Methods of treating cancer resistant to immune checkpoint therapy and compositions useful for the same

Abstract

The present invention relates generally to the fields of cancer cell biology, cancer therapeutics, immunotherapy and neurotrophic tyrosine kinase receptor 1 (NTRK1). More specifically, the invention relates to methods of inhibiting NTRK1, methods of treating cancer, methods of reducing cancer resistance or enhancing sensitivity to immunotherapy, and methods of treating a subject resistant to an immune checkpoint inhibitor.

Description

[0001] METHODS OF TREATING CANCER RESISTANT TO IMMUNE CHECKPOINT THERAPY AND COMPOSITIONS USEFUL FOR THE SAME

[0002] STATEMENT OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 586.652, filed September 29, 2023, the entire contents of which are incorporated by reference herein.

[0004] STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

[0005] A Sequence Listing in XML format, entitled 9151-276WO_ST26.xml, 4,529 bytes in size, generated on September 24, 2024, and filed herewith, is hereby incorporated by reference in its entirety for its disclosures.

[0006] FIELD OF THE INVENTION

[0007] The present invention relates generally to the fields of cancer cell biology, cancer therapeutics, immunotherapy and neurotrophic ty rosine kinase receptor 1 (NTRK1). More specifically, the invention relates to methods of inhibiting NTRK1 , methods of treating cancer, methods of reducing cancer resistance or enhancing sensitivity to immunotherapy, and methods of treating a subject resistant to an immune checkpoint inhibitor.

[0008] BACKGROUND OF THE INVENTION

[0009] The treatment regimen of non-small cell lung cancer (NSCLC) has drastically changed owing to the superior anti-cancer effects due to the immune-checkpoint inhibitor (ICI). However, only 20% of NSCLC patients experience benefit after receiving ICI and the mechanisms causing the unresponsiveness to remain elusive.

[0010] The present invention overcomes previous shortcomings in the art by providing methods and compositions for treating cancers, increasing sensitivity of cancers to immunotherapy, and increasing efficacy of immunotherapy in the treatment of cancers including NSCLC.

[0011] SUMMARY OF THE INVENTION

[0012] One aspect of the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor, thereby treating the cancer.

[0013] Another aspect of the present invention provides a method of inducing or enhancing sensitivity to an immune checkpoint inhibitor in a subject having, suspected of having, or at risk of having cancer, comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor, thereby inducing or enhancing sensitivity to the immune checkpoint inhibitor in the subj ect.

[0014] Another aspect of the present invention provides a method of treating a subject resistant to an immune checkpoint inhibitor, comprising: determining whether the subject is positive for NTRK1 gene expression and / or function and / or NTRK1 protein expression and / or function; and administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor; thereby treating the subject resistant to an immune checkpoint inhibitor.

[0015] Another aspect of the present invention provides a method of enhancing efficacy of an immune checkpoint inhibitor in a subject receiving the immune checkpoint inhibitor (e.g.. a subject having, suspected of having, or at risk of having cancer, e.g., a cancer patient), comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1); thereby enhancing the therapeutic efficacy of the immune checkpoint inhibitor in the subj ect.

[0016] Another aspect of the present invention provides a method of reducing immunosuppression in a subject resistant to an immune checkpoint inhibitor (e.g., a subject having, suspected of having, or at risk of having cancer, e.g., a cancer patient), comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1), wherein the inhibiting of NTRK1 function in the subject reduces cancer immunosuppressive resistance to the immune checkpoint inhibitor, thereby reducing immunosuppression in the subject.

[0017] In some embodiments, a method of the present invention may further comprise administering to the subject an immune checkpoint inhibitor. In some embodiments, the subject may have previously received and / or may be concurrently receiving administration of an immune checkpoint inhibitor.

[0018] Another aspect of the present invention provides a composition or combination comprising an inhibitor of NTRK1 (including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (including but not limited to an inhibitor of CTLA-4. PD-1, B7-1, B7-2, PD-L, and / or PD-L2).

[0019] Another aspect of the present invention provides a kit comprising the composition or combination of the present invention, and instructions for use.

[0020] DETAILED DESCRIPTION OF THE DRAWINGS

[0021] FIG. 1 shows data plots of mutation and survival analyses in Immunotherapy receiving NSCLC patients. (FIG. 1 panel A) Top 5 most mutation genes of ICI receiving patients (FIG. 1 panel B). List of mutations associated with a survival (FIG. 1 panel C) of patients with or without MAP2K1 mutation. (FIG. 1 panel D) overall survival (OS) of patients with or without NTRK1 mutation. (FIG. 1 panel E) Analysis of co-occurring and mutually exclusive mutations with other major mutations. (FIG. 1 panel F) Lollipop plots of NTRK1 mutation.

[0022] FIG. 2 shows data graphs and bar graphs regarding analyses indicating knockdown of NTRK1 enhances ICI response in vivo. Western blot of NTRK1 expression of LL2 (FIG. 2 panel A) and CMT (FIG. 2 panel B) cell lines with or without knockdown of NTRK1. Growth of flank tumors of LL2 (FIG. 2 panel C) and CMT (FIG. 2 panel D) cell lines. Flow cytometry was performed of T cells isolated from spleen and lymph node collect at the end point. CD4+Effector T cells (FIG. 2 panels E and F), CD4 stem-cell like Effector T cells (FIG. 2 panels G and H) and CD8+ Effector T cells (FIG. 2 panels I and J) population of each mice was shown.

[0023] FIG. 3 shows data graphs and bar graphs regarding analyses indicating inhibition of NTRK1 by Entrectinib enhances ICI response in vivo. Growth of flank tumors of LL2 (FIG. 3 panel A) and CMT (FIG. 3 panel B) cell lines. Flow cytometry was performed of T cells isolated from spleen and lymph node collect at the end point. CD4+Effector T cells (FIG. 3 panels C and D), CD4+stem-cell like Effector T cells (FIG. 3 panels E and F) and CD8+ Effector T cells (FIG. 3 panels G and H) population of each mice was shown.

[0024] FIG. 4 shows a data graph align probability of survival against overall survival (OS) in the validation Cohort.

[0025] FIG. 5 shows images of stained immunohistochemistry (IHC) slides of tumors. (FIG. 5 panel A) LL / 2 tumors receiving treatment of either IgG, Anti-PD-1, Entrectinib. or Entrectinib + Anti-PD-1; (FIG. 5 panel B) CMT tumors receiving treatment of either IgG, Anti- PD-1, Entrectinib, or Entrectinib + Anti-PD-1.

[0026] FIG. 6 shows data graphs of probability of survival against overall survival in TMB low and TMB high designated patients receiving immune checkpoint therapy (ICI; left panel) or ICI and chemotherapy (right panel). FIG. 7 shows a data graph and corresponding summary table showing the association of NTRK1 or MAP2K.1 with probability of survival and overall survival.

[0027] FIG. 8 shows a data graph showing association between NTRK1 and longer survival on ICI.

[0028] FIG. 9 shows a schematic of TrkA, TrkB and TrkC signaling pathways.

[0029] FIG. 10 shows an image of a GSEA enrichment plot for the NTRK signaling pathway in wildtype versus mutant patient samples.

[0030] FIG. 11 shows a data plot of LL / 2 cell line tumor cells treated with anti-PD-1 or IgG control.

[0031] FIG. 12 shows a data plot of CMT cell line tumor cells treated with anti-PD-1 or IgG control.

[0032] FIG. 13 shows a data plot of 344SQ cell line tumor cells treated with anti-PD-1 or IgG control.

[0033] FIG. 14 shows a data plot of LL / 2 cancer cell lines treated with shNTRKl IgG, shNTRKl and PD-L scrambled shRNA (control) IgG. or scrambled shRNA (control) with PD- 1. Image of blot results below indicate successful knockdown of NTRK1 in shRNA-treated samples.

[0034] FIG. 15 shows bar graphs of CD4+ T cells isolated from mouse spleen (left) and lymph node (right) for the indicated groups.

[0035] FIG. 16 shows bar graphs of stem-like CD4+ T cells isolated from mouse spleen (left) and lymph node (right) for the indicated groups.

[0036] FIG. 17 shows data plots of tumor volume post CMT cancer cell injection (left) or LL / 2 cancer cell injection (right) for the indicated groups.

[0037] FIG. 18 shows bar graphs of CD8+ T cells isolated from mouse spleen (left) and lymph node (right) for the indicated groups.

[0038] FIG. 19 shows bar graphs of CD8+ T expansion in populations isolated from mouse spleen (left) and lymph node (right) for the indicated groups.

[0039] FIG. 20 shows bar graphs of CD4+ T cells isolated from mouse spleen (left) and lymph node (right) for the indicated groups.

[0040] FIG. 21 shows bar graphs of stem-like CD4+ T cells from mouse spleen (left) and lymph node (right) for the indicated groups.

[0041] FIG. 22 shows a table of Association between clinical factors and patients’ overall survival (OS) examined by multivariate analyses by logistic regression. No correlation was found with the indicated patient parameters. FIG. 23 shows data graphs of OS of patients with or without NTRKJ mutations under different conditions, analyzed by Mantel-Cox test.

[0042] FIG. 24 shows data graphs of OS of patients with or without NTRK1 or MAP2K1 mutations under different conditions, analyzed by Mantel-Cox test.

[0043] FIG. 25 shows a diagram of Lollipop analysis showing the position and types of NTRK1 mutations. *p < 0.05, **p < 0.01, ***p < 0.001.

[0044] FIG. 26 shows (FIG. 26 panel A) Tumor volume of mice inoculated with LL / 2 (left. n=10) and CMT167 (right, n=5) cells with or without KD of NTRK1 and anti-PD-1 treatment. The KD efficiency of NTRK1 by shRNA were confirmed by Western Blot. (FIG. 26 panel B) Immunocytochemistry analyses of CD4+ and CD8+ T cells in the tumor tissues from mice inoculated with LL / 2 (left) or CMT167 (right) with or without KD of NTRK1 treated with indicated treatments. Scale bar: 20pm.

[0045] FIG. 27 shows (top panel) bar graph quantification of effector CD4+ T cells, stem-like CD4+ T cells, and effector CD8+ T cells in the spleen and TDLNs of tumor bearing mice inoculated with LL / 2 (left) and CMT167 (right) with or without KD of NTRK1 and anti-PD-1 treatment. Scale bar: 20 pm. *p < 0.05, **p < 0.01. ***p < 0.001. FIG. 27 (bottom panel) shows bar graph quantification of effector CD4+ T cells, stem-like CD4+ T cells, and effector CD8+ T cells in the spleen and TDLNs of tumor bearing mice inoculated with LL / 2 (left) and CMT167 (right) with or without KD of NTRK1 and anti-PD-1 treatment . Scale bar: 20 pm. *p < 0.05, **p < 0.01, ***p < 0.001

[0046] Fig. 28 bar graph quantification of effector CD4+ T cells, stem-like CD4+ T cells, and effector CD8+ T cells in the spleen and TDLNs of tumor bearing mice inoculated with LL / 2 (left) and CMT167 (right) with or without KD of NTRK1 and anti-PD-1 treatment. Scale bar: 20 pm. *p < 0.05, **p < 0.01, ***p < 0.001.

[0047] FIG. 29 shows bar graph quantification of pre-exhausted T cells (left) and Thl subtype (right) in the spleen and TDLNs of tumor bearing mice inoculated with LL / 2 and CMT167 with or without KD of NTRK1 and anti-PD-1 treatment. Scale bar: 20 pm. *p < 0.05, **p < 0.01, ***p < 0.001.

[0048] FIG. 30 shows a data graph of in vitro cell growth by % confluence over time of LL / 2 cells (top) and CMT167 cells (bottom) in the presence of Entrectinib.

[0049] FIG. 31 show s bar graphs of (FIG. 31 panel A) Tumor volume of mice inoculated with LL / 2 (left) and CMT167 (right) cells with or without receiving Entrectinib or anti-PD-1 treatment. (n=5): (FIG. 31 panel B) Quantification of CD4+ and CD8+ T cells in the tumor tissues from LL / 2 (left) and CMT167 (right) inoculated mice treated with indicated treatments. Scale bar: 20 pm. Quantification of (FIG. 31 panel C) effector CD4+ T (FIG. 31 panel D) stemlike CD4+ T cells and (FIG. 31 panel E) effector CD8+ T cells in the spleen and TDLNs of tumor bearing mice inoculated with LL / 2 (left) and CMT167 (right) with or without Entrectinib and anti-PD-1 treatment. Scale bar: 20 pm *p < 0.05, **p < 0.01, ***p < 0.001.

[0050] FIG. 32 shows data plots of (FIG.32 panel A) PCA results of LL / 2 tumor samples (n=3- 4) from mice received indicated treatments; (FIG. 32 panel B) IPA results of immune related functions that were enriched in Entrectinib treated LL / 2 tumor compare to IgG treated tumor; (FIG. 32 panel C) Immunocytochemical analyses of Ml macrophages in tumors with or without KD of NTRKl(left) and tumors with or without treatment of Entrectinib; and (FIG. 32 panel D) IPA results of enriched T cell related functions in combination treated tumors compared to Anti-PDl monotherapy treated groups. FIG. 32 panel E shows a bar graph of mMCP-counter and QuanTiseq analyses of T cell populations in tumors from LL / 2 tumor bearing mice treated with indicated treatments. FIG. 32 panel F shows a schematic of DCQ analyses of different T cell populations within the tumors derived from indicated groups. *p < 0.05, **p < 0.01. ***p < 0.001.

[0051] FIG. 33 shows data plots, bar graphs, and images of western blots and histology regarding (FIG. 33 panel A) IPA results of upregulated immune related activities in LL / 2 cells with KD of NTRK1; (FIG. 33 panel B) Volcano Plot of upregulated immune related secretory' or extracellular genes in LL / 2-shNTRKl cells. Fold changes (log) of genes between the sh- scramble and shNTRKl were plotted on the x-axis. and the adjusted p-value (-l*logl0 scale) was plotted on the y-axis; (FIG. 33 panel C) mRNA expression of NTRK1 target genes identified from figure 5B were examined by qRT-PCR in LL / 2 and CMT167 cells; (FIG. 33 panel D) mRNA expressions of CCN1, C3, CXCL1 and CCL2 in responders (n=458) and nonresponders (n=809) of patients who received anti-PD-1 treatments using ROC plotter; (FIG. 33 panel E) C3 protein was examined by Western Blot in LL / 2 and CMT167 cells with or without KD of NTRK1; (FIG. 33 panel F) Western Blot analyses of C3 expression in LL / 2 and CMT167 cells treated with different doses of Entrectinib. C3 levels in LL / 2 and CMT167 cells treated with various doses of (FIG. 33 panel G) LY294002 and (FIG. 33 panel H) PD98059 were measured by Western Blot; (FIG. 33 panel I) Representative images of C3 immunohistochemical staining in NSCLC samples from patients with or without NTRK1 mutations. Scale bar: 20 pm; (FIG. 33 panel J) Quantification of C3 staining intensity' of patients’ samples. *p < 0.05, **p < 0.01, ***p < 0.001.

