Method for purifying protein

Abstract

Provided is a method for producing and purifying a target protein, and more specifically, provided are a fusion protein containing a self-aggregating peptide, a linker peptide, a spacer and a target protein moiety, wherein the linker peptide contains an amino acid sequence selected from an elastin-like polypeptide (ELP) or a protease propeptide (ProP) and the spacer contains a cleavage site, and a method for column-free one-step purification of the target protein by means of expressing the fusion protein.

Description

Protein purification methods Technical Field

[0001] The present invention relates to the field of genetic engineering, and more particularly to a method for producing a target protein by using a fusion protein comprising a target protein, a self-aggregating peptide and a connecting peptide portion, and an application thereof in high-throughput production and purification. Background Art

[0002] Recombinant proteins are widely used in a variety of fields, including biomedicine and biocatalysis. In practical applications, high requirements are usually placed on the activity and purity of proteins. However, the large-scale production and purification of many recombinant proteins remain challenging. Among the various expression systems currently used, eukaryotic expression systems such as Chinese hamster ovary (CHO), yeast, or insect cells can express most proteins, including those with complex structures. However, these systems have long production cycles and high costs, or may cause immunogenicity due to incorrect modifications such as glycosylation. Escherichia coli is the most attractive expression system due to its clear genetic background and simple genetic manipulation. However, when expressing proteins containing disulfide bonds or complex structures, such as human insulin and human growth hormone, in E. coli, inactive inclusion bodies are often formed due to protein misfolding, requiring a complex denaturation / renaturation process to restore their activity, resulting in complex production processes, low efficiency, and high costs.

[0003] At the same time, the target protein must be of sufficiently high purity. For example, proteins for medical or pharmaceutical use typically require a purity exceeding 99%; proteins used for X-ray crystallography or biochemical analysis typically require a purity exceeding 95%; and proteins used for antigen-antibody reactions and N-terminal sequencing analysis typically require a purity exceeding 90%. However, separating and purifying the target protein from the host cell protein background is a technical bottleneck in recombinant protein production. Traditional recombinant protein purification methods rely on column chromatography, including ion exchange chromatography, size exclusion chromatography, and affinity chromatography. However, due to their lack of specificity, ion exchange chromatography and size exclusion chromatography are difficult to use as single purification methods to obtain high-purity target proteins. Affinity chromatography requires specific resins and buffers, making it costly and unsuitable for industrial application. Currently, four to six column chromatography steps are typically required to achieve high purity of the target protein, significantly increasing the time and cost of downstream protein purification. It is reported that the cost of the downstream purification process accounts for 50-80% of the overall production cost of recombinant proteins (Markus et al., Trends in Analytical Chemistry, 2021, 20(4):309-325). Moreover, the complex and specific purification conditions make the purification process difficult to standardize, which is not conducive to high-throughput protein purification.

[0004] In recent years, researchers have attempted to develop protein purification methods that do not rely on column chromatography, including the use of N proand elastin-like polypeptide (ELP) tags. However, N pro The induction of inactive inclusion bodies and the subsequent renaturation and refolding required in the downstream process increase time and economic costs. The ELP tag purification process requires multiple phase transitions (high-temperature aggregation-centrifugation-low-temperature disaggregation-centrifugation), typically requiring 3-5 phase transitions to obtain a recombinant protein with a purity of 95%, which affects protein activity and prolongs the purification cycle (Biomacromolecules 2007, 8, 1417-1424). In addition, the ELP tag has a relatively large molecular weight (generally above 30 kDa to ensure purification efficiency), resulting in low recovery of the target protein.

[0005] In recent years, the cleavable self-aggregation tag (cSAT) method has been developed. It uses self-assembling peptides to induce fusion proteins to form active protein aggregates. The target protein is then released into the supernatant by introducing self-cleavage of the intein, thereby achieving the expression and purification of recombinant proteins (Wu W. et al., Microbial Cell Factories, 2011, 10, 9; Xing L. et al., Microbial Cell Factories, 2011, 10, 42). However, existing cSAT technology can only produce recombinant proteins of moderate purity (60-80%), requiring two subsequent standard column purification steps to obtain high-purity proteins with purities exceeding 95%.

[0006] Therefore, a low-cost, high-efficiency preparation technology is needed to produce high-purity and high-activity target proteins.

[0007] Summary of the Invention

[0008] The present invention provides a low-cost, simple, and efficient method for producing and purifying proteins / peptides in a single step, based on a cleavage tag from a self-aggregating peptide. Specifically, this column-free, one-step purification method enables low-cost, simple, and efficient production of high-purity target proteins. More importantly, this column-free, one-step purification method can be used for high-throughput protein purification and screening, particularly for protein drug screening.

[0009] In the first aspect of the present invention, the present invention provides a fusion protein, which comprises from N to C terminus (a) a self-aggregating peptide, a connecting peptide, a spacer and a target protein portion or (b) a target protein, a spacer, a connecting peptide and a self-aggregating peptide portion, wherein the target protein is connected to the connecting peptide via a spacer, and the spacer comprises a cleavage site.

[0010] In some embodiments, the target protein is selected from insulin-like growth factors such as insulin-like growth factor-1 (IGF-1), growth hormones such as human growth hormone (hGH), nanobodies such as anti-new crown nanobody NB21, xylanase, caplacizumab and glutathione sulfhydryl transferase (GST).

[0011] In some embodiments, the connecting peptide comprises an amino acid sequence selected from an elastin-like polypeptide (ELP) and a protease propeptide (ProP), in particular selected from the protease propeptide PEP of Deinococcus gobiensis or a homologue thereof.

[0012] In some embodiments, the self-aggregating peptide comprises a self-assembling peptide, including a surfactant-like short peptide, such as L6KD (SEQ ID NO: 5), or one or more tandemly repeated amphipathic β-pleated short peptides, such as ELK16 (SEQ ID NO: 6). In some embodiments, the self-aggregating peptide comprises a salt concentration-responsive self-aggregating peptide, including α-helical MpA or β-pleated short peptides EIK8 (SEQ ID NO: 58) and EFR8 (SEQ ID NO: 59).

[0013] In the second aspect of the present invention, an isolated polynucleotide is provided, which comprises a nucleotide sequence encoding the fusion protein of the first aspect or a complementary sequence thereof.

[0014] In the third aspect of the present invention, an isolated polynucleotide is provided, which comprises a nucleotide sequence encoding a self-aggregating peptide, a connecting peptide and a spacer, and a multiple cloning site, wherein the multiple cloning site is used to clone a nucleotide sequence for expressing a target protein, whereby the polynucleotide can produce the fusion protein of the first aspect after expression.

[0015] In a fourth aspect of the present invention, a construct, such as an expression construct, is provided, comprising the polynucleotide of the second aspect or the third aspect.

[0016] In the fifth aspect of the present invention, a host cell is provided, which comprises the polynucleotide of the second aspect or is transformed by the construct of the fourth aspect, wherein the host cell is capable of expressing the fusion protein.

[0017] In some embodiments, the host cell is selected from prokaryotes, yeast, and higher eukaryotic cells, wherein the prokaryotes include bacteria of the genera Escherichia, Bacillus, Salmonella, and Pseudomonas and Streptomyces, preferably Escherichia coli.

[0018] In a sixth aspect of the present invention, a method for producing and purifying a target protein is provided:

[0019] (a) preparing the fusion protein of the first aspect;

[0020] (b) obtaining an insoluble fraction containing the fusion protein;

[0021] (c) releasing the target protein from the insoluble portion by cleaving a cleavage site in the fusion protein; and

[0022] (d) optionally, recovering and / or purifying the target protein.

[0023] In some embodiments, step (a) of the method comprises: culturing the host cell of the fifth aspect to express the fusion protein. In further embodiments, step (b) of the method comprises: lysing the host cell, and then obtaining an insoluble fraction comprising the fusion protein by aggregation of the self-aggregating peptide, for example, by inducing the fusion protein to form an insoluble fraction under a certain salt concentration.

[0024] In some embodiments, a method for high-throughput production and purification of multiple target proteins is provided, the method comprising the following steps:

[0025] (a) preparing the fusion protein of the first aspect in parallel, for example, culturing the host cell of the fifth aspect in a multi-well plate such as a 48-, 96-, or 384-deep-well plate to express the fusion protein;

[0026] (b) obtaining an insoluble fraction containing the fusion protein by aggregation of the self-aggregating peptides, for example, placing the fraction in a multi-well plate such as a 48-, 96-, or 384-well filter plate;

[0027] (c) releasing the target protein from the insoluble portion by cleaving a cleavage site in the fusion protein; and

[0028] (d) optionally, recovering and / or purifying the target protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 shows the expression and purification strategy of the target protein based on self-aggregating peptide (SAP) and linker peptide (linker) and the structure of the expression vector used. A: Expression and purification strategy; B: SAP-Linker-Mtu-POI vector structure.

[0030] Figure 2 shows the SDS-PAGE analysis results of the expression and purification of insulin-like growth factor-1 (IGF-1), human growth hormone (hGH), anti-COVID-19 nanoantibody NB21, xylanase, capecitabine, and glutathione S-transferase (GST) fusion proteins. A: IGF-1 expression and purification SDS-PAGE quantitative analysis results; B: hGH expression and purification SDS-PAGE quantitative analysis results; C: NB21 expression and purification SDS-PAGE quantitative analysis results; D: xylanase expression and purification SDS-PAGE quantitative analysis results; E: capecitabine expression and purification SDS-PAGE quantitative analysis results; F: GST expression and purification SDS-PAGE quantitative analysis results.

[0031] Figure 3 shows the high-throughput expression and purification strategy of the target protein and the SDS-PAGE analysis results. A: Schematic diagram of the expression and purification strategy; B: SDS-PAGE analysis results of the target protein, Xyl: xylanase, Cap: capecitabine.

[0032] Figure 4 shows the results of fermentation production, expression and purification of capecitabine. A: OD and glucose control process of the fermentation production process; B: SDS-PAGE analysis results of capecitabine expression and purification.

[0033] Figure 5 shows a protein purification method based on salt-responsive self-aggregating peptides and linker peptides, as well as a diagram of the expression vector structure used. A: Expression and purification strategy; B: Diagram of the SAP-Linker-Mtu-POI vector structure.

[0034] Figure 6 shows the SDS-PAGE results of 0.7 M (NH4)2SO4-mediated expression and salt purification of human growth hormone (hGH, SEQ ID NO: 10) fusion protein, as well as quantitative analysis. The self-aggregating peptides are A: MpA (SEQ ID NO: 7); B: MpA-PEP; C: EIK8 (SEQ ID NO: 58); D: EIK8-PEP; E: EFR8 (SEQ ID NO: 59); and F: EFR8-PEP.

[0035] Figure 7 shows the expression and purification strategy of the target protein based on self-aggregating peptides, linker peptides, and intein (Mxe), as well as the structure of the expression vector used. A: Expression and purification strategy; B: POI-Mxe-Linker-ELK16 vector structure.

[0036] FIG8 shows the results of SDS-PAGE analysis of the intein Mxe (SEQ ID NO: 4) used for the expression and purification of xylanase fusion protein.

[0037] Figure 9 shows the SDS-PAGE analysis results of the linker peptide HD (SEQ ID NO: 44) and HFBII (SEQ ID NO: 45) for fusion protein expression and purification. A: SDS-PAGE analysis results of insulin-like growth factor-1 (IGF-1) expression and purification; B: SDS-PAGE analysis results of capecitabine expression and purification.

[0038] Figure 10 shows the results of SDS-PAGE analysis of the expression and purification of fusion proteins using linker peptides P1-P10. A: SDS-PAGE analysis of insulin-like growth factor-1 (IGF-1) expression and purification; B: SDS-PAGE analysis of capecitabine expression and purification.

[0039] Figure 11 shows SDS-PAGE analysis results for the expression and purification of fusion proteins using the linker peptide PEP truncated forms N1 (SEQ ID NO: 56) and N2 (SEQ ID NO: 57). A: SDS-PAGE analysis results for the expression and purification of insulin-like growth factor-1 (IGF-1); B: SDS-PAGE analysis results for the expression and purification of capecitabine; C: SDS-PAGE analysis results for the expression and purification of xylanase.

[0040] Detailed Description of the Invention

[0041] The present invention is not limited to the specific methods, schemes, reagents, etc. described herein, because these can change. The terms used herein are only used to describe the purpose of specific embodiments rather than to limit the scope of the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art. The protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory operation steps used herein are terms and routine steps widely used in the corresponding fields. The experimental methods not specifically described in the present invention are all carried out according to the specific methods in the book "Molecular Cloning Laboratory Manual" (4th edition) J. Sambrook, or are carried out according to the instructions of the relevant products. The biological reagents used in the present invention, unless otherwise specified, can all be obtained from commercial sources. Those skilled in the art can make various changes, modifications and substitutions without departing from the spirit of the present invention.

[0042] As used herein, the term "and / or" encompasses all combinations of items connected by the term, and should be treated as if each combination had been individually listed herein. For example, "A and / or B" encompasses "A," "A and B," and "B." For example, "A, B, and / or C" encompasses "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0043] Unless otherwise indicated, nucleic acid sequences are referred to herein in a 5' to 3' orientation from left to right; amino acid sequences are referred to herein in an amino (N) to carboxyl (C) orientation from left (upstream) to right (downstream), unless otherwise indicated.

[0044] As used herein, the terms "nucleotide sequence," "polynucleotide," "nucleic acid," and "nucleic acid sequence" are used interchangeably and refer to a macromolecule composed of multiple nucleotides linked by 3'-5' phosphodiester bonds, wherein the nucleotides include ribonucleotides and deoxyribonucleotides. The polynucleotide sequences of the present invention can be codon-optimized for different host cells (e.g., E. coli) to improve expression of the fusion protein. Methods for codon optimization are known in the art.

[0045] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and "enzyme" and "antibody" are both considered "proteins," and are defined as biological molecules composed of amino acid residues linked by peptide bonds.

[0046] As used herein, "self-aggregation" refers to a property of a polypeptide, that is, polypeptide monomers assemble into polymers under certain physical and / or chemical conditions.

[0047] In a first aspect, the present invention provides a fusion protein comprising, from N to C terminus, (a) a self-aggregating peptide, a connecting peptide, a spacer and a target protein portion or (b) a target protein, a spacer, a connecting peptide and a self-aggregating peptide portion, wherein the target protein portion is connected to the connecting peptide portion via a spacer, and wherein the spacer portion comprises a cleavage site.

[0048] As used herein, "target protein" refers to any polypeptide or protein that can be purified by the method of the present invention, non-limiting examples of which include enzymes, hormones, immunoglobulin chains, therapeutic polypeptides such as anti-cancer polypeptides, diagnostic polypeptides, or polypeptides that can be used for immunization purposes, or biologically active fragments thereof, etc. The target polypeptide can be derived from any source, including microbial-derived polypeptides, mammalian-derived polypeptides, and artificial proteins (e.g., fusion proteins or mutant proteins), etc.

