Backbone plasmid, recombinant plasmid, monkeypox virus particle, and use

Abstract

The present invention relates to the field of bioengineering, particularly to a backbone plasmid, a recombinant plasmid, a monkeypox virus particle, and a use. The backbone plasmid is provided by deleting two inverted terminal repeat sequences of a virus and deleting a L2R gene or both L2R and A30.5L genes, wherein the virus includes monkeypox virus. The recombinant plasmid has simple construction, and a virus is rescued by only ligating a ligated fragment of two inverted terminal repeat sequences with one linearized plasmid in vitro. The backbone plasmid is convenient to modify, and a sequence of interest can be rapidly modified by means of homologous fragment recombination in a bacterium; the detection is convenient, and a fluorescent protein and a luciferase reporter gene are both expressed; and the use is safe, and the key gene L2R essential for virus assembly is deleted or both L2R and A30.5L genes are deleted, so that only a single round of infection can be carried out in a cell free of inverse complementary expression, making it impossible to generate a new virus by means of assembly; thus, viral etiology and application research can be carried out in a laboratory having a relatively low level of biological safety.

Description

Backbone plasmid, recombinant plasmid and monkeypox virus particles and their applications

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on November 1, 2023, with application number 2023114446197 and invention name “Backbone plasmid, recombinant plasmid and monkeypox virus particles and applications”, the entire contents of which are incorporated by reference into this application.

[0002] This application claims priority to the Chinese patent application filed with the China Patent Office on January 26, 2024, with application number 202410116678.X and invention name “Backbone plasmid, recombinant plasmid and monkeypox virus particles and applications”, the entire contents of which are incorporated by reference into this application. Technical Field

[0003] The present invention relates to the field of bioengineering, and in particular to a backbone plasmid, a recombinant plasmid and monkeypox virus particles and applications. Background Art

[0004] Monkeypox (MPXV) is a zoonotic disease caused by the monkeypox virus (MPXV). It is primarily transmitted through direct contact with infected animals, contaminated materials, and infectious humans, through damaged skin or mucous membranes. Common symptoms of monkeypox infection include a rash or mucous membrane lesions, accompanied by fever, headache, muscle aches, fatigue, and swollen lymph nodes. The mortality rate ranges from 0% to 11%. The monkeypox virus was first discovered in non-human primates in Africa in the 1950s, and human infection was first confirmed in the Congo in the 1970s. The virus subsequently spread across the African continent, primarily in Central and West Africa, but has also gradually spread globally. In the summer of 2022, a global monkeypox outbreak occurred, affecting over 100 countries and primarily among men who have sex with men.

[0005] China reported its first imported case of monkeypox in September 2022, followed by a local case in June 2023, with reports continuing in multiple provinces across the country. China's National Health Commission decided to include monkeypox as a Category B infectious disease under the Law of the People's Republic of China on the Prevention and Control of Infectious Diseases, effective September 20, 2023, and to implement the same prevention and control measures as for Category B infectious diseases.

[0006] MPXV belongs to the Poxviridae family and the genus Orthopoxvirus. It is an enveloped, double-stranded DNA virus. It is primarily divided into two clades: Central African I and West African II. Clade II is further divided into clades IIa and IIb. The strain that caused global outbreaks in 2022 belonged to clade IIb, with mild clinical symptoms and a mortality rate of approximately 0.1%. Currently, there are insufficient candidate drugs and vaccines for monkeypox, and its mechanisms of infection, pathogenicity, and transmission remain underdeveloped.

[0007] MPXV is a biosafety level 3 virus. Manipulation of the MPXV virus requires a biosafety level 3 laboratory, severely limiting research on the virus. Therefore, establishing a virus model that can be manipulated in a lower-level biosafety laboratory is crucial for rapidly and efficiently evaluating the efficacy of antiviral drugs and vaccines targeting MPXV, studying the viral infection lifecycle (e.g., entry and replication) and pathogenic mechanisms, and developing vaccines.

[0008] The genome of MPXV is relatively large, consisting of a linear double-stranded DNA of approximately 197 kb in length, encoding approximately 200 proteins. Therefore, it is difficult to modify its genome.

[0009] Summary of the Invention

[0010] In view of this, the present invention provides a backbone plasmid, a recombinant plasmid, and monkeypox virus particles and applications. The construction method of the recombinant plasmid provided by the present invention is simple. Only the connecting fragments of the two terminal inverted repeat sequences are recombined and spliced ​​with a linearized plasmid in vitro to rescue the virus; the backbone plasmid modification is convenient. The target sequence can be quickly modified by the homologous fragment recombination method in bacteria; the detection is convenient. The fluorescent protein and luciferase reporter genes are expressed at the same time, which is convenient for detection and observation; and it is safe to use. The key gene L2R required for the assembly of viral particles is deleted, or the L2R and A30.5L genes are deleted at the same time. In cells without reverse complementary expression, only a single round of cell entry and replication can be carried out, and new viral particles cannot be assembled. Therefore, viral pathogenesis and application research can be carried out in laboratories with lower biosafety levels, such as antiviral drug screening, immune evaluation, and viral infection mechanism research.

[0011] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0012] The present invention provides a backbone plasmid, comprising: a backbone plasmid 1 or a backbone plasmid 2;

[0013] The backbone plasmid 1 includes: the L2R gene of the virus and the inverted repeat sequences at both ends are deleted;

[0014] The backbone plasmid 2 includes: the L2R gene, A30.5L gene and two terminal inverted repeat sequences of the deleted virus;

[0015] The viruses include: monkeypox virus.

[0016] In some embodiments of the present invention, in the above backbone plasmid, the L2R gene has:

[0017] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0018] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0019] (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2);

[0020] The A30.5L gene has:

[0021] (4) the nucleotide sequence shown in SEQ ID NO: 45; or

[0022] (5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0023] (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

[0024] In some embodiments of the present invention, in the above backbone plasmid, the two ends include a 5' end and a 3' end;

[0025] The inverted repeat sequence at the 5' end has:

[0026] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0027] (5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0028] (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); and / or

[0029] The inverted repeat sequence at the 3' end has:

[0030] (7) the nucleotide sequence shown in SEQ ID NO: 3; or

[0031] (8) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or

[0032] (9) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8).

[0033] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 is:

[0034] In some embodiments of the present invention, the sequence of SEQ ID NO: 2 is:

[0035] In some embodiments of the present invention, the sequence of SEQ ID NO: 3 is:

[0036] The present invention also provides a method for constructing a backbone plasmid, wherein the construction of the backbone plasmid 1 comprises the following steps:

[0037] S1: obtaining a viral genome fragment in which the L2R gene and the inverted repeat sequences at both ends are deleted;

[0038] S2: Take the viral genome fragment obtained in S1 and connect it with the shuttle plasmid, and obtain the fusion fragment after enzyme digestion;

[0039] S3: Take the fusion fragments and connect them to obtain the backbone plasmid 1.