[0052] FIG. 34 shows data plots, images of histology and bar graphs regarding (FIG. 34 panel A) Tumor volume of mice inoculated with LL / 2-shNTRKl (left) and CMT167-shNTRKl (right) cells with or without KO of C3 (n=5). KO of C3 in both cell lines were confirmed by Western Blot; (FIG. 34 panel B) Quantification of CD4+ and CD8+ T cells in the tumor tissues from IgG or anti-PD-1 treated mice inoculated with LL / 2-shNTRKl (left) or CMT167- shNTRKl (right) with or without KO of C3. Scale bar: 20 pm; quantification of (FIG. 34 panel C) effector CD4+ T cells, (FIG. 34 panel D) effector stemdike CD4+ T cells, and (FIG. 34 panel E) effector CD8+ T cells in the spleen and TDLNs of tumor bearing mice inoculated with LL / 2-shNTRKl (left) and CMT167-shNTRKl (right) with or without KO of C3 and anti-PD- 1 treatment. Scale bar: 20 pm *p < 0.05, **p < 0.01, ***p < 0.001.

[0053] DETAILED DESCRIPTION OF THE INVENTION

[0054] The present invention now will be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations, and variations thereof.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0056] All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0057] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a composition comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.

[0058] As used in the description of the invention and the appended claims, the singular forms "a," "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0059] Also as used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0060] The term "about," as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1 %, ± 0.5%, or even ± 0.1% of the specified value as well as the specified value. For example, "about X" where X is the measurable value, is meant to include X as well as variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of X. A range provided herein for a measurable value may include any other range and / or individual value therein.

[0061] As used herein, phrases such as "between X and Y" and "between about X and Y" should be interpreted to include X and Y. As used herein, phrases such as "between about X and Y" mean "between about X and about Y" and phrases such as "from about X to Y" mean "from about X to about Y."

[0062] The term "comprise," "comprises" and "comprising" as used herein, specify the presence of the stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0063] As used herein, the transitional phrase "consisting essentially of means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term "consisting essentially of when used in a claim of this invention is not intended to be interpreted to be equivalent to "comprising."

[0064] Amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 C.F.R. §1.822 and established usage. As used herein, the term "amino acid" encompasses any naturally occurring amino acids, modified forms thereof, and synthetic amino acids, including non-naturally occurring amino acids. Alternatively, the amino acid can be a modified amino acid residue or can be an amino acid that is modified by post-translation modification (e.g, acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation or sulfatation).

[0065] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.

[0066] To illustrate further, if. for example, the specification indicates that a particular amino acid can be selected from A, G, I, L and / or V, this language also indicates that the amino acid can be selected from any subset of these amino acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc., as if each such subcombination is expressly set forth herein. Moreover, such language also indicates that one or more of the specified amino acids can be disclaimed. For example, in particular embodiments the amino acid is not A, G or I; is not A; is not G or V; etc., as if each such possible disclaimer is expressly set forth herein.

[0067] As used herein, the term "polypeptide" encompasses both peptides and proteins, unless indicated otherwise.

[0068] A "polynucleotide." "nucleic acid," or "nucleic acid molecule" as used herein is a sequence of nucleotide bases, and may be RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotide), but in representative embodiments are either single or double stranded DNA sequences.

[0069] As used herein, an "isolated" polynucleotide (e.g., an "isolated DNA" or an "isolated RNA") means a polynucleotide at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide. In representative embodiments an "isolated" nucleotide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.

[0070] Likewise, an "isolated" polypeptide means a polypeptide that is at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide. In representative embodiments an "isolated" polypeptide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.

[0071] As used herein, by "isolate" or "purify" (or grammatical equivalents) a vector, it is meant that the vector (e.g., a virus vector, e.g., an expression vector, e.g., a liposome, etc.) is at least partially separated from at least some of the other components in the starting material. In representative embodiments an "isolated" or "purified" vector is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.

[0072] "Amino acid sequence" and terms such as "peptide," "polypeptide," and "protein" are used interchangeably herein, and are not meant to limit the amino acid sequence to the complete, native amino acid sequence (i.e., a sequence containing only those amino acids found in the protein as it occurs in nature) associated with the recited protein molecule. The proteins and protein fragments of the presently disclosed subject matter can be produced by recombinant approaches or can be isolated from a naturally occurring source. The protein fragments can be any size, and for example can range in size from four amino acid residues to the entire amino acid sequence minus one amino acid.

[0073] The "N-terminus" of a polypeptide is any portion of the polypeptide that starts from the N-terminal amino acid residue and continues to a maximum of the midpoint of the polypeptide.

[0074] The "C-terminus" of a polypeptide is any portion of the polypeptide that starts from the C-terminal amino acid residue and continues to a maximum of the midpoint of the polypeptide.

[0075] A "heterologous nucleotide sequence" or "heterologous nucleic acid," with respect to a cell, is a sequence or nucleic acid, respectively, that is not naturally occurring in the cell. Generally, the heterologous nucleic acid or nucleotide sequence comprises an open reading frame that encodes a polypeptide and / or a nontranslated RNA.

[0076] A "therapeutic." "therapeutic polypeptide," "therapeutic molecule" and similar terms refer to a polypeptide and / or molecule that can alleviate, reduce, prevent, delay and / or stabilize symptoms that result from an absence or defect in a protein in a cell or subject and / or is a polypeptide and / or molecule that otherwise confers a benefit to a subject, e.g., anti-cancer effects or improvement in transplant survivability or induction of an immune response.

[0077] As used herein with respect to nucleic acids, the term "fragment" refers to a nucleic acid that is reduced in length relative to a reference nucleic acid and that comprises, consists essentially of and / or consists of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a corresponding portion of the reference nucleic acid. Such a nucleic acid fragment may be. where appropriate, included in a larger polynucleotide of which it is a constituent. In some embodiments, the nucleic acid fragment comprises, consists essentially of or consists of at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45. 50. 55, 60, 65, 70, 75, 80, 85, 90, 95. 100, 125, 150, 175. 200. 225, 250, 300, 350. 400, 450, 500, or more consecutive nucleotides. In some embodiments, the nucleic acid fragment comprises, consists essentially of or consists of less than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150. 175, 200. 225, 250, 300, 350, 400, 450 or 500 consecutive nucleotides.

[0078] As used herein with respect to polypeptides, the term "fragment" refers to a polypeptide that is reduced in length relative to a reference polypepride and that comprises, consists essentially of and / or consists of an amino acid sequence of contiguous amino acids identical or almost identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to a corresponding portion of the reference polypeptide. Such a polypeptide fragment may be, where appropriate, included in a larger polypeptide of which it is a constituent. In some embodiments, the polypeptide fragment comprises, consists essentially of or consists of at least about 2, 3, 4. 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40. 45. 50. 55. 60. 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, or more consecutive amino acids. In some embodiments, the polypeptide fragment comprises, consists essentially of or consists of less than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90. 95, 100, 125. 150, 175, 200, 225, 250, 300, 350. 400, 450 or 500 consecutive amino acids.

[0079] As used herein with respect to nucleic acids, the term "functional fragment" or "active fragment" refers to nucleic acid that encodes a functional fragment of a polypeptide.

[0080] As used herein with respect to polypeptides, the term "functional fragment" or "active fragment" refers to polypeptide fragment that retains at least about 20%. 25%. 30%. 35%. 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or more of at least one biological activity7of the full-length polypeptide (e.g., the ability7to up- or down-regulate gene expression). In some embodiments, the functional fragment actually has a higher level of at least one biological activity of the full-length polypeptide.

[0081] A "fusion protein" is a polypeptide produced when two heterologous nucleotide sequences or fragments thereof coding for two (or more) different polypeptides not found fused together in nature are fused together in the correct translational reading frame. Illustrative fusion polypeptides include fusions of a peptide of the invention (or a fragment thereof) to all or a portion of glutathione-S-transferase. maltose-binding protein, or a reporter protein (e.g., Green Fluorescent Protein, P-glucuronidase, P-galactosidase, luciferase), hemagglutinin, c-myc, FLAG epitope, etc.

[0082] As used herein, the term "modified," as applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof. Modified sequences may also be referred to as "modified variant(s)."

[0083] As used herein, "nucleic acid molecule," "nucleotide sequence." and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA and chimeras of RNA and DNA. The term nucleic acid refers to a chain of nucleotides without regard to length of the chain. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be a sense strand or an antisense strand. The nucleic acid can be synthesized using oligonucleotide analogs or derivatives (e.g, inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered basepairing abilities or increased resistance to nucleases. The present invention further provides a nucleic acid that is the complement (which can be either a full complement or a partial complement) of a nucleic acid or nucleotide sequence of this invention.

[0084] An "isolated polynucleotide" is a nucleotide sequence (e.g., DNA or RNA) that is not immediately contiguous with nucleotide sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are immediately contiguous to a coding sequence. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g.. a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment), independent of other sequences. It also includes a recombinant DNA that is part of a hybrid nucleic acid encoding an additional polypeptide or peptide sequence. An isolated polynucleotide that includes a gene is not a fragment of a chromosome that includes such gene, but rather includes the coding region and regulator}' regions associated with the gene, but no additional genes naturally found on the chromosome.

[0085] A "recombinant" nucleic acid, polynucleotide or nucleotide sequence is one produced by genetic engineering techniques.

[0086] A "recombinant" polypeptide is produced from a recombinant nucleic acid, polypeptide or nucleotide sequence.

[0087] A polypeptide, composition, compound or combination of the invention may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components (e.g., a promoter from the host organism operably linked to a polynucleotide of interest to be expressed in the host organism, wherein the polynucleotide of interest is from a different organism than the host or is not normally found in association with that promoter).

[0088] The term "isolated" can refer to a nucleic acid, nucleotide sequence or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Moreover, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state. "Isolated" does not mean that the preparation is technically pure (homogeneous), but it is sufficiently pure to provide the polypeptide or nucleic acid in a form in which it can be used for the intended purpose.

[0089] An isolated cell refers to a cell that is separated from other components with which it is normally associated in its natural state. For example, an isolated cell can be a cell in culture medium and / or a cell in a pharmaceutically acceptable carrier of this invention. Thus, an isolated cell can be delivered to and / or introduced into a subject. In some embodiments, an isolated cell can be a cell that is removed from a subject and manipulated as described herein ex vivo and then returned to the subject.

[0090] A "vector" is any nucleic acid molecule for the cloning of and / or transfer of a nucleic acid into a cell. A vector may be a replicon to which another nucleotide sequence may be attached to allow for replication of the attached nucleotide sequence. A "replicon" can be any genetic element (e.g, plasmid, phage, cosmid. chromosome, viral genome) that functions as an autonomous unit of nucleic acid replication in vivo, i.e., capable of replication under its own control. The term "vector" includes both viral and nonviral (e.g., plasmid) nucleic acid molecules for introducing a nucleic acid into a cell in vitro, ex vivo, and / or in vivo. A large number of vectors known in the art may be used to manipulate nucleic acids, incorporate response elements and promoters into genes, etc. For example, the insertion of the nucleic acid fragments corresponding to response elements and promoters into a suitable vector can be accomplished by ligating the appropriate nucleic acid fragments into a chosen vector that has complementary cohesive termini. Alternatively, the ends of the nucleic acid molecules may be enzymatically modified or any site may be produced by ligating nucleotide sequences (linkers) to the nucleic acid termini. Such vectors may be engineered to contain sequences encoding selectable markers that provide for the selection of cells that contain the vector and / or have incorporated the nucleic acid of the vector into the cellular genome. Such markers allow identification and / or selection of host cells that incorporate and express the proteins encoded by the marker. A "recombinant" vector refers to a viral or non-viral vector that comprises one or more heterologous nucleotide sequences (z. e. , transgenes), e.g., two, three, four, five or more heterologous nucleotide sequences.

[0091] Viral vectors have been used in a wide variety of gene delivery applications in cells, as well as living animal subjects. Viral vectors that can be used include, but are not limited to, retrovirus, lentivirus, adeno-associated virus, poxvirus, alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr virus, and adenovirus vectors. Non-viral vectors include plasmids, liposomes, electrically charged lipids (cytofectins), nucleic acid-protein complexes, and biopolymers. In addition to a nucleic acid of interest, a vector may also comprise one or more regulatory regions, and / or selectable markers useful in selecting, measuring, and monitoring nucleic acid transfer results (delivery' to specific tissues, duration of expression, etc.).

[0092] Vectors may be introduced into the desired cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a nucleic acid vector transporter ( 263: 14621 (1988); and Hartmut et al.. Canadian Patent Application No. 2,012.311, filed Mar. 15. 1990). In various embodiments, other molecules can be used for facilitating delivery of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., WO95 / 21931), peptides derived from nucleic acid binding proteins (e.g., WO96 / 25508), and / or a cationic polymer (e.g., WO95 / 21931). It is also possible to introduce a vector in vivo as naked nucleic acid (see U.S. Patent Nos. 5.693.622, 5,589.466 and 5.580,859). Receptor-mediated nucleic acid delivery approaches can also be used (Curiel et al., Hum. Gene Ther. 3: 147 (1992); Wu et al., J. Biol. Chem. 262:4429 (1987)).

[0093] The term "transfection" or "transduction" means the uptake of exogenous or heterologous nucleic acid (RNA and / or DNA) by a cell. A cell has been "transfected" or "transduced" with an exogenous or heterologous nucleic acid when such nucleic acid has been introduced or delivered inside the cell. A cell has been "transformed" by exogenous or heterologous nucleic acid when the transfected or transduced nucleic acid imparts a phenotypic change in the cell and / or a change in an activity or function of the cell. The transforming nucleic acid can be integrated (covalently linked) into chromosomal DNA making up the genome of the cell or it can be present as a stable plasmid.

[0094] By the term "express" or "expression" of a polynucleotide coding sequence, it is meant that the sequence is transcribed, and optionally, translated. Typically, according to the present invention, expression of a coding sequence of the invention will result in production of the polypeptide of the invention. The entire expressed polypeptide can also function in intact cells without purification.

[0095] "Label" or "tag" as used herein may be any suitable label or detectable or otherwise functional group, e.g., a detectable moiety, including but not limited to biotin, avidin, fluorophores, antigens (including proteins and peptides), antibodies, porphyrins, radioactive or stable isotopes, etc., inclusive of examples as further described herein.

[0096] The terms "antibody" and "immunoglobulin" include antibodies or immunoglobulins of any isotype, fragments of antibodies that retain specific binding to antigen, including but not limited to Fab, Fv, single chain Fv (scFv), Fc, and Fd fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, and fusion proteins including an antigenbinding portion of an antibody and a non-antibody protein. The antibodies can in some embodiments be detectably labeled, e.g., with a radioisotope, an enzyme which generates a detectable product, a fluorescent protein, and the like. The antibodies can in some embodiments be further conjugated to other moieties, such as members of specific binding pairs, e.g., biotin (member of biotin-avidin specific binding pair), and the like. Also encompassed by the terms are Fab', Fv, F(ab')2, and other antibody fragments that retain specific binding to antigen (e.g., any antibody fragment that comprises at least one paratope).

[0097] Antibodies can exist in a variety of other forms including, for example, Fv, Fab, and (Fab')2, as well as bi-functional (i.e., bi-specific) hybrid antibodies (see e.g., Lanzavecchia et al., 1987) and in single chains (see e.g., Huston et al., 1988 and Bird et al., 1988, each of which is incorporated herein by reference in its entirety). See generally. Hood et al.. 1984, and Hunkapiller & Hood, 1986. The phrase "detection molecule" is used herein in its broadest sense to include any molecule that can bind with sufficient specificity to a biomarker to allow for detection of the particular biomarker. To allow for detection can mean to determine the presence or absence of the particular biomarker member and, in some embodiments, can mean to determine the amount of the particular biomarker. Detection molecules can include antibodies, antibody fragments, and nucleic acid sequences.