[0049] In one embodiment, the target protein is selected from a therapeutic molecule, a detectable molecule or a targeting molecule. The therapeutic molecule includes but is not limited to nucleic acid drugs, protein drugs (including therapeutic polypeptides, therapeutic antibodies, etc.), etc. Exemplary therapeutic molecules include but are not limited to toxins, immunomodulators, antagonists, apoptosis inducers, hormones, radiopharmaceuticals, anti-angiogenic agents, gene drugs, cytokines, chemokines, prodrugs, chemotherapy drugs, etc. The detectable molecules include but are not limited to fluorescent proteins, enzymes, tags, such as red fluorescent protein (RFP), glutathione sulfhydryl transferase, xylanase, etc. The targeting molecules include but are not limited to targeting antibodies, specific receptor ligands, etc. For example, the targeting molecule can be an antibody that specifically targets a tumor antigen.

[0050] In some embodiments, the target protein of the present invention is soluble under certain conditions, for example, it is soluble under conditions where cleavage is induced at the cleavage site, or after cleavage, it becomes soluble by changing the solution conditions such as pH, salt concentration, etc., while the remaining part of the fusion protein after cleavage remains an insoluble aggregate due to the aggregation effect of the self-aggregating peptide.

[0051] In some embodiments, the amino acid sequence of the target protein of the present invention contains at least two cysteines, which can form an intramolecular disulfide bond, such as one intramolecular disulfide bond, two intramolecular disulfide bonds, or more intramolecular disulfide bonds. In some embodiments, the target protein of the present invention is a nanobody. In some embodiments, the target protein of the present invention is an enzyme. In some embodiments, the length of the target protein can be 20-500 amino acids, for example, about 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 amino acids.

[0052] In some embodiments, the target protein or polypeptide is selected from insulin-like growth factors such as insulin-like growth factor-1 (IGF-1), growth hormones such as human growth hormone (hGH), nanobodies such as anti-new crown nanobody NB21, xylanase, capecitabine and glutathione sulfhydryl transferase (GST).

[0053] In some embodiments, the target protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 10-11 or an amino acid sequence encoded by a nucleotide sequence selected from any one of SEQ ID NOs: 38-43.

[0054] As used herein, human growth hormone (hGH) contains 191 amino acids and has two intramolecular disulfide bonds. Human growth hormone can act on almost all tissues and cells, such as physiologically maintaining positive nitrogen balance and initiating protein synthesis in muscle cells, increasing amino acid uptake in skeletal muscle, regulating the longitudinal growth of bones, protecting myocardial cells and lymphocytes from apoptosis, etc. (Levarski et al., Protein Expression and Purification, 2014, 100: 40-47; Zamani et al., Molecular Biotechnology, 2015, 57: 241-250). Therefore, human growth hormone has been widely used in the treatment of various diseases, and there are 11 growth hormone indications approved by the U.S. FDA. Currently, the global sales of growth hormone exceed US$3 billion.

[0055] As used herein, insulin-like growth factor (IGF) contains 70 amino acids and three intramolecular disulfide bonds. It is a group of polypeptide substances with growth-promoting effects, and its secretory cells are widely distributed in human tissues such as the liver, kidney, lung, heart, brain, and intestine. The IGF family includes IGF-I and IGF-II. The production of IGF-I is more dependent on GH, and its growth-promoting effect is strong, making it an important growth factor in childhood. Insulin-like growth factor has been identified as a key factor in many biological systems, including regulating cell development and DNA synthesis, improving blood circulation, and participating in cell proliferation and differentiation. IGF-I has also been used in oxidative folding models, which has promoted the study of disulfide bond formation and rearrangement processes (Jonathan S. et al., Science, 253(5026):1386-1393).

[0056] As used herein, nanobodies are single-domain antibodies (VHH) containing only one heavy chain variable domain. Compared with general chemical drugs and common antibody drugs IgG, they have many advantages such as high stability, strong penetrability, simple structure, and low immunogenicity. They are antiviral drugs with great potential. Experiments have shown that a class of nanobodies can bind to the spike protein of SARS-CoV-2 with high affinity, preventing cells from being infected by the virus (Schoof et al., Science, 2020, 370(6523):1473-1479).

[0057] On September 3, 2018, the EMA approved Sanofi's nanobody drug Cablivi (capacilizumab) for the treatment of acquired thrombotic thrombocytopenic purpura (aTTP) in adults. Acquired or immune-mediated thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy (TMA) characterized by thrombocytopenia and hemolytic anemia. The pathogenesis of acquired TTP is that the patient's own antibodies inhibit the activity of the von Willebrand factor (vWF) cleavage protease ADAMTS13, causing vWF to adhere to platelets and form microvascular thrombi. Capacilizumab contains 259 amino acids and is composed of two 128-amino acid anti-vWF humanized nanobodies connected by an AAA amino acid linker. It is usually expressed by yeast fermentation.

[0058] As used herein, xylanase is a commonly used industrial enzyme that helps hydrolyze D-xylan into D-xylose. Hemicellulose, composed of xylan, is the primary component of most plant cell walls. Xylanase hydrolyzes this component and can therefore be used in a variety of applications, including reducing the viscosity of wheat, barley, corn cobs, and other difficult-to-digest foods.

[0059] As used herein, glutathione S-transferase (GST) is one of the most important Phase II metabolic enzymes for biotransformation in vivo and a major detoxification system for cellular resistance to damage and cancer. Due to its solubility-promoting effect when expressed as a fusion protein and its specific affinity for its substrate, glutathione, it is often used as a tag or model protein for protein purification.

[0060] As used herein, "self-aggregating peptide" refers to a polypeptide that is fused to a protein portion and can mediate the formation of insoluble active aggregates of the fusion protein in the cell after expression in the host cell.

[0061] As used herein, "active aggregate" means that the target protein portion can still be correctly folded and retain activity, or that the target protein portion in the aggregate can retain activity after being released from the fusion protein, preferably in a soluble state.

[0062] Self-aggregating peptides (such as amphiphilic self-assembling peptides) have the ability to induce the formation of active aggregates. When these self-aggregating peptides are fused to a target protein and expressed in host cells, the expressed fusion protein forms insoluble aggregates. Aggregate formation offers several advantages. First, it prevents degradation of the fusion protein by intracellular proteases, thereby increasing its stability. Second, aggregate formation can reduce the burden of the fusion protein on host cell growth, thereby increasing target protein yield. After cell lysis, insoluble aggregates can be collected from the cell lysate by simple centrifugation or filtration, enabling initial purification of the fusion protein and removal of soluble impurities. Subsequently, by cleaving the cleavage site located at the junction between the self-aggregating peptide and the target protein, the soluble portion containing the target protein is released from the insoluble portion (precipitate) and dispersed in the supernatant. Finally, simple centrifugation or filtration is used again to remove insoluble impurities, yielding the soluble target protein. This method based on self-aggregating peptides can simplify protein separation and purification steps, avoiding the use of expensive equipment such as purification columns, thereby significantly reducing production costs. This protein production method based on self-aggregating peptides has broad application prospects, especially in the fields of biopharmaceuticals and protein engineering, providing a new approach for efficient and economically feasible protein production.

[0063] Common self-aggregating peptides in this field can be divided into three categories (Yang et al., Biotechnol Lett, 2018, 40:745-753). The first category induces the formation of stable active aggregates; the second category remains soluble in the cell and forms aggregates in response to external conditions such as pH and salt concentration; the third category, such as N pro Due to the induction of the formation of inactive aggregates, an additional denaturation process is required during the subsequent protein purification process, which is time-consuming and labor-intensive and will not be discussed further in the following discussion.

[0064] Some amphiphilic polypeptides are known in the art. Due to the interaction between their hydrophilic and hydrophobic regions and other driving forces, they can spontaneously form specific self-assembly structures under appropriate conditions (Zhao Q et al., Microbial Cell Factories, 2016, 15: 136). The self-aggregating peptides used in the present invention can be selected from amphiphilic β-folded short peptides, amphiphilic α-helical short peptides and surfactant-like short peptides. Surfactant-like short peptides are composed of a hydrophobic amino acid tail and a hydrophilic amino acid head, and can form assembly structures such as micelles and nanotubes in aqueous solution. Surfactant-like short peptides suitable for use as the self-aggregating peptides of the present invention include L6KD, whose amino acid sequence is shown in SEQ ID NO: 5. In addition, surfactant-like peptides with similar structures (such as L6KD, L6K2 (SEQ ID NO: 60), L6D2 (SEQ ID NO: 61), etc.) have similar activities and can promote the formation of insoluble active aggregates of fusion proteins in cells (Zhou et al., Microbial Cell Factories, 2012, 11, 10). An amphiphilic β-pleated short peptide refers to a short peptide consisting of 4-30 amino acid residues, in which hydrophobic amino acids and charged hydrophilic amino acids are arranged alternately to form a β-pleated structure. In this structure, the hydrophobic amino acid residues are located on one side, and the alternating positively charged and negatively charged hydrophilic amino acid residues are located on the other side. These short peptides can form self-assembly structures through hydrophobic interactions, electrostatic interactions and hydrogen bonding. Generally speaking, the longer the length of the amphiphilic β-pleated structure or the stronger the hydrophobicity, the easier it is for self-assembly to occur, and the higher the mechanical strength of the self-aggregate formed. Specific examples of amphiphilic β-pleated short peptides suitable for the present invention include EIK8 (SEQ ID NO: 58), EFR8 (SEQ ID NO: 59), ELK16 (SEQ ID NO: 6), etc.

[0065] MpA is an amphipathic α-helical peptide with a hydrophilic region separated by a hydrophobic region. The state of MpA is regulated by salt concentration. In a saline solution, under the action of salt-induced hydrophobic interactions and other driving forces, MpA can spontaneously form a specific self-aggregating structure. Within a certain range, as the salt ion concentration increases, the strength of the aggregate increases and the volume increases (Daniel EW et al., Proceedings of the National Academy of Sciences, 2005, 102: 12656-12661; Lin Zhanglin et al., WO2022253266A1).

[0066] In one embodiment, the salt is selected from a monovalent metal salt such as a potassium salt or a sodium salt, a divalent metal salt such as a magnesium salt, a calcium salt, a manganese salt or a copper salt, or an ammonium salt, preferably an ammonium salt, a potassium salt or a sodium salt. In one embodiment, the anion of the salt is selected from a sulfate, a hydrogen phosphate, an acetate, a halide such as a fluoride, a chloride, a bromide or an iodide, a nitrate, a perchlorate, or a thiocyanate ion, preferably a sulfate, a hydrogen phosphate, a chloride or an acetate. In one embodiment, the salt is selected from sodium chloride, sodium sulfate, sodium nitrate, disodium hydrogen phosphate, sodium dihydrogen phosphate, sodium carbonate, potassium chloride, potassium sulfate, potassium nitrate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, potassium carbonate, ammonium nitrate, ammonium sulfate or ammonium chloride, preferably sodium chloride, sodium sulfate or ammonium sulfate.

[0067] As used herein, "spacer" refers to a polypeptide composed of an amino acid sequence of a certain length, which includes a sequence for achieving cutting and connects the various parts of the fusion protein without affecting the structure and activity of the various parts. These cutting sequences include enzymatic cleavage sequences that can be used for protease recognition, or intein sequences for self-cleavage, etc. In certain applications, such as in the production of polypeptide drugs, it is necessary to have a consistent sequence between the recombinantly produced polypeptide and the target polypeptide, i.e., there are no additional amino acid residues at both ends. For this reason, in some embodiments, the spacer in the fusion protein of the present invention also includes a cleavage site. By cutting the cleavage site, the target polypeptide can be released from the fusion protein. The cleavage site for releasing the soluble target protein portion from the insoluble portion (precipitate) in the present invention can be selected from a temperature-dependent cleavage site, a pH-dependent cleavage site, an ion-dependent cleavage site, an enzyme cleavage site or a self-cleavage site, or any other known cleavage site.

[0068] In some embodiments, the cleavage site is a self-cleavage site, for example, an amino acid sequence comprising an intein that can cleave by itself. Intein-based cleavage methods do not require external enzymes or the use of hazardous substances such as hydrogen bromide. Simply changing the buffer environment in which the aggregate is located can simply induce cleavage (Wood et al., Nature Biotechnology, 1999, 17: 889-892). A variety of inteins with self-cleavage properties are known in the art, such as a series of inteins with different self-cleavage properties developed by NEB. In some embodiments, the cleavage site is a pH-dependent cleavage site. In some embodiments, the spacer is connected to the N-terminus or C-terminus of the target polypeptide portion. It should be understood that those skilled in the art can select a suitable spacer as needed and select a suitable connection position for the spacer.

[0069] In some embodiments, the length of the spacer is 10-250 amino acid residues, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 amino acid residues. In some embodiments, the spacer consists of a cleavage site, such as a self-cleavage site, as described herein.

[0070] In the fusion polypeptide of the present invention, the spacer is directly connected to the target polypeptide portion and / or the salt concentration responsive self-aggregating peptide portion. In other embodiments, the spacer further comprises an amino acid linker at its N-terminus and / or C-terminus. In other embodiments, the spacer is connected to the target polypeptide portion and / or the salt concentration responsive self-aggregating peptide portion via an amino acid linker. In some embodiments, the cleavage site is located at the C-terminus of the spacer, and the cleavage site is adjacent to the N-terminus of the target polypeptide portion. In some embodiments, the cleavage site is located at the N-terminus of the spacer, and the cleavage site is adjacent to the C-terminus of the target polypeptide portion. In some embodiments, the spacer is connected to the target polypeptide portion via the cleavage site. In some embodiments, the spacer is directly connected to the N-terminus or C-terminus of the target polypeptide portion via the cleavage site.

[0071] In some embodiments, the spacer comprises an intein, which comprises a self-cleavage site. As used herein, an intein is a special sequence polypeptide with protease activity. After inducing its protease activity, it can be cleaved at a specific amino acid residue at a designed site, thereby separating the target polypeptide from the fusion polypeptide and releasing it into the solution, thereby obtaining a high-purity target polypeptide. The intein-based cleavage method does not require the addition of external enzymes or the use of harmful substances such as hydrogen bromide used in chemical methods. Instead, it simply requires changing the buffer environment in which the aggregate is located to induce cleavage (Wu et al., 1998; TELENTI et al., 1997). Various self-cleaving inteins are known in the art, such as a series of inteins with different self-cleavage properties from NEB.