[0040] In some embodiments of the present invention, in the above construction method, the viral genome fragment in S2 includes a fragment containing a thymidine kinase gene, and the fragment is modified and then connected to the shuttle plasmid.

[0041] In some embodiments of the present invention, in the above construction method, the modification includes the steps of inserting a promoter, a fluorescent protein and a luciferase reporter gene.

[0042] In some embodiments of the present invention, in the above construction method, the promoter includes: monkeypox virus late promoter P11; the fluorescent protein includes: one or more of mGreenLantern, GFP, EGFP, mNeonGreen, TurboGFP, ZsGreen, mCherry, mIFP and mScarlet3; the luciferase reporter gene includes: one or more of Gaussia luciferase reporter gene, NanoLuc luciferase, Firefly luciferase and Renilla luciferase.

[0043] In some embodiments of the present invention, in the above construction method, the promoter includes: monkeypox virus late promoter P11; the fluorescent protein includes: mGreenLantern; the luciferase reporter gene includes: Gaussia luciferase reporter gene.

[0044] In some embodiments of the present invention, in the above construction method, the luciferase reporter gene is inserted through a P2A connecting peptide.

[0045] In some embodiments of the present invention, in the above construction method, the viral genome segments in S1 include F1 to F23;

[0046] The F1 has the sequence shown in SEQ ID NO: 8:

[0047] The F2 has the sequence shown in SEQ ID NO: 9:

[0048] The F3 has the sequence shown in SEQ ID NO: 10:

[0049] The F4 has the sequence shown in SEQ ID NO: 11:

[0050] The F5 has the sequence shown in SEQ ID NO: 12:

[0051] The F6 has the sequence shown in SEQ ID NO: 13:

[0052] The F7 has the sequence shown in SEQ ID NO: 14:

[0053] The F8 has the sequence shown in SEQ ID NO: 15:

[0054] The F9 has the sequence shown in SEQ ID NO: 16:

[0055] The F10 has the sequence shown in SEQ ID NO: 17:

[0056] The F11 has a sequence as shown in SEQ ID NO: 18:

[0057] The F12 has a sequence as shown in SEQ ID NO: 19:

[0058] The F13 has the sequence shown in SEQ ID NO: 20:

[0059] The F14 has a sequence as shown in SEQ ID NO: 21:

[0060] The F15 has the sequence shown in SEQ ID NO: 22:

[0061] The F16 has the sequence shown in SEQ ID NO: 23:

[0062] The F17 has a sequence as shown in SEQ ID NO: 24:

[0063] The F18 has the sequence shown in SEQ ID NO: 25:

[0064] The F19 has the sequence shown in SEQ ID NO: 26:

[0065] The F20 has the sequence shown in SEQ ID NO: 27:

[0066] The F21 has the sequence shown in SEQ ID NO: 28:

[0067] The F22 has the sequence shown in SEQ ID NO: 29:

[0068] The F23 has the sequence shown in SEQ ID NO: 30:

[0069] In some embodiments of the present invention, in the above construction method, the fusion fragments in S3 include: fusion fragments B to fusion fragments G;

[0070] The fusion fragment B includes: F3 to F6;

[0071] The fusion fragment C includes: F7 to F10;

[0072] The fusion fragment D includes: F11;

[0073] The fusion fragment E includes: F12 to F15;

[0074] The fusion fragment F includes: F16 to F19;

[0075] The fusion fragment G includes: F20 to F23.

[0076] In some embodiments of the present invention, in the above construction method, the fusion fragment B has the sequence shown as SEQ ID NO:31-SEQ ID NO:32-SEQ ID NO:33-SEQ ID NO:34-SEQ ID NO:35-SEQ ID NO:36-SEQ ID NO:37 (the original SEQ ID NO:31 sequence is split into SEQ ID NO:31-SEQ ID NO:32-SEQ ID NO:33-SEQ ID NO:34-SEQ ID NO:35-SEQ ID NO:36-SEQ ID NO:37), specifically:

[0077] The sequence shown in SEQ ID NO: 31:

[0078] The sequence shown in SEQ ID NO: 32:

[0079] The sequence shown in SEQ ID NO: 33:

[0080] The sequence shown in SEQ ID NO: 34:

[0081] The sequence shown in SEQ ID NO:35:

[0082] The sequence shown in SEQ ID NO: 36:

[0083] In some embodiments of the present invention, in the above construction method, the fusion fragment C has the sequence shown as SEQ ID NO:37-SEQ ID NO:38-SEQ ID NO:39-SEQ ID NO:40-SEQ ID NO:41-SEQ ID NO:42 (the original SEQ ID NO:32 sequence is split into SEQ ID NO:37-SEQ ID NO:38-SEQ ID NO:39-SEQ ID NO:40-SEQ ID NO:41-SEQ ID NO:42), specifically:

[0084] The sequence shown in SEQ ID NO:37 is:

[0085] The sequence shown in SEQ ID NO:38 is:

[0086] The sequence shown in SEQ ID NO:39 is:

[0087] The sequence shown in SEQ ID NO:40 is:

[0088] The sequence shown in SEQ ID NO:41 is:

[0089] The sequence shown in SEQ ID NO:42 is:

[0090] In some embodiments of the present invention, in the above construction method, the fusion fragment D has the sequence shown as SEQ ID NO:43-SEQ ID NO:44 (the original SEQ ID NO:33 sequence is split into SEQ ID NO:43-SEQ ID NO:44), specifically:

[0091] The sequence shown in SEQ ID NO:43:

[0092] The sequence shown in SEQ ID NO:44:

[0093] In some embodiments of the present invention, in the above construction method, the fusion fragment E has the sequence shown as SEQ ID NO:45-SEQ ID NO:46-SEQ ID NO:47-SEQ ID NO:48-SEQ ID NO:49-SEQ ID NO:50 (the original SEQ ID NO:34 sequence is split into SEQ ID NO:45-SEQ ID NO:46-SEQ ID NO:47-SEQ ID NO:48-SEQ ID NO:49-SEQ ID NO:50), specifically:

[0094] The sequence shown in SEQ ID NO:45 is:

[0095] The sequence shown in SEQ ID NO:46 is:

[0096] The sequence shown in SEQ ID NO:47 is:

[0097] The sequence shown in SEQ ID NO:48 is:

[0098] The sequence shown in SEQ ID NO:49 is:

[0099] The sequence shown in SEQ ID NO:50 is:

