 3.30

[0190] 28 1.73 3.06 ± 0.04

[0191] 29 N 3.10 ± 0.12

[0192] 32 2.89 4.8* ± 1.40

[0193] N means ‘bimodal effect, EC50 cannot be determined’

[0194] *Eniax value at a concentration of 7 pmol.l1Example 3: Influencing protein homeostasis (proteostasis) of the cell by bis(phenylmethylene)cycloalkanones and their heterocyclic analogues

[0195] U2OS cells stably expressing the Ub(G76V)-GFP reporter were cultured in DMEM medium containing 10% FBS, 2 mmol. I1L-glutamine, 50 pg / ml penicillin, and 50 pg / ml streptomycin in a CO2 incubator at 37 °C in an atmosphere containing 5% CO2. Cells were first seeded at 10xl03cells / well in a 384-well plate in DMEM culture medium without the addition of phenol red. On the second day, the test compounds were added. The experiment was carried out in at least three measurements. After 8 hours, the GFP signal was measured (excitation X = 400 nm, emission X = 510 nm), followed by measurement of the cytotoxic effect of the compounds using the Resazurin / Almar blue assay according to the manufacturer’s protocol (ThermoFisher Scientific, catalogue number DAL1025). The GFP intensity was normalised to cell viability according to the formula: (GFP intensity of the compound) / (basal GFP intensity). The basal GFP intensity corresponds to cells that were exposed to DMSO control alone. The results are then expressed as a percentage of the DMSO control.

[0196] Table 2 also shows the results of thecomparative compound ASC-JM17, which shows a strong inhibitory effect on protein degradation, up to eightfold compared to the DMSO control, thus negatively affecting the proteostasis of the cell. In contrast, bis(phenylmethylene)cycloalkanones and their heterocyclic analogues do not inhibit protein degradation in the cell and proteostasis is not changed.

[0197] Table 2: Influencing protein homeostasis (proteostasis) of the cell by selected bis(phenylmethylene)cycloalkanones and their heterocyclic analogues using a GFP degron-based reporter assay

[0198] Emax [10 JimolJ'1]

[0199] Compound EC50 [jimol.l1] - _ - x s

[0200] ASC-JM17 4.24 8.00 ± 2.21

[0201] 1 N 0.18 ± 0.05

[0202] 2 N -0.01 ± 0.25

[0203] 3 N 0.33 ± 0.29

[0204] 5 N 0.35 ± 0.01

[0205] 6 N 0.06 ± 0.04

[0206] 7 N 0.12 ± 0.02

[0207] 8 N 0.12 ± 0.06

[0208] 9 N 0.17 ± 0.05

[0209] 12 N 0.29 ± 0.01

[0210] 13 N 0.18 ± 0.05

[0211] 14 N 0.13 ± 0.01

[0212] 15 N 0.15 ± 0.09

[0213] 16 N 0.17 ± 0.05

[0214] 17 N 0.23 ± 0.02

[0215] 18 N 0.12 ± 0.01

[0216] 19 N 0.14 ± 0.04

[0217] 20 N 0.24 ± 0.09

[0218] 21 N -0.02 ± 0.02

[0219] 22 N 0.13 ± 0.07

[0220] 23 N 0.20 ± 0.01

[0221] 24 N 0.21 ± 0.00

[0222] 25 N -0.08 ± 0.17 26 N -0.11 ± 0.01

[0223] 27 N -0.09 ± 0.01

[0224] 28 N 0.13 ± 0.01

[0225] 29 N -0.15 ± 0.02

[0226] 31 N 0.30 ± 0.04

[0227] 32 N 0.09 ± 0.05

[0228] N means ‘bimodal effect, EC50 cannot be determined’

[0229] Example 4: Effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues on the expression of genes controlled by the transcription factor NRF1 (NFE2L1).

[0230] The human neuroblastoma cell line SH-SY5Y was cultured in DMEM medium containing 10% FBS and 2 mmol.l1L-glutamine in a CO2 incubator at 37 °C and in an atmosphere containing 5% CO2. The compounds were added to 4xl05cells in two technical and three biological repeats each time. After 16 hours, the cells were lysed and mRNA isolation was performed using the NucleoSpin RNA kit (Macherey -Nagel, catalogue number 740955.250) according to the manufacturer’s protocol. mRNA was then transcribed into cDNA using the TATTA GrandScript cDNA Supermix kit (TATAAbiocenter) according to the manufacturer’s recommendations. Quantitative RT-PCR (RT-qPCR) was performed using LightCycler 480 (Roche Life Science). The primers for each gene used in the RT-qPCR reaction are shown in Table 3. The mRNA encoding GAPDH was used for data normalisation.