[0072] In some specific embodiments of the present invention, the intein is selected from Mxe GyrA, Ssp DnaB, or MtuΔI-CM. The "MtuΔI-CM" is derived from the wild-type Mtu recA intein, which is obtained by deleting the nuclease domain of the Mtu recA extra-large intein, retaining the N-terminal 110 amino acids and the C-terminal 58 amino acids to obtain a very small intein, and then introducing four mutations: C1A, V67L, D24G, and D422G (Wood et al., Nature Biotechnology, 1999, 17:889-892). In some embodiments, the MtuΔI-CM comprises the amino acid sequence set forth in SEQ ID NO:3. In some embodiments, the nucleotide sequence encoding the MtuΔI-CM has the nucleotide sequence set forth in SEQ ID NO:36. In some embodiments, the MtuΔI-CM is linked to the C-terminus of the target polypeptide portion. In some embodiments, the intein MtuΔI-CM can be induced to self-cleave at its carboxyl terminus by a buffer system at pH 5.5-6.8, such as pH 6.2. In some embodiments, the spacer is MtuΔI-CM or a mutant thereof.

[0073] In some embodiments, the intein is Mxe GyrA, which has the sequence shown in SEQ ID NO:4. In some embodiments, Mxe GyrA is linked to the C-terminus of the target protein. In some embodiments, the addition of an appropriate amount of dithiothreitol (DTT) to the buffer system can induce self-cleavage of Mxe GyrA at its amino terminus. The concentration of DTT and the reaction time can be determined by the skilled artisan as needed. In addition, DTT can also be removed in subsequent operations. In some embodiments, the spacer is Mxe GyrA or a mutant thereof.

[0074] Previous work has shown that protein purification methods based on cleavable, self-aggregating peptides often suffer from disaggregation of some of the self-aggregated peptides after cleavage, resulting in reduced target protein purity. Furthermore, some proteins experience low cleavage efficiency and are prone to precipitation after cleavage, resulting in low target protein yields. To address these issues, the inventors introduced a linker peptide.

[0075] As used herein, a "connector peptide" is a peptide segment located between a self-aggregating peptide and a spacer. As discovered by the present inventors, the presence of the connector peptide allows for cleavage at the cleavage site and release of the target protein, while the remaining portion (comprising the self-aggregating peptide, the connector peptide, and any spacer or a portion thereof) maintains a tendency or inclination to aggregate, thereby reducing disaggregation of the self-aggregating peptide and enabling improvements in target protein purity, cleavage efficiency, and / or yield.

[0076] In some embodiments, the connecting peptide comprises an amino acid sequence selected from an elastin-like polypeptide (ELP) or a protease propeptide (ProP), in particular selected from the gobiprotease propeptide PEP or a homologue thereof (e.g., at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the PEP).

[0077] As used herein, the term "identity" is used to refer to the match between two polypeptides. The "percent identity" between two sequences is determined by dividing the number of matching positions shared by the two sequences by the number of positions compared x 100. For example, percent identity can be determined by a computer program such as the algorithm of Needleman and Wunsch (J Mol Biol. 48:444-453 (1970)) incorporated into the GAP program in the GCG software package (available at www.gcg.com) or the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)).

[0078] As used herein, elastin-like polypeptide (ELP) is a synthetic polypeptide polymer derived from natural elastin. ELP is composed of multiple VPGXG repeating units (X = A, G, V, or E), and its aggregation properties are related to the number of repeating units (Banki et al., Nature Methods, 2005, 2(9): 659-661). ELP can undergo a reversible phase transition process, known as the inverse temperature transition. When the temperature is below the transition temperature (Tt), ELP is highly soluble in the liquid phase. However, when the temperature is above Tt, the hydrophilic ELP dehydrates and aggregates. ELP fusion proteins also exhibit this property. It should be noted that when the phase transition occurs, only the ELP aggregates, and the fused exogenous protein does not denature or precipitate. By utilizing this characteristic of ELP, the ELP tag can be used to purify ELP fusion proteins conveniently and quickly. In addition, the purification process does not require chromatographic separation, thus avoiding expensive affinity resins and purification equipment. At the same time, the concentration and replacement of the ELP fusion protein buffer also become very simple. The aggregation of the ELP fusion protein is triggered by heating or increasing the salt ion concentration, and the ELP fusion protein is separated from the expression host protein by centrifugation. The precipitated ELP fusion protein is redissolved with a low-salt, low-temperature solution, and then centrifuged to remove insoluble proteins to obtain the ELP fusion protein. A purer ELP fusion protein can be obtained by repeating the steps of triggering precipitation, centrifugation, and re-dissolution. This purification process is called Inverse Transition Cycling (ITC). To ensure that it has good solubility under experimental conditions, the ELP used in this article contains a repeating pentapeptide (VPGXG) 15 (SEQ ID NO: 62), wherein X can independently be Ala, Gly, Val or Glu in a ratio of 4:1, and its phase transition temperature is 45-60°C (J ang et al., Science Advances, 2020, 6(41): eabc4824-4833).

[0079] The present inventors have discovered that the ELP sequence can improve protein solubility when expressed as a fusion. In particular, improvements in the yield and recovery of the target protein were observed, likely due to the repulsive force that increases the distance between molecules.

[0080] As used herein, a protease propeptide is a portion of a protease that is removed during the activation of a protease into a mature protease. The propeptide not only inhibits protease activity but also functions as a molecular chaperone, promoting proper protein folding. Propeptides are widely found in proteases of prokaryotes, eukaryotes, and viruses. They were first discovered and studied during the in vitro renaturation of a secretory protease, subtilisin E (Yabuta et al., Journal of Biological Chemistry, 2001, 276(48):44427-44434). The propeptide is located at the N-terminus of the polypeptide chain and is essential for the folding of subtilisin E. Experiments have shown that after treatment with a denaturant, subtilisin E becomes an unstructured polypeptide chain. When the denaturant is slowly removed, the mature peptide cannot fold correctly and still lacks a higher-order structure, indicating that the mature peptide of subtilisin E does not have all the information required for its own folding. However, when the mature peptide of subtilisin E is co-expressed with a peptide segment at the N-terminus, the mature peptide can fold into a protein with a spatial structure through renaturation. Therefore, this peptide segment at the N-terminus is named IMC (intramolecular chaperone). (Jia Y. et al., FEBS Letters, 2010, 584(23):4789-4796) When studying the folding of nattokinase (NK) in vivo, it was found that the mature peptide co-expressed with IMC can fold correctly, while in the absence of IMC, the mature peptide becomes an inclusion body and cannot be successfully renatured even in vitro. This shows that IMC is also essential for the folding of the mature peptide in vivo.

[0081] In vitro studies have also found that the propeptide of subtilisin E not only assists in the folding of its own protease, but also helps subtilisin BPN and subtilisin Carlsberg, which are highly homologous and have similar three-dimensional structures, to refold (Ujwal Shinde et al., PNAS, 1993, 90: 6924-6928). Studies on some propeptide mutants have found that some mutants have lost the function of assisting protease folding, but their inhibitory effects are more significant. Unlike the original propeptide, they can spontaneously form secondary structures without the presence of a protease (Cynthia et al., Journal of Biological Chemistry, 2001, 305, 1: 151-165). It is possible that the chaperone activity and protease inhibitor activity of the propeptide are separate.

[0082] Sequence analysis of protease propeptides revealed that propeptides are almost always less conserved than their cognate catalytic domains and contain a large number of charged amino acids. The propeptide has two conserved domains N1 and N2 (motifs N1 and N2), including the hydrophobic amino acid residue Val 12 ,Phe 14 ,Ile 30 ,Val 37 ,Leu 51 ,Val 56 ,Leu 59 ,Val 65 and Val 68 (Cynthia et al., Journal of Biological Chemistry, 2001, 305, 1: 151-165). The conserved domain is flanked by charged residues, which are speculated to initiate protease folding through "hydrophobic collapse." Recently, Lin Min et al. discovered that a propeptide (PEP) from the S8 protein family protease of Deinococcus gobiensis (CN112481286B, 2022) can enable the soluble expression of four milk proteins that were not originally expressed, including αS2-casein, κ-casein, α-lactalbumin, and bovine serum albumin, in Escherichia coli.

[0083] In some embodiments, the connecting peptide comprises a (VPGXG)n motif, wherein n is an integer, preferably 10-20, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, more preferably 15. It is known in the art that the strength of aggregation can be adjusted by adjusting the hydrophilicity of the peptide sequence (e.g., using AGVE and adjusting its ratio), which is within the knowledge of those skilled in the art. In one embodiment, the X is independently selected from A, G, V and E. In one embodiment, the X is independently selected from A, G and V. In one embodiment, the X is independently selected from V and E, preferably V:E is about 4:1.

[0084] In some embodiments, the connecting peptide comprises 30-100 amino acid residues, for example, 30-95, 30-90, 30-85, 30-80, 30-75, 30-70, 30-65, 30-60, 30-55, 30-50, 30-40, 40-95, 40-90, 40-85, 40-80, 40-75, 40-70, 40-65, 40-60, 40-55, 40-50, 50-95, 50-90, 50-85, 50-80, 50-75, 50-70, 50-65, 50-60, 60-95, 60-90, 60-85, 60-80, 60-75, 60-70, 60-65, 60-60, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 amino acid residues.

[0085] In some embodiments, the connecting peptide comprises an amino acid sequence selected from any one of SEQ ID NOs: 1-2 and 46-55. In some embodiments, the connecting peptide comprises an amino acid sequence selected from any one of SEQ ID NOs: 52-55, or an amino acid sequence having at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 2. In particular, the connecting peptide is derived from Deinococcus gobiensis, preferably a propeptide of a protease of the S8 protein family.

[0086] In some embodiments, the PEP homolog is selected from P1-P10, wherein P1 (SEQ ID NO:46) is derived from a yeast protease propeptide, P2 (SEQ ID NO:47) is derived from a cucumber protease propeptide, P3 (SEQ ID NO:48) is derived from a cyanobacterial protease propeptide, P4 (SEQ ID NO:49) is derived from a subtilisin propeptide, P5 (SEQ ID NO:50) is derived from a human PCSK9 protease propeptide, and P6-P10 (SEQ ID NOs:51-55) are derived from bacterial protease propeptides.

[0087] In some embodiments, an amino acid linker may be included between the self-aggregating peptide and the connecting peptide, the connecting peptide and the spacer, and / or the spacer and the target protein. In some embodiments, an amino acid linker is included between the self-aggregating peptide and the connecting peptide. In some embodiments, an amino acid linker is included between the connecting peptide and the spacer. In some embodiments, an amino acid linker is included between the spacer and the target protein.

[0088] Those skilled in the art will appreciate that in order to reduce the mutual interference between different parts in the fusion protein of the present invention, the different parts of the fusion protein can be connected by amino acid linkers. As used herein, "amino acid linker" refers to a polypeptide of a certain length consisting of amino acids with low hydrophobicity and low charge effect, which can fully unfold the connected parts and fold into their respective natural conformations without interfering with each other when fused to the protein. Commonly used amino acid linker types include flexible GS type amino acid linkers, rich in glycine (G) and serine (S), and rigid PT type amino acid linkers, rich in proline (P) and threonine (T). In some embodiments, the amino acid linker is selected from GS type amino acid linkers and PT type amino acid linkers. In one embodiment, the length of the amino acid linker can be about 3-30 amino acids, such as about 3-25, 3-20, 3-15, 3-10, 3-5, 5-25, 5-20, 5-15, 5-10, 10-25, 10-25, 10-20, 10-15, 15-25, 15-20, 20-25 amino acids, such as about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 amino acids. In some embodiments, the amino acid sequence of the GS type amino acid linker used in the present invention is shown in SEQ ID NO: 8. In other embodiments, the amino acid sequence of the PT type amino acid linker used in the present invention is shown in SEQ ID NO: 9.

[0089] The inventors were surprised to find that PEP or its homologous polypeptide sequence can promote the expression and aggregation of fusion proteins, and solve the problem of self-aggregation tag disaggregation that was previously prevalent in purification methods based on cleavable self-aggregation tags, thereby increasing the purity of the target protein to 95%, 96%, 97% or even above 98%. This is a new method that truly realizes the coupling of high-activity expression and high-purity purification of recombinant proteins. This method can achieve low-cost, simple and efficient production of high-purity, high-activity recombinant proteins. More importantly, this one-step method for achieving high-purity protein preparation can be used for high-throughput purification of proteins and high-throughput screening of proteins, especially in the screening of protein drugs.

[0090] High-throughput protein purification is of great significance in fields such as drug screening. For example, in the screening process of antibody drugs, the preferred screening method is surface display technology, such as phage surface display, which can quickly screen potential target sequences within a few weeks, with a library capacity of >10 6 CFU (Lu et al., Journal of Biomedical Science, 2020, 27, 1). However, the protein sequences obtained by surface display are likely to be false positives or have insufficient affinity. The current gold standard for antibody detection is still to detect the affinity between antigen and antibody through SPR or BLI, and both detection technologies require the purity of the test object to be >90%. Therefore, after dozens to hundreds of candidate sequences are screened by surface display technology, the proteins containing these sequences need to be expressed and purified one by one, and affinity testing is performed. There are already some commercial His-Tag-based high-throughput purification technologies, such as small gravity columns, but this process is time-consuming, labor-intensive and costly, which limits its large-scale application.

[0091] The purification technology provided by this invention not only allows for the production of highly pure proteins in a single step, but also allows for easy standardization of the purification process, eliminating the need for individually optimized purification conditions for each target protein and the use of expensive reagents or materials. This makes it well-suited for development into high-throughput screening technologies. For example, it could be used for screening nanoantibody drugs or antimicrobial peptides, or combined with AI-assisted protein design for protein evolution engineering.

[0092] In a second aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence encoding the fusion protein of the first aspect or a complementary sequence thereof.

[0093] In the third aspect, the present invention provides an isolated polynucleotide comprising a nucleotide sequence encoding a self-aggregating peptide, a connecting peptide and a spacer, and a multiple cloning site, wherein the multiple cloning site is used to clone a nucleotide sequence for expressing a target protein, whereby the polynucleotide can produce the fusion protein described in the first aspect after expression.

[0094] As used herein, the term "expression" generally refers to the process of producing a polypeptide by transcription and translation of a polynucleotide. In this article, the term "expression" can be understood as "heterologous expression", that is, it refers to the expression of a polypeptide encoded by a heterologous nucleic acid in a host cell or in vitro.

[0095] In a fourth aspect, the present invention provides a construct, such as an expression construct, comprising the polynucleotide of the second aspect or the third aspect.

[0096] As used herein, "expression construct" refers to a vector, such as a recombinant vector, suitable for expressing a nucleotide sequence of interest in an organism. "Expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (such as transcription to generate mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein. The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or an RNA capable of translation (such as mRNA). Typically, in an expression construct, the nucleotide sequence of interest is operably linked to a regulatory sequence.

[0097] As used herein, "regulatory sequence" and "regulatory element" are used interchangeably and refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence and that affect the transcription, RNA processing or stability, or translation of the sequence of interest. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

[0098] As used herein, the term "operably linked" refers to a regulatory sequence that is linked to a nucleotide sequence of interest such that transcription of the nucleotide sequence of interest is controlled and regulated by the regulatory sequence. Techniques for operably linking regulatory sequences to nucleotide sequences of interest are known in the art.