[0100] In some embodiments of the present invention, in the above construction method, the fusion fragment F has a sequence as shown in SEQ ID NO:51-SEQ ID NO:52-SEQ ID NO:53-SEQ ID NO:54-SEQ ID NO:55-SEQ ID NO:56 (the original SEQ ID NO:35 sequence is split into SEQ ID NO:51-SEQ ID NO:52-SEQ ID NO:53-SEQ ID NO:54-SEQ ID NO:55-SEQ ID NO:56), specifically:

[0101] The sequence shown in SEQ ID NO:51 is:

[0102] The sequence shown in SEQ ID NO:52 is:

[0103] The sequence shown in SEQ ID NO:53 is:

[0104] The sequence shown in SEQ ID NO:54 is:

[0105] The sequence shown in SEQ ID NO:55 is:

[0106] The sequence shown in SEQ ID NO:56 is:

[0107] In some embodiments of the present invention, in the above construction method, the fusion fragment G has the sequence shown as SEQ ID NO:57-SEQ ID NO:58-SEQ ID NO:59-SEQ ID NO:60-SEQ ID NO:61-SEQ ID NO:62 (the original SEQ ID NO:36 sequence is split into SEQ ID NO:57-SEQ ID NO:58-SEQ ID NO:59-SEQ ID NO:60-SEQ ID NO:61-SEQ ID NO:62), specifically:

[0108] The sequence shown in SEQ ID NO:57 is:

[0109] The sequence shown in SEQ ID NO:58 is:

[0110] The sequence shown in SEQ ID NO:59 is:

[0111] The sequence shown in SEQ ID NO:60 is:

[0112] The sequence shown in SEQ ID NO:61 is:

[0113] The sequence shown in SEQ ID NO:62 is:

[0114] In some embodiments of the present invention, in the above construction method, the fragment containing the thymidine kinase gene is F11.

[0115] In some embodiments of the present invention, in the above construction method, the construction of the backbone plasmid 2 comprises the following steps:

[0116] S1: Obtaining the sgRNA expression plasmid for deleting the A30.5L gene and the viral genome fragment for deleting the A30.5L gene;

[0117] S2: Take the backbone plasmid 1 and Cas9 expression plasmid and transform them into cells to obtain competent cells;

[0118] S3: The sgRNA expression plasmid and the viral genome fragment in S1 are transferred into the competent cells obtained in S2. After resistance screening, the backbone plasmid 2 is obtained.

[0119] The present invention also provides a recombinant plasmid, comprising: a recombinant plasmid 1 or a recombinant plasmid 2;

[0120] The recombinant plasmid 1 comprises: any of the following and fragments of inverted repeat sequences at both ends of the virus;

[0121] (I), the backbone plasmid 1 in the above backbone plasmid; and / or

[0122] (II), backbone plasmid 1 obtained by the above construction method;

[0123] The recombinant plasmid 2 comprises: any of the following and fragments of inverted repeat sequences at both ends of the virus;

[0124] (I), the backbone plasmid 2 in the above backbone plasmid; and / or

[0125] (II), backbone plasmid 2 obtained by the above construction method;

[0126] The viruses include: monkeypox virus.

[0127] In some embodiments of the present invention, the method for constructing the above-mentioned recombinant plasmid comprises the following steps:

[0128] S1: Amplify the inverted repeat sequences at both ends separately, connect them, and obtain fragments;

[0129] S2: The backbone plasmid 1 and the backbone plasmid 2 are respectively digested and purified, and then ligated with the fragments to obtain the recombinant plasmid 1 and the recombinant plasmid 2, respectively.

[0130] In some embodiments of the present invention, the fragment described in the above construction method S1 has a sequence as shown in SEQ ID NO:63-SEQ ID NO:64 (the original SEQ ID NO:37 sequence is split into SEQ ID NO:63-SEQ ID NO:64), specifically:

[0131] The sequence shown in SEQ ID NO:63 is:

[0132] The sequence shown in SEQ ID NO:64 is:

[0133] In some embodiments of the present invention, in the above construction method, the amplification in S1 uses primer set 1 and primer set 2;

[0134] The primer set 1 has:

[0135] (13), the nucleotide sequence shown in SEQ ID NO: 4 and SEQ ID NO: 5; or

[0136] (14) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (13), and having the same or similar function as the nucleotide sequence shown in (13); or

[0137] (15) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (13) or (14); and / or

[0138] The primer set 2 has:

[0139] (16), the nucleotide sequence shown in SEQ ID NO: 6 and SEQ ID NO: 7; or

[0140] (17) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (16), and having the same or similar function as the nucleotide sequence shown in (16); or

[0141] (18) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (16) or (17).

[0142] The present invention also provides a reverse complementation system for monkeypox virus, comprising: any of the following items and a cell line expressing the monkeypox virus L2R gene or a cell line expressing the monkeypox virus L2R gene and the A30.5L gene;

[0143] (I), the above-mentioned recombinant plasmid; and / or

[0144] (II) The recombinant plasmid obtained by the above construction method.

[0145] In some embodiments of the present invention, in the reverse complementation system, the cell line expressing the monkeypox virus L2R gene is obtained by the following steps:

[0146] S1: After obtaining the plasmid containing the L2R gene, transfect cells with the lentiviral packaging plasmid to obtain lentivirus;

[0147] S2: After the lentivirus is used to transduce CV-1 cells, the cell line expressing the monkeypox virus L2R gene is obtained.

[0148] In some embodiments of the present invention, in the reverse complementation system, the 5' end of the L2R gene in S1 contains a protein tag.

[0149] In some embodiments of the present invention, in the reverse complementation system, the protein tag includes: an HA tag.

[0150] In some embodiments of the present invention, in the reverse complementation system, the cell line expressing the monkeypox virus L2R gene and A30.5L gene is obtained by the following steps:

[0151] S1: After obtaining the plasmid containing the A30.5L gene, transfect cells with the lentiviral packaging plasmid to obtain lentivirus;

[0152] S2: using the lentivirus to transduce the cell line expressing the monkeypox virus L2R gene to obtain the cell line expressing the monkeypox virus L2R gene and the A30.5L gene.

[0153] In some embodiments of the present invention, the 5' end of the A30.5L gene in the reverse complementation system S1 contains a protein tag.

[0154] In some embodiments of the present invention, in the reverse complementation system, the protein tag includes: a FLAG tag.

[0155] The present invention also provides a method for preparing monkeypox virus particles, wherein the reverse complementation system is used to transfect cells, and cells are cultured to obtain the monkeypox virus particles.

[0156] In some embodiments of the present invention, the above-mentioned cells include CV-1-L2R cells.

[0157] The present invention also provides monkeypox virus particles obtained by the above preparation method.