[0231] The results of the analysis are shown in Table 4. An increase in the level of mRNA encoding the monitored proteasome subunits PSMB7, PSMD12 or PSMC4 compared to the control occurred after the treatment of all tested compounds. Also, the compounds showed a significant effect compared to the control in increasing the level of mRNA (HSP1A1, DNAJA1 and HSPB1) encoding heat shock proteins. This effect was most pronounced for compounds 8, 15 and 17 and significantly exceeded that of the comparator compound ASC-JM17.

[0232] Table 3: Sequence of primers for RT-qPCR

[0233] Gene

[0234] Primer Sequence (5 - 3 ) name

[0235] F TGCAAAGAGGGGATACAAGC (SEQ ID NO. 1)

[0236] PMSB7

[0237] R GCAACAACCATCCCTTCAGT (SEQ ID NO . 2)

[0238] F GGAAGACCATGTTGGCAAAG (SEQ ID NO. 3)

[0239] PMSC4

[0240] R AAGATGATGGCAGGTGCATT (SEQ ID NO . 4)

[0241] F GTGCGCGACTGACTAAAACA (SEQ ID NO. 5)

[0242] PSMD12

[0243] R TAGGCAGAGCCTCATTTGCT (SEQ ID NO. 6) F GCTGCGACAGTCCACTACCT (SEQ ID NO. 7) HSPA1A

[0244] R TGCCGGTTCCCTGCTCTCTG (SEQ ID NO. 8)

[0245] F TCGACGAGGAGAAGACCTTT (SEQ ID NO. 9)

[0246] DNAJA1

[0247] R TCTGACCTGGATGAGAGGTG (SEQ ID NO . 10)

[0248] F AGGATGGCGTGGTGGAGA (SEQ ID NO. 11) HSPB1

[0249] R GGGAGGAGGAAACTTGGGTG (SEQ ID NO . 12)

[0250] F AATCCCATCACCATCTTCCA (SEQ ID NO. 13) GAPDH

[0251] R TGGACTCCACGACGTACTCA (SEQ ID NO. 14)

[0252] T able 4: Effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described here on the expression of genes controlled by the transcription factor NRF1 (NFE2LP), monitored by quantitative RT-PCR. The efficiency of the activation of the genes of interest by the selected compounds is expressed as the expression level of the gene of interest in cells treated with the test compound compared to the expression of the gene of interest in cells treated with dimethyl sulphoxide (DMSO) as a negative control or in cells treated with ASC-JM17. Statistics were evaluated by one-tailed unpaired t-test with Welch’s adjustment in GraphPad Prism 9. The p-values indicate an increase in the level of a given mRNA and are relative to DMSO-treated cells or ASC-JM17; p-values < 0.0001 are indicated by the letter ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. Experiments were performed in biological hexaplicate.

[0253] Example 5: Effect of bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described here on the expression of proteins controlled by the transcription factor NRF1 (NFE2L1)

[0254] Analysis of the expression levels of the studied proteins HA-NRF1, HSPA1A, NQO1 and PSMB7 by western blot in HEK-293 cells overproducing the tagged HA-NRF1 protein and SH-SY5Y cells overproducing a-synuclein. Cells were treated with dimethyl sulphoxide (DMSO) as a negative control, ASC-JM17, or test compounds at 5 pmol.l1concentration for 16 hours.

[0255] Significant increases in NRF1 protein levels occurred in four of the five compounds studied. A similar result was obtained when the expression of HSPA1A protein was monitored. The expression of ubiquinone (NQO1) was then significantly increased after treatment of cells with compounds 13 and 17. In the case of the level of the proteasome subunit PSMB7, an increasing trend was observed for compound 8.

[0256] Table 5: Effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described herein on the expression of NRF1 (NFE2L1) transcription factor-controlled proteins monitored by western blotting. The expression level of the proteins studied was calculated from the integrated fluorescence of the respective bands and normalised to P-actin. Statistics were performed using a one-sample Student’s t-test in GraphPad Prism 9 software, with p-values relative to DMSO-treated cells. The p-values < 0.0001 are indicated by letter ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. Experiments were performed in biological quadruplicate (HA-NRF1 in hexaplicate).