[0099] In the expression constructs of the present invention, the polynucleotide sequence encoding the fusion protein is operably linked to expression control sequences to facilitate desired transcription and ultimately production of the fusion protein in the host cell. Suitable expression control sequences include, but are not limited to, promoters, enhancers, ribosome interaction sites such as ribosome binding sites, polyadenylation sites, transcriptional splicing sequences, transcriptional termination sequences, and sequences that stabilize mRNA.

[0100] Vectors used in the expression constructs of the present invention include those that replicate autonomously in host cells, such as plasmid vectors, and also include vectors that are capable of integrating into and replicating along with host cell DNA. Many vectors suitable for the present invention are commercially available. In one embodiment, the expression construct of the present invention is derived from pET30a(+) from Novagen.

[0101] In a fifth aspect, the present invention provides a host cell comprising the polynucleotide of the second aspect of the invention or transformed with the construct of the fourth aspect of the invention, such as an expression construct, wherein the host cell is capable of expressing the fusion protein.

[0102] Host cells for expressing fusion protein of the present invention include prokaryotes, yeast and higher eukaryotic cells. Exemplary prokaryotic hosts include the bacterium of Escherichia, Bacillus, Salmonella and Pseudomonas and Streptomyces. In a preferred embodiment, the host cell is an Escherichia cell, preferably Escherichia coli. In a specific embodiment of the present invention, the host cell used is Escherichia coli BL21 (DE3) strain cell (Novagen).

[0103] A polynucleotide or construct of the present invention, e.g., an expression construct, can be introduced into a host cell by one of a number of well-known techniques, including but not limited to heat shock transformation, electroporation, DEAE-dextran transfection, microinjection, liposome-mediated transfection, calcium phosphate precipitation, protoplast fusion, microprojectile bombardment, viral transformation, and the like.

[0104] In one embodiment, the polynucleotide encoding the fusion protein can be integrated into the genome of the host cell, which can express the encoded fusion protein under appropriate conditions or constitutively express the encoded fusion protein.

[0105] In one embodiment, the polynucleotide encoding the fusion protein is present in the host cell in an extrachromosomal form (eg, a plasmid or a construct such as an expression vector).

[0106] In a sixth aspect, the present invention provides a method for producing and purifying a target protein, comprising:

[0107] (a) preparing the target protein into the fusion protein described in the first aspect;

[0108] (b) generating active aggregates by aggregation of self-aggregating peptides to obtain an insoluble fraction containing the fusion protein;

[0109] (c) releasing the target protein from the insoluble portion by cleaving a cleavage site in the fusion protein; and

[0110] (d) optionally, recovering and / or purifying the target protein.

[0111] Herein, the preparation of fusion proteins can be carried out using any suitable techniques and means known in the art, such as using host cells or in vitro cell-free expression systems to express the fusion protein under suitable expression conditions. The host cells or expression systems expressing the fusion protein can be used directly in subsequent steps, or can be isolated or purified to remove non-desirable substances to obtain host cells or expression systems expressing the fusion protein.

[0112] In one embodiment, step (a) of the method comprises: culturing the host cell of the fifth aspect of the invention under conditions suitable for expression of the fusion protein, and optionally isolating and / or collecting the host cell.

[0113] In one embodiment, step (a) of the method comprises: transforming host cells with the construct, in particular the expression construct, of the fourth aspect of the invention, culturing the transformed host cells under conditions suitable for expression of the fusion protein, and optionally isolating and / or collecting the host cells.

[0114] In one embodiment, step (a) of the method comprises: constructing an expression construct (e.g., a plasmid or viral vector) comprising a nucleotide sequence encoding a fusion protein formed by fusion of the peptide described in the first aspect of the invention and a target protein, transforming host cells with the expression construct, culturing the transformed host cells under conditions suitable for expression of the fusion protein, and optionally isolating and / or collecting the host cells.

[0115] In one embodiment, the polynucleotide sequence encoding the target protein can be cloned into the multiple cloning site of the polynucleotide of the third aspect of the present invention to obtain a polynucleotide encoding a fusion protein, and then a construct containing the polynucleotide can be introduced into a host cell for expression or expressed in an in vitro cell-free system to produce a fusion protein.

[0116] The host cells include prokaryotes, yeasts and higher eukaryotic cells, such as bacteria including but not limited to Escherichia, Bacillus, Salmonella, Pseudomonas and Streptomyces, preferably Escherichia cells, more preferably Escherichia coli, such as Escherichia coli BL21 (DE3) (Novagen).

[0117] Herein, obtaining the insoluble portion containing the fusion protein refers to achieving aggregation of the fusion protein by adopting appropriate methods or means such as adjusting pH, salt ion concentration, etc. according to the aggregation properties of the self-aggregating peptide adopted, targeting the host cell or expression system expressing the fusion protein, thereby obtaining active aggregates of the fusion protein.

[0118] In one embodiment, the method step (b) includes: collecting and lysing cells, and / or collecting the supernatant or precipitate containing the fusion protein. For example, if the self-aggregating peptide spontaneously or under certain conditions self-aggregates in the host cell, after the fusion protein is expressed, the host cells are collected, the cells are lysed, the precipitate is collected, or the precipitate is collected under the certain conditions (for example, by centrifugation). For example, when using a self-aggregating peptide that induces aggregation with salt (especially when the fusion protein can be soluble after expression), after the fusion protein is expressed, the aggregation of the self-aggregating peptide is induced by increasing the salt concentration (for example, after expression by the host cell, the supernatant is obtained by crushing the cells, and then salt is added), resulting in the aggregation of the fusion protein and the active aggregate of the fusion protein. Step (b) can be repeated more than once, for example, the precipitate obtained is redissolved by changing the pH or salt concentration, and then precipitated to further reduce the content of substances other than the fusion protein in the precipitate obtained.

[0119] Conditions for expressing fusion proteins are known in the art, such as temperature, pH, culture medium, etc. Any suitable method for recovering fusion proteins is known in the art, including but not limited to, for example, by chromatography, centrifugation, dialysis, etc.

[0120] Herein, cleavage of the cleavage site in the fusion protein can be performed using any suitable technique known in the art, thereby rendering the target protein no longer connected to the rest of the fusion protein and becoming a free, independent portion. For example, the obtained insoluble portion containing the fusion protein can be placed in a suitable solution, and the pH and other conditions can be adjusted to allow cleavage at the cleavage site described herein, thereby releasing the target protein.

[0121] As described herein, cleavage of the fusion protein can be performed by any suitable means known in the art, such as including a spacer sequence between the short peptide tag and the target protein, wherein the spacer sequence comprises a cleavage site that can be cleaved (such as the cleavage site described herein), thereby removing the short peptide tag by cleaving the fusion protein, thereby releasing the target protein.

[0122] Herein, the released target protein can be recovered by any suitable method or means. For example, if the released target protein is soluble under the cleavage conditions, it can be dissolved in the solution, while the remaining portion of the cleaved fusion protein also forms insoluble aggregates due to the aggregation of the self-aggregating peptide, thereby collecting the supernatant, and optionally removing the precipitate, such as by centrifugation; if the released target protein is insoluble under the cleavage conditions, the conditions of the solution, such as pH, salt ion concentration, etc., can be changed to make it soluble and the remaining portion of the cleaved fusion protein also forms insoluble aggregates due to the aggregation of the self-aggregating peptide, and then collecting the supernatant, optionally removing the precipitate, such as by centrifugation.

[0123] In one embodiment, the method comprises the following steps: (a) culturing a host cell of the present invention to express a fusion protein of the present invention; (b) lysing the host cell, then removing the soluble portion of the cell lysate and recovering the insoluble portion (the fusion protein is insoluble in the cytoplasm), or removing the insoluble portion of the cell lysate and recovering the soluble portion (the fusion protein is soluble in the cytoplasm, such as a self-aggregating peptide that does not aggregate in the cytoplasm using salt-induced aggregation), adding salt to induce the fusion protein to form an insoluble portion at a certain salt concentration; (c) releasing a soluble target protein from the fusion protein of the insoluble portion by cutting the cleavage site; and (d) recovering the soluble portion containing the target protein, and optionally separating or purifying it. A schematic diagram of the method of the present invention can be seen in Figure 1A.

[0124] In the present invention, the method for lysing the host cells is selected from the treatment methods commonly used in the art, such as ultrasound, homogenization, high pressure (e.g., in a French press), hypotonicity (osmolysis), detergents, lytic enzymes, organic solvents, or a combination thereof, and the lysis is performed under weakly alkaline pH conditions (e.g., pH 7.5-8.5), thereby lysing the cell membrane of the host cells and releasing the active aggregates from the cell, while still maintaining an insoluble state. In other embodiments, the fusion protein is recovered in a soluble form, and the fusion protein is obtained in a precipitated state by changing the ion concentration.

[0125] In a further embodiment, the present invention provides a method for high-throughput production and purification of multiple target proteins, comprising:

[0126] (a) preparing the respective target proteins in parallel to form the fusion proteins of the first aspect, for example, by expressing a polynucleotide encoding the fusion protein in a host cell or an in vitro cell-free system, the polynucleotide being obtained, for example, by cloning a nucleotide sequence encoding the target protein into the multiple cloning site of the polynucleotide of claim 7, for example, by culturing the host cells of the fifth aspect in a 96-deep-well plate to express the fusion protein;

[0127] (b) generating active aggregates by aggregation of self-aggregating peptides to obtain an insoluble fraction containing the fusion protein, for example, in a 96-well filter plate;

[0128] (c) releasing the target protein from the insoluble portion by cleaving a cleavage site in the fusion protein; and

[0129] (d) optionally, recovering and / or purifying the target protein.

[0130] The method of the present invention can be used to prepare multiple fusion proteins of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300 or more target proteins in parallel. Multiple target proteins can be prepared into the fusion proteins of the present invention separately, for example, host cells expressing these fusion proteins are placed in an array on a multi-well culture plate, such as a 96-well plate, and then the method of producing and purifying the target protein of the present invention is carried out, thereby simultaneously producing and purifying multiple target proteins.

[0131] As used herein, "purity" refers to the purity of the target protein, that is, the proportion of the target protein, such as human growth hormone, to the total protein in the purified solution. Since the target protein is expressed in cells, there are a large number of other proteins in the cells (for example, E. coli has thousands of proteins). Purifying the target protein from such a large and diverse protein mixture has always been a key technical challenge. Through steps such as cell crushing, centrifugation, and separation after cutting, the purified solution basically contains only protein and inorganic salts. Therefore, the higher the proportion of target protein in the purified solution, the higher the purity of the production.

[0132] Unlike existing production and purification technologies, the present invention's fusion method, which is based on the assistance of self-aggregating peptides and connecting peptides, can successfully produce large quantities of active target proteins. The self-aggregating peptides used in the present invention can induce the fusion protein to form a large number of active protein aggregates, which can prevent the target protein from being degraded in the host and help it to fold correctly in prokaryotic cells. In particular, the inventors were surprised to find that this method only requires a simple centrifugation operation to obtain a target protein with a considerable yield and a purity of >98%. The production and purification method of the present invention has low equipment requirements, does not require column purification, has low production costs, is easy to operate, and has extremely high purity.

[0133] As used herein, the word "or" is intended to include "and" unless the context indicates otherwise.

[0134] As used herein, "optional" or "optionally" means that the subsequently described event or circumstance occurs or does not occur, and the description includes instances where the event or circumstance occurs and instances where it does not occur. For example, an optionally included step means that the step exists or does not exist.

[0135] As used herein, the term "about" refers to a range of values ​​that includes the specific value and that one skilled in the art would reasonably consider to be similar to the specific value. In some embodiments, the term "about" refers to within the standard error of measurement using commonly accepted methods of measurement in the art. In some embodiments, about refers to ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, or even ±0.5% of the specific value.

[0136] As used herein, when a specific value or ratio is listed for a feature in the specification, a range consisting of any two of the values ​​or ratios is also included. For example, when the values ​​1, 2, 3, and 4 are listed, a range of 1-2, 1-3, 1-4, 2-3, 2-4, and 3-4 is also included.

[0137] Although various embodiments and aspects of the present invention are shown and described herein, it will be apparent to those skilled in the art that these embodiments and aspects are merely examples of the present invention. Those skilled in the art can make various changes, alterations, and substitutions without departing from the spirit of the present invention. It will be appreciated that the various alternatives of the embodiments of the present invention described herein can be used in the enforcement of the present invention. Example

[0138] In order to make the technical solutions and advantages of the present invention more clear, the embodiments of the present invention will be further described in detail below through examples. It should be understood that the examples should not be construed as limiting, and those skilled in the art can make further adjustments to the embodiments based on the principles of the present invention.

[0139] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to, for example, Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, Cold Spring Harbor, NY). All primers used were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0140] Example 1: Construction of L6KD-Mtu-POI, L6KD-ELP-Mtu-POI, L6KD-PEP-Mtu-POI fusion protein expression vectors

[0141] POI represents the target protein. In the examples of this application, POI refers to insulin-like growth factor IGF-1, human growth hormone hGH (SEQ ID NO: 10), anti-COVID-19 nanoantibody NB21 (SEQ ID NO: 40), xylanase, capecitabine, or glutathione sulfhydryltransferase GST. The primers required for plasmid construction were designed using oligo 7 and synthesized by Shanghai Bioengineering Co., Ltd. as shown in Table 1.

[0142] Table 1: Oligonucleotide primers used in this example

[0143] First, the ELP (SEQ ID NO: 1) polynucleotide sequence was designed (Banki MR et al., Nature Methods, 2005, 2(9): 659-661), and the PEP (SEQ ID NO: 2) polynucleotide sequence was obtained from NCBI (NCBI No.: WP_014683986). The gene fragment was synthesized by Beijing Ruibo Xingke. Using the synthesized gene as a template, ELP-F2 and ELP-R2 as primers were used to amplify the ELP and PEP polynucleotide fragments respectively by PCR reaction. The PCR reaction used NEB's Q5 polymerase (New England Biolab (NEB)) and the PCR conditions were: 98°C 30 seconds, 98°C 10 seconds, 67°C 30 seconds, 72°C 30 seconds, for a total of 30 cycles; and finally 72°C 2 minutes. After the reaction was completed, the PCR amplification products were separated and recovered on 1% agarose gel.