[0098] The term "contact" or grammatical variations thereof as used with respect to the interaction between two or more components, e.g., NTRK1 and an inhibitor thereof, e.g., an inhibitor of NTRK1 and an immune checkpoint inhibitor, e.g., an inhibitor of NTRK1 and / or an immune checkpoint inhibitor and a cell, refers to bringing the two or more components in sufficiently close proximity’ to each other for one to exert a biological effect on the other. In some embodiments, the term contact means binding of the one component to the other.

[0099] By the terms "treat," "treating" or "treatment of' (and grammatical variations thereof) it is meant that the severity’ of the subject’s condition is reduced, at least partially improved or stabilized and / or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and / or there is a delay in the progression of the disease or disorder.

[0100] By "substantially retain" a property and / or to maintain a property "substantially the same" as a comparison (e.g., a control), it is meant that at least about 75%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the property (e.g. , activity or other measurable characteristic) is retained.

[0101] The term "enhance" or "increase" refers to an increase in the specified parameter of at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, twelvefold, or even fifteen-fold, and / or indicate an increase of at least about 25%. 50%. 75%. 100%, 150%, 200%, 300%. 400%, 500% or more.

[0102] As used herein, the terms "reduce," "reduces," "reduction," "diminish," "inhibit" and similar terms mean a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97% or more. In particular embodiments, the inhibition or reduction results in little or essentially no detectible activity (at most, an insignificant amount, e g., less than about 10% or even 5%).

[0103] As used herein, the terms "subject" and "patient" are used interchangeably herein and refer to both human and nonhuman animals. A subject of this invention can be any subject that is susceptible to a disorder that can benefit by the methods and compositions of the present invention and / or be treated for a disorder by the methods and compositions of the present invention. In some embodiments, the subject of any of the methods of the present invention is a mammal. The term "mammal" as used herein includes, but is not limited to, humans, primates, non-human primates (e.g., monkey s and baboons), cattle, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g.. rats, mice, hamsters, and the like), etc. Human subjects include neonates, infants, juveniles, and adults. As a further option, the subject can be a laboratory animal and / or an animal model of disease. Preferably, the subject is a human. The subject may be of any gender, any ethnicity and any age. In some embodiments, the subject has, is suspected to have, and / or is at risk of cancer, e.g., a "subject in need".

[0104] A "subject in need thereof or "a subject in need of is a subject known to have, or is suspected of having or developing or is at risk of having or developing disorder that can be treated by the methods and compositions of the present invention, or would benefit from the delivery' of a particle and / or composition including those described herein.

[0105] A "sample", "biological sample", and / or "ex vivo sample" of this invention can be any biological material, such as a biological fluid (e.g., blood, saliva, mucus, semen, vaginal fluids, cellular supernatant, and the like), an extract from a cell, an extracellular matrix isolated from a cell, a cell (in solution or bound to a solid support), a tissue (e.g., a healthy subject or patient biopsy), a tissue homogenate, and the like as are well known in the art.

[0106] Grammatical variations of "administer," "administration," and "administering" to a subject include any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal. intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like.

[0107] "Concurrent administration," "administration in combination," "simultaneous administration," or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time, overlapping in time, or one following the other. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time.

[0108] "Systemic administration" refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g. , greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, "local administration" refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration but are undetectable or detectable at negligible amounts in distal parts of the subject's body. Administration includes selfadministration and the administration by another.

[0109] The terms "prevent." "preventing" and "prevention" (and grammatical variations thereof) refer to prevention and / or delay of the onset of a disease, disorder and / or a clinical symptom(s) in a subject and / or a reduction in the severity of the onset of the disease, disorder and / or clinical symptom(s) relative to what would occur in the absence of the methods of the invention. The prevention can be complete, e.g., the total absence of the disease, disorder and / or clinical symptom(s). The prevention can also be partial, such that the occurrence of the disease, disorder and / or clinical symptom(s) in the subject and / or the severity of onset are substantially less than what would occur in the absence of the present invention.

[0110] A "treatment effective" or "effective" amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, a "treatment effective" or "effective" amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.

[0111] A "prevent on effective" amount as used herein is an amount that is sufficient to prevent and / or delay the onset of a disease, disorder and / or clinical symptoms in a subject and / or to reduce and / or delay the severity of the onset of a disease, disorder and / or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, as long as some preventative benefit is provided to the subject.

[0112] An "effective amount" or "therapeutically effective amount" refers to an amount of a compound, combination or composition of this invention that is sufficient to produce a desired effect, which can be a therapeutic and / or beneficial effect. In general, a "therapeutically effective amount" or "treatment effective amount" refers to an amount that is a sufficient, but non-toxic, amount of the active ingredient (i.e., administered agents of this invention) to achieve the desired effect, which, for example, can be a reduction or elimination in the severity and / or frequency of symptoms and / or improvement or remediation of damage, or otherwise prevent, hinder, retard or reverse the progression of a disease or any other undesirable symptom. The effective amount will vary' with the age, general condition of the subject, the severity' of the condition being treated, the particular agent administered, the duration of the treatment, the nature of any concurrent treatment, the pharmaceutically acceptable carrier used, and like factors within the knowledge and expertise of those skilled in the art. As appropriate, an effective amount or therapeutically effective amount in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and / or by using routine experimentation. See, for example, Remington, The Science and Practice of Pharmacy (latest edition)).

[0113] In some embodiments, an effective amount of one agent (e.g., an inhibitor of NTRK1) may be such an amount that produces a desired effect on the functionality' and / or efficacy of another agent (e.g., an immune checkpoint inhibitor). In some embodiments, an effective amount of one agent (e.g., an immune checkpoint inhibitor) may be vary under particular circumstances, for example, when in combination with another agent (e.g., an inhibitor of NTRK1). for example, wherein the amount of one agent needed to be effective may be reduced when in combination with another agent as compared to when administered devoid of the other agent or when administered solo.

[0114] The terms "protective" immune response or "protective" immunity as used herein indicates that the immune response confers some benefit to the subject in that it prevents or reduces the incidence and / or severity and / or duration of disease or any other manifestation of infection. For example, in representative embodiments, a protective immune response or protective immunity results in anti-tumor functions. Alternatively, a protective immune response or protective immunity7may be useful in the therapeutic treatment of existing disease.

[0115] An "active immune response" or "active immunity" is characterized by "participation of host tissues and cells after an encounter with the immunogen. It involves differentiation and proliferation of immunocompetent cells in lymphoreticular tissues, w hich lead to synthesis of antibody or the development of cell-mediated reactivity7, or both." Herbert B. Herscowitz, Immunophysiology: Cell Function and Cellular Interactions in Antibody Formation, in IMMUNOLOGY: BASIC PROCESSES 117 (Joseph A. Bellanti ed„ 1985). Alternatively stated, an active immune response is mounted by the host after exposure to antigens the host views as "non-self1, e.g., immunogens by infection or by vaccination, e.g., cancer antigens. Active immunity7can be contrasted with passive immunity7, which is acquired through the "transfer of preformed substances (antibody, transfer factor, thymic graft, interleukin-2) from an actively immunized host to a non-immune host. " Id.

[0116] As used herein, to "suppress" a function or activity is to reduce the function or activity when compared to otherwise same conditions except for a condition or parameter of interest, or alternatively, as compared to another condition. For example, cells that suppress tumor growth reduce the rate of growth of the tumor compared to the rate of growth of the tumor in the absence of the cells.

[0117] As used herein, "immunosuppressive" refers to a function or activity that suppresses one or more aspects of an active immune response. An "immunosuppressive agent" refers to an agent that inhibits or prevents an immune response, e.g., to a foreign material in a subject. Immunosuppressive agents generally act by inhibiting immune cell (e.g., T-cell, B-cell, NK cell, and the like) activation, disrupting proliferation, and / or suppressing inflammation. Likewise, as used herein, the term "immunosuppression" and / or "cancer immunosuppression" refers the status of the local environment (including but not limited to the tumor microenvironment (TME) and / or the subject in general) wherein one or more aspects of an active immune response are suppressed, despite the optional presence of a stimulus and / or other agent which, under non-immunosuppressive conditions, would stimulate and / or enhance an active immune response.

[0118] The term "biologically active" as used herein means an enzyme or protein having structural, regulator ', or biochemical functions of a naturally occurring molecule.

[0119] As used herein the term "control" refers to a comparative sample and / or other reference source for a control subject.

[0120] "Control subject" as used herein refers to a subject which does not have said condition(s) of the subject in need, e.g., said cancer and / or an illness to which the methods of the present invention disclosed herein may provide beneficial health effects.

[0121] As used herein, "tumor microenvironment" or "TME" refers to the immediate and adjacent surroundings of a tumor, including but not limited to, the surrounding stromal environment (e.g., stroma cells), vasculature (e.g., blood vessels), immune cells, fibroblasts and extracellular matrix (ECM), as well as any molecules (e.g., proteins or other macromolecules) encompassed therein. Further description of tumor microenvironments can be found in, e.g., Valkenburg et al. 2018 Nat Rev Clin Oncol 15:366-381 and Ho et al. 2020 Nat Rev Clin Oncol 17:527-540, the disclosures of each of which are incorporated herein by reference.

[0122] Methods and compositions

[0123] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary^ language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0124] All compositions described herein may be useful in the methods described herein and / or other useful utility such as reagents for in vitro and / or in vivo research and development.

[0125] At diagnosis, a majority of lung cancers are metastatic of locally advanced. Of nonsmall cell lung cancer, 1.7% of patients are diagnosed at an unknown stage, 23.1% and Stage I, 19% at Stage III. and 47.1% at Stage IV cancer.

[0126] Treatment options for late-stage lung cancer currently include chemotherapy (such as but not limited to cisplatin, etoposide, and paclitaxel), radiotherapy (such as but not limited to external beam radiation (EBRT), intensity modulated radiation therapy (IMRT)), targeted therapy (such as but not limited to crizotinib, sotorasib, and / or Osimertinib), or immunotherapy (such as but not limited to nivolumab, pembrolizumab, and / or atezolizumab). These and other treatment options for lung cancer are further described in Ashrafi et al. 2022 Cancers 14(19):4562. the disclosures of which are incorporated herein by reference.

[0127] While not wishing to be bound to theory, the expression of PD-L1 may no longer be a good biomarker for response to immune checkpoint immunotherapy (ICI), due to both technical factors and cut-off standards which may influence utility of PD-L1 as a marker. For example, some NSCLC patients have an absence of PD-Li expression and some PD-L1 negative patients still obtain durable responses to anti-PD-l / PD-Ll therapy, such as shown in Figure 3 of Garon et al. 2015 NEJM 372:2018-2028, the disclosures of which are incorporated herein by reference. Indeed, a large portion of patients may not respond to ICI treatment for a variety of reasons, as reviewed in Sharma et al. 2017 Cell 168:P707-723. the disclosures of which are incorporated herein by reference.

[0128] This invention is based, in part, on the discovery by the inventors that expression and / or function of neurotrophic ty rosine kinase receptor type 1 (NTRK) is associated with cancer cell resistance to ICI.

[0129] As used herein, NSCLC refers to "non-small cell lung cancer," any type of epithelial lung cancer other than small-cell lung cancer (SCLC). While not wishing to be bound to theory. NSCLCs may be relatively insensitive to cancer therapeutics including but not limited to chemotherapy and / or immunotherapy, as compared to small-cell lung cancer. Non-limiting types ofNSCLC include squamous-cell carcinoma, large-cell carcinoma, adenocarcinoma, as well as pleomorphic, carcinoid and salivary gland derived carcinomas.

[0130] As used herein, "NTRK" or "NTRK" refer to the gene and gene product, respectively, of the neurotrophic tyrosine kinase receptor family, also referred to as the TrK receptor family, inclusive of TrkA (NTRK1), TrkB (NTRK2) and TrkC (NTRK3). Similarly, as used herein, "NTRK1" and "NTRK1" refer to the gene and gene product, respectively of the neurotrophic tyrosine kinase receptor type 1 gene. NTRK1 may also be referred to as TRK, TRK1, tropomyosin receptor kinase A (TRKA), and / or high affinity nerve growth factor receptor. Without wishing to be bound to theory, NTRK1 is understood to be a high affinity catalytic receptor of the neurotrophic nerve growth factor (NGF), and to mediate effects of NGF including but not limited to neuronal differentiation, neural proliferation, nociceptor response and avoidance of programmed cell death.

[0131] As used herein, the term "programmed cell death" refers to a number of methods used by eukary otic cells (e.g., single cells organisms and cells within a multicellular organism) that lead to morphological cellular changes and cell death, including but not limited to blebbing, cell shrinkage, nuclear fragmentation, chromatin condensation, DNA fragmentation and mRNA decay. Without wishing to be bound to theory', programmed cell death may be stimulated by external signals or certain damage to the cell and / or signals internal to the cell (e.g., apoptosis). Non-limiting examples of programmed cell death including necroptosis, pyroptosis and apoptosis, is further described in Bertheloot et al. 2021 Cellular & Molecular Immunology 18: 1106-1121, the disclosures of which are incorporated herein by reference.

[0132] As used herein, the term "inhibitor" and similar terms refers to a molecule (e.g., small molecule, e.g.. a compound, e.g., a nucleic acid molecule, e.g., a polypeptide) that interferes with expression and / or any activity of the listed target. As such, the term "inhibitor of NTRK1 " refers a molecule that interferes with the expression and / or activity of NTRK1. Non-limiting examples of an inhibitor of NTRK1 include an inhibitor of NTRK1 expression, an inhibitor of NTRK1 activation, and / or an inhibitor of NTRK1 activity.

[0133] One aspect of the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor; thereby treating the cancer.

[0134] Another aspect of the present invention provides a method of inducing or enhancing sensitivity to an immune checkpoint inhibitor in a subject having, suspected of having, or at risk of having cancer, comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor; thereby inducing or enhancing sensitivity to the immune checkpoint inhibitor in the subject.

[0135] Another aspect of the present invention provides a method of treating a subject resistant to an immune checkpoint inhibitor, comprising: determining whether the subject is positive for NTRK1 gene expression and / or function and / or NTRK1 protein expression and / or function; and administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor; thereby treating the subject resistant to an immune checkpoint inhibitor.

[0136] Another aspect of the present invention provides a method of enhancing efficacy of an immune checkpoint inhibitor in a subject receiving the immune checkpoint inhibitor (e.g., a subject having, suspected of having, or at risk of having cancer, e.g., a cancer patient), comprising administering to the subject an effective amount of an inhibitor of NTRK1 ; thereby enhancing the therapeutic efficacy of the immune checkpoint inhibitor in the subject.

[0137] As described above, some patients may inherently have and / or develop resistance to or show reduced efficacy of conventional immune checkpoint inhibitors such as those described herein, for example, as compared (normalized) to the average response to or efficacy of the received immune checkpoint inhibitor displayed by a corresponding patient population. In some embodiments, administration of an inhibitor of NTRK1 in combination with an immune checkpoint inhibitor may avoid or provide a reduction in one or more of the side effects associated with administration of the immune checkpoint inhibitor. In some embodiments, administration of an inhibitor of NTRK1 may complement the effect (e.g., enhance the efficacy) of an immune checkpoint inhibitor when the immune checkpoint inhibitor is administered at a known, conventional dose. In other embodiments, the immune checkpoint inhibitor may administered at a reduced dose, when in combination with an inhibitor of NTRK1, that is about 10% (e.g., about 20%, 25%, 30%. 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%, 80%, 90% or 95%) of the known, conventional dose the immune checkpoint inhibitor.