[0257] Example 6: Effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described here on proteasome activity in the cell

[0258] The proteolytic activity of the 20S proteasome was measured using a Anorogenic substrate (Sue -LEVY - AMC, Bachem 1-1395). The PC12, HEK293, MCF and SH-SY5Y-SNCA cell lines were incubated with the test compounds for 16 hours at a concentration of 5 pmol.F1. Cells were lysed in lysis buffer (50 mmol.F1HEPES, pH 7.5; 5 mmol.F1EDTA; 150 mmol.F1NaCl; 2 mmol.F1ATP; 1% Triton) and lysates were incubated each time in technical triplicate in the dark for 30 minutes at 37 °C in 100 pL of buffer (50 mmol.F1Tris, pH 8.0; 10 mmol.F1MgC12; 1 mmol.F1ATP; 1 mmol.F1DTT) with 200 pmol.F1Sue -LEVY - AMC Anorogenic substrate for measurement of chymotrypsin activity. The Auorescence of the formed AMC was measured with a Auorimeter at excitation wavelength X = 360 nm and emission wavelength X = 460 nm. The proteasome activities were relative to the control group affected only by DMSO.

[0259] The results are shown in Table 6. A significant increase in proteasome activity in individual cell lines compared to the control occurred in the case of compounds 13, 15 and 17. For the others, an increasing trend was observed.

[0260] Table 6: Relative chymotrypsin activity of proteasome in HEK 293, MCF, PC-12 and SH-SY5Y cell lines express SNCA after treatment with the compounds for 16 hours. Statistics were evaluated by one-sample Student’s t-test in GraphPad Prism 9 software. The p-values are relative to DMSO-treated cells; the p- values < 0.0001 are indicated by letter ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. Experiments were performed in biological triplicate or quadruplicate.

[0261] Example 7: Protective effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described herein against proteotoxic stress in SH-SY5Y cells in which aggregation of overproduced a-synuclein was induced by rotenone.

[0262] The protective effect of the compounds against proteotoxic stress was further investigated in the SH-SY 5Y - SNCA (synuclein overproducing) cell line compared to the parental SH-SY5Y line. Both cell lines were treated with DMSO as negative control, rotenone [1.125 pmol.l1] (which induces proteotoxic stress) and tested compounds [in the concentration series of 7.5; 5; 3.75; 2.5; 1.25 and 0.625 pmol.l1]. Measured viability values were relative to the DMSO control and are presented as mean ± standard deviation [%].

[0263] As indicated in Table 7, all tested compounds showed a protective effect against proteotoxic stress induced by a-synuclein.

[0264] Table 7: Protective effect of tested compounds against proteotoxic stress. SH-SY5Y and SH-SY5Y SNCA cells were treated with DMSO as negative control, rotenone [1.125 pmol.l1] and tested compounds [in the concentration series of 7.5; 5; 3.75; 2.5; 1.25 a 0.625 pmol.l1]. Measured viability values were relative to the DMSO control and are presented as mean ± standard deviation [%]. Statistics were evaluated using Welch’s ANOVA test followed by multiple comparisons using Dunnett’s T3 test in GraphPad Prism 9. The p-values are relative to cells treated with rotenone alone; p-values < 0.0001 are indicated by letter ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. Experiments were performed in biological triplicate.

[0265] Example 8: Determination of the possible influence of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described herein on the formation of reactive oxygen species in the cell

[0266] Reactive oxygen species (ROS) generation and associated oxidative stress in cells were measured using a 2',7'-dichlorofluorescin diacetate (H2DCFDA) probe (catalogue number D6883-50MG, Sigma-Aldrich) to detect ROS generation inside cells. For plate preparation, 10,000 SH-SY5Y cells were seeded per well in a 96-well plate, the cells were allowed to adhere overnight, and the following day the test compounds were added at two concentrations of 5 and 25 pmol.l1; rotenone (Merck, catalogue number R8875-1G) and TBHP organic peroxide were used as controls for ROS induction in the cells. After 2 hours, the cells were washed with IxPBS (137 mmol. I1NaCl; 2.7 mmol.l1KC1; 1.5 mmol.l1KH2PO4; 10 mmol.l1Na2HPO4) and then 100 pL per well of H2DCFDA probe dissolved in IxPBS at a final concentration of 100 pmol.l1was added for 30 minutes. This was followed by washing out the free probe. In the final step, 50 pL IxPBS was added per well and the fluorescence signal was measured using a Tecan infinite Ml 000 reader at excitation and emission wavelengths of 480 / 535 nm. Experiments were performed in biological triplicate consisting of atechnical quadruplicate for each experiment; data are shown as percentage of DMSO control. The results are presented in T able 6. None of the tested compounds caused the formation of reactive oxygen species at a concentration of 5 pmol.l1or at a concentration 5 times higher (25 pmol.l1), which is in sharp contrast to ASC-JM17, which significantly increased ROS compared to the DMSO control.