[0144] Using the pET32-L6KD-MtuΔI-CM-hGH template (Lin et al., Chemical Engineering Science, 2022, 262:118052), where the L6KD amino acid sequence is shown in SEQ ID NO:5, the Mtu nucleotide sequence is shown in SEQ ID NO:36, and the hGH nucleotide sequence is shown in SEQ ID NO:39, PCR was performed using primers MF, ORI-R, and ORI-F, MR to amplify the Mtu-hGH fragment and the Backbone-L6KD fragment, respectively. PCR reactions were performed using NEB's Q5 polymerase. PCR conditions were as follows: 98°C for 30 seconds, 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 120 seconds, for a total of 30 cycles; and finally at 72°C for 2 minutes. After completion of the reaction, the PCR products were separated and recovered on a 1% agarose gel. The ELP, Mtu-hGH fragment and Backbone-L6KD fragment, as well as the PEP, Mtu-hGH fragment and Backbone-L6KD fragment were assembled by Gibson assembly (for example, see https: / / www.neb.cn / applications / cloning-and-synthetic-biology / dna-assembly-and-cloning / gibson-assembly), and the homology arm sequences were CCGACGCCGACCCCAGAATTC (SEQ ID NO: 65), GCGCTGGCTGAAGGCACGC (SEQ ID NO: 66) and TGTGACCGTCTCCGGGAGCTG (SEQ ID NO: 16), to obtain pET32-L6KD-ELP-Mtu-hGH and pET32-L6KD-PEP-Mtu-hGH. The assembled product was transformed into Escherichia coli DH5α competent cells, and the transformed cells were spread on LB plates supplemented with 100 μg / mL carbenicillin to screen positive clones. The plasmids were extracted and sequenced. The sequencing results showed that the cloned plasmid sequences were correct.

[0145] The amino acid sequence of the NB21 gene (SEQ ID NO: 40) was obtained from the literature (Schoof et al., Science, 2020, 370(6523): 1473-1479), and the gene fragment was obtained by gene codon optimization and synthesis by Shanghai Bioengineering. The synthesized gene was used as a template and POI-F and END-R were used as primers to amplify the NB21 fragment by PCR. The Backbone-KanaR fragment was amplified by PCR using pET30-L6KD-Mtu-IGF (Lin et al., Chemical Engineering Science, 2022, 262: 118052) as a template and END-F and ORI-R as primers. The Backbone-L6KD-Mtu fragment was amplified by PCR using the above-mentioned pET32-L6KD-MtuΔI-CM-hGH as a template and ORI-F and POI-R as primers. After the PCR reaction, the PCR amplification product was separated and recovered by 1% agarose gel. The NB21, Backbone-KanaR, and Backbone-L6KD-Mtu fragments were assembled by Gibson Assembly to generate the pET30-L6KD-Mtu-NB21 plasmid. The construction procedures for the pET30-L6KD-ELP-Mtu-NB21 and pET30-L6KD-PEP-Mtu-NB21 plasmids were similar, except that the PCR templates for the Backbone-L6KD-Mtu fragment were replaced with pET32-L6KD-ELP-Mtu-hGH and pET32-L6KD-PEP-Mtu-hGH, respectively. The Gibson Assembly product was transformed into competent Escherichia coli DH5α cells, and the transformed cells were plated on LB plates supplemented with 50 μg / mL kanamycin to screen for positive clones. The plasmids were then extracted and sequenced.

[0146] The construction process of other plasmids was similar. IGF-1 (SEQ ID NO: 38), xylanase (SEQ ID NO: 41), caplacizumab (SEQ ID NO: 42) and GST (SEQ ID NO: 43) genes were derived from pET30-L6KD-Mtu-IGF (Lin et al., Chemical Engineering Science, 2022, 262, 118052), pET30-CpA-Mtu-Xylanase (Lin Zhanglin et al., WO2022253266A1), pET32-L6KD-Mtu-Caplacizumab (Lin et al., Chemical Engineering Science, 2022, 262: 118052) and pET30-CpA-Mtu-GST (Lin Zhanglin et al., WO2022253266A1), respectively. Taking GST as an example: PCR amplification of the GST-Backbone fragment was performed using pET30-CpA-Mtu-GST as a template and primers POI-F and ORI-R to obtain the GST-Backbone fragment. Next, PCR amplification of the Backbone-L6KD-Mtu fragment was performed using pET30-L6KD-Mtu-NB21 as a template and primers ORI-F and POI-R to obtain the Backbone-L6KD-Mtu fragment. After the PCR reaction, the PCR amplification product was separated and recovered on a 1% agarose gel. These two fragments were assembled using Gibson Assembly to obtain the pET30-L6KD-Mtu-GST plasmid. The construction procedures for the pET30-L6KD-ELP-Mtu-GST and pET30-L6KD-PEP-Mtu-GST plasmids are similar, except that the PCR templates of the expression vectors are replaced with pET30-L6KD-ELP-Mtu-NB21 and pET30-L6KD-PEP-Mtu-NB21, respectively. The Gibson Assembly product was transformed into competent E. coli DH5α cells. The transformed cells were plated on LB plates supplemented with 50 μg / mL kanamycin to screen for positive clones. The plasmids were then extracted and sequenced. The structures of the constructed pET30-L6KD-Mtu-POI, pET30-L6KD-ELP-Mtu-POI, and pET30-L6KD-PEP-Mtu-POI plasmids are shown in Figure 1B.

[0147] Example 2: Expression and purification of IGF-1 / hGH / Nb21 / xylanase / capacilizumab / GST

[0148] Six different types of target proteins were purified, including human insulin-like growth factor IGF-1, human growth hormone hGH, novel coronavirus nanobody Nb21, xylanase, capecitabine and glutathione S-transferase GST.

[0149] The plasmids constructed in Example 1 (containing plasmids pET32-L6KD-Mtu-hGH, pET32-L6KD-ELP-Mtu-hGH, pET32-L6KD-PEP-Mtu-hGH, pET30-L6KD-Mtu-IGF-1 / Nb21 / Xylanase / Caplacizumab / GST, pET30-L6KD-ELP-Mtu-IGF-1 / Nb21 / Xylanase / Caplacizumab / GST and pET30-L6KD-PEP-Mtu-IGF-1 / Nb21 / Xylanase / Caplacizumab / GST) were transformed into Escherichia coli BL21 (DE3) respectively. The above expression strains were inoculated into LB liquid medium containing 50 μg / mL kanamycin or 100 μg / mL carbenicillin, and cultured in a shaking incubator at 37°C until the logarithmic phase (OD 600 =0.4-0.6), add 0.2mM IPTG, induce at 18℃ for 24 hours, measure bacterial concentration OD 600 (The following 1mL OD 600 The cell mass of 1 is called 1OD).

[0150] Bacteria were resuspended to 20 OD / mL in lysis buffer B1 (2.4 g Tris, 29.22 g NaCl, 0.37 g Na₂EDTA·2H₂O dissolved in 800 mL of water, adjusted to pH 8.5, and brought to 1 L with water). The cells were then sonicated (200 W power, 3 sec sonication, 3 sec interval, 99 sonication cycles). The cells were centrifuged at 15,000 g for 20 min at 4°C, and the supernatant and pellet were collected. The pellet was washed twice with an equal volume of lysis buffer and resuspended in an equal volume of cleavage buffer (PBS supplemented with 40 mM Bis-Tris, pH 6.2, 2 mM EDTA). The pellet was incubated at 25°C for 24 h to allow for autocleavage of the intein. The cells were then centrifuged at 15,000 g for 20 min at 4°C, and the pellet was resuspended in an equal volume of lysis buffer. The resulting supernatant and pellet were analyzed by SDS-PAGE along with the pre-cleavage supernatant and pellet. The results are shown in Figure 2. Lanes ES, EP, CP, and CS are expression and purification samples of the target proteins, namely, ES: cell lysate supernatant; EP: cell lysate precipitate, in which clear aggregates expressed by the fusion protein can be detected; CP: precipitate separated after cleavage; CS: supernatant separated after cleavage, in which clear target protein bands can be detected; Lane IV is a protein quantitative standard containing bovine serum albumin BSA or aprotinin APR, with the loading amounts being 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, and 0.3125 μg, respectively.

[0151] ImageJ gel quantitative analysis software was used to perform optical density analysis of the target bands according to protein quantitative standards. The yield of aggregates formed by the fusion protein, the yield of the target protein released into the supernatant after intein-mediated self-cleavage, the MtuΔI-CM cleavage efficiency, the recovery rate, and the purity in the supernatant were calculated. The results are shown in Table 2.

[0152] Table 2: Expression and purification of IGF-1 / hGH / Nb21 / xylanase / capacilizumab / GST

[0153] a Protein aggregate yield (volume per liter of LB medium), b The target protein yield after intein-mediated self-cleavage (volume per liter of LB medium), c Intein-mediated cleavage efficiency = 100% × (aggregate expression level before cleavage - aggregate remaining amount after cleavage) / aggregate yield before cleavage, d Recovery rate = 100% × actual yield of target protein / theoretical yield of target protein that can be produced if protein aggregates are completely cleaved.

[0154] All 18 fusion proteins used (L6KD-Mtu-IGF-1 / hGH / Nb21 / Xylanase / Caplacizumab / GST, L6KD-ELP-Mtu-IGF-1 / hGH / Nb21 / Xylanase / Caplacizumab / GST, and L6KD-PEP-Mtu-IGF-1 / hGH / Nb21 / Xylanase / Caplacizumab / GST) were expressed as precipitates. The L6KD-Mtu system expressed aggregates at levels of 205-545 mg / L LB culture medium. The target proteins were separated from L6KD-Mtu by self-cleavage of the intein MtuΔI-CM with cleavage efficiencies of 38-70%. The target proteins released into the supernatant after cleavage of the L6KD-Mtu tag ranged from 2.2-57 mg / L LB culture medium, with purities of 27-93%. The L6KD-ELP-Mtu system expressed aggregates at 19-419 mg / L LB culture medium, with a cleavage efficiency of 82-99%. The target protein yield released into the supernatant after cleavage was 7.3-42 mg / L LB culture medium, with a purity of 17-74%. The L6KD-PEP-Mtu system expressed aggregates at 365-557 mg / L LB culture medium, with a cleavage efficiency of 50-91%. The target protein yield released into the supernatant after tag cleavage was 6.7-78 mg / L LB culture medium, with a purity of >98%.

[0155] Example 3: High-throughput expression and purification of target protein

[0156] The high-throughput protein expression and purification process is shown in Figure 3A. The strain obtained in Example 2 (containing plasmid pET30-L6KD-PEP-Mtu-Nb21 / Xylanase / Caplacizumab / GST or pET32-L6KD-PEP-Mtu-hGH) was streaked and revived. Escherichia coli BL21 (DE3) cells carrying the target plasmid were inoculated into a 96-well culture plate, each well containing 200 μL LB medium supplemented with 50 μg / mL kanamycin or 100 μg / mL carbenicillin, and cultured overnight at 37°C with shaking at 800 rpm. The overnight culture was transferred to a 96-deep-well plate at a ratio of 1:50, each well containing 800 μL fresh LB medium supplemented with the corresponding antibiotics, and then cultured at 37°C for 2 hours until the OD 600Reach 0.4-0.8. The culture temperature was lowered to 18°C, and 200 μL of LB medium containing 1 mM IPTG was added to start protein expression. Then the culture was continued at 18°C ​​for 24 hours. After the culture was completed, the cells were harvested by centrifugation at 4,000g, 4°C for 30 minutes. 200 μL of BugBuster reagent (Millipore) was added to each well to lyse E. coli. The cell lysate was then transferred to a 96-well filter plate, centrifuged at 2,500g, 4°C for 30 minutes, the filtrate was discarded, and 200 μL of buffer B1 was added to wash the protein aggregates on the filter membrane twice. Then 100 μL of cleavage buffer was added, incubated at 25°C for 24 hours, and the filtrate was collected by centrifugation for SDS-PAGE analysis. The purification results are shown in Figure 3. Lanes I-IV contain protein quantification standards containing bovine serum albumin (BSA), with loading amounts of 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, 0.3125 μg, and 0.15625 μg, respectively. The statistical results of relative grayscale analysis of the purified target protein are shown in Table 3.

[0157] Table 3: Fermentation production and protein expression and purification

[0158] a Target protein yield after intein-mediated self-cleavage (volume calculated per liter of LB medium).

[0159] Results showed that after high-throughput expression and purification, our method can still obtain the target protein with a yield of 10-26 mg / L culture medium and a purity of 90-98%. The final protein concentration is 80-208 mg / L, with a purity of >90%, which can meet the needs of most downstream detection or screening.

[0160] Example 4: Fermentation production, expression and purification of capecitabine

[0161] To explore the commercial application potential of the present invention, capecitabine was selected as an example for further scale-up production. The fermentation process was consistent with our previous work (Lin et al., Chemical Engineering Science, 2022, 262: 118052), and the scale-up fermentation was carried out in a 5-L fermentor using a DO-stat fed-batch feeding strategy.

[0162] The strain obtained in Example 2 (containing the plasmid pET30-L6KD-PEP-Mtu-Caplacizumab) was streaked and revived. 140 mL of LB culture medium was inoculated as seed liquid one day in advance. For fermentation in a 5-L fermentor tank, the initial fermentation broth volume was 2 L, the seed culture broth was inoculated at a ratio of 7%, the initial fermentation temperature was 37 ° C, the rotation speed was 200 rpm, the entire fermentation process was ventilated at 3 L / min, and the dissolved oxygen was controlled at 20%. When the dissolved oxygen was lower than 20%, the dissolved oxygen was maintained by increasing the rotation speed, and the maximum speed was 1,000 rpm. During the fermentation culture process, the initial glucose concentration was 10 g / L, which was consumed about 5 hours after inoculation. At this time, the dissolved oxygen and pH value of the culture medium rose, and feeding began. During the feeding process, in order to prevent the accumulation of acetate in the culture medium during the fermentation process, the glucose concentration in the fermentation medium was controlled at 0.1-1.5 g / L. Samples were taken every 2 hours after inoculation to measure the bacterial OD 600 and the glucose concentration in the culture medium, when the bacterial OD 600 When the temperature reaches 30-40℃, the temperature is lowered to 18℃, and IPTG with a final concentration of 0.2mM is added for induction. After 28h of induction, the cells are placed in the tank. 600 The expression and purification results are shown in Figure 4. Lanes I to VI contain protein quantitative standards containing bovine serum albumin (BSA), with sample loadings of 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, 0.3125 μg, and 0.15625 μg, respectively. The relative grayscale analysis of capecitabine released into the supernatant after cleavage and detailed statistical results of the purification process are shown in Table 4.

[0163] Table 4: Fermentation production and protein expression and purification of capecitabine

[0164] a Protein aggregate yield (volume per liter of LB medium), b The target protein yield after intein-mediated self-cleavage (volume per liter of LB medium), c Intein-mediated cleavage efficiency = 100% × (aggregate expression level before cleavage - aggregate remaining amount after cleavage) / aggregate yield before cleavage, d Recovery rate = 100% × actual yield of target protein / theoretical yield of target protein that can be produced if protein aggregates are completely cleaved.

[0165] The results showed that at 24 hours of induction, the yield of fusion protein aggregates was 12.1 g / L of culture medium, and the yield of capecitabine released into the supernatant after cleavage was 1.1 g / L of culture medium, with a purity of 98%; at 28 hours of induction, the yield of fusion protein aggregates was 13.5 g / L of culture medium, and the yield of capecitabine released into the supernatant after cleavage was 1.4 g / L of culture medium, with a purity of 99%, which is about 33 times that of shake flask horizontal fermentation.