[0158] The present invention also provides the use of the above-mentioned backbone plasmid, the backbone plasmid obtained by the above-mentioned construction method, the above-mentioned recombinant plasmid, the recombinant plasmid obtained by the above-mentioned construction method, the above-mentioned reverse complementation system and / or the above-mentioned monkeypox virus particles in antiviral drug screening.

[0159] The present invention also provides the use of the above-mentioned backbone plasmid, the backbone plasmid obtained by the above-mentioned construction method, the above-mentioned recombinant plasmid, the recombinant plasmid obtained by the above-mentioned construction method, the above-mentioned reverse complementation system and / or the above-mentioned monkeypox virus particle in immune evaluation.

[0160] The present invention also provides the use of the above-mentioned backbone plasmid, the backbone plasmid obtained by the above-mentioned construction method, the above-mentioned recombinant plasmid, the recombinant plasmid obtained by the above-mentioned construction method, the above-mentioned reverse complementation system and / or the above-mentioned monkeypox virus particles in the study of viral infection mechanisms.

[0161] The present invention also provides the use of the above-mentioned backbone plasmid, the backbone plasmid obtained by the above-mentioned construction method, the above-mentioned recombinant plasmid, the recombinant plasmid obtained by the above-mentioned construction method, the above-mentioned reverse complementation system and / or the above-mentioned monkeypox virus particles in the preparation of drugs or preparations for treating and / or preventing monkeypox virus.

[0162] The present invention also provides a drug or preparation comprising the aforementioned backbone plasmid, the backbone plasmid obtained by the aforementioned construction method, the aforementioned recombinant plasmid, the recombinant plasmid obtained by the aforementioned construction method, the aforementioned reverse complementation system and / or the aforementioned monkeypox virus particles and acceptable excipients.

[0163] In some embodiments of the present invention, the above-mentioned medicine or preparation includes: a vaccine.

[0164] The present invention provides a backbone plasmid, comprising: a backbone plasmid 1 or a backbone plasmid 2; the backbone plasmid 1 comprises: a deleted viral L2R gene and inverted repeat sequences at both ends; the backbone plasmid 2 comprises: a deleted viral L2R gene, an A30.5L gene and inverted repeat sequences at both ends; the virus comprises: monkeypox virus.

[0165] The beneficial effects of the present invention include:

[0166] (1) Simple operation. Only two terminal inverted repeat sequence fragments and a plasmid are spliced ​​in vitro to rescue the virus, which simplifies the operation;

[0167] (2) Convenient detection. Simultaneous expression of fluorescent protein and luciferase reporter genes facilitates detection and observation;

[0168] (3) Safe to use. L2R, a key gene required for viral particle organization, is missing. In wild-type cells without L2R expression, only a single round of cytosolic entry and replication can be performed, and new viral particles cannot be packaged and produced. Therefore, viral etiology and application research can be carried out in laboratories with a lower biosafety level, such as antiviral drug screening, immune evaluation, and viral infection mechanism research. BRIEF DESCRIPTION OF THE DRAWINGS

[0169] FIG1 is a schematic diagram showing the construction of a single-round infection monkeypox reporter virus particle lacking the L2R gene;

[0170] Figure 2 shows fluorescence images of rescue and infection of a single-round monkeypox reporter virus lacking L2R; wherein: Figure 2A shows the cell infection status at different time points during virus rescue; Figure 2B shows the virus infection status in CV-1 cells trans-complemented with L2R (CV-1-L2R);

[0171] FIG3 is a schematic diagram showing the construction of a single-round infection monkeypox reporter virus particle lacking both the L2R and A30.5 genes;

[0172] FIG4 shows the infection status of a single-round infection monkeypox reporter virus lacking L2R on wild-type CV-1 cells; FIG4A shows the infection status of a P1 virus on cells after three consecutive infection passages; FIG4B shows the infection status of a P5 virus on cells after three consecutive infection passages;

[0173] FIG5 shows the growth curves of a single-round infection monkeypox reporter virus lacking L2R on CV-1 cells trans-complemented with L2R (CV-1-L2R) and wild-type CV-1 cells; FIG5A shows the titer changes of virus infection; FIG5B shows the luciferase expression detection after virus infection;

[0174] FIG6 shows the stability of a single-round infection monkeypox reporter virus lacking L2R; FIG6A shows the nucleic acid electrophoresis results of a PCR amplification product lacking the L2R region; FIG6B shows the nucleic acid electrophoresis results of a PCR amplification product lacking the fluorescent protein and luciferase regions;

[0175] FIG7 shows the infection of different cell lines with a single round of monkeypox reporter virus lacking L2R; FIG7A shows the infection of different cell lines at an MOI of 0.5 after 48 hours; FIG7B shows the flow cytometry results of infection efficiency at different infection doses after 48 hours;

[0176] FIG8 shows the photographic and flow cytometric results of a single round of infection of monkeypox reporter virus lacking L2R in host gene B3GAT3 knockout cells;

[0177] Figure 9 shows a single-round infection monkeypox reporter virus lacking L2R used for drug validation; wherein: Figure 9A is a fluorescence image of the inhibition of viral infection by the drugs Tecovirimat and Cidofovir at concentrations of 12.5 nM and 25 μM, respectively; Figure 9B is a high-content scan and quantitative statistical analysis of the inhibition of viral infection by the drugs Tecovirimat and Cidofovir at different concentrations;

[0178] Figure 10 shows the infection characteristics of a single-round infection monkeypox reporter virus lacking both the L2R and A30.5L genes; wherein: Figure 10A shows the infection status of the P5 generation virus in wild-type CV-1 cells and CV-1-L2R cells expressing L2R after three consecutive infection passages; Figures 10B and 10C show the virus infection titer and luciferase activity detection of the P3 generation virus in wild-type CV-1, CV-1-L2R expressing L2R, and CV-1-L2R-A30.5L cells expressing both L2R and A30.5L. DETAILED DESCRIPTION

[0179] The present invention discloses a backbone plasmid, a recombinant plasmid, and monkeypox virus particles and applications. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters for implementation. It should be noted that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0180] In Example 1 and Verification Examples 1 to 4 of the present invention, Escherichia coli Stbl3 competent cells, DH10B infection competent cells, and Gaussia luciferase detection kit were purchased from Thermo Fisher Scientific; VL6-48 Saccharomyces cerevisiae strain was derived from Beijing Coolaibo Technology Co., Ltd.; FuGENE HD transfection reagent was purchased from Promega; the codon-optimized L2R gene and MPXV genome fragments were synthesized by a biological company; pSMART-BAC vector was purchased from Lucigen; fowlpox virus FPV vaccine strain was purchased from Boehringer Ingelheim; plasmids psPAX2, pMD2.G, pML107, pYES1L-URA, and pLV-EF1a-IRES-Puro were purchased from Addgene; pRS416-257 vector was derived from Tianjin Jiutian Gene Company; Escherichia coli CRISPR editing plasmids pEcCas and pEcgRNA were purchased from Addgene; various restriction endonucleases, T4 DNA ligase, and Gibson Assembly cloning kit and high-fidelity DNA polymerase were purchased from NEB.