[0267] Table 6: Effect of selected compounds on the formation of reactive oxygen species in the cell measured by DCF-DA assay. SH-SY5Y cells were treated with DMSO as a negative control or ASC-JM17 as a control compound. Statistics were evaluated by one-tailed Student’s t-test (against DMSO) and one-tailed unpaired t-test with Welch’s adjustment (ASC-JM17). The p-values indicate a significant change in ROS level and are relative to DMSO or ASC-JM17 treated cells; p-values < 0,0001 are indicated by letter ‘a’, p < 0,001 = ‘b’, p < 0,01 = ‘c’, p < 0,05 = ‘d’. Experiments were performed in biological triplicate.

[0268] Example 9: Effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described herein on the cell cycle

[0269] Cell cycle analysis was performed using flow cytometry after treatment of SH-SY5Y cells with tested compounds in comparison with the negative control DMSO and the control compound ASC-JM17. The individual phases of the cell cycle were determined by staining with propidium iodide (P4170-250MG, Sigma-Aldrich), which as a fluorescent dye intercalates into double -stranded DNA and thus allows semi- quantitative determination of the total DNA content and the distribution of the cell population in the different phases of the cycle: G0 / G1 phase (unreplicated content), S phase (DNA synthesis), G2 / M phase. Cells in 6-well plates at a density of 2.5 x IQ5cells / ml were exposed to the compounds at a concentration of 5 pmol.l1for 16 hours in a CO2 incubator. Subsequently, cells were collected into cytometry tubes, centrifuged for 5 minutes at 500g, washed with nonsterile PBS, and fixed in 70% ethanol at 4 °C. The samples thus prepared were stored at -20 °C. Next, 500 pL of propidium iodide solution was added, and after mixing and incubation for 15 min in a water bath at 37 °C in the dark, 200 pL of ribonuclease A solution (0.7 mol. I1, 060M7000V, Sigma-Aldrich, USA) was added, followed again by 15-min incubation under the same conditions. Samples incubated in this way were kept for at least 1 hour at 4 °C. The analysis was performed on a BD LSR Fortessa flow cytometer using an argon laser (excitation at a wavelength of 488 nm).

[0270] The results are shown in Table 7. None of the compounds tested has an effect on the cell cycle progression. In contrast, the control compound ASC-JM17 leaves a significant proportion of cells in G2 / M phase relative to the control, indicating cell cycle arrest at the G2 checkpoint and thus significant toxicity of the comparative compound.

[0271] Table 7: Cell cycle analysis after treatment of SH-SY5Y cells with the test compounds at a concentration of 5 pM for 16 hours. SH-SY5Y cells were treated with DMSO as a negative control or with the comparative compound ASC-JM17. Values are presented as mean ± standard deviation in %.

[0272] Example 10: Effect of the bis(phenylmethylene)cycloalkanones and their heterocyclic analogues described herein on the formation of polyQ aggregates in the cell.

[0273] To visualise and quantify the amount of expansive polyQ aggregates, U2OS cells were grown on slides divided into four individual compartments pre-coated with poly-D-lysine solution. Forty thousand cells in 450 pL of phenol red-free DMEM culture medium were seeded into individual chambers on these slides. The cells were then allowed to adhere until the next day. Subsequently, cells were transfected with Lipofectamine2000 (Thermo Fisher Scientific, USA) Htt EGFP-Q74 plasmid (Addgene, catalogue number 40262, obtained as a gift from David Rubinsztein) to generate expansion repeats. Four hours after transfection, the medium was replaced with clean medium and the test compounds were added at a final concentration of 5 pmol.l1, and the cells treated in this way were subsequently cultured for 24 hours. Subsequently, the culture medium was aspirated and the cells were washed with PBS and a fixative solution of 4% paraformaldehyde at 400 pL per chamber was added, and the slides were incubated in a hood for 20 minutes. The experiment was performed for each compound including the control in biological triplicate. Subsequently, the slides were washed two more times with PBS and the fixed cells were permeabilised with a solution of 0.3% Triton X100 and 0.1% FBS in PBS for half an hour. Subsequently, cell nuclei were stained using Hoechst 33255 solution (ThermoFisher Scientific, catalogue number H3569) at a concentration of 1 pg / ml for 10 min. Finally, the solution was aspirated and replaced with fresh PBS. Fluorescence images were taken using a Zeiss LSM 780 confocal microscope. The selected fluorophores were captured: EGFP excitation X = 488 nm; emission X = 495-555 nm, at 25% laser power and Hoechst 33255 excitation X = 405 nm; emission X = 410-435 nm, at 10% laser power. For each of the compounds and for the control sample (DMSO), images of > 60 randomly selected cells were taken, and image analysis was subsequently performed on the images thus acquired using ZEN (Zeiss, Germany) and hnageJ (National Institutes of Health, Bethesda USA) software to quantify the EGFP signal intensity in positive cells and to determine the number and size of expansive Htt-Q74 aggregates within GFP-positive cells.