[0166] Example 5: Construction of SAP-Mtu-hGH, SAP-PEP-Mtu-hGH fusion protein expression vectors

[0167] SAP stands for aggregation peptide. In the present examples, SAP refers to MpA (SEQ ID NO: 7), EIK8 (SEQ ID NO: 58), and EFR8 (SEQ ID NO: 59). The expression vectors used included pET30-MpA / EIK8 / EFR8-Mtu-hGH and pET30-MpA / EIK8 / EFR8-PEP-Mtu-hGH. Primers required for plasmid construction were designed using oligo 7 and synthesized by Shanghai Bioengineering Co., Ltd., as shown in Table 5.

[0168] Table 5: Oligonucleotide primers used in this example

[0169] The pET30-L6KD-PEP-Mtu-IGF obtained in Example 1 was used as a template, and PEP-F and POI-R were used as primers to amplify the PEP-Mtu fragment by PCR reaction. The hGH-Backbone-MpA fragment was amplified by PCR reaction using pET30-MpA-Mtu-hGH (Lin Zhanglin et al., WO2022253266A1) as a template and POI-F and 11-R as primers. The PCR reaction used NEB's Q5 polymerase, and the PCR conditions were: 98°C for 30 seconds, 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 120 seconds, for a total of 30 cycles; finally, 72°C for 2 minutes. After the reaction, the PCR amplification products were separated and recovered on 1% agarose gel. The PEP-Mtu fragment and hGH-Backbone-MpA fragment were assembled by Gibson Assembly, and the assembled products were transformed into Escherichia coli DH5α competent cells. The transformed cells were spread on LB plates supplemented with 50 μg / mL kanamycin to screen positive clones. The plasmids were extracted and sequenced. The sequencing results showed that the cloned plasmid sequences were correct.

[0170] The plasmid construction processes for pET30-EIK8 / EFR8-Mtu-hGH and pET30-EIK8 / EFR8-PEP-Mtu-hGH are similar. The nucleotide sequence of EIK8 / EFR8 is shorter and is directly introduced using primers. Using EIK8 as an example, the Mtu-hGH-Backbone fragment was amplified by PCR using pET30-MpA-Mtu-hGH as a template and primers EIK8-F and ORI-R. The Backbone-EIK8 fragment was amplified by PCR using pET30-MpA-Mtu-hGH as a template and primers ORI-F and EIK8-R. The PEP-Mtu-hGH-Backbone fragment was amplified by PCR using pET30-MpA-PEP-Mtu-hGH as a template and primers EIK8-F and ORI-R. PCR reactions used NEB's Q5 polymerase. PCR conditions were as follows: 98°C for 30 seconds, 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 120 seconds, for a total of 30 cycles; finally, 72°C for 2 minutes. After completion of the reaction, PCR products were separated and recovered on a 1% agarose gel. The Mtu-hGH-Backbone, Backbone-EIK8 fragments, and the PEP-Mtu-hGH-Backbone, Backbone-EIK8 fragments were assembled using Gibson assembly. The construction of EFR8 was similar, except that the corresponding primers were replaced with EFR8-F and EFR8-R, respectively. The assembled products were transformed into competent Escherichia coli DH5α cells, and the transformed cells were plated on LB plates supplemented with 50 μg / mL kanamycin to screen for positive clones. Plasmids were extracted and sequenced, confirming that the sequences of the cloned plasmids were correct. The structures of the constructed SAP-Mtu-hGH and SAP-PEP-Mtu-hGH plasmids are shown in Figure 5B.

[0171] Example 6: hGH protein purification mediated by MpA, EIK8 and EFR8 phase transition and Mtu-mediated cleavage

[0172] The plasmids constructed in Example 5 (containing plasmids pET30-MpA-Mtu-hGH, pET30-MpA-PEP-Mtu-hGH, pET30-EIK8-Mtu-hGH, pET30-EIK8-PEP-Mtu-hGH, pET30-EFR8-Mtu-hGH and pET30-EFR8-PEP-Mtu-hGH) were transformed into Escherichia coli BL21 (DE3) competent cells to obtain 6 hGH fusion protein expression strains. The 6 expression strains were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured in a shaking incubator at 37°C until the logarithmic phase (OD600 =0.4-0.6), add 0.2mM IPTG, induce at 18℃ for 24 hours, measure bacterial concentration OD 600 The cells were harvested by centrifugation at 4000 rpm for 25 min at 4°C, and the supernatant culture medium was removed and the cells were frozen at -80°C. (The following 1 mL of OD 600 The cell mass of 1 is called 1OD).

[0173] The cells were resuspended to 100 OD / mL in lysis buffer B3 (2.4 g Tris, 0.37 g EDTA·2Na dissolved in 800 mL of water, adjusted to pH 8.0, and brought to 1 L with water). Ultrasonic disruption was performed (disruption conditions: 2-amplitude horn, 20% power, 2-second ultrasonic time, 2-second interval, for 25-30 minutes). The cells were centrifuged at 15,000 g for 30 minutes at 4°C. The supernatant and precipitate were collected and sampled. The expression of the fusion protein in the supernatant and precipitate was analyzed by SDS-PAGE.

[0174] Na2SO4 was added to the lysate supernatant to 0.7M and placed at 4°C overnight for 12 hours to allow the self-aggregating peptide to fully aggregate. The suspension was then centrifuged at 4°C, 15,000g for 30 minutes, and the precipitate was washed with buffer B4 containing 0.7M Na2SO4 (99.43g Na2SO4, 2.4g Tris, 0.37g EDTA·2N aDissolve in 800 mL of water, adjust pH to 8.0, and dilute to 1 L with water. Wash once, centrifuge under constant conditions, and separate the supernatant and precipitate. Resuspend the precipitate in cleavage buffer B5 (NaCl-free PBS supplemented with 0.7 M NaSO, 40 mM Bis-Tris, pH 6.2, 2 mM EDTA) containing 0.7 M NaSO and incubate at 25°C for 24 hours to allow for full self-cleavage of the intein. Incubate at 4°C for 3 hours to allow for complete aggregation of the aggregated peptides, and then centrifuge the suspension at 16,000 g for 30 minutes at 4°C. The supernatant after cell lysis, the supernatant and precipitate after salt aggregation, and the supernatant and precipitate after cleavage were analyzed together by SDS-PAGE. The results are shown in Figure 6. Lanes ES, EP, ESS, ESP, CP, and CS are the expression and purification samples of the target protein, respectively: ES: cell lysate supernatant, in which a clear fusion protein band can be detected; EP: cell lysate precipitate, which almost does not contain fusion protein; ESS: supernatant separated after salt aggregation of the lysate supernatant; ESP: precipitate separated after salt aggregation of the lysate supernatant, in which a clear fusion protein band can be detected; CP: precipitate after cleavage of the aggregate obtained by salt addition; CS: supernatant after cleavage of the aggregate obtained by salt addition, in which a clear target protein band can be detected; Lane IV is a protein quantitative standard containing bovine serum albumin BSA, and the loading amounts are 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, and 0.3125 μg, respectively.

[0175] The optical density analysis of the target bands was performed using ImageJ (National Institutes of Health) gel quantitative analysis software using protein quantitative standards. The target protein yield released into the supernatant after intein-mediated self-cleavage, the aggregation efficiency after salt addition, the MtuΔI-CM cleavage efficiency, and the recovery rate of human growth hormone hGH and its purity in the supernatant were calculated. The results are shown in Table 6.

[0176] Table 6: hGH purification by 0.7M Na2SO4-mediated MpA / EIK8 / EFR8 phase transition and Mtu-mediated cleavage

[0177] a The expression level of the fusion protein in the lysis supernatant (the volume is calculated per liter of LB medium), b The yield of target protein after intein-mediated self-cleavage (volume per liter of LB medium), c Aggregation efficiency = 100% × the amount of fusion protein in the precipitate after salt addition / (the amount of fusion protein in the precipitate after salt addition + the amount of fusion protein in the supernatant after salt addition). dIntein-mediated self-cleavage efficiency = 100% × (amount of fusion protein in the precipitate after salt addition - amount of fusion protein in the precipitate after cleavage) / amount of fusion protein in the precipitate after salt addition, e Recovery rate = 100% × actual target protein yield / theoretical target protein yield that can be produced by the expression supernatant under complete cleavage.

[0178] The six fusion proteins used (MpA-Mtu-hGH, MpA-PEP-Mtu-hGH, EIK8-Mtu-hGH, EIK8-PEP-Mtu-hGH, EFR8-Mtu-hGH, and EFR8-PEP-Mtu-hGH) were all expressed in soluble form, with soluble expression levels ranging from 353 to 537 mg / L. In the presence of 0.7 M Na₂SO₄, the lysis supernatant largely precipitated the fusion proteins from the soluble form, with aggregation efficiencies of 92 to 99%. The target protein was separated from MpA / EIK8 / EFR8-Mtu by self-cleavage of the intein MtuΔI-CM, with cleavage efficiencies of 53 to 93%. The hGH yield released into the supernatant after cleavage ranged from 51 to 95 mg / L, with purities of 80 to 99%. Among them, the SAP-PEP-Mtu-hGH fusion protein exhibited the highest hGH purity, at 99%.

[0179] Example 7: Construction of a fusion protein expression construct containing the intein Mxe GyrA (SEQ ID NO: 4)

[0180] The expression vectors pET30-Xylanase-Mxe-ELK16 and pET30-Xylanase-Mxe-PEP-ELK16 used in the examples of this application, and the required primers were designed using oligo 7 and synthesized by Shanghai Bioengineering Co., Ltd. as shown in Table 7.

[0181] Table 7: Oligonucleotide primers used in this example

[0182] The Mxe-ELK16-Backbone fragment was amplified by PCR using pET30-LipA-Mxe-ELK16 (Zhou et al., Microbial Cell Factories, 2012, 11, 10) as a template and primers Mxe-F and ORI-R. The Backbone-Xylanase fragment was amplified by PCR using pET30-Xylanase-Mxe-MpA (Lin Zhanglin et al., WO2022253266A1) as a template and primers ORI-F and Mxe-R1. PCR reactions were performed using NEB's Q5 polymerase with 30 cycles of 98°C for 30 seconds, 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 120 seconds; the final cycle was 72°C for 2 minutes. After completion of the reaction, the PCR products were separated and recovered on a 1% agarose gel. The Mxe-ELK16-Backbone fragment and the Backbone-Xylanase fragment were assembled by Gibson Assembly.

[0183] Using the pET30-L6KD-PEP-Mtu-IGF obtained in Example 1 as a template, PG-F and PM-R as primers were used to amplify the PEP fragment by PCR reaction, using pET30-LipA-Mxe-ELK16 as a template, KL-F and ORI-R as primers to amplify the ELK16-Backbone fragment by PCR reaction, and using pET30-Xylanase-Mxe-MpA as a template, ORI-F and Mxe-RP as primers to amplify the Backbone-Xylanase-Mxe fragment by PCR reaction. The PEP fragment, ELK16-Backbone fragment, and Backbone-Xylanase-Mxe fragment were assembled by Gibson Assembly. The assembly products were transformed into Escherichia coli DH5α competent cells, and the transformed cells were plated on LB plates supplemented with 50 μg / mL kanamycin to screen positive clones, extract plasmids, and sequence them. The sequencing results showed that the cloned plasmid sequences were all correct. The structures of the constructed pET30-Xylanase-Mxe-ELK16 and pET30-Xylanase-Mxe-PEP-ELK16 plasmids are shown in Figure 7B.

[0184] Example 8: Expression and purification of xylanase

[0185] The strain constructed in Example 7 (containing plasmids pET30-Xylanase-Mxe-ELK16 and pET30-Xylanase-Mxe-PEP-ELK16) was inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured in a shaking incubator at 37°C until the logarithmic phase (OD 600 =0.4-0.6), 0.2 mM IPTG was added, cells were harvested after induction at 18°C ​​for 24 hours, and the bacterial concentration OD was measured. 600 (The following 1mL OD 60 The amount of cells equal to 0 is called 1OD)

[0186] The cells were resuspended to 20 OD / mL in lysis buffer B1 (2.4 g Tris, 29.22 g NaCl, 0.37 g Na2EDTA·2H2O dissolved in 800 mL water, adjusted to pH 8.5, and fixed to 1 L with water) and ultrasonically disrupted (crushing conditions: power 200 W, ultrasonic time 3 sec, interval time 3 sec, ultrasonic number 99 times). Centrifuged at 4 ° C, 12000 rpm for 20 min, and the supernatant and precipitate were collected separately. The precipitate was washed twice with lysis buffer and fully resuspended in cleavage buffer (20 mM Tris-HCl, 500 mM NaCl, 40 mM dithiothreitol, 1 mM EDTA, pH 8.5) and placed at 25 ° C overnight for 24 hours to allow the intein to fully undergo self-cleavage. The suspension was then centrifuged, and the resulting supernatant and precipitate were subjected to SDS-PAGE detection together with the precipitate before cleavage (the precipitate was resuspended in the same volume of lysis buffer as in the previous resuspension step). As shown in Figure 8, lanes ES, EP, CP, and CS are samples of target protein expression and purification, namely, ES: cell lysate supernatant; EP: cell lysate precipitate, in which clear aggregates expressed by the fusion protein can be detected; CP: precipitate separated after cleavage; CS: supernatant separated after cleavage, in which clear target protein bands can be detected; lanes I-VI are protein quantitative standards containing bovine serum albumin BSA, with sample loading amounts of 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, 0.3125 μg, and 0.15625 μg, respectively.

[0187] According to the protein quantitative standards, the optical density analysis of the target band was performed using ImageJ gel quantitative analysis software. The aggregate yield formed by the fusion protein, the yield of xylanase released into the supernatant after intein-mediated self-cleavage, the Mxe GyrA cleavage efficiency, the xylanase recovery rate and its purity in the supernatant were calculated. The results are shown in Table 8.

[0188] Table 8: Expression and purification of xylanase

[0189] a Protein aggregate yield (volume per liter of LB medium), b The target protein yield after intein-mediated self-cleavage (volume per liter of LB medium), c Intein-mediated cleavage efficiency = 100% × (aggregate expression level before cleavage - aggregate remaining amount after cleavage) / aggregate yield before cleavage, d Recovery rate = 100% × actual yield of target protein / theoretical yield of target protein that can be produced if protein aggregates are completely cleaved.

[0190] The two fusion proteins used (Xylanase-Mxe-ELK16 and Xylanase-Mxe-PEP-ELK16) both existed as precipitates, with aggregate expression levels ranging from 278 to 282 mg / L LB culture medium. The two different fusion proteins were self-cleaved by the intein Mxe GyrA, separating the xylanases from Mxe-ELK16 with cleavage efficiencies of 51 to 70%. The yield of xylanase released into the supernatant after cleavage was 78 to 107 mg / L LB culture medium, and the purity of the recovered xylanase after cleavage was 92 to 98%. The Xylanase-Mxe-PEP-ELK16 fusion protein exhibited the highest xylanase purity. Specifically, this purification technique based on the self-aggregating peptide and self-cleaving tag allowed the xylanase to be purified in a single step, yielding 107 mg / L LB culture medium with a purity of 98%.