[0181] The present invention will be further described below in conjunction with the embodiments:

[0182] Example 1 Preparation of single-round monkeypox reporter virus particles lacking the L2R gene

[0183] 1. Synthesis of monkeypox virus gene fragments

[0184] Using the GenBank-listed reference sequence ON568298 of the monkeypox virus isolate, a complete monkeypox virus genome fragment was designed and synthesized. The genome was divided into 23 segments, ranging from 4,000 to 9,000 base pairs in length, designated F1-F23. The L2R gene sequence located at F10 was deleted. Each adjacent segment of segments F3-F23 contained 80-base pairs of homology arms to facilitate transformation-associated recombination (TAR) cloning. The sequences of F1-F23 are shown in SEQ ID NOs: 8-30. The codon-optimized L2R gene is shown in SEQ ID NO: 1. The process for fragment design, synthesis, and construction of the full-length genome pBAC-MPXV is shown in Figure 1.

[0185] 2. Construction of CV-1-L2R cell line stably expressing L2R

[0186] The puromycin resistance gene in pLV-EF1a-IRES-Puro was replaced with the red fluorescent protein gene mCherry to generate pLV-EF1a-IRES-mCherry. Using the codon-optimized L2R gene as a template, PCR amplification was performed, and an HA tag sequence was introduced at the 5' end. The HA tag sequence was then ligated into the pLV-EF1a-IRES-mCherry vector, which had been double-digested with the restriction endonucleases BamHI and EcoRI. This construct yielded pLV-EF1a-HA-L2R-IRES-mCherry, the inserted HA-L2R sequence of which is shown in SEQ ID NO:65. This plasmid was co-transfected into 293T cells with the lentiviral packaging plasmids psPAX2 and pMD2.G to generate lentivirus. This lentivirus was then transduced into CV-1 cells, and the cell population positive for mCherry expression was sorted by flow cytometry to generate a stable cell line, CV-1-L2R. The cells were expanded and cryopreserved for future use.

[0187] The sequence of HA-L2R is shown in SEQ ID NO: 65:

[0188] 3. Preparation of terminal inverted repeat sequence linker fragment A

[0189] A primer pair was designed, the sequences of which are shown in SEQ ID NO:4 and SEQ ID NO:5. Using fragment F2 as a template, PCR was performed to amplify the inverted terminal repeat sequence at the 5' end of the viral genome. Sequences for the Type IIS restriction endonuclease SapI were introduced at both the 5' and 3' ends of the PCR fragment. The PCR fragment was cloned into the vector pRS416-257 via Gibson assembly to construct plasmid pF2. The sequence of plasmid pF2 after digestion with the restriction endonuclease SapI is shown in SEQ ID NO:2.

[0190] A primer pair was designed; the primer sequences are shown in SEQ ID NO:6 and SEQ ID NO:7. Using fragment F1 as a template, the inverted terminal repeat at the 3' end of the viral genome was amplified by PCR. Sequences for the Type IIS restriction endonuclease SapI were introduced at both the 5' and 3' ends of the PCR fragment. The PCR fragment was cloned into the vector pRS416-257 by Gibson assembly to construct plasmid pF1.

[0191] The sequence of plasmid pF1 after digestion with restriction endonuclease SapI is shown in SEQ ID NO:3.

[0192] After digestion with the restriction endonuclease SapI and recovery by agarose gel electrophoresis, the two recombinant plasmids were ligated using T4 DNA ligase to obtain ligated fragment A, which was frozen for future use. The sequence of fragment A is shown in SEQ ID NO:63-SEQ ID NO:64.

[0193] 4. Construction of intermediate transition plasmid

[0194] (1) Construction of Saccharomyces cerevisiae strain VL6-48A and plasmids pBAC-TRP1 and pBAC-URA3

[0195] To avoid recombination and improve the success rate of TAR cloning, the URA3 gene of the Saccharomyces cerevisiae strain VL6-48 needs to be completely deleted. First, the LEU2 selection tag of the yeast CRISPR editing plasmid pML107 is replaced with the TRP1 selection tag to obtain pML107-TRP1. Based on the sequence of chromosome V of the Saccharomyces cerevisiae S288C strain (Genbank no. NC_001137), an sgRNA targeting the URA3 gene is designed, as shown in SEQ ID NO:66, and constructed into the yeast CRISPR plasmid pML107-TRP1 to obtain the CRISPR editing plasmid pML107-TRP1-sgURA3.

[0196] sgRNA sequence: GAGTAAAAAATTGTACTTGG (as shown in SEQ ID NO: 66)

[0197] The homology arms on both sides of the URA3 gene were amplified by PCR and ligated by PCR to obtain the complete homology arm HA-delURA3 for URA3 knockout, the sequence of which is shown in SEQ ID NO: 40. The constructed plasmid pML107-TRP1-delURA3 and the homology arm HA-delURA3 were co-transfected into the VL6-48 strain to generate the yeast strain VL6-48A, in which the URA3 gene promoter and coding frame were completely deleted.

[0198] Sequence of HA-delURA3: (as shown in SEQ ID NO:67)

[0199] The SP6 promoter, T7 promoter, and loxP recognition site of the pSMART-BAC vector were deleted, and the promoter, coding region, and terminator sequence of TRP1 or URA3 located in the pYES1L-URA plasmid were inserted into the AfeI site of the pSMART-BAC vector to obtain the yeast-E. coli shuttle plasmids pBAC-TRP1 and pBAC-URA3, respectively, which were used for the subsequent construction of intermediate transition plasmids and backbone plasmids.

[0200] (2) Fragments F3, F4, F5, and F6, along with linearized pBAC-TRP1, were TAR cloned in yeast VL6-48A to obtain the intermediate plasmid pBAC-B. pBAC-B was digested with NotI-HF and recovered by agarose gel electrophoresis to obtain a ligated fragment B containing F3, F4, F5, and F6. The sequence of fragment B is shown in SEQ ID NO:31-SEQ ID NO:32-SEQ ID NO:33-SEQ ID NO:34-SEQ ID NO:35-SEQ ID NO:36-SEQ ID NO:37.