[0274] The results are shown in Table 8. Analysis of the number of expansive aggregates in cells treated with the test compounds clearly showed that compound 8 reduced the relative fluorescence intensity of one cell by 66%, the other compounds reduced the relative fluorescence intensity of one cell by values ranging from 57% to 37%. In contrast, the comparative compound ASC-JM17 reduced the amount of aggregates to only 67%. The total area occupied by protein aggregates in the cell remained unchanged. Surprisingly, however, a significant decrease compared to the control was observed for compound 17. The amount of GFP positive cells with protein aggregates decreased significantly for all tested compounds, a significant decrease compared to the control was again observed for compound 17.

[0275] Table 8: Analysis of the expansive Htt-Q74 aggregates in U2OS cells after treatment of cells with the test compounds at a concentration of 5 pmol.l1for 24 hours compared with the DMSO control and ASC-JM17 control compound. The fluorescence intensities of the test cells are relative to the DMSO control. Values of total area of aggregates in cells are given in pm2and the amount of GFP positive cells with aggregates are given as % of the total number of cells examined. Values of relative fluorescence intensities and total area of aggregates were statistically analysed using the Kolomorov-Smimov test; the proportions of GFP- positive cells with aggregates were analysed using a one-tailed unpaired t-test with Welch’s adjustment in GraphPad Prism 9. The p-values < 0.0001 are indicated by letter ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’ and p < 0.05 = ‘d’.

[0276] Relative fluorescence intensity of a single cell

[0277] DMSO 108 0 6 028 TOO 194 V03 - - ASC-JM17 109 0.03 0.36 0.67 1.27 7.72 c

[0278] 8 103 0.02 0.20 0.34 0.70 2.48 a a

[0279] 13 104 0.06 0.26 0.48 0.99 3.02 a

[0280] 15 109 0.04 0.34 0.63 1.33 4.02 c

[0281] 16 107 0.05 0.25 0.43 0.95 6.16 a d

[0282] 17 108 0.04 0.23 0.46 0.74 6.50 a c

[0283] Total area of aggregates in a single cell [inn2] COMPOUND n Min Q0.25 Median Q0.75 Max P(DMSO) P(ASC-JMI7)

[0284] DMSO 82 0.53 1.06 1.85 3.18 15.88

[0285] ASC-JM17 53 0.53 0.53 1.06 1.59 6.88 d

[0286] 8 49 0.53 1.06 1.59 2.38 6.35

[0287] 13 72 0.53 0.53 1.59 2.65 9.53

[0288] 15 70 0.53 1.06 1.59 2.12 9.53

[0289] 16 71 0.53 1.06 2.12 2.65 6.88

[0290] 17 56 0.53 0.53 1.06 1.59 5.29 c

[0291] Amount of GFP positive cells with aggregates [%1 COMPOUND

[0292] X S P(DMSO) P(ASC-JM17)

[0293] DMSO 75.33 12.66

[0294] ASC-JM17 46.33 13.32 d

[0295] 8 67.33 23.12

[0296] 13 68.00 6.08

[0297] 15 68.00 13.08

[0298] 16 48.67 12.86

[0299] 17 53.33 20.50 d

[0300] Industrial applicability

[0301] The present invention relates to the use of bis(phenylmethylene)cycloalkanones and heterocyclic analogues thereof in human and veterinary medicine for the treatment and / or prevention of diseases caused by the occurrence of misfolded proteins in the cell, imbalances in protein homeostasis and proteotoxic stress, in general proteinopathies, in particular neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), Creutzfeldt-Jakob disease (CJD), desminopathies, spinocerebellar ataxia (SCA), transthyretin familial amyloid polyneuropathy, dentatorubral-pallidoluysian atrophy, as well as systemic amyloidoses, organ-confined amyloidoses, cystic fibrosis or diabetes mellitus.