[0138] Accordingly, in another aspect of this invention, a method is provided for reducing a required dose or complementing the effect of an immune checkpoint inhibitor in the treatment of cancer in a subject in need thereof comprising administering to the subject an effective amount of an inhibitor of NTRK1 in combination with the immune checkpoint inhibitor.

[0139] In some embodiments, administering to the subject an effective amount of an inhibitor of NTRK1 in combination with an immune checkpoint inhibitor may enhance the efficacy of said immune checkpoint inhibitor by at least about 5% to about 100% or more, e.g., at least about 5%, 10%, 15%, 20%, 25%. 30%. 35%. 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% enhanced efficacy or any value or range therein, e.g., as compared (normalized) to the efficacy to the received immune checkpoint inhibitor by a subject receiving the immune checkpoint inhibitor devoid of in combination with the inhibitor of NTRK1 and / or receiving the immune checkpoint inhibitor solo.

[0140] In some embodiments, administering to the subject an effective amount of an inhibitor of NTRK1 in combination with an immune checkpoint inhibitor may enhance the efficacy of said immune checkpoint inhibitor by at least about 2-fold to about 100-fold or more, e.g., at least about 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or more or any value or range therein, e.g., as compared (normalized) to the efficacy to the received immune checkpoint inhibitor by a subject receiving the immune checkpoint inhibitor devoid of in combination with the inhibitor of NTRK1 and / or receiving the immune checkpoint inhibitor solo.

[0141] Another aspect of the present invention provides a method of reducing immunosuppression in a subject resistant to an immune checkpoint inhibitor (e.g., a subject having, suspected of having, or at risk of having cancer, e.g., a cancer patient), comprising administering to the subject an effective amount of an inhibitor of NTRK1, wherein the inhibiting of NTRK1 function in the subject reduces cancer immunosuppressive resistance to the immune checkpoint inhibitor, thereby reducing immunosuppression in the subject.

[0142] In some embodiments, a method of the present invention may further comprise administering to the subject an immune checkpoint inhibitor.

[0143] In some embodiments, the subject of a method of the present invention may have previously received and / or may be concurrently receiving administration of an immune checkpoint inhibitor.

[0144] A therapeutic agent or therapeutic treatment contemplated in the present invention may be any cancer treatment which may be of use to the subject in need. In some embodiments, the therapeutic agent may be an immunotherapy agent such as an immune checkpoint inhibitor (e.g., anti-PDl, anti-PDLl, anti-CTLA4, and the like). In some embodiments, the immunotherapy may be an autologous cellular immunotherapy, e.g., chimeric antigen receptor (CAR)-T cell therapy, CAR-NK cell therapy, and / or other modified immune cell (e.g., dendritic cell based therapy, e.g., Sipuleucel-T and the like)). In some embodiments, the immunotherapy may be targeted antibody therapy (e.g., monoclonal antibody therapy) such as, but not limited to, anti-CD20, anti-EGFR, anti-VEGF, anti-VEGFR2, anti-TNFa, anti-CD44, anti-CD19, anti-CD3, anti-EpCAM, anti-IGFIR, anti-MUCl. anti-CD51, anti-integrin, or any other targeted antibody-based therapy with anti-cancer function. In some embodiments, the therapeutic treatment may be surgery. In some embodiments, the therapeutic treatment may be radiation therapy.

[0145] In some embodiments, an immune checkpoint inhibitor may be, but is not limited to, inhibitors targeting CTLA-4 (CD152), PD-1 (CD279), B7-1 (CD80). B7-2 (CD86), B7-H1 (PD-L1; CD274), and / or B7-DC (PD-L2; CD273). In some embodiments, the checkpoint inhibitor therapy may be, but is not limited to, pembrolizumab, nivolumab, ipilimumab, atezolizumab, avelumab, durvalumab, cemiplimab, amivantamab, apolizumab, bevacizumab, bivatuzumab, blinatumomab, camrelizumab, catumaxomab. cemiplimab, cixutumumab, chvatuzumab (e.g., clivatuzumab tetraxetan) durvalumab, edrecolomab, ertumaxomab. etaracizumab, faricimab, inebilizumab, intetumumab, isatuximab, margetuximab, necitumumab, nimotuzumab, Obinutuzumab, ocrelizumab, ofatumumab, olaratumab, panitumumab, pemtumomab, pertuzumab, racotumomab, ramucirumab, retifanlimab, rituximab, siltuximab, tafasitamab, teclistamab, tisotumab, tositumomab, trastuzumab, tremelimumab, votumumab and / or any variant, functional fragment and / or biosimilar thereof. In some embodiments, the immune checkpoint inhibitor may be an inhibitor of CTLA- 4 (CD152). PD-1 (CD279), B7-1 (CD80). B7-2 (CD86), PD-L l (B7-H1 : CD274), and / or PD- L2 (B7-DC: CD273).

[0146] In some embodiments, the immune checkpoint inhibitor may be a small molecule, an antibody or functional fragment thereof, and / or an RNA molecule (e.g., RNAi, shRNA, miRNA, etc.).

[0147] In some embodiments, the therapeutic agent may be a therapeutic treatment. In some embodiments, the therapeutic treatment may be surgery. In some embodiments, the therapeutic treatment may be radiation therapy.

[0148] An inhibitor of NTRK1 contemplated in the present invention may be any treatment that is able to reduce in vivo expression and / or function of NTRK1 in the subject and which may be of use to the subject in need. In some embodiments, the inhibitor of NTRK1 may be a small molecule, an antibody or functional fragment thereof, and / or an RNA molecule (e.g., RNAi, shRNA, miRNA, etc.). In some embodiments, the inhibitor of NTRK1 may be entrectinib or any functional analog, fragment and / or biosimilar thereof. Entrectinib and its signaling pathways are further described in Jiang et al. 2022 Biomedicine & Pharmacotherapy 150: 112974, the disclosures of which are incorporated herein by reference.

[0149] In some embodiments of the methods of the present invention, the cancer may be in a subject, e.g., a mammalian subj ect, e.g., a human subject, e.g., a patient. In some embodiments, the cancer may be an in vitro cell, an ex vivo cell, or an in vivo cell.

[0150] In some embodiments, the cancer may be NTRK1 functional (e g., NTRK1 "positive", e.g., NTRK1 wildtype and / or any wildtype-functional mutant thereof).

[0151] In some embodiments, the cancer may be resistant to the immune checkpoint inhibitor prior to the administering of the inhibitor of NTRK1.

[0152] Cancers relevant to the invention include, but are not limited to, any cancer capable of developing resistance to immunotherapy. For example, in some embodiments, the cancer may be, but is not limited to, lung cancer, breast cancer, melanoma, colon cancer, liver cancer, or kidney cancer.

[0153] In some embodiments, the cancer may be lung cancer, such as but not limited to nonsmall cell lung cancer (NSCLC).

[0154] In some embodiments, the cancer may have been, prior to the application of any one of the methods of the present invention, resistant to previously received immunotherapy treatment, e.g.. at least about 5% resistant (e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% resistant or any value or range therein) to previously received immunotherapy treatment, e.g., as compared (normalized) to the average response to the received immunotherapy by a corresponding patient population

[0155] In some embodiments, a method of the present invention may further comprise retrieving a sample of the subject (e.g., a biopsy, a blood sample, a mucus sample, a cheek swab, and the like).

[0156] In some embodiments, a method of the present invention may further comprise measuring NTRK1 gene expression and / or function and / or NTRK1 protein expression and / or function in the sample.

[0157] In some embodiments, contacting of a cell (e.g., a cancer cell, e.g., a cell within the tumor microenvironment) with the inhibitor of NTRK1 and / or a composition or combination comprising the same may inhibit NTRK1 expression and / or activity in the cell, e.g., inhibits NTRK1 activity in the cell by at least about 5% (e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%. 100% or any value or range therein) as compared to a control, for example, a cell not contacted with the inhibitor of NTRK1 and / or a composition or combination comprising the same.

[0158] In some embodiments, the administering of an effective amount of the inhibitor of NTRK1 may inhibit NTRK1 activity in the cancer (e.g., inhibits NTRK1 activity in a cancer cell, e.g., in one or more cancer cells of the cancer, and / or in a cell within the tumor microenvironment e.g., in one or more cells within the TME) by at least about 5% (e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or any value or range therein), as compared to a control, for example, a cancer (e.g.. one or more cancer cells of the cancer, e.g., one or more cells within the TME) in a human subject having the cancer and having not been administered the inhibitor of NTRK1.

[0159] The inhibitor of NTRK1 and / or the immune checkpoint inhibitor may be administered via any appropriate route, as would be within the knowledge of the skilled artisan, e.g.. an oncologist, as needed for the conditions of the particular subject and / or patient. In some embodiments, the inhibitor may be administered topically (e.g., direct application), intravenously, cutaneously, subcutaneously, intraperitoneally, intra-arterially, intratumorally, intrathecally, intramuscularly, orally (e.g., by oral tablet or capsule), intranasally, sublingually, via inhalation, in an implant, in a matrix, in a gel, or any combination thereof.

[0160] Also provided herein is a composition comprising an inhibitor of NTRK1 (e.g., including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (e.g., including but not limited to an inhibitor of CTLA-4, PD-L B7-1. B7-2, PD-L. and / or PD-L2).

[0161] Also provided herein is a combination comprising an inhibitor of NTRK1 (e.g., including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (e g., including but not limited to an inhibitor of CTLA-4. PD-1. B7-1, B7-2. PD-L, and / or PD-L2).

[0162] In some embodiments, a composition or combination of the present invention may be for use in any one of the methods of the present invention.

[0163] Polypeptides and fragments thereof of the invention can be modified for in vivo use by the addition, at the amino- and / or carboxyl-terminal ends, of a blocking agent to facilitate survival of the relevant polypeptide in vivo. This can be useful in those situations in which the polypeptide termini tend to be degraded by proteases prior to cellular uptake. Such blocking agents can include, without limitation, additional related or unrelated peptide sequences that can be attached to the amino and / or carboxyl terminal residues of the polypeptide to be administered. This can be done either chemically during the synthesis of the polypeptide or by recombinant DNA technology by any suitable methods. For example, one or more non-naturally occurring amino acids, such as D- alanine, can be added to the termini. Alternatively, blocking agents such as pyroglutamic acid or other molecules known in the art can be attached to the amino and / or carboxyl terminal residues, or the amino group at the amino terminus or carboxyl group at the carboxyl terminus can be replaced with a different moiety. Additionally, the polypeptide terminus can be modified, e.g., by acetylation of the N-terminus and / or amidation of the C-terminus. Likewise, the peptides can be covalently or noncovalently coupled to pharmaceutically acceptable "carrier" proteins prior to administration. These and other modifications to polypeptides contemplated to provide protease resistance, including but not limited to, backbone extension, side chain substitution, cyclization of the polypeptide, and / or conjugation to theN- and / or C-terminus and / or polypeptide side chain are further described in Lucana et al. 2021 Pharmaceutics 13:2065, incorporated herein by reference in its entirety.

[0164] Polypeptides and fragments thereof of the invention can also be modified to comprise (e.g., linked, conjugated, bound (e g., covalently bound, non-covalently bound), complexed, encapsulated, etc.) to and / or with one or more detectable moiety. Any suitable detectable moiety known in the art can be used in the practice of the present invention, and the detectable moiety can be detected using any method known in the art. For example, in some embodiments, the detectable moiety may be an exogenous epitope or chemical label that is attached to the polypeptide. Non-limiting examples of detectable moieties include an epitope, an enzyme, a ligand, a receptor, an antibody or antibody fragment and the like. In some embodiments, a detectable moiety of the invention may be a fluorescent moiety (e.g., GFP, EFP, RFP and the like), a peptide tag (e.g., FLAG, e.g., FLAG-tag), an antibody or fragment thereof, hemagglutinin antigen, polyHis, biotin, Protein A, streptavidin, maltose binding protein, c- myc, an enzyme such as glutathione-S-transferase, alkaline phosphatase, horseradish peroxidase. P-glucuronidase, [3-galactosidase or luciferase, a radioactive moiety and / or an electron-dense moiety such as a ferritin or gold particle(s).

[0165] The detectable moiety can be detected either directly or indirectly using any suitable method. For example, for direct detection, the tag or reagent can comprise a radioisotope (e.g,35S) and the presence of the radioisotope detected by autoradiography. As another example, the tag or reagent can comprise a fluorescent moiety and be detected by fluorescence as is known in the art. Alternatively, the tag or reagent comprising the detectable moiety can be indirectly detected, i. e. , the detectable moiety requires additional reagents to render it detectable. Illustrative methods of indirect labeling include those utilizing chemiluminescence agents, chromogenic agents, enzymes that produce visible reaction products, and ligands (e.g., haptens, antibodies or antigens) that may be detected by binding to labeled specific binding partners (e g. , hapten binding to a labeled antibody or a first antibody binding to a second antibody).

[0166] In some embodiments, the detectable moiety may be an antibody or antibody fragment. A variety of protocols for detecting the presence of and / or measuring the amount of antibodies or other polypeptides are known in the art. Examples of such protocols include, but are not limited to, enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), radioreceptor assay (RRA), competitive binding assays and immunofluorescence microscopy. These and other assays are described, among other places, in Hampton et al. (Serological Methods, a Laboratory Manual, APS Press, St Paul, Minn (1990)) and Maddox et al. (J. Exp. Med. 158: 1211-1216 (1993)).

[0167] In some embodiments, a composition or combination of the present invention may further comprise a pharmaceutically acceptable carrier (e.g., a pharmaceutical formulation). By "pharmaceutically acceptable" it is meant a material that is not toxic or otherwise undesirable, z.e., the material may be administered to a subject without causing any undesirable biological effects.

[0168] In some embodiments, the present invention provides a pharmaceutical composition comprising a composition or combination of the present invention in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier will be respirable, and will preferably be in solid or liquid particulate form.

[0169] Another aspect of the present invention relates to a kit comprising the composition or combination of the present invention and useful for carrying out the methods of the invention. The kit may further comprise additional reagents for carry out the methods (e.g., buffers, containers, additional therapeutic agents) as well as instructions for use. For example, in some embodiments, a kit of the present invention may comprise an inhibitor of NTRK1 (e.g., including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (e.g., including but not limited to an inhibitor of CTLA-4, PD-1 , B7-1 , B7-2, PD-L, and / or PD-L2), and optionally instructions for use.

[0170] Another aspect of the present invention provides for use of a composition or combination of the present invention in reducing resistance to immunotherapy in a cancer cell, reducing oncogenic activity of a cancer cell, inhibiting NTRK1 activity in a cell, treating cancer, increasing sensitivity of a cancer cell to immunotherapy such as immune checkpoint therapy, and / or increasing efficacy of immunotherapy in treating cancer.

[0171] Another aspect of the invention provides for preparation of a medicament for use comprising the composition or combination of the present invention.

[0172] The invention will now be described with reference to the following examples. It should be appreciated that these examples are not intended to limit the scope of the claims to the invention but are rather intended to be exemplary' of certain embodiments. Any variations in the exemplified methods that occur to the skilled artisan are intended to fall within the scope of the invention.

[0173] EXAMPLES

[0174] Example 1: Enhancing ICI efficacy by targeting NTRK signaling in NSCLC patients.