[0201] (3) Fragments F7, F8, F9, and F10, along with linearized pBAC-TRP1, were cloned by TAR cloning to obtain the intermediate plasmid pBAC-C. pBAC-C was digested with NotI-HF and recovered by agarose gel electrophoresis to obtain a ligated fragment C containing F7, F8, F9, and F10. The sequence of fragment C is shown in SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, and SEQ ID NO:42.

[0202] (4) The monkeypox virus late promoter P11, the fluorescent protein mGreenLantern containing the nuclear localization signal NLS, the Gaussia luciferase reporter gene connected via P2A, and the linearized pBAC-URA3 vector were inserted into the site of the thymidine kinase gene in fragment F11, and the intermediate transition plasmid pBAC-D was obtained by Gibson assembly cloning; the end of fragment F11 contained a NotI-HF restriction site; the linearized pBAC-D plasmid was digested with NotI-HF and recovered by agarose gel electrophoresis to obtain a connection fragment D containing the F11 and P11 promoters, the reporter gene, and the BAC vector. The sequence of fragment D has the sequence shown in SEQ ID NO:43-SEQ ID NO:44.

[0203] (5) Fragments F12, F13, F14, and F15, along with linearized pBAC-TRP1, were cloned by TAR cloning to obtain the intermediate plasmid pBAC-E. pBAC-E was digested with NotI-HF and recovered by agarose gel electrophoresis to obtain a ligated fragment E containing F12, F13, F14, and F15. The sequence of fragment E is shown in SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, and SEQ ID NO:50.

[0204] (6) Fragments F16, F17, F18, and F19 were cloned with linearized pBAC-TRP1 by TAR cloning to obtain the intermediate plasmid pBAC-F. pBAC-F was digested with NotI-HF and recovered by agarose gel electrophoresis to obtain a ligated fragment F containing F16, F17, F18, and F19. The sequence of fragment F is shown in SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, and SEQ ID NO:50.

[0205] (7) Fragments F20, F21, F22, and F23 were cloned with linearized pBAC-TRP1 by TAR cloning to obtain the intermediate plasmid pBAC-G. pBAC-G was digested with NotI-HF and recovered by agarose gel electrophoresis to obtain a ligated fragment G containing F20, F21, F22, and F23. The sequence of fragment G is shown in SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, and SEQ ID NO:62.

[0206] 5. Construction of the backbone plasmid pBAC-I lacking the L2R gene

[0207] (1) The linked fragments B, C, D, E, F, and G obtained in step 4 of Example 1 were cloned by yeast TAR cloning to obtain the monkeypox genome bacterial artificial chromosome pBAC-I, which does not contain fragment A. Fragments B and G are adjacent to two homology arms of fragment A, and an AscI restriction enzyme sequence located between the two homology arms. pBAC-I can be linearized by AscI digestion and ligated to fragment A by Gibson assembly cloning.

[0208] (2) The recombinant backbone plasmid pBAC-I obtained in step (1), i.e., the P0 generation, was used to verify the correctness of the sequence by second-generation sequencing. The corresponding P0 generation bacterial solution was inoculated at a ratio of 1:1000 and passaged 10 times. Among them, the bacterial solutions of the P5 and P10 generations were selected, and plasmid DNA was extracted for second-generation sequencing. The sequencing results showed that P5 and P10 had no additional insertion, deletion, or substitution mutations compared to P0.

[0209] 6. Rescue of monkeypox reporter virus particles from a single round of infection lacking the L2R gene

[0210] (1) In vitro full-length genome ligation

[0211] The backbone plasmid pBAC-I obtained in step 5 (1) of Example 1 was digested with AscI and purified by isopropanol precipitation to obtain a linearized fragment Linear-pBAC-I. The terminal inverted repeat sequence linker fragment A obtained in step 3 of Example 1 was recombined with the fragment Linear-pBAC-I using the Gibson assembly cloning kit to obtain a circularized full-genome pBAC-MPXV. ΔL2R .

[0212] (2) Plasmid transfection and virus rescue

[0213] The CV-1-L2R cells obtained in step 2 of Example 1 were inoculated into a 6-well plate. When the cell confluence reached 90%, they were infected with fowl pox virus FPV. After 2 hours, the virus was washed off and the culture medium was replaced with fresh culture medium. The circularized full-length genome pBAC-MPXV obtained in step 6 (1) was transfected into the culture medium using FuGENE HD transfection reagent. ΔL2R Transfect cells. Replace the culture medium with fresh medium 8 hours after transfection. Observe cytopathic effects and fluorescent protein expression on days 2, 3, 4, and 5 after transfection, and take photos, as shown in Figure 2A.

[0214] On the fifth day after transfection, cells and culture medium were harvested, frozen and thawed three times at -80°C, and the supernatant collected after centrifugation was the P0 virus, which was stored at -80°C. The harvested P0 virus was inoculated into a 6-well plate confluent with a monolayer of CV-1-L2R cells. Two hours later, the virus was washed off and the culture medium was replaced with fresh culture medium. On the third day of infection, cytopathic effects and fluorescent protein expression were observed and photographed, as shown in Figure 2B. Three days after infection, cells and culture medium were harvested, frozen and thawed three times at -80°C, and the supernatant collected after centrifugation was the P1 virus, which was stored at -80°C. Serial passages were performed in the same manner to obtain P2-P5 viruses.

[0215] Example 2 Preparation of single-round monkeypox reporter virus particles lacking both L2R and A30.5L genes

[0216] 1. Construction of the CV-1-L2R-A30.5L cell line stably expressing L2R and A30.5L

[0217] The puromycin resistance gene in pLV-EF1a-IRES-Puro was replaced with the near-infrared fluorescent protein gene mIFP to generate pLV-EF1a-IRES-mIFP. Using the codon-optimized A30.5L gene as a template, PCR amplification was performed, and a FLAG tag sequence was introduced at the 5' end. The pLV-EF1a-FLAG-A30.5L-IRES-mIFP vector was then ligated with the pLV-EF1a-IRES-mIFP vector, which had been double-digested with the restriction endonucleases BamHI and EcoRI. The inserted FLAG-A30.5L sequence is shown in SEQ ID NO:72. The plasmid was co-transfected with lentiviral packaging plasmids psPA X2 and pMD2.G into 293T cells to obtain a lentivirus; the lentivirus was used to transduce the CV-1-L2R cells constructed in Example 1, and the double-positive cell population expressing both mCherry and mIFP was sorted by flow cytometry to obtain a stably expressing cell line CV-1-L2R-A30.5L. The cells were expanded and frozen for future use.