Claims

CLAIMS1. Compounds of the general formula Iwherein R1, R2, R3, and R4are independently selected from the group comprising a hydrogen atom, a fluorine atom, a hydroxy, a methoxy, a difluoromethoxy, and a trifluoromethoxy group, optionally R1and R2together form a methylenedioxy group and / or R3and R4together form a methylenedioxy group;A is a carbon or nitrogen atom and R5is selected from the group comprising a hydrogen atom, deuterium,C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl and a group, wherein R6is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3-C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group, orA is selected from the group comprising an oxygen atom, a sulphur atom, and an SO2 group, and R5is not present; n is 1, 2 or 3; for use as a medicament in the treatment or prevention of proteinopathies, such as neurodegenerative diseases, amyloidosis, cystic fibrosis or diabetes.

2. Compounds of the general formula I for use according to claim 1, wherein when A is a carbon or nitrogen atom, then R5is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl and a group R®^0 wherein R6is selected from the group comprising C1-C6 alkyl, C3-C6 cycloalkyl, C6-C10 aryl, trifluoromethyl, C1-C6 alkyloxy, C3-C6 cycloalkyloxy, C6-C10 aryloxy, C1-C6 alkylamino, C3-C6 cycloalkylamino and C6-C10 arylamino group.

3. Compounds of the general formula I for use according to claim 1 , wherein at least one of the substituents R1, R2, R3or R4is not a hydroxy group.

4. Compounds of the general formula I for use according to claim 1 as a medicament in the treatment of neurodegenerative diseases selected from the group comprising amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), Creutzfeldt-Jakob disease (CJD), spinocerebellar ataxia (SCA), dentatorubral-pallidoluysian atrophy, transthyretin familial amyloid polyneuropathy, systemic amyloidosis, organ-confined amyloidosis, cystic fibrosis, and diabetes.

5. Compounds of the general formula I for use according to claim 1 as a medicament in the prevention of genetically based forms of neurodegenerative diseases, selected from the group comprising familial amyotrophic lateral sclerosis (ALS), familial Parkinson’s disease (PD), familial Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), familial Creutzfeldt-Jakob disease (CJD), familial spinocerebellar ataxia (SCA), transthyretin familial amyloid polyneuropathy, familial dentatorubral- pallidoluysian atrophy, familial systemic amyloidoses, familial organ-specific amyloidoses, and cystic fibrosis.

6. Compounds of the general formula I, selected from the group consisting of:2,6-bis(3-fluoro-4-(trifluormethoxy)benzylidene)-4-methylcyclohexanone, l-acetyl-3,5-bis(3,4-methylendioxybenzylidene)piperidin-4-one,3.5-bis(3,4-dimethoxybenzylidene)-l-cyclopropylkarbonylpiperidin-4-one,3.5-bis(3,4-dimethoxybenzylidene)-l-trifluoracetylpiperidin-4-one,3 ,5 -bi s ( 3 ,4-dimethoxybenzylidene)- 1 -(3 ,4-dimethoxybenzoyl)piperidin-4-one, l-cyclopropankarbonyl-3,5-bis(4-hydroxy-3-methoxybenzylidene)piperidin-4-one,2.4-bis(3,4-dimethoxybenzylidene)-8-methyl-8-azabicyclo[3.2.1]octan-3-one,2.6-bis(3,4-dimethoxybenzylidene)-4-trifluormethylcyclohexanone,2.6-bis(4-methoxy-3-(trifluormethoxy)benzylidene)-4-methylcyclohexanone,3 , 5 -bis(4-methoxy-3 -(trifluormethoxy )benzylidene) - 1 -acetylpiperidin-4 -one ,3 ,5 -bis(4-methoxy-3 -(trifluormethoxy )benzylidene) - 1 -(3 ,4-dimethoxybenzoyl)piperidin-4-one,3 ,5 -bi s ( 3 ,4-di(difluormethoxy)benzylidene) - 1 -acetylpiperidin-4-one,2.6-bis(3,4-di(difluormethoxy)benzylidene)-4-methylcyklohexanone,2.6-bis(4-hydroxy-3-(trifluormethoxy)benzylidene)-4-methylcyklohexanone,3.5-bis(3,4-bis(difluoromethoxy)benzylidene)tetrahydrothiopyran-4-one.

Images