[0175] Introduction: The FDA’s approval of immune checkpoint inhibitors (ICI) in 2015 drastically changed the survival of late-stage non-small cell lung cancer (NSCLC) patients. However, only about 30% of NSCLC patients respond to treatment, while the other 70% are immune resistant. Through an analysis of 424 NSCLC patients, we have identified a loss-of- function mutation in Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) as a biomarker for response to ICI. We hypothesize that by treating wild-type immune-resistant tumors with Entrectinib, we can mimic the effect of the mutation in NTRK1 and induce immune responses. Methods: To identify biomarkers, we collected genomic sequencing data and comprehensive clinical characteristics on 424 NSCLC patients who received ICI or chemo-ICI treatment. To determine the role of NTRK1 in vivo, we implanted LL / 2-scramble (wild-type NTRK1) or LL / 2-shNTRKl, which diminished NTRK1, into C57 / B6 mice. The animals were injected with either IgG or Anti-PDl. To determine if we could mimic the effect of a mutation in NTRK1. C57 / B6 mice were inoculated with LL2-wildtype NTRK1 and treated with either a) IgG. b) Entrectinib. c) Anti-PD-1, or d) Anti-PD-1 + Entrectinib. All in vivo experiments had tumor growth monitored, and a flow cytometry panel was performed at the endpoint to understand the immune responses. Bulk RNA-Sequencing was performed on cell cultures and tumors.

[0176] Results: Mice given the LL / 2-shNTRKl responded to Anti-PD-1 treatment and had a significant increase in CD4+ stem-like effector T cells in the spleen and tumor-draining lymph nodes. Animals that were inoculated with the LL / 2 cell lines and treated with Anti-PD-1 + Entrectinib also responded. Mice treated with Anti-PD-1 + Entrectinib were found to have a significant increase in CD4+ stem-like effector T cells as well. RNA-Sequencing revealed that in the mutant cell line LL / 2-shNTRKl and LL / 2 tumors treated with Anti-PD-1 + Entrectinib. there was a significant upregulation of C3 production. Our studies demonstrate that the loss of NTRK1 function, through either genetic ablation or enzymatic.

[0177] Further description: A total of 424 stage III & stage IV. EGFR negative, Non-Small Cell Lung Cancer (NSCLC) patients that received immune checkpoint inhibitors (ICIs) as first- line treatment were identified (Table 1). Sequencing were performed prior to treatment. Patients sequencing was combined to look at the 73 genes that overlapped between the two- sequencing platform (Table 1). The top 5 mutated genes in patients who received at least one dose or cycle of ICI are listed (FIG. 1 panel A). To identify mutations associated with patients’ overall survival (OS), we performed univariate Cox proportional hazard analyses by comparing OS between patients with a specific mutate gene and wild-type patient. We found that MAP2K1 was detrimental to survival on immunotherapy while NTRK1 was beneficial to survival (FIG. 1 panel B). There were 4 patients that had & MAP2K1 mutation with a median OS of 4.985 months compared to wildtype patients that had a median OS of 16.17 months (FIG. 1 panel C). 26 patients with NTRK1 mutation had a median OS of 24.67 months compared to wildtype patients that had a median OS of 15.57 months (FIG. 1 panel D). We further validated that aNTRKl mutation significantly increases OS compared to wildtype NSCLC tumors (FIG. 4). A somatic mutation interaction analysis for mutation was performed but did not reveal a significant interaction between the two mutations of interest and the top 5 mutations found in this cohort (FIG. 1 panel E) NTRK1 mutation significantly increased survival on immunotherapy suggests NTRK1 in tumor might play a role in immune response. To understand why this occurred, first we decide to study the mutations in our patients. A lollipop plot of NTRK1 mapped on gene structures showed majority of mutations occurred outside of the primary domains of the gene (FIG. 1 panel F). The gene NTRK1 encode tyrosine kinase receptors TrkA and activation of this receptor by nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) further triggers downstream pathways, including PI3K and MAPK signaling. Notably, studies have shown that PI3K and MAPK activation are associated with a decreased ICI response12Interestingly, mutation of NTRK1 has been reported to lead to loss of function of NTRK11. Also, we found that NI RK1 signature genes are enriched in NSCLC patients with wild-type NTRK1 compared to NTRK1 mutated patients suggesting NTRK1 mutation led to loss of function too. Therefore, we believe that loss of function of NTRK1 caused by NTRK1 mutation regulates immune response to ICI treatment and inhibition of NTRK1 pathway might lead to better response of ICT treatment. We decided to investigate the role of NTRK1 in ICI therapy as more than 5% of the cohort having this mutation and might benefit from NTRK1 inhibitors which are already available clinically.

[0178] To further validate that loss of function of NTRK 1 promotes ICI response in vivo, we generated NTRK1 knockdown LL / 2 and CMT cell line using shRNA. The knockdown efficiency has been confirmed by Western Blot (FIG. 2 panels A & B). LL / 2 and CMT is an ICI non-responsi e murine cell line with wide-type NTRK 1 . W e inoculated LL / 2 or CMT with or without knockdown of NTRK 1 into the flank of C57 / B6 mice followed by either TgG or Anti-PD-1 treatment. In both respective models, we observed that tumor growth was significantly decreased in mice that w ere inj ected with the shNTRKl and treated with Anti- PD-1 treatment (FIG. 2 panels C & D). Given the important of the adaptative immunity’ in fighting cancer, we sought to assess the profiles of T cells in the spleens and draining lymph nodes of each group. CD3+ CD4+ CD44hlCD62L10(CD4 Effector T cells) population w ere found to be significantly increased in both models in mice bearing the shNTRKl tumors with Anti-PD-1 treatment except for in the spleen in CMT-shNTRKl (FIG. 2 panels E & F). Further analysis of CD4+ Effector T cells subtypes showed that there was an increase of stemcell like Effector T cells (TCF-lhlToxloCD44hlCD62LloCD4+CD3+) in the shNTRKl / Anti-PD- 1 group compared to other groups. (FIG. 2 panels G & H). These cells are characterized by self-renewal and are response for durable antitumor response with immune checkpoint inhibitors. In addition to stem-cell like CD4+ Effector T cells, there was also an increase of CD8+ Effector T cells (CD3+CD8+CD44hiCD62L10) population in shNTRKl / Anti-PD-1 recipients (FIG. 2 panels H & I). Having an increased amount of effector CD8+ and CD4+ T cells shows that the immune system is actively fighting the tumor cells in the body. Finding that these CD4+ Effector T cells are stem-cell like shows that these cells are not exhausted and are actively preventing other cells from experiencing exhaustion. Together, these findings indicate that suppressing NTRK1 expression in tumor cells enhances ICI treatment response by increasing stem-cell like CD4+ Effector T cells and CD8+ Effector T cells.

[0179] As loss of function of NTRK1 is beneficial to NSCLS patients receiving ICI treatment, we next investigated if inhibition of NTRK1 will enhance ICI efficacy in NTRK1 -wildtype patients. We used the drug Entrectinib to mimic the mutation of NTRK1 in wild type NTRK1 tumors. Entrectinib was approved for treating patients with NTRKl-vene fusion. NTRKl-gene fusion is the over activation of NTRK1 and NTRK1 expression. Treating Entrectinib on wildtype tumors might lead to deceased activity of NTRK1 and thus benefit ICI treatment. Therefore, we decided to combine Entrectinib with Anti-PD-1 treatment. Mice were given either IgG + Sham, Entrectinib only, Anti-PD-1 only, or Entrectinib + Anti-PD-1. Mice that were injected with either LL / 2 or CMT and treated with Entrectinib + Anti-PD-1 had a significantly lower tumor volume compared to other groups (FIG. 3 panels A & B). We found that there was a significant increase of CD4+ Effector T cells, stem-cell like CD4 Effector T cells, and CD8 Effector T cells in the Entrectinib + Anti-PD-1 group (FIG. 3 panels C & D). IHC of tumors showed a higher amount of infiltrating CD4+ and CD8+ T cells in Entrectinib + Anti-PD-1 treatment groups (FIG. 5 panels A & B). These findings further suggest that NTRK1 in tumors cells is a key factor in tumor immune response and inhibiting NTRK1 activity' enhance ICI treatment in vivo. Therefore, combination of NTRK1 inhibitors and ICI treatment could potentially benefit NTRK wildtype NSCLC patients.

[0180] Table 1. Characteristics of NSCLC patients with or without NTRK1 mutation.

[0181] Example 2. NTRK1 mutation is beneficial while on immunotherapies.

[0182] Analyses were performed determining the tumor burden (TMB) status between the patient cohort as described in Example 1, when receiving immune checkpoint therapy (ICI) (FIG. 6, left panel) as compared to patients receiving ICI and chemotherapy (FIG. 6, right panel). No significant difference in TMB status was found.

[0183] Mutation analysis was performed, wherein 424 patients who received ICI- chemotherapy or ICI treatment alone who had sequencing data available were chosen. Cox proportional hazard scores were identified on 77 genes that overlapped, and genes were identified that separated into protective or harmful categories. 'Harmful' genes received (-1) score and 'protective' genes received (+1) score to create gene score, and a gene composite score was evaluated for its ability to predict overall survival. Mutation in the NTRK1 gene was identified as beneficial while on immunotherapy, as shown in FIG. 7. Stratifying patients by wildtype or mutant NTRK1 showed longer overall survival on ICI in the presence of mutated NTRK1, as shown in FIG. 8. NTRK1 encodes for TRK A receptors that result in activation of signal transduction pathways at diagramed in FIG. 9. NTRK mutation was found to cause a loss of function, as shown in FIG. 10.

[0184] Exome sequence of the below syngeneic cell lines was performed (Table 2). For mouse experiments, B6 mice received injections of cancer cells at day 0, followed by anti-PD-1 treatment or control IgG treatment at days 7, 11, and 15. Results from experiments are shown in FIGS. 11-13, indicating that LL / 2 and CMT tumor bearing mice do not respond to ICI treatment. When LL / 2 cells were treated with shNTRKl to knockdown NTRK1 and injected into mice, LL / 2-shNTRKl tumors did respond to anti-PD-1 treatment (FIG. 14).

[0185] Table 2: Cell lines.

[0186] Mice received anti-PD-1 treatment had increased CD4+ T cells in the spleen and lymph nodes (FIG. 15). as well as specifically increased stem-like CD4+ T cells (FIG. 16). Stem cell like CD4+ T cells are characterized by self-renewal, expansion, and persistence, and express the transcription TCF-1+. Compared with terminally exhausted T cells, stem cell-like T cells are responsible for the durable antitumor responses conferred by T cell therapy and immune checkpoint blockade (ICB).

[0187] Without wishing to be bound to theory, NTRK gene fusion appears to be rare in NSCLC, occurring in 0.2%-3% of cases of lung cancer, 1% of colon cancer, 1% of sarcomas, 1% of glioblastomas, 0.5% of head and neck squamous cell carcinomas, 2%-12% of thyroid cancers, 10% of high-grade pediatric gliomas, and 91%-100% infantile fibrosarcomas, according to a summary of data provided by SeraCare at blog.seracare.com / ngs / anti- tropomyosin-receptor-tyrosine-kinase-therapies-and-ntrk-fusion-testing-a-new-paradigm-for- identifying-and-managing-a-class-of-rare-pediatric-and-adult-cancer-patients, incorporated herein by reference. Efficacy of entrectinib against a TRKA-driven colorectal carcinoma tumor (KM12) has previously been shown in Ardini et al. 2016 Molecular Cancer Therapeutics 15(4):628-639, incorporated herein by reference. NTRK may experience fusion and / or mutation, wherein fusion forms through intra- and inter-chromosomal rearrangements and leads to activation of MAPK, PIK, and STAT3 signaling pathways, and occurs in about 0. 17% of NSCLC patients. Mutation, on the other hand, leads to loss of function resulting in sensory and autonomic neuronal disorders, loss of appetite control and energy imbalances.

[0188] To test entrectinib treatment, B6 mice were given either entrectinib only, anti-PD-1 only, entrectinib and PD-1, or control. All groups were injected with cancer cell lines at day 0, and treated with their designated either anti-PD-1 or IgG control at days 7, 10 and 14. Entrectinib or sham treatment was given at days 7, 8. 9, and 10 and again on days 14, 15. 16 and 17. Mice receiving entrectinib along with PD-1 treatment had a significantly lower tumor volume (CMT cell line, FIG. 17 left; LL2 cell line, FIG. 17 right). Increased CD8+ effector cells were found in the co-treatment group in the spleen and lymph nodes (FIG. 18), and those CD8+ cells present also showed enhanced proliferation (FIG. 19). Increased CD4+ T cells in general as well as in particular stem-like CD4+ T cells were also found (FIGs. 20 and 21). Example 3: Enhancing Immune Checkpoint Inhibitor Efficacy by Targeting Neurotrophic Tyrosine Kinase Receptor 1 (NTRK1) in NTRK1 Wild-type NSCLC.

[0189] Lung cancer remains the leading cause of cancer deaths despite improvements in treatments (1). Non-small cell lung cancer (NSCLC) accounts for 85% of cases diagnosed in the United States (2). Regardless of the efforts on detecting lung cancer earlier, most patients are diagnosed with stage III or IV tumors upon their first assessment (3). For late-stage NSCLC, chemotherapy, concurrent targeted therapy, radiation therapy, and immunotherapies are firstline treatment approaches (4). Immune Checkpoint Inhibitors (ICI) were approved by the FDA in 2015 for treating patients with late-stage NSCLC, revolutionizing thoracic oncology treatments (5). Unfortunately, only a subset of patients respond to ICI, multiple mechanisms are involved in the resistance to ICI including suppression of anti -tumor functions of T cells directly through immune-suppressive ligands and factors or indirectly through recruitment of immune suppressive cells (6). In clinical practice, patients with positive programmed death ligrand-1 (PD-L1) expression or high tumor mutational burden (TMB) were considered to be more likely to benefit from ICI (7,8). However, several studies found that PD-L1 was not a reliable predictive marker due to the limitation of tissue sampling and detection methods (9). Early studies found that in patients with greater than or equal to 10 mutations per Mb, there is a superior response to ICI treatment (10). However, Wu et al found that age is a critical variable in predicting ICI response by using TMB status, and TMB failed to correlate with patients’ response in older patients (11).

[0190] In this study, we identified that mutation of neurotrophic receptor tyrosine kinase 1 (NTRK1) gene was correlated with a prolonged OS in ICI treated NSCLC patients. NTRK1 encodes tropomyosin receptor kinase A (TrkA). a transmembrane tyrosine kinase that plays a crucial role in neural development and tumor progression though activation of MAPK, PI3K and PKC pathways (17, 18). Gene fusion and mutation are the main categories of NTRK1 genetic alterations (18). NTRK1 gene fusion causes constitutive activation of TrKA signaling and is frequently observed in several types of rare cancers, including soft tissue sarcoma and thyroid cancer (19). Larotrectinib and Entrectinib are two FDA approved Trk inhibitors which showed superior anti-tumor efficacy in treating NTRK1 fusion tumors (20). However, NTRK1 fusion is extremely rare (0.25%) in NSCLC patients, which limits its usage in clinic (21). Notably, NTRK1 point mutations lead to loss of its tyrosine kinase function and impairs the activation of downstream pathways, suggesting that treating NTRK1 wild-type patients with Larotrectinib or Entrectinib may mimic mutation caused loss of function (22).