[0218] The sequence of FLAG-A30.5L is shown in SEQ ID NO:72:

[0219] 2. Construction of the backbone plasmid pBAC-II lacking both L2R and A30.5L genes

[0220] (1) Construction of sgRNA expression plasmid pEcgRNA-A30.5L for knocking out A30.5L

[0221] The spectinomycin resistance gene of pEcgRNA was replaced with the ampicillin gene Amp R to obtain pEcgRNA-AmpR. Primer pairs were designed, with the primer sequences shown in SEQ ID NO:73 and SEQ ID NO:74. PCR amplification was performed using pEcgRNA-AmpR as a template, followed by Gibson assembly and ligation to obtain pEcgRNA-A30.5L.

[0222] (2) Construction of homology arm fragment J for knocking out A30.5L

[0223] A primer pair was designed, and the primer sequences are shown in SEQ ID NO:75 and SEQ ID NO:76. PCR amplification was performed using pBAC-I constructed in Example 1 as a template to obtain homology arm fragment JU. A primer pair was designed, and the primer sequences are shown in SEQ ID NO:77 and SEQ ID NO:78. PCR amplification was performed using pBAC-I as a template to obtain homology arm fragment JD. The two PCR fragments JU and JD were fused together by PCR to obtain homology arm fragment J for knocking out A30.5L. The sequence of fragment J is shown in SEQ ID NO:79.

[0224] (3) Construction of backbone plasmid pBAC-II

[0225] The plasmid pBAC-I constructed in Example 1 and the Cas9 expression plasmid pEcCas were co-electroplated into DH10B competent cells. After resistance screening, single clones were picked and electroporated competent cells were prepared. pEcgRNA-A30.5L and homology arm fragment J were co-electroplated into the above-mentioned DH10B competent cells containing both pBAC-I and pEcCas. After resistance screening and PCR identification, the backbone plasmid pBAC-II containing both L2R and A30.5L gene deletions was obtained. The construction process is shown in Figure 3.

[0226] 3. Rescue of monkeypox reporter virus particles lacking both L2R and A30.5L genes in a single round of infection

[0227] (1) In vitro assembly of full-length genomes

[0228] The backbone plasmid pBAC-II obtained in step 2 (3) of Example 2 was digested with AscI and purified by isopropanol precipitation to obtain a linearized fragment Linear-pBAC-II. The terminal inverted repeat sequence linker fragment A obtained in step 3 of Example 1 was recombined with the fragment Linear-pBAC-II using the Gibson assembly cloning kit to obtain a circularized full-genome pBAC-MPXV. ΔL2R-A30.5L .

[0229] (2) Plasmid transfection and virus rescue

[0230] The CV-1-L2R-A30.5L cells obtained in step 1 of Example 2 were seeded into a 6-well plate and infected with fowl pox virus FPV when the cell confluence reached 90%. After 2 hours, the virus was washed off and the culture medium was replaced with fresh culture medium. The circularized full-length genome pBAC-MPXV obtained above was transfected into the culture medium using FuGENE HD transfection reagent. ΔL2R-A30.5LTransfect cells. Replace the culture medium with fresh medium 8 hours after transfection. Observe cytopathic effects and fluorescent protein expression on days 2, 3, 4, and 5 after transfection.

[0231] On the fifth day after transfection, cells and culture medium were harvested, frozen and thawed three times at -80°C, and the supernatant collected after centrifugation was the P0 virus, which was stored at -80°C. The harvested P0 virus was inoculated into a 6-well plate containing a monolayer of CV-1-L2R-A30.5L cells. After 2 hours, the virus was washed off and replaced with fresh culture medium. Cytopathic effects and fluorescent protein expression were observed on the third day of infection. Cells and culture medium were harvested three days after infection, frozen and thawed three times at -80°C, and the supernatant collected after centrifugation was the P1 virus, which was stored at -80°C. Serial passages were performed in the same manner to obtain P2-P5 viruses.

[0232] Validation Example 1: Identification and Characterization of a Single-Round Monkeypox Reporter Virus Deleting the L2R Gene

[0233] (1) Single-round infection characteristics of the virus

[0234] Wild-type CV-1 cells that do not express L2R were seeded in 6-well plates. When the cells reached 100% confluence, the P1 generation virus was harvested and inoculated. Two hours later, the virus was washed off and the culture medium was replaced with fresh medium. Cytopathic effects and fluorescent protein expression were observed and photographed on day 5 of infection. After 5 days of infection, the cells and culture medium were harvested, frozen and thawed three times at -80°C, the supernatant was collected by centrifugation, and inoculated onto freshly plated wild-type CV-1 cells. The cells were observed for 5 days and photographed. After 5 days of infection, the cells and culture medium were harvested, frozen and thawed three times at -80°C, the supernatant was collected by centrifugation, and the cells were again inoculated onto freshly plated wild-type CV-1 cells. The cells were observed for 5 days and photographed. Cytopathic effects and fluorescent protein expression are shown in Figure 4A. The results show that P1 generation virus particles, which undergo a single round of infection, cannot complete multiple rounds of infection and replication in wild-type CV-1 cells that do not express L2R.

[0235] In the same manner as described above, P5 virus was inoculated into wild-type CV-1 cells that do not express L2R and serially passaged three times on these wild-type cells. Cytopathic effects and fluorescent protein expression were observed, as shown in Figure 4B. The results showed that P5 virus particles, which produced a single round of infection, were unable to complete multiple rounds of infection and replication in wild-type CV-1 cells that do not express L2R.

[0236] (2) Growth curve of monkeypox reporter virus in a single round of infection

[0237] L2R-expressing cells CV-1-L2R and wild-type cells CV-1 that do not express L2R were seeded in 12-well plates. When the cell confluence reached 100%, they were infected with the P3 virus at an MOI of 0.015. The supernatant was collected at 12, 24, 48, 72, and 96 hours to detect Gaussia luciferase activity. The remaining culture medium and cells were collected at the same time, frozen and thawed three times at -80°C, and the supernatant was collected by centrifugation. The virus proliferation was measured by a focus-forming assay, as shown in Figures 5A and 5B. The results showed that on L2R-expressing cells CV-1-L2R, the virus underwent multiple rounds of amplification, with the titer reaching more than 7 times, while on wild-type cells CV-1 that do not express L2R, the virus could not effectively proliferate. Similarly, on L2R-expressing cells CV-1-L2R, the luciferase activity increased by more than 9 times.

[0238] (3) Genomic stability of monkeypox reporter virus in a single round of infection

[0239] The genome of the P5 virus was extracted using a DNA extraction kit. Primer pairs were designed, with the sequences shown in SEQ ID NO:68 and SEQ ID NO:69. PCR amplification of the region containing the deleted L2R gene locus was performed, and the band sizes were consistent with expectations after gel electrophoresis and imaging. Sanger sequencing of the purified PCR product revealed no sequence insertion, as shown in Figure 6A. These results demonstrate that the L2R gene deletion in the virus is stable.