[0191] Example 9: Construction of L6KD-HD / HFBII-Mtu-POI, L6KD-ProP-Mtu-POI, L6KD-N1 / N2 fusion protein expression vectors

[0192] POI represents the target protein. In the present application embodiment, HD (SEQ ID NO: 44) refers to the hydrophilic domain, HFBII (SEQ ID NO: 45) refers to hydrophobic protein, ProP refers to the protease propeptide, including P1-P10, N1 (SEQ ID NO: 56) and N2 (SEQ ID NO: 57) are truncated PEP, POI refers to insulin-like growth factor, capecitabine. The expression vector used includes a combination of pET30-L6KD-ProP-Mtu and two POIs. The primers required for constructing the plasmid were designed by oligo 7 and synthesized by Shanghai Bioengineering as shown in Table 9.

[0193] Table 9: Oligonucleotide primers used in this example

[0194] First, the amino acid sequences of the hydrophilic domain HD (Liu et al., Microbial Biotechnology, 2019, 12: 752-762) and the hydrophobic protein HFBII (Uniprot ID: P79073 HYP2_HYPJE) were searched, and gene fragments were obtained by gene synthesis by Shanghai Shenggong according to their amino terminal sequences. Various protease propeptide (propeiptide, hereinafter referred to as ProP) sequences P1-P10 homologous to PEP were obtained by BLAST, among which P1 (SEQ ID NO: 46) was derived from yeast protease propeptide, P2 (SEQ ID NO: 47) was derived from cucumber protease propeptide, P3 (SEQ ID NO: 48) was derived from cyanobacteria protease propeptide, P4 (SEQ ID NO: 49) was derived from subtilisin propeptide, which was also the earliest discovered and most studied propeptide, P5 (SEQ ID NO: 50) was derived from human PCSK9 protease propeptide, and the remaining P6-P10 (SEQ ID NO: 51-55) were derived from bacterial protease propeptides. The sequence identity of the 10 propeptides with PEP is 38-95%. Based on their amino terminal sequences, gene fragments were obtained by gene synthesis by Shanghai Biotech. The N1 and N2 of the truncated PEP were also obtained by gene synthesis by Shanghai Biotech based on their amino terminal sequences. Using the synthesized genes as templates, ELP-F2 and ELP-R2 as primers, PCR amplification was performed to obtain polynucleotide fragments of each connecting peptide. The PCR reaction used NEB's Q5 polymerase (New England Biolab (NEB)), and the PCR conditions were: 98℃30sec, 98℃10sec, 67℃30sec, 72℃30sec, for a total of 30 cycles; finally 72℃2min. After the reaction, the PCR amplification products were separated and recovered on 1% agarose gel.

[0195] Using the pET32-L6KD-MtuΔI-CM-IGF template, the Mtu-IGF fragment and the Backbone-L6KD fragment were amplified by PCR using primers MF, ORI-R, and ORI-F, MR, respectively. PCR reactions were performed using NEB's Q5 polymerase with 30 cycles of 98°C for 30 seconds, 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 120 seconds, followed by a final cycle at 72°C for 2 minutes. The PCR products were separated and recovered on a 1% agarose gel. The linker, Mtu-IGF fragment, and Backbone-L6KD fragment were assembled by Gibson assembly. The pET30-L6KD-linker-Mtu-caplacizumab plasmid was constructed similarly, except that the PCR template in the expression vector was replaced with pET30-L6KD-Mtu-caplacizumab. The assembled products were transformed into Escherichia coli DH5α competent cells, and the transformed cells were spread on LB plates supplemented with 50 μg / mL kanamycin to screen positive clones. The plasmids were extracted and sequenced. The sequencing results showed that the cloned plasmid sequences were correct.

[0196] Example 10: Hydrophilic domain HD and hydrophobic protein HFBII as connecting peptides for expression and purification of target proteins

[0197] The plasmids constructed in Example 9 (containing plasmids pET30-L6KD-HD-Mtu-IGF, pET30-L6KD-HD-Mtu-Caplacizumab, pET30-L6KD-HFBII-Mtu-IGF and pET30-L6KD-HFBII-Mtu-Caplacizumab) were transformed into Escherichia coli BL21 (DE3) competent cells to obtain four fusion protein expression strains containing different connecting peptides. Two expression strains were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured in a shaking incubator at 37°C until the logarithmic phase (OD 600 =0.4-0.6), add 0.2mM IPTG, induce at 18℃ for 24 hours, measure bacterial concentration OD 600 (The following 1mL OD 600 The cell mass of 1 is called 1OD).

[0198] Bacteria were resuspended to 20 OD / mL in lysis buffer B1 (2.4 g Tris, 29.22 g NaCl, 0.37 g Na₂EDTA·2H₂O dissolved in 800 mL of water, adjusted to pH 8.5, and brought to 1 L with water). The cells were then sonicated (200 W power, 3 sec sonication, 3 sec interval, 99 sonication cycles). The cells were centrifuged at 15,000 g for 20 min at 4°C, and the supernatant and pellet were collected. The pellet was washed twice with an equal volume of lysis buffer and resuspended in an equal volume of cleavage buffer (PBS supplemented with 40 mM Bis-Tris, pH 6.2, 2 mM EDTA). The pellet was incubated at 25°C for 24 h to allow for autocleavage of the intein. The cells were then centrifuged at 15,000 g for 20 min at 4°C, and the pellet was resuspended in an equal volume of lysis buffer. The resulting supernatant and pellet were analyzed by SDS-PAGE along with the pre-cleavage supernatant and pellet. The results are shown in Figure 9. Lanes ES, EP, CP, and CS are expression and purification samples of the target protein, respectively: ES: cell lysate supernatant; EP: cell lysate precipitate, in which clear aggregates expressed by the fusion protein can be detected; CP: precipitate separated after cleavage; CS: supernatant separated after cleavage, in which clear target protein bands can be detected; lanes I-VI are protein quantitative standards containing aprotinin APR or bovine serum albumin BSA, and the loading amounts are 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, 0.3125 μg, and 0.15625 μg, respectively.

[0199] According to the protein quantitative standards, the optical density analysis of the target band was performed using ImageJ gel quantitative analysis software. The yield of aggregates formed by the fusion protein, the yield of the target protein released into the supernatant after intein-mediated self-cleavage, the MtuΔI-CM cleavage efficiency, the recovery rate of the target protein and its purity in the supernatant were calculated. The results are shown in Table 10.

[0200] Table 10: HD and hydrophobin HFBII as linker peptides for target protein expression and purification

[0201] a Protein aggregate yield (volume per liter of LB medium), b The target protein yield after intein-mediated self-cleavage (volume per liter of LB medium), c Intein-mediated cleavage efficiency = 100% × (aggregate expression level before cleavage - aggregate remaining amount after cleavage) / aggregate yield before cleavage, d Recovery rate = 100% × actual yield of target protein / theoretical yield of target protein that can be produced if protein aggregates are completely cleaved.

[0202] The four fusion proteins used (L6KD-ProP-Mtu-IGF and L6KD-ProP-Mtu-Caplacizumab) all existed as precipitates, with aggregate expression levels ranging from 25 to 94 mg / L LB culture medium. The four different fusion proteins were self-cleaved by the intein MtuΔI-CM, and the target proteins were separated from L6KD-Mtu-HD / HFBII with cleavage efficiencies ranging from 31 to 97%. The yield of target protein released into the supernatant after cleavage ranged from 0.2 to 5.8 mg / L LB culture medium, and the purity of the target protein recovered after cleavage ranged from 4 to 70%. Hydrophilicity and hydrophobicity alone cannot be used to determine whether a linker peptide is suitable for obtaining high-purity proteins using the methods of the present invention.

[0203] Example 11: Various ProPs used as connecting peptides for expression and purification of target proteins

[0204] The plasmids constructed in Example 9 (containing plasmids pET30-L6KD-ProP-Mtu-IGF and pET30-L6KD-ProP-Mtu-Caplacizumab) were transformed into Escherichia coli BL21 (DE3) competent cells to obtain 20 strains expressing fusion proteins containing different ProPs. Two expression strains were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured in a shaking incubator at 37°C until the logarithmic phase (OD 600 =0.4-0.6), add 0.2mM IPTG, induce at 18℃ for 24 hours, measure bacterial concentration OD 600 (The following 1mL OD 600 The cell mass of 1 is called 1OD).

[0205] Bacteria were resuspended to 20 OD / mL in lysis buffer B1 (2.4 g Tris, 29.22 g NaCl, 0.37 g Na₂EDTA·2H₂O dissolved in 800 mL of water, adjusted to pH 8.5, and brought to 1 L with water). The cells were then sonicated (200 W power, 3 sec sonication, 3 sec interval, 99 sonication cycles). The cells were centrifuged at 15,000 g for 20 min at 4°C, and the supernatant and pellet were collected. The pellet was washed twice with an equal volume of lysis buffer and resuspended in an equal volume of cleavage buffer (PBS supplemented with 40 mM Bis-Tris, pH 6.2, 2 mM EDTA). The pellet was incubated at 25°C for 24 h to allow for autocleavage of the intein. The cells were then centrifuged at 15,000 g for 20 min at 4°C, and the pellet was resuspended in an equal volume of lysis buffer. The resulting supernatant and pellet were analyzed by SDS-PAGE along with the pre-cleavage supernatant and pellet. The results are shown in Figure 10. Lanes ES, EP, CP, and CS are expression and purification samples of the target protein, respectively: ES: cell lysate supernatant; EP: cell lysate precipitate, in which clear aggregates expressed by the fusion protein can be detected; CP: precipitate separated after cleavage; CS: supernatant separated after cleavage, in which clear target protein bands can be detected; lanes I-VI are protein quantitative standards containing aprotinin APR or bovine serum albumin BSA, and the loading amounts are 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, 0.3125 μg, and 0.15625 μg, respectively.

[0206] According to the protein quantitative standards, the optical density analysis of the target band was performed using ImageJ gel quantitative analysis software. The yield of aggregates formed by the fusion protein, the yield of the target protein released into the supernatant after intein-mediated self-cleavage, the MtuΔI-CM cleavage efficiency, the recovery rate of the target protein and its purity in the supernatant were calculated. The results are shown in Table 11.

[0207] Table 11: Various ProPs used as linker peptides for target protein expression and purification

[0208] a Protein aggregate yield (volume per liter of LB medium), b The target protein yield after intein-mediated self-cleavage (volume per liter of LB medium), c Intein-mediated cleavage efficiency = 100% × (aggregate expression level before cleavage - aggregate remaining amount after cleavage) / aggregate yield before cleavage, d Recovery rate = 100% × actual yield of target protein / theoretical yield of target protein that can be produced when protein aggregates are completely cleaved. eSequence similarity between ProP and PEP, algorithm from (Chen et al., Molecular Plant, 2020, 13(8): 1194-1202).

[0209] The 20 fusion proteins used (L6KD-ProP-Mtu-IGF and L6KD-ProP-Mtu-Caplacizumab) all existed as precipitates, with aggregate expression levels ranging from 52 to 433 mg / L LB culture medium. The 20 different fusion proteins were self-cleaved by the intein MtuΔI-CM, separating the target proteins from L6KD-Mtu-ProP with cleavage efficiencies ranging from 17 to 91%. The yield of target proteins released into the supernatant after cleavage ranged from 0.9 to 26 mg / L LB culture medium, and the purity of the recovered target proteins after cleavage ranged from 19 to 99%. Among them, the purified proteins of propeptides P7-P10, which share >60% sequence similarity with PEP, all achieved >96% purity, demonstrating the potential of various protease propeptides with high sequence similarity to PEP to obtain high-purity proteins using the methods of the present invention.

[0210] Example 12: PEP truncated form: N1 and N2 as connecting peptides for expression and purification of target protein

[0211] The plasmids constructed in Example 9 (containing plasmids pET30-L6KD-N1-Mtu-IGF, pET30-L6KD-N1-Mtu-Caplacizumab, pET30-L6KD-N1-Mtu-Xylanase, pET30-L6KD-N2-Mtu-IGF, pET30-L6KD-N2-Mtu-Caplacizumab and pET30-L6KD-N2-Mtu-Xylanase) were transformed into Escherichia coli BL21 (DE3) competent cells to obtain 6 fusion protein expression strains containing different truncated PEPs. Two expression strains were inoculated into LB liquid culture medium containing 50 μg / mL kanamycin and cultured in a 37°C shaker until the logarithmic phase (OD 600 =0.4-0.6), add 0.2mM IPTG, induce at 18℃ for 24 hours, measure bacterial concentration OD 600 (The following 1mL OD 600 The cell mass of 1 is called 1OD).

[0212] Bacteria were resuspended to 20 OD / mL in lysis buffer B1 (2.4 g Tris, 29.22 g NaCl, 0.37 g Na₂EDTA·2H₂O dissolved in 800 mL of water, adjusted to pH 8.5, and brought to 1 L with water). The cells were then sonicated (200 W power, 3 sec sonication, 3 sec interval, 99 sonication cycles). The cells were centrifuged at 15,000 g for 20 min at 4°C, and the supernatant and pellet were collected. The pellet was washed twice with an equal volume of lysis buffer and resuspended in an equal volume of cleavage buffer (PBS supplemented with 40 mM Bis-Tris, pH 6.2, 2 mM EDTA). The pellet was incubated at 25°C for 24 h to allow for autocleavage of the intein. The cells were then centrifuged at 15,000 g for 20 min at 4°C, and the pellet was resuspended in an equal volume of lysis buffer. The resulting supernatant and pellet were analyzed by SDS-PAGE along with the pre-cleavage supernatant and pellet. The results are shown in Figure 11. Lanes ES, EP, CP, and CS are expression and purification samples of the target protein, respectively: ES: cell lysate supernatant; EP: cell lysate precipitate, in which clear aggregates expressed by the fusion protein can be detected; CP: precipitate separated after cleavage; CS: supernatant separated after cleavage, in which clear target protein bands can be detected; lanes I-VI are protein quantitative standards containing aprotinin APR or bovine serum albumin BSA, and the loading amounts are 5 μg, 2.5 μg, 1.25 μg, 0.625 μg, 0.3125 μg, and 0.15625 μg, respectively.

[0213] According to the protein quantitative standards, the optical density analysis of the target band was performed using ImageJ gel quantitative analysis software. The yield of aggregates formed by the fusion protein, the yield of the target protein released into the supernatant after intein-mediated self-cleavage, the MtuΔI-CM cleavage efficiency, the recovery rate of the target protein and its purity in the supernatant were calculated. The results are shown in Table 12.