[0191] Materials and Methods Data Acquisition

[0192] Patients with primary Non-Small Cell Lung Cancer (NSCLC) diagnosis and had genomic profiling performed were retrospectively evaluated for this study. Written informed consent was obtained prior to sample collection. All samples were collected from newly diagnosed patients and patients that received more than one treatment were excluded. Sociodemographic, clinical characteristics, and outcomes were determined via electronic medical records. PD-L1 expression was determined by immunohistochemistry (IHC) performed on formalin-fixed paraffin-embedded (FFPE) or frozen tissue sections. PD-L1 expression was determined as negative (<1%), or positive (>1%) of total positively stained tumor cells. Data of Tumor Mutational Burden (TMB) were provided. Patients with a 10 or less mutation were considered TMB-low while those with 10 or more mutation were considered TMB-high. The PFS is calculated based on RECIST 1.1.

[0193] Genomic Profiling

[0194] Genomic profiling was conducted using next-generation sequencing of circulating tumor DNA (Guardant360 CDx, Guardant Health, Redwood City, CA) and tumor tissue (FoundationOne CDx. Foundation Medicine. Cambridge, MA). All molecular testing were performed in CLIA compliant labs.

[0195] Human Samples

[0196] Formalin-fixed paraffin-embedded (FFPE) tumors tissues from lung cancer patients were retrieved from the tumor tissue bank in accordance with ethical guidelines. All samples were collected under the IRB (Institute Review Board) approved protocol.

[0197] Cell Culture and Reagents

[0198] Murine Lung Cancer cells lines LL / 2 and CMT167 were purchased from American Typer Culture Collection (ATCC) and Sigma respectively. All cell lines were cultured in RPMI medium supplemented with 10% FBS, streptomycin (lOOmg / ml) and penicillin (lOOunits / ml). All cells were grown at 37 °C in a 5% CO2 atmosphere. Cells were tested negative for Mycoplasma by PCR (ATCC, 30-1012k, lot 70008746), and they were used between passages 20 and 50. LY294002, PD98059 and Entrectinib were purchased from SelleckChem (Houston, TX). Anti-mouse PD-1 (clone RMP1-14). isotype antibody (Rat IgG2b) and Anti-mouse CD8 (Clone 53-6.7) were obtained from BioXCell (West Lebanon, NH, USA).

[0199] Cell proliferation assay

[0200] 3xl04tumor cells w-ere seeded into a 96-well plate and the growth of cells were measured by IncuCyte (Sartorius) up to 72hr.

[0201] Generation of NTRK1 knockdown cell lines Four shRNA targeting mouse NTRK1 were purchased from Horizon with the sequences indicated below. Lentivirus was made and LL / 2 and CMT167 were infected with #2 and #4 shRNA to achieve the maximum knockdown efficiency followed by puromycin selection. #1 :5’ TAGTTCCCGTTGTTGACATGC3’ (SEQ ID NO: 1), #2:5’ ATGAAACTGGTCTCGTTGAGC3’ (SEQ ID NO:2), #3: 5’ ATCACTGGTGACATTGACCAG3' (SEQ ID N0:3) and #4: 5' ATCCTCTGGAGCTAATACAGC3’ (SEQ ID N0:4).

[0202] Immunohistochemistry

[0203] Human Lung Cancer de-identified samples were obtained from the tumor tissue bank. Samples were obtained with 10pm thickness from the formaldehyde-fixed and paraffin- embedded tissue specimens. The sections were deparaffinized, and antigens were retrieved by heating the slides in lOrnM sodium citrate (pH 6.0) at 85 °C for 30 minutes. The slides were cooled down and treated with 3% H2O2 for 10 minutes. Slides were washed three times and blocked by 5%BSA for Ihr at room temperature. After blocking, slides were washed three times by PBS and incubated overnight at 40with Complement C3 polyclonal antibody (1:500, Thermo-Fisher #PA4-21349). The slides were then incubated with secondary Anti-Rabbit HRP antibodies (Cell Signaling Technologies, cat#7074P2) and visualized using the Envision-plus kit (Agilent Dako, Santa Clara, CA, USA). Staining intensity was quantified by IHC profiler plugin of Fiji ImageJ. Five randomized fields were analyzed for each slides. (28) Immunocytochemistry

[0204] For frozen section staining, slides were fixed with 70% ethanol followed by PBS wash and blocked with 5% BSA for Ihr at room temperature. After blocking, slides were washed three times with PBS and incubated with antibodies for, Alexa Fluor 594 anti-CD4 (1:500, Biolegend, cat# 100446), Alexa Fluro 488 anti-CD8 (1 : 100; BD Pharmingen, cat# 557696), Alexa Fluro 488 anti-F4 / 80 (1 :200, Biolegend, cat#157310), and Alexa Fluro 594 anti-MHCII antibodies (1 :200, Biolegend, cat#l 16407), Ihr at room temperature followed by wash with PBS for three times. Anti-neutrophil elastase antibody (1 :200, Abeam #ab68672) and anti- CD19 antibody (1 :200, Invitrogen #PA5-27442) were used followed by anti-rabbit IgG AlexaFluor 555 (1:500, cell signaling technology #4413S). Slides were preserved by ProLong Gold antifade reagent with DAPI (Thermo, cat#P36931) Fluorescence images were taken by a fluorescent microscope (Olympus 1X83).

[0205] Western Blot

[0206] Cells were lysed with Laemmli sample buffer (Bio-Rad) followed by SDS-PAGE separation. Proteins were transferred onto nitrocellulose membranes followed by blocking with 5% skim milk. Blocked membrane were incubated with antibodies against NTRK1 (1:300; Cell Signaling Technology), C3 (1: 1000; ThermoFisher) and GAPDH (1:5,000; Cell Signaling Technology). The bound antibodies were detected using an enhanced chemiluminescence detection kit (GE Healthcare Lifescience).The proteins were visualized on X-Ray film developed by SRX-101A film processor.

[0207] Quantitative real-time PCR

[0208] Total RNA was extracted from the cells by Direct-zol RNA microprep kits (Zymo) and reverse transcribed by iScript™ Reverse Transcription kit (Bio-Rad). The cDNA was then amplified with a pair of forw ard and reverse primers. Three replication were analyzed for each experiments. PCR reactions were performed using CFX Connect (Bio-Rad) and iTaq Universal SYBR Green Supermix (Bio-Rad) following manufacture’s direction. ). The thermal cycling conditions composed of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of PCR using the following profile: 94°C, 30 s; 60°C, 30 s; and 72°C, 30 s.

[0209] Mice

[0210] C57BL / 6 mice experiments were done in accordance with appropriate IACUC protocols. Both male and female mice were used. For flank injections, 3 x 105cells mixed with 50% of growth factor reduced Matrigel (Coming) were injected into each flank of C57BL / 6 mice (6 weeks old). Mice were randomized and treated with either, IgG, Anti-PD-1, Entrectinib, or Entrectinib + Anti-PD-1. For Anti-PD-1 treatment experiments, 150ug anti-PD- 1 were given by intraperitoneally (i.p.) every 4 days starting on day 7 after tumor inoculation.

[0211] For IgG treatment, 150ug IgG in 1 OOuL of PBS were injected i.p. every 4 days starting on day 7 after tumor inoculation. For Entrectinib treatment, 30mg / kg of Entrectinib w as given through oral gavage for 4 days on 3 day off. Preparation of Entrectinib treatment was described as previously (29). For Entrectinib + Anti-PD-1 treatment, 150ug of anti-PD-1 were injected i.p. every 4 days with Entrectinib of 30mg / kg given through oral gavage for 4 days on 3 days off on day 7 after tumor inoculation.

[0212] For anti-CD8a depletion (InVivoMAb BE0004-1, Clone 53-6.7), 200ug of anti-CD8a was diluted with PBS for a total injection volume of 200uL. Depletion began before tumor implantation with mice receiving i.p. injections every day for 3 days, with last dose given 1 day before tumor implantation and maintenance doses given every 6 days after (30). Control treatments consisted of 200uL of PBS. Depletion of CD8+ cells were validated by flow cytometry of blood samples before tumor implantation. Tumors were measured every 3-4 days by researchers who were blinded to the cage information using external caliper. Tumor volume was calculated by ’A (Length x Width2)(31) . 5-10 replicants were examined for each group. Intracellular cytokine staining and flow cytometry

[0213] Spleens and draining lymph nodes were harvested from experimental animals and processed into a single-cell suspension by mashing on a cell culture plate in RPMI 1640 + 10% Fetal Bovine Serum (FBS) with a 5mL syringe plunger and then filtered by 70um nylon cell strainer (Thermo-Fisher). Red blood cells (RBs) were lysed using deionized water and 10% PBS was added to stop lysis reaction. For each stain, 3 x 106 cells were incubated for 5 hours at 37 °C and 5% CO2 in the presence of GolgiPlug (BD 555029) and GolgiStop (BD 554724) for intracellular cytokine staining. Upon harvest, cells were first stained with viability dye Zombie Red (Biolegend). Cells were then surface stained with antibodies against CD3 (17A2 1:80, Biolegend), CD4 (RM4-5 1 : 100, BD), CD8 (53-6.7, 1 : 100, Thermo), PD-1 (J43, 1 :80, Thermo). CD62-L (MEL- 14, 1: 100. Thermo). CD44 (IM7, 1: 100, Thermo) for 30 minutes on ice. Samples were washed with Fluorescence-activated cell sorter (FACS) buffer (PBS with 2% FBS) and fixed by adding fixation / permeabilization solution (Biolegend) for 60 minutes. Cells were then washed with permeabilization buffer (Biolegend) and then incubated with permeabilization buffer + normal mouse serum (25-5544-95, 1 :50, eBioscience) for 15 minutes, followed by addition of antibodies against IFNy (XMG1.2. 1:80. Thermo), TNFa (MP6-XT22, 1 :80, BD), Granzyme-B (NGZB, 1 : 100, Thermo), T-Bet (eBio4B10, 1 :20, Thermo), TCF-1 (S33-966, 1 :20, BD), TIM-3 (RMT3-23, 1 :20, Thermo), Tox (REA473, 1 :80, Miltenyi-biotec), Ki-67 (SolA15, 1:80, Thermo), and IL-2 (JES6-5H4, 1 : 100, BD). Cells were incubated 30 minutes at room temperature in the dark. Cells were washed twice with permeabilization buffer and fixed by adding 2%PFA in PBS and then acquired on an LSR Fortessa X-20 (BD Biosciences). Data were analyzed using FlowJo analytical software (FlowJo, LLC).

[0214] RNA-Sequencing and data analysis

[0215] RNAs were extracted from cancer cells or tumors using RNAeasy Micro Kit (Qiagen, Germantown, USA Cat #74004). RNA sequencing was performed by LC Science. Briefly, RNA sequencing library was prepared following Illumina’s TruSeq-stranded-mRNA sample preparation protocol. Quality control analysis and quantification of the sequencing library were performed using Agilent Technologies 2100 Bioanalyzer High Sensitivity DNA Chip. Paired ended sequencing was performed on Illumina’s NovaSeq 6000 sequencing system. Bioinformatics

[0216] Differential gene expression was analyzed using R package DESeq2. For tumor samples, genes with p<0.01 was employed for Qiagen Ingenuity Pathway Analysis (IP A). For cancer cells, top 100 differentially expressed gene based on p value was employed for IPA. Diseases or Functions result of IPA core analysis was plotted by R package gglot2. Volcano plot was generated by R package EnhancedVolcano (32). Deconvolution of RNAseq data was performed by R package immunedeconv. (33-35) TIMER2.0 (timer, compgenomics. org / timer / ) was used to analyze the immune infiltrates in cancer types (36). GSEA was performed with TCGALUAD and TCGA-LUSC cohort with permutation of 1000. The KEGG neurotrophins signaling pathway was obtained through MSigDB (37). Rocplot was used to analyze gene expression in responder and non-responder of ICI treated patients in different tumor types (38). OS and PFS of ICI treated patients with C3 low or high expression was generated by KM-Plot with the KM-Plot for immunotherapy feather (39).

[0217] Statistical Analysis

[0218] To perform OS analysis, we applied Cox proportional hazard regression models with the time between the treatment start date and the date of death. For PFS analysis, we calculated the time between the treatment start date and the day of progression. Hazard ratios and corresponding 95% confidence intervals were estimated from these proportional hazard regression models. All analyses were calculated by GraphPad Prism if not specified. Data are presented as mean + sd. Multivariate analyses were calculated by R glmnet package (40). The Maftools package analyzed the mutation patterns and visualized the results in R 4.1.3 (41). The p-value is calculated by Student’s t-test if not specified. A p-value less than 0.05 was used in all analyses to determine significance with significance symbolized as *p < 0.05, **p < 0.01, ***p < 0.001.

[0219] Results

[0220] NTRK1 mutation is associated with a prolonged OS in NSCLC patients treated with ICI. We previously collected clinicogenomics data of 713 NSCLC patients who received next generation sequencing (NGS) either using DNA from tumor biopsy (Foundation Medicine) or circulating tumor DNA (Guardant Health) (16). We further identified 424 first line immunotherapy treated patients who were diagnosed with primary lung cancer. Patients’ clinical characteristics and treatment regimens were listed in Table 1 and Table 3.

[0221] Table 3. Patient treatment regimens.

[0222] To examine whether any clinical factors were correlated with patients' OS, we performed Multivariant Cox Regression analyses and found that none of these characteristics were significantly associated with patients’ OS (FIG. 22). Next, we performed univariate Cox proportional hazard analyses by comparing OS between patients cartying a specific mutation and corresponding wild-type patients. We identified two genes (MAP2K1 and NTRK / ) whose mutations were correlated with the ICI response (FIG. IB). Patients with NTRK1 mutant tumors had a prolonged OS while MAP2K1 mutant patients had a worse OS (FIG. 1C). Due to the low mutation rate of MAP2K1 (0.9%), we decided to focus on NTRK1 gene. The median OS of NTRK1 mutant patients was 24.67 months compared to 15.57 months in wild-ty pe patients (FIGs. 23 and 24). NTRK1 mutations were not associated with abetter OS in in patients who received chemotherapy, concurrent chemoradiation, radiation, or tyrosine kinase inhibitor (TKI), suggesting that NTRK1 may play a critical role in regulating immune response upon ICI treatment (FIGs. 23 and 24). In contrast to other tyrosine kinase receptors, mutations of NTRK families (NTRK1 / 2 / 3) usually lead to loss of function (42). Indeed, GSEA result confirmed attenuated NTRK signaling in TCGA NSCLC patients with mutant NTRK genes (FIG. 10). As shown in FIG. 25, most of the NTRK mutations belong to missense mutation and 9 out of 26 patients carries G18E mutation at the signaling peptide region of NTRK1. However, validation in another cohort is required to confirm whether G18E is a "hotspot" mutation. Our clinicogenomics based analyses revealed that mutant NTRK1 was specifically associated with a better response to ICI.

[0223] Knockdown of NTRK1 promotes ICI efficacy by enhancing T cells mediated immune response. To further validate that loss of function of NTRK1 promotes ICI response in vivo, we generated NTRK1 knockdown (KD) cell lines using LL / 2 and CMT167, two syngeneic lung cancer cells that do not respond to ICI (43). Exome sequencing also showed that both cell lines express wildtype NTRK1. Previous study had showed that NTRK1 promotes tumor growth through modulating YAP signaling and we found that KD of NTRK1 significantly reduced the proliferation of LL / 2 cells but not in CMT167 cells (44). We inoculated LL / 2 or CMT167 cells with or without KD of NTRK 1 into the flank of C57 / B6 mice followed by either IgG or Anti- PD-1 treatment one week after the inoculation. In both models, tumor suppression effects were only observed in anti-PD-1 treated mice that were injected with shNTRKl cells (FIG. 26 panel A). Enriched CD4+ and CD8+ T cells were found in tumors derived from anti-PD-1 treated mice inoculated with LL / 2 and CMT167 shNTRKl cells compared to other groups (Fig. 26 panel B). To further characterize the T cells, we performed FACS analyses that are able to detect 10 subgroups of T cells using a 15-color antibody panel.

[0224] We identified three groups of T cells that showed significant differences upon anti-PD- 1 treatment and KD of NTRK1, including CD4+ effector T cells (CD3+CD4+CD44hiCD62Llo), CD4+ stem like T cells (TCF- lhiToxl°CD44hiCD62Ll°CD4+CD3+) and CD8+ effector T cells (CD3+CD8+CD44hiCD62Llo). As shown in FIG. 27, top panel, CD4+ Effector T cells were found to be significantly increased in TDLNs from anti-PD-1 treated mice injected with the NTRK1 KD LL / 2 and CMT167 tumors. Increased amounts of CD4+ effector T cells in the spleen were only observed in LL / 2 groups but not in CMT167 groups. Further analysis of CD4+ T cells subtypes showed that there was an increase of stem like CD4+ T cells in the shNTRKl / Anti-PD-1 group compared to other groups. (FIG. 27, bottom panel). These T cells have the self-renewal abilities and are responsible for durable antitumor response upon ICI treatment by enhancing the activities of CD8+ Effector T cells (45-47). Indeed, increased amounts of CD8+ Effector T cells were found in the TDLNs from anti-PD-1 treated mice injected with NTRK1 KD cells (FIG. 28). In addition, we also examined pre-exhausted T cells (TCFl -T-bet+ CD44+CD4+) and TH1 (IFNG+TNFA+CD44+CD4+) populations in TDLNs and found that pre-exhausted T cells were highly enriched in NTRK1 KD LL / 2 and CMT167 cells treated with anti-PD-1 (FIG. 29, left), while TH1 cells were enriched only in the TDLNs of anti-PD-1 treated LL / 2-shNTRKl group (FIG. 29, right).

[0225] To examine whether CD8+ T cells are required for anti-PD-1 mediated tumor killing in NTRK1 KD groups, we depleted CD8 T cells by anti-CD8 antibodies followed by testing ICI efficacy in LL / 2-shNTRKl and CMT167 / shNTRKl cells inoculated mice. Successful depletion of CD8+ T cells in circulation before tumor inoculation was confirmed by FACS analyses. Depletion of CD8+ T cells completely abolished the anti-tumor effect of anti-PD-1 in both LL / 2-shNTRKl and CMT167-shNTRKl models. Our pre-clinical and FACS analyses results strongly suggest that KD of NTRK1 significantly enhanced the anti-PD-1 efficacy with an increased T cell infiltration and the deposition of effectors T cells as well as stem-like CD4+ T cells. Entrectinib enhances ICI response in NTRK1 wild-type tumors. The mutation rate of NTRK1 in NSCLC patients is around 6-7%, suggesting that majority of patients can benefit from therapies that target NTRK1 pathway. Therefore, we investigated whether targeting NTRK1 signaling will enhance ICI efficacy in NTRK1 -wildtype tumors. Entrectinib is an FDA approved NTRK1 inhibitor and was used to mimic NTRK1 loss of function (20). Notably, treatment of Entrectinib did not affect tumor cell proliferation in vitro (FIG. 30). We first tested whether combination of Entrectinib with Anti-PD-1 will synergistically suppress tumor growth in vivo. As shown in FIG. 31 panel A, mice that were treated with Entrectinib and anti-PD-1 had a significantly lower tumor volume compared to mice that received monotherapy. Increased amounts of tumor infiltrating CD4+ and CD8+ T cells were also observed in the combination groups (FIG. 31 panel B). FACS analyses showed that mice treated with Entrectinib + anti-PD-1 had significantly higher effector CD4+ T cell in the spleen and TDLNs (FIG. 31 panel C). Consistent with our previous observation that mice inoculated with NTRK1 KD cell lines had higher levels of stem-like CD4+ T cells upon anti-PD-1 treatment, such T cell populations were also found highly enriched in the spleens and TDLNs of mice receiving the combination treatment (FIG. 31 panel D). Again, we found a significantly higher amount of CD8+ Effector T cells in the spleen and TDLNs of mice treated with Entrectinib + Anti-PD- 1 (FIG. 31 panel E). Both pre-exhausted T cells and TH1 cells were significantly enriched in the combination groups in both cell lines. These findings further suggest that NTRK1 signaling plays a critical role in the immune response during anti-PD-1 therapy and combination of Entrectinib with anti-PD-1 may overcome immune resistance in NTRK1 wild-type patients.

[0226] Entrectinib reshapes tumor immune microenvironment. To further investigate how Entrectinib enhances the efficacy of immune therapy, we performed bulk RNA sequencing using the tumors from LL / 2 bearing mice treated with IgG, Entrectinib, anti-PD-1 and Entrectinib+Anti-PD-1. Principal component analysis (PC A) showed that combination treatment groups had distinct transcriptome compared to monotherapy groups (FIG. 32 panel A). Next, we performed differential expression analysis with DeSeq2, and top 500 differential expressed genes were selected for Qiagen IPA core analysis. We found that Entrectinib significantly increased the expressions of signature genes of myeloid cells especially antigen presenting cells (APCs) compared to control group, suggesting that Entrectinib may strengthen the antigen stimulation in the tumor (FIG. 32 panel B). To further validate this finding, we examined Ml macrophages (F4 / 80+ / MHCII+) which are known to play a critical role in antigen presentation by immunocytochemistry. Indeed, increased Ml macrophages infiltration was observed in both NTRK1 KD and Entrectinib treated tumors (FIG. 32 panel C).When comparing the combination group with the anti-PDl monotherapy group, we observed further augment of APC infiltration and a substantial alteration of T cell activities (FIG. 32 panel D). Firstly, we observed increased quantity and proliferation of T cells, indicating there are enhanced T cells infiltration in combination treated tumors and they were less exhausted. Secondly, we observed enhanced T cell activation and cytotoxicity', suggesting those T cells are functional and they are responsible for tumor elimination. To further clarify the composition of T cells in the tumor, we performed immune deconvolution analyses. Results from mMCP-counter and quanTIseq demonstrated that combination treatment significantly increased the amount of CD8+T cells and cytotoxicity but not Tregs (FIG. 32 panel E). For a more detailed examination of T cell subpopulations, we used DCQ which compares different cell types within one sample. As shown in FIG. 32 panel F, CD8+ effector T cells were found highly enriched in combination treated tumors which is consistent with our previous FACS results. Our in silicon based immune population analyses demonstrated that Entrectinib enhances anti-PDl efficacy by creating a T cells supportive immune microenvironment which potentially mediated by Ml macrophages.

[0227] Knock down of NTRK1 promotes complement C3 expression in tumor cells. To understand the molecular mechanisms by which decreased NTRK1 signaling promotes ICI response, we performed RNA sequencing of LL / 2 cells with or without KD of NTRK1 followed by gene differential expression analysis. Next, we applied the top 100 differentially expressed genes to Qiagen IPA analysis to examine which cellular functions were regulated by NTRK1 signaling. Among 34 significantly altered cellular functions, we identified 16 differentially expressed immune related outcomes, including enhanced recruitment of leukocytes and myeloid cells and decreased apoptosis of lymphocytes (FIG. 33 panel A). These results are consistent with our previous tumor bulk sequencing data that Entrectinib treatment was capable of modulating immune microenvironment by enhancing myeloid cell infiltration (FIG. 32 panel A). To further identify the target genes that regulate immune cell activities, we focused on 7 genes (NOS2, CXCL1, C3, CCN1, DLL1, CCL2, and SERPINE1) which encode secretary proteins that are known to play essential roles in regulating immune cell functions from 29 IPA selected immune related genes (FIG. 33 panel B). Four out of seven genes including CCN1, C3, CXCL1 and CCL2 were validated in both LL / 2 and CMT167 cells by qRT-PCR (FIG. 33 panel C). CXCL1 and CCL2 are well known chemokines associated with myeloid cells mobilization and recruitment (48). CCN1 was reported to be a novel immune cell migration modulator by affecting actin polymerization (49). C3 is a multi- functional molecule that engages in both innate and adoptive immunity while also playing a key role in turning on the complement system pathways (50).

[0228] To examine whether those genes are associated with a better ICI response, we examined their expressions in responders and non-responders using Roc plotter and found that C3 is the only gene whose expression is significantly upregulated in responders (FIG. 33 panel D). Survival analyses by KM-plotter also demonstrated that high C3 expression is associated with prolonged PFS and OS in patients treated with anti-PD-1 therapies. C3 upregulation in NTRK1 KD and Entrectinib treated cells or tumors were validated by Western Blot or IHC respectively (FIG. 33 panels E and F). PI3K, MAPK and PKC pathways are three major downstream signaling of NTRK1(51). To examine whether C3 expression is regulated by those pathways, cells ere treated with PI3K inhibitors LY294002, MAPK inhibitor PD98059 and PKC inhibitor Bisindolylmal eimide II followed by measuring C3 expression. We found that targeting PI3K and MAPK but not PKC significantly induced C3 expression in LL / 2 and CMT167 cells, suggesting that NTRK1 suppresses C3 expression through PI3K and MAPK pathways (FIG. 33 panels G and H). Elevated C3 expression were also found in tumors derived from NTRK1 mutant patients compared to wildtype patients (FIG. 33 panels I and J). Notably, in addition to tumor cells, strong C3 staining was also observed in the stromal regions, suggesting that other non-cancerous cells may also contribute to the C3 upregulation in the NTRK1 mutant tumors.

[0229] C3 is required for NTRK1 mediated ICI response. Our RNA sequencing and patient data showed that C3 is a downstream target of NTRK1 pathway, and its expression is associated with a better OS and PFS in ICI treated patients. To validate these findings in vivo, we generated C3 knockout (KO) LL / 2-shNTRKl and CMT167-shNTRKl cells followed by testing their response to anti-PD-1 treatment in mice. As shown in FIG. 34 panel A, KO of C3 abolished anti-tumor effect of anti-PD-1 treatment in NTRK1 KD LL / 2 and CMT167 cells. Moreover, KO of C3 significantly decreased the infiltration of CD4+ and CD8+ T cells in the tumors formed by NTRK1 KD cells (FIG. 34 panel B). To further understand whether such impaired immune response is due to lack of stem-like CD4+ T cells and effector T cells, we examined those T cell populations in the spleen and TDLNs of tumor bearing mice. KO of C3 in NTRK1 KD cells significantly reduced the amounts of effector CD4+ / CD8+ T cells and stem-like CD4+ T cells in both spleen and TDLNs (FIG. 34 panels C-E). To validate our findings in clinical samples, we examined the correlation betw een C3 expression and the degree of immune cell infiltration by using TIMER. We found that C3 expression was positively correlated with the infiltration of CD4+ T cells and dendritic cells, whereas negatively correlated with the infiltration of MDSC cells in both LUAD and LUSC patients. We evaluated Ml macrophages populations (F4 / 80+ / MHCII +) within the tumor tissues and found that KO of C3 in both NTRK1 KD cell lines significantly reduced tumor entrained Ml macrophages. Since C3 is also known to be able to attract and activate neutrophils and B cells which may play a role in immunotherapy response, we examined neutrophils and B cell populations in tumors derived from LL / 2 and CMT167 with or without manipulation of NTRK1 and C3 by using antibodies against neutrophil elastase and CD19 respectively. We did not observe any B cells in within the tumor and most of the neutrophils were found in the edge of tumor and no significant difference was found between those three groups in terms of tumor infiltrated neutrophils.

[0230] References in Example 3:

[0231] 1. Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin 2022;72:7-33

[0232] 2. Molina JR, Yang P, Cassivi SD, Schild SE, Adjei AA. Non-small cell lung cancer: epidemiology’, risk factors, treatment, and survivorship. Mayo Clin Proc 2008;83:584-94

[0233] 3. Ganti AK. Klein AB, Cotaria I. Seal B. Chou E. Update of Incidence, Prevalence. Survival. and Initial Treatment in Patients With Non-Small Cell Lung Cancer in the US. JAMA Oncol 2021;7: 1824-32

[0234] 4. Scheff RJ, Schneider BJ. Non-small-cell lung cancer: treatment of late stage disease: chemotherapeutics and new frontiers. Semin Intervent Radiol 2013;30: 191-8

[0235] 5. Shields MD, Marin-Acevedo JA, Pellini B. Immunotherapy for Advanced Non-Small Cell

[0236] Lung Cancer: A Decade of Progress. Am Soc Clin Oncol Educ Book 2021;41 : 1-23

[0237] 6. Bai R, Chen N, Li L, Du N, Bai L, Lv Z, et al. Mechanisms of Cancer Resistance to Immunotherapy. Front Oncol 2020; 10: 1290

[0238] 7. Garon EB, Rizvi NA, Hui R, Leighl N, Balmanoukian AS, Eder JP, et al. Pembrolizumab for the treatment of non-small-cell lung cancer. N Engl J Med 2015;372:2018-28

[0239] 8. Jung J, Heo YJ, Park S. High tumor mutational burden predicts favorable response to anti-

[0240] PD-(L)1 therapy in patients with solid tumor: a real-world pan-tumor analysis. J Immunother Cancer 2023; 11

[0241] 9. Doroshow DB, Bhalla S, Beasley MB, Sholl LM, Kerr KM, Gnjatic S, et al. PD-L1 as a biomarker of response to immune-checkpoint inhibitors. Nat Rev Clin Oncol 2021;18:345-