[0214] Table 12: PEP truncated forms N1 and N2 used as connecting peptides for target protein expression and purification

[0215] a Protein aggregate yield (volume per liter of LB medium), b The target protein yield after intein-mediated self-cleavage (volume per liter of LB medium), c Intein-mediated cleavage efficiency = 100% × (aggregate expression level before cleavage - aggregate remaining amount after cleavage) / aggregate yield before cleavage, d Recovery rate = 100% × actual yield of target protein / theoretical yield of target protein that can be produced if protein aggregates are completely cleaved.

[0216] All six fusion proteins used were present as precipitates, with aggregate expression levels ranging from 216 to 335 mg / L LB culture medium. The six different fusion proteins were self-cleaved by the intein MtuΔI-CM, and the target proteins were separated from L6KD-Mtu-N1 / N2 with cleavage efficiencies ranging from 1 to 85%. The yield of target protein released into the supernatant after cleavage ranged from 0.9 to 78 mg / L LB culture medium, and the purity of the recovered target protein after cleavage ranged from 47 to 99%. This demonstrates that truncated PEPs do not guarantee the potential for obtaining high-purity proteins using the methods of the present invention.

[0217] Sequence Listing

[0218] SEQ ID NO:1 ELP amino acid sequence, 78aa in length

[0219] SEQ ID NO: 2 PEP amino acid sequence, 76aa in length

[0220] SEQ ID NO:3Mtu amino acid sequence, length 168aa

[0221] SEQ ID NO:4Mxe amino acid sequence, length 198aa

[0222] SEQ ID NO:5L6KD amino acid sequence, 8aa in length

[0223] SEQ ID NO:6ELK16 amino acid sequence, 16aa in length

[0224] SEQ ID NO:7MpA amino acid sequence, 30aa in length

[0225] SEQ ID NO:8GS amino acid linker amino acid sequence, length 15aa

[0226] SEQ ID NO:9PT amino acid linker amino acid sequence, length 17aa

[0227] SEQ ID NO: 10 hGH amino acid sequence, 191 aa in length

[0228] SEQ ID NO:11RFP amino acid sequence, 235aa in length

[0229] SEQ ID NO: 12 Primer ELP-F2, 19 nt in length

[0230] SEQ ID NO: 13 Primer ELP-R2, length 17 nt

[0231] SEQ ID NO: 14 Primer MF, 22 nt in length

[0232] SEQ ID NO: 15 Primer MR, 20 nt in length

[0233] SEQ ID NO: 16 Primer ORI-F, 21 nt in length

[0234] SEQ ID NO: 17 Primer ORI-R, length 21 nt

[0235] SEQ ID NO: 18 Primer END-F, 20 nt in length

[0236] SEQ ID NO: 19 Primer END-R, 20 nt in length

[0237] SEQ ID NO: 20 Primer POI-F, 22 nt in length

[0238] SEQ ID NO: 21 Primer POI-R, 22 nt in length

[0239] SEQ ID NO: 22 Primer PEP-F, 24 nt in length

[0240] SEQ ID NO: 23 Primer 11-R, 33 nt in length

[0241] SEQ ID NO: 24 Primer EIK8-F, 45 nt in length

[0242] SEQ ID NO: 25 Primer EIK8-R, 45 nt in length

[0243] SEQ ID NO: 26 Primer EFR8-F, 45 nt in length

[0244] SEQ ID NO: 27 Primer EFR8-R, length 45 nt

[0245] SEQ ID NO: 28 Primer Mxe-F, 23 nt in length

[0246] SEQ ID NO: 29 Primer Mxe-R1, 23 nt in length

[0247] SEQ ID NO:30 Primer PG-F, 59 nt in length

[0248] SEQ ID NO: 31 Primer PM-R, length 40 nt

[0249] SEQ ID NO:32 Primer KL-F, 18 nt in length

[0250] SEQ ID NO: 33 Primer Mxe-RP, 53 nt in length

[0251] SEQ ID NO: 34 ELP nucleotide sequence, 234 bp in length

[0252] SEQ ID NO: 35 PEP nucleotide sequence, 228 bp in length

[0253] SEQ ID NO:36Mtu nucleotide sequence, 504 bp in length

[0254] SEQ ID NO:37Mxe nucleotide sequence, 594 bp in length

[0255] SEQ ID NO:38 IGF-1 nucleotide sequence, 210 bp in length

[0256] SEQ ID NO: 39 hGH nucleotide sequence, 573 bp in length

[0257] SEQ ID NO:40NB21 nucleotide sequence, 351 bp in length

[0258] SEQ ID NO:41 Xylanase nucleotide sequence, length 1218 bp

[0259] SEQ ID NO: 42 Capacillinamycin nucleotide sequence, 777 bp in length

[0260] SEQ ID NO: 43 GST nucleotide sequence, length 654 bp

[0261] SEQ ID NO: 44HD amino acid sequence, 67aa in length

[0262] SEQ ID NO:45HFBII amino acid sequence, 71aa in length

[0263] SEQ ID NO:46P1 amino acid sequence, 81aa in length

[0264] SEQ ID NO:47P2 amino acid sequence, 77aa in length

[0265] SEQ ID NO:48P3 amino acid sequence, 66aa in length

[0266] SEQ ID NO:49P4 amino acid sequence, 77aa in length

[0267] SEQ ID NO:50P5 amino acid sequence, 73aa in length

[0268] SEQ ID NO:51P6 amino acid sequence, 70aa in length

[0269] SEQ ID NO:52P7 amino acid sequence, 79aa in length

[0270] SEQ ID NO:53P8 amino acid sequence, 77aa in length

[0271] SEQ ID NO:54P9 amino acid sequence, 76aa in length

[0272] SEQ ID NO:55P10 amino acid sequence, 76aa in length

[0273] SEQ ID NO:56N1 amino acid sequence, 40aa in length

[0274] SEQ ID NO:57N2 amino acid sequence, 36aa in length

[0275] SEQ ID NO:58EIK8 amino acid sequence

[0276] SEQ ID NO:59EFR8 amino acid sequence

[0277] SEQ ID NO:60L6K2 amino acid sequence

[0278] SEQ ID NO:61L6D2 amino acid sequence

[0279] SEQ ID NO:62

[0280] (VPGXG) 15 , wherein X is independently Ala, Gly, Val or Glu

[0281] SEQ ID NO:63

[0282] VPGXG, where X is Ala, Gly, Val, or Glu

[0283] SEQ ID NO:64

[0284] (VPGXG)n wherein X is independently Ala, Gly, Val or Glu, and n=10-100

[0285] SEQ ID NO:65

[0286] SEQ ID NO:66

Claims

1. A fusion protein comprising, from N to C terminus: (a) a self-aggregating peptide, a connecting peptide, a spacer and a target protein portion; or (b) a target protein, a spacer, a connecting peptide and a self-aggregating peptide portion, wherein: The connecting peptide comprises an elastin-like polypeptide (ELP) or a protease propeptide (ProP), in particular an anisoglobulin protease propeptide PEP or a homologue thereof, preferably, the connecting peptide comprises 30-100, preferably 60-80 amino acid residues; and The spacer comprises a cleavage site, and preferably the spacer has a length of 10-250 amino acid residues; Optionally, an amino acid linker is included between the aggregating peptide and the connecting peptide, the connecting peptide and the spacer, and / or the spacer and the target protein, and preferably the amino acid linker comprises an amino acid sequence selected from any one of SEQ ID NOs: 8-9.

2. The fusion protein of claim 1, wherein the connecting peptide comprises: (a) an amino acid sequence selected from any one of SEQ ID NOs: 1-2 and 46-55, or an amino acid sequence having at least 60% identity thereto, preferably comprising any one of SEQ ID NOs: 52-55, or an amino acid sequence having at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity thereto; or (b) comprises the (VPGXG)n motif, wherein X is independently A, G, V or E, preferably V or E, more preferably V:E=4:1; n is an integer, preferably n is 10-20, more preferably 15, for example comprising the amino acid sequence shown in SEQ ID NO:

1.

3. The fusion protein of claim 1 or 2, wherein the self-aggregating peptide is selected from amphipathic self-assembling short peptides, such as amphipathic β-fold short peptides, amphipathic α-helical short peptides, surfactant-like short peptides and salt concentration-responsive self-aggregating peptides, such as selected from SEQ ID NOs: 5-7 and 58-61.

4. The fusion protein of any one of claims 1-3, wherein the cleavage site is selected from a temperature-dependent cleavage site, a pH-dependent cleavage site, an ion-dependent cleavage site, an enzyme cleavage site or a self-cleavage site, preferably comprising an intein such as Mxe GyrA, Ssp DnaB or MtuΔI-CM, for example comprising the amino acid sequence shown in any one of SEQ ID NOs: 3-4.

5. The fusion protein according to any one of claims 1 to 4, wherein the target protein: (a) located at the C-terminus of the fusion protein and the spacer is connected to the N-terminus of the target protein, or the target protein is located at the N-terminus of the fusion protein and the spacer is connected to the C-terminus of the target protein; (b) selected from therapeutic molecules, detectable molecules and targeting molecules, such as toxins, immunomodulators, antagonists, apoptosis inducers, hormones, radiopharmaceuticals, anti-angiogenic agents, cytokines, chemokines, prodrugs, chemotherapeutic drugs, fluorescent proteins, enzymes, tags, targeting antibodies or specific receptor ligands, in particular selected from red fluorescent protein (RFP), insulin-like growth factors such as insulin-like growth factor-1 (IGF-1), growth hormones such as human growth hormone (hGH), nanobodies such as anti-new crown nanobody NB21, xylanase, capecitabine and glutathione sulfhydryltransferase (GST), in particular, the target protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 10-11 or an amino acid sequence encoded by a nucleotide sequence shown in any one of SEQ ID NOs: 38-43; and / or (c) 20-500 amino acids in length.

6. An isolated polynucleotide comprising a nucleotide sequence encoding the fusion protein of any one of claims 1 to 5 or a complementary sequence thereof.

7. An isolated polynucleotide comprising a nucleotide sequence encoding a self-aggregating peptide, a connecting peptide and a spacer and a multiple cloning site, wherein the multiple cloning site is used to clone a nucleotide sequence for expressing a target protein, whereby the polynucleotide, after expression, can produce a fusion protein according to any one of claims 1 to 5, wherein the self-aggregating peptide, the connecting peptide and the spacer are as defined in any one of claims 1 to 5.

8. The polynucleotide of claim 7, wherein the target protein has a length of 20-500 amino acids, for example, selected from therapeutic molecules, detectable molecules and targeting molecules, such as toxins, immunomodulators, antagonists, apoptosis inducers, hormones, radiopharmaceuticals, anti-angiogenic agents, cytokines, chemokines, prodrugs, chemotherapeutic drugs, fluorescent proteins, enzymes, tags, targeted antibodies or specific receptor ligands, in particular selected from red fluorescent protein (RFP), insulin-like growth factors such as insulin-like growth factor-1 (IGF-1), growth hormones such as human growth hormone (hGH), nanobodies such as anti-new crown nanoantibody NB21, xylanase, capecitabine and glutathione sulfhydryltransferase (GST), in particular, the target protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 10-11 or an amino acid sequence encoded by a nucleotide sequence shown in any one of SEQ ID NOs: 38-43.

9. The polynucleotide of any one of claims 6-8, which encodes from 5' to 3' direction: (a) a self-aggregating peptide, a connecting peptide, a spacer and a target protein; or (b) a target protein, a spacer, a connecting peptide and a self-aggregating peptide, optionally encoding an amino acid linker between an aggregating peptide and a connecting peptide, a connecting peptide and a spacer, and / or a spacer and a target protein.

10. A construct, preferably an expression construct, comprising the polynucleotide of any one of claims 6 to 9.

11. A host cell comprising the polynucleotide of claim 6 or transformed by a construct, preferably an expression construct, comprising the polynucleotide, wherein the host cell is capable of expressing the fusion protein, preferably selected from prokaryotes, yeasts and higher eukaryotic cells, such as bacteria of the genera Escherichia, Bacillus, Salmonella and Pseudomonas and Streptomyces, preferably Escherichia coli.

12. A method for producing and purifying a target protein, preferably a soluble target protein, the method comprising: (a) preparing the target protein into a fusion protein as described in any one of claims 1 to 5, for example, expressing a polynucleotide encoding the fusion protein in a host cell or an in vitro cell-free system, wherein the polynucleotide is obtained, for example, by cloning a nucleotide sequence encoding the target protein into a multiple cloning site of a polynucleotide according to claim 7; (b) generating active aggregates by aggregation of self-aggregating peptides to obtain an insoluble fraction containing the fusion protein; (c) releasing the target protein from the insoluble portion by cleaving the cleavage site in the fusion protein; and (d) optionally, recovering and / or purifying the target protein, Preferably, the host cell is selected from prokaryotes, yeasts and higher eukaryotic cells, such as bacteria of the genera Escherichia, Bacillus, Salmonella, Pseudomonas and Streptomyces, preferably Escherichia coli.

13. A method for high-throughput production and purification of multiple target proteins, preferably soluble target proteins, comprising the following steps: (a) preparing each target protein into a fusion protein according to any one of claims 1 to 5, for example, expressing a polynucleotide encoding the fusion protein in a host cell or an in vitro cell-free system, the polynucleotide being obtained, for example, by cloning a nucleotide sequence encoding the target protein into a multiple cloning site of a polynucleotide according to claim 7, for example, culturing a host cell according to claim 11 in a multi-well plate to express the fusion protein; (b) generating active aggregates by aggregation of self-aggregating peptides to obtain an insoluble fraction comprising the fusion protein, for example in a multi-well plate; (c) releasing the target protein from the insoluble portion by cleaving the cleavage site in the fusion protein; and (d) optionally, recovering and / or purifying the target protein.

14. The method of claim 12 or 13, wherein step (a) comprises: Cultivating the host cell of claim 11 to express the fusion protein, optionally, step (b) comprises: lysing the host cell to obtain an insoluble fraction containing the fusion protein.

15. The method of any one of claims 12-14, wherein the target protein is 20-500 amino acids in length, for example, selected from therapeutic molecules, detectable molecules and targeting molecules, such as toxins, immunomodulators, antagonists, apoptosis inducers, hormones, radiopharmaceuticals, anti-angiogenic agents, cytokines, chemokines, prodrugs, chemotherapeutic drugs, fluorescent proteins, enzymes, tags, targeted antibodies or specific receptor ligands, in particular selected from red fluorescent protein (RFP), insulin-like growth factors such as insulin-like growth factor-1 (IGF-1), growth hormones such as human growth hormone (hGH), nanobodies such as anti-new crown nanoantibody NB21, xylanase, capecitabine and glutathione sulfhydryltransferase (GST), in particular, the target protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 10-11 or an amino acid sequence encoded by a nucleotide sequence shown in any one of SEQ ID NOs: 38-43.

Images