[0242] 62 Klempner SJ. Fabrizio D, Bane S, Reinhart M, Peoples T, Ali SM, et al. Tumor Mutational Burden as a Predictive Biomarker for Response to Immune Checkpoint Inhibitors: A Review of Cunent Evidence. Oncologist 2020:25 :el47-e59 Wu Y, Xu J, Xu J, Wang Y, Wang L, Lv W, et al. The predictive value of tumor mutation burden for immune checkpoint inhibitors therapy in non-small cell lung cancer is affected by patients' age. Biomark Res 2020;8:9 Schwartzberg L, Kim ES, Liu D. Schrag D. Precision Oncology: Who, How, What. When, and When Not? Am Soc Clin Oncol Educ Book 2017;37: 160-9 Morash M, Mitchell H, Beltran H, Elemento O, Pathak J. The Role of Next-Generation Sequencing in Precision Medicine: A Review' of Outcomes in Oncology. JPers Med 2018;8 Chong W, Wang Z, Shang L. Jia S. Liu J, Fang Z, et al. Association of clocklike mutational signature with immune checkpoint inhibitor outcome in patients with melanoma and NSCLC. Mol Ther Nucleic Acids 2021;23:89-100 Seegobin K, Majeed U, Wiest N, Manochakian R, Lou Y, Zhao Y. Immunotherapy in NonSmall Cell Lung Cancer With Actionable Mutations Other Than EGFR. Front Oncol 2021: 11:750657 Smith MR, Wang Y, D'Agostino R, Jr., Liu Y, Ruiz J, Lycan T, etal. Prognostic Mutational Signatures of NSCLC Patients treated with chemotherapy, immunotherapy and chemoimmunotherapy. NPJ Precis Oncol 2023;7:34 Khotskaya YB, Holla VR, Farago AF. Mills Shaw KR, Meric-Bemstam F. Hong DS. Targeting TRK family proteins in cancer. Pharmacol Ther 2017;173:58-66 Amatu A, Sartore-Bianchi A, Bencardino K, Pizzutilo EG, Tosi F, Siena S. Tropomyosin receptor kinase (TRK) biology' and the role of NTRK gene fusions in cancer. Ann Oncol 2019:30:viii5-viiil5 Manea CA, Badiu DC, Ploscaru IC, Zgura A, Bacinschi X, Smarandache CG. et al. A review of NTRK fusions in cancer. Ann Med Surg (Lond) 2022;79: 103893 Dunn DB. Larotrectinib and Entrectinib: TRK Inhibitors for the Treatment of Pediatric and Adult Patients With NTRK Gene Fusion. J Adv Pract Oncol 2020; 11:418-23 Liu F, Wei Y, Zhang H, Jiang J. Zhang P. Chu Q. NTRK Fusion in Non-Small Cell Lung Cancer: Diagnosis, Therapy, and TRK Inhibitor Resistance. Front Oncol 2022; 12: 864666 Shaikh SS, Chen YC, Halsall SA, Nahorski MS, Omoto K, Young GT, et al. A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV). Hum Mutat 2017;38:55-63 Saibil SD, Ohashi PS. Targeting T cell activation in immuno-oncology. Curr Oncol 2020:27: S98-S 105 Ostroumov D, Fekete-Drimusz N, Saborowski M, Kuhnel F, Woller N. CD4 and CD8 T Lymphocyte interplay in controlling tumor growth. Cell Mol Life Sci 2018;75:689-713 Gattinoni L, Speiser DE, Lichterfeld M, Bonini C. T memory stem cells in health and disease. Nat Med 2017;23: 18-27 Shin B. Kress RL, Kramer PA. Darley-Usmar VM. Bellis SL, Harrington LE. Effector CD4 T cells with progenitor potential mediate chronic intestinal inflammation. J Exp Med 2018;215: 1803-12 Laidlaw BJ, Craft JE, Kaech SM. The multifaceted role of CD4(+) T cells in CD8(+) T cell memory. Nat Rev Immunol 2016;16: 102-11 Varghese F, Bukhari AB, Malhotra R, De A. IHC Profiler: an open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of human tissue samples. PLoS One 2014;9:e96801 Iyer R, Wehrmann L. Golden RL, Naraparaju K. Croucher JL, MacFarland SP, et al. Entrectinib is a potent inhibitor of Trk-driven neuroblastomas in a xenograft mouse model. Cancer Lett 2016;372: 179-86 Lemer EC, Woroniecka KI, D'Anniballe VM, Wilkinson DS, Mohan AA, Lorrey SJ, et al. CD8(+) T cells maintain killing of MHC-I -negative tumor cells through the NKG2D- NKG2DL axis. Nat Cancer 2023;4: 1258-72 Tomayko MM, Reynolds CP. Determination of subcutaneous tumor size in athymic (nude) mice. Cancer chemotherapy and pharmacology71989;24: 148-54 Kevin Blighe SR, Myles Lewis. EnhancedVolcano: Publication-ready volcano plots with enhanced colouring and labeling [EnhancedVolcano]: Bioconductor version; 2023. Sturm G, Finotello F, List M. Immunedeconv: An R Package for Unified Access to Computational Methods for Estimating Immune Cell Fractions from Bulk RNA- Sequencing Data. Methods Mol Biol 2020;2120:223-32 Finotello F, Mayer C, Plattner C, Laschober G, Rieder D, Hackl H, et al. Molecular and pharmacological modulators of the tumor immune contexture revealed by deconvolution of RNA-seq data. Genome Medicine 2019:11:34 Altboum Z, Steuerman Y, David E, Bamett-Itzhaki Z, Valadarsky L, Keren-Shaul H, et al. Digital cell quantification identifies global immune cell dynamics during influenza infection. Mol Syst Biol 2014:10:720 Li T, Fu J, Zeng Z, Cohen D, Li J, Chen Q, et al. TIMER2.0 for analysis of tumorinfiltrating immune cells. Nucleic Acids Res 2020;48:W509-wl4 Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 2005;102: 15545-50 Fekete JT, Gyorffy B. R°Cplot.org: Validating predictive biomarkers of chemotherapy / hormonal therapy / anti-HER2 therapy using transcriptomic data of 3.104 breast cancer patients. Int J Cancer 2019;145:3140-51 Kovacs SA, Fekete JT, Gyorffy B. Predictive biomarkers of immunotherapy response with pharmacological applications in solid tumors. Acta Pharmacol Sin 2023;44: 1879-89 Friedman J, Hastie T, Tibshirani R. Regularization Paths for Generalized Linear Models via Coordinate Descent. J Stat Softw 2010;33: 1-22 Mayakonda A, Lin DC, Assenov Y, Plass C, Koeffler HP. Maftools: efficient and comprehensive analysis of somatic variants in cancer. Genome Res 2018;28: 1747-56 Rogers C, Morrissette JJD. Sussman RT. NTRK point mutations and their functional consequences. Cancer Genet 2022;262-263:5-15 Bullock BL, Kimball AK, Poczobutt JM, Neuwelt AJ, Li HY, Johnson AM, et al. Tumor- intrinsic response to IFNgamma shapes the tumor microenvironment and anti-PD-1 response in NSCLC. Life Sci Alliance 2019;2 Yang X, Shen H, Buckley B, Chen Y, Yang N, Mussell AL, et al. NTRK1 is a positive regulator ofYAP oncogenic function. Oncogene 2019;38:2778-87 Connolly KA, Kuchroo M, Venkat A, Khatun A, Wang J, William I, et al. A reservoir of stem-like CD8(+) T cells in the tumor-draining lymph node preserves the ongoing antitumor immune response. Sci Immunol 2021;6:eabg7836 Utzschneider DT, Charmoy M, Chennupati V, Pousse L, Ferreira DP, Calderon-Copete S, et al. T Cell Factor 1-Expressing Memory-like CD8(+) T Cells Sustain the Immune Response to Chronic Viral Infections. Immunity 2016;45:415-27 Brightman SE, Becker A, Thota RR. Naradikian MS, Chihab L, Zavala KS. et al. Neoantigen-specific stem cell memory-like CD4(+) T cells mediate CD8(+) T celldependent immunotherapy of MHC class Il-negative solid tumors. Nat Immunol 2023;24: 1345-57 Kohli K, Pillarisetty VG, Kim TS. Key chemokines direct migration of immune cells in solid tumors. Cancer Gene Ther 2022;29: 10-21 Lobel M. Bauer S, Meisel C, Eisenreich A, Kudematsch R, Tank J, et al. CCN1 : a novel inflammation-regulated biphasic immune cell migration modulator. Cell Mol Life Sci 2012;69:3101-13 Ricklin D, Reis ES, Mastellos DC, Gros P, Lambris JD. Complement component C3 - The "Swiss Army Knife" of innate immunity and host defense. Immunol Rev 2016;274:33-58 Molloy NH, Read DE, Gorman AM. Nerve growth factor in cancer cell death and survival. Cancers (Basel) 2011;3:510-30 Franco ML, Melero C, SarasolaE, Acebo P, Luque A, Calatayud-Baselgal, etal. Mutations in TrkA Causing Congenital Insensitivity to Pain with Anhidrosis (CIPA) Induce Misfolding, Aggregation, and Mutation-dependent Neurodegeneration by Dysfunction of the Autophagic Flux. J Biol Chem 2016;291 :21363-74 Wang WB, Cao YJ, Lyu SS, Zuo RT, Zhang ZL, Kang QL. Identification of a novel mutation of the NTRK1 gene in patients with congenital insensitivity' to pain with anhidrosis (CIPA). Gene 2018;679:253-9 Indo Y. Molecular basis of congenital insensitivity to pain with anhidrosis (CIPA): mutations and polymorphisms in TRKA (NTRK1) gene encoding the receptor tyrosine kinase for nen e growth factor. Hum Mutat 2001;18:462-71 Doebele RC, Drilon A, Paz-Ares L, Siena S, Shaw AT, Farago AF, et al. Entrectinib in patients with advanced or metastatic NTRK fusion-positive solid tumours: integrated analysis of three phase 1-2 trials. Lancet Oncol 2020;21:271-82 Neamatallah T. Mitogen-Activated Protein Kinase Pathway: A Critical Regulator in Tumor Associated Macrophage Polarization. J Microsc Ultrastruct 2019;7:53-6 Killick J, Morisse G, Sieger D, Astier AL. Complement as a regulator of adaptive immunity. Semin Immunopathol 2018;40:37-48 Kopf M, Abel B, Gallimore A, Carroll M, Bachmann MF. Complement component C3 promotes T cell priming and lung migration to control acute influenza virus infection. Nat Med 2002;8:373-8 Zhou W, Patel H, Li K, Peng Q. Villiers MB. Sacks SH. Macrophages from C3-deficient mice have impaired potency to stimulate alloreactive T cells. Blood 2006;107:2461-9 Nabizadeh JA, Manthey HD, Steyn FJ, Chen W, Widiapradja A, Md Akhir FN, et al. The Complement C3a Receptor Contributes to Melanoma Tumorigenesis by Inhibiting Neutrophil and CD4+ T Cell Responses. J Immunol 2016;196:4783-92 Kwak JW, Laskowski J, Li HY, McSharry MV, Sippel TR, Bullock BL, et al. Complement Activation via a C3a Receptor Pathway Alters CD4(+) T Lymphocytes and Mediates Lung Cancer Progression. Cancer Res 2018;78: 143-56 Im SJ, Hashimoto M, Gemer MY, Lee J, Kissick HT, Burger MC, et al. Defining CD8+ T cells that provide the proliferative burst after PD-1 therapy. Nature 2016;537:417-21 Jansen CS, Prokhnevska N, Master VA, SandaMG, Carlisle JW, Bilen MA, et al. An intra- tumoral niche maintains and differentiates stem-like CD8 T cells. Nature 2019;576:465-70 Li HY, McSharry M, Bullock B, Nguyen TT, Kwak J, Poczobutt JM, et al. The Tumor Microenvironment Regulates Sensitivity of Murine Lung Tumors to PD-1 / PD-L1 Antibody Blockade. Cancer Immunol Res 2017;5:767-77 Fridman WH, Meylan M, Petitprez F, Sun CM, Italiano A, Sautes-Fridman C. B cells and tertiary lymphoid structures as determinants of tumour immune contexture and clinical outcome. Nat Rev Clin Oncol 2022;19:441-57 Trub M, Zippelius A. Tertiary Lymphoid Structures as a Predictive Biomarker of Response to Cancer Immunotherapies. Front Immunol 2021;12:674565 Snipstad S, Bremnes F. Dehli Haugum M. Sulheim E. Characterization of immune cell populations in syngeneic murine tumor models. Cancer Med 2023;12: l 1589-601

Claims

WHAT IS CLAIMED IS:

1. A method of treating cancer in a subject in need thereof comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor. thereby treating the cancer.

2. A method of inducing or enhancing sensitivity to an immune checkpoint inhibitor in a subject having, suspected of having, or at risk of having cancer, comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) in combination with an immune checkpoint inhibitor, thereby inducing or enhancing sensitivity to the immune checkpoint inhibitor in the subject.

3. A method of treating a subject resistant to an immune checkpoint inhibitor, comprising: determining whether the subject is positive for Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1) gene expression and / or function and / or NTRK1 protein expression and / or function; and administering an effective amount of an inhibitor of NTRK1 in combination with an immune checkpoint inhibitor, thereby treating the subject resistant to an immune checkpoint inhibitor.

4. A method of enhancing efficacy of an immune checkpoint inhibitor in a subject receiving the immune checkpoint inhibitor (e.g., a subject having, suspected of having, or at risk of having cancer, e.g., a cancer patient), comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1); thereby enhancing the therapeutic efficacy of the immune checkpoint inhibitor in the subject.

5. A method of reducing immunosuppression in a subject resistant to an immune checkpoint inhibitor (e.g., a subject having, suspected of having, or at risk of having cancer, e.g., a cancer patient), comprising administering to the subject an effective amount of an inhibitor of Neurotrophic Receptor Tyrosine Kinase 1 (NTRK1),wherein the inhibiting ofNTRKl function in the subject reduces cancer immunosuppressive resistance to the immune checkpoint inhibitor, thereby reducing immunosuppression in the subject.

6. The method of claim 4 or 5, further comprising administering to the subject an immune checkpoint inhibitor.

7. The method of any one of claims 1-6, further comprising retrieving a sample of the subject (e.g., a biopsy, a blood sample, a mucus sample, a cheek swab, and the like).

8. The method of claim 7, further comprising measuring NTRK1 gene expression and / or function and / or NTRK1 protein expression and / or function in the sample.

9. The method of any one of claims 1-8, wherein the subject has previously received and / or is concurrently receiving administration of an immune checkpoint inhibitor.

10. The method of any one of claims 1-9, wherein the immune checkpoint inhibitor is an inhibitor of CTLA-4 (CD152), PD-1 (CD279), B7-I (CD80), B7-2 (CD86), PD-L1 (B7-H1; CD274), and / or PD-L2 (B7-DC; CD273).1 1 . The method of any one of claims 1 -9, wherein the immune checkpoint inhibitor is a small molecule, an antibody or functional fragment thereof, and / or an RNA molecule (e.g., RNAi, shRNA, miRNA, etc.).

12. The method of any one of claims 1-11, wherein the inhibitor ofNTRKl is a small molecule, an antibody or functional fragment thereof, and / or an RNA molecule (e.g., RNAi, shRNA, miRNA, etc.).

13. The method of any one of claims 1-12, wherein the inhibitor ofNTRKl is entrectinib or any functional analog, fragment and / or biosimilar thereof.

14. The method of any one of claims 1-13, wherein the cancer is NTRK1 functional (e.g., NTRK1 "positive", e.g., NTRK1 wildtype and / or any wildtype-functional mutant thereof).

15. The method of any one of claims 1-14, wherein the cancer is resistant to the immune checkpoint inhibitor prior to the administering of the inhibitor of NTRK1.

16. The method of any one of claims 1-15, wherein the cancer is lung cancer, breast cancer, melanoma, colon cancer, liver cancer, or kidney cancer.

17. The method of any one of claims 1-16, wherein the cancer is lung cancer, such as but not limited to non-small cell lung cancer (NSCLC).

18. A composition comprising an inhibitor of NTRK1 (e.g., including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (e.g., including but not limited to an inhibitor of CTLA-4, PD-1, B7-1, B7-2, PD-L, and / or PD-L2).

19. A combination comprising an inhibitor of NTRK1 (e.g., including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (e.g., including but not limited to an inhibitor of CTLA-4. PD-1, B7-1, B7-2, PD-L, and / or PD-L2).

20. The composition or combination of claim 18 or 19, further comprising a pharmaceutically acceptable carrier, diluent and / or excipient.

21. A kit comprising an inhibitor of NTRK1 (e.g., including but not limited to entrectinib or any functional analog, fragment and / or biosimilar thereof) and an immune checkpoint inhibitor (e.g., including but not limited to an inhibitor of CTLA-4, PD-L B7-1, B7-2, PD-L, and / or PD-L2).

22. The composition, combination and / or kit of any one of claims 18-21, for use in the method of any one of claims 1-17.

Images