[0240] A primer pair was designed, and the primer sequences are shown in SEQ ID NO:70 and SEQ ID NO:71. PCR amplification of the mGreenLantern fluorescent protein and Gaussia luciferase reporter gene loci was performed. Gel electrophoresis and imaging revealed band sizes consistent with expectations. Sanger sequencing of the purified PCR product revealed no sequence alterations, as shown in Figure 6B. These results demonstrate that the deletion of the mGreenLantern fluorescent protein and Gaussia luciferase reporter genes in the virus is stable.

[0241] The extracted P5 viral genome was subjected to next-generation sequencing to analyze the stability of the viral genome during a single round of infection. The results showed no L2R gene sequence insertions or mutations in the entire genome, indicating the stability of the viral genome during passage.

[0242] Verification Example 2: Application of a single-round infection monkeypox reporter virus lacking the L2R gene in the susceptibility characteristics of different cells

[0243] A549 cells, HeLa cells, 293T cells, U-2OS cells, HaCat cells, HFF cells, Vero E6 cells, BHK-21 cells, CV-1 cells, Huh7 cells, SW13 cells, and BS-C-1 cells were infected with the single-round monkeypox reporter virus at MOIs of 0.5, 0.15, 0.05, and 0.015, respectively. Fluorescent protein expression was observed under a fluorescence microscope 48 hours after infection, and cells infected at an MOI of 0.5 were photographed (Figure 7A). The cells were then digested and fixed with 2% paraformaldehyde for 15 minutes. After washing once with PBS, the cells were resuspended in PBS and the infection efficiency of the virus was determined by flow cytometry (Figure 7B). The results showed that HaCat cells, CV-1 cells, and Vero E6 cells were highly susceptible, while Huh7 cells and SW-13 cells were less susceptible.

[0244] Validation Example 3: Application of a Single-Round Infection Monkeypox Reporter Virus Deleting the L2R Gene in the Study of Infection-Related Host Factors

[0245] Studies have reported that heparan sulfate (HS) promotes monkeypox virus infection, and B3GAT3 is a key gene in the heparan sulfate biosynthesis pathway. Wild-type A549 cells (A549 WT) and B3GAT3-knockout A549 cells (A549ΔB3GAT3) were infected with a single round of monkeypox reporter virus at MOIs of 0.5, 0.15, 0.05, and 0.015, respectively. Fluorescent protein expression was observed under a fluorescence microscope 48 hours after infection, and cells infected at an MOI of 0.15 were photographed. Cells were then digested and fixed with 2% paraformaldehyde for 15 minutes. After washing once with PBS, cells were resuspended in PBS and assayed for viral infection efficiency by flow cytometry. The results of the cell images and flow cytometry are shown in Figure 8. Knockout of the B3GAT3 gene significantly reduced viral infection efficiency.

[0246] Validation Example 4: Application of Single-round Infection Monkeypox Reporter Virus with L2R Gene Deficiency in Antiviral Drug Research

[0247] The drugs Tecovirimat and Cidofovir are compounds known to have significant inhibitory effects on monkeypox virus infection. Tecovirimat was diluted two-fold from a starting concentration of 100 nM, and Cidofovir was diluted two-fold from a starting concentration of 200 μM. CV-1-LR2 cells were pre-treated for 1 hour. Then, in the presence of the drugs, the cells were infected with monkeypox reporter virus at an MOI of 0.015 in a single round for 2 hours. The virus was then washed off, and drug-containing culture medium was added and infected for 48 hours. Fluorescent protein expression was observed under a fluorescence microscope and photographed, as shown in Figure 9A. The cells were digested, fixed with 2% paraformaldehyde for 15 minutes, washed once with PBS, and resuspended in PBS. The virus infection efficiency was determined by flow cytometry. The flow cytometry results are shown in Figure 9B. The results showed that both Tecovirimat and Cidofovir could significantly inhibit single-round monkeypox virus infection, with IC50 values ​​of 2.969 nM and 13.64 μM, respectively.

[0248] Validation Example 5: Identification and Characterization of a Single-Round Monkeypox Reporter Virus Deleting Both the L2R and A30.5L Genes

[0249] (1) Single-round infection characteristics of the virus

[0250] Wild-type CV-1 cells that do not express L2R and CV-1-L2R cells that express L2R were seeded in 6-well plates. When the cells reached 100% confluence, the P5 generation virus was inoculated. After 2 hours, the virus was washed off and the culture medium was replaced with fresh culture medium. Cytopathic effects and fluorescent protein expression were observed and photographed on the 5th day of infection. After 5 days of infection, the cells and culture medium were harvested, frozen and thawed three times at -80°C, the supernatant was collected by centrifugation, and inoculated onto freshly plated cells. The cells were observed for 5 days and photographed. After 5 days of infection, the cells and culture medium were harvested, frozen and thawed three times at -80°C, the supernatant was collected by centrifugation, and the supernatant was again inoculated onto freshly plated cells. The cells were observed for 5 days and photographed. Cytopathic effects and fluorescent protein expression are shown in Figure 10A. The results showed that single-round infection of P5 generation double-deficient virus particles in wild-type CV-1 cells that do not express L2R or in CV-1-L2R cells that only express L2R were unable to complete multiple rounds of infection and replication.

[0251] (2) Growth curve of monkeypox reporter virus in a single round of infection

[0252] CV-1-L2R-A30.5L cells expressing both L2R and A30.5L, CV-1-L2R cells expressing only L2R, and wild-type CV-1 cells not expressing L2R were seeded in 12-well plates. When the cells reached 100% confluence, they were infected with the P3 virus at an MOI of 0.015. Supernatants were collected at 12, 24, 48, 72, and 96 hours for assaying Gaussia luciferase activity. The remaining culture medium and cells were harvested, frozen and thawed three times at -80°C, and the supernatant was centrifuged. Viral proliferation was measured by a spot-forming assay, as shown in Figures 10B and 10C. The results showed that only on the CV-1-L2R-A30.5 cells expressing both L2R and A30.5, the virus underwent multiple rounds of amplification, reaching titers exceeding 7, whereas on the wild-type CV-1 cells not expressing L2R, the virus failed to effectively proliferate. Similarly, in CV-1-L2R-A30.5 cells expressing both genes, luciferase activity increased by more than 45-fold.

[0253] The backbone plasmid, recombinant plasmid, and monkeypox virus particles and their applications provided by the present invention are described in detail above. The principles and implementation methods of the present invention are described herein using specific examples. The description of the above examples is intended only to facilitate understanding of the methods and core concepts of the present invention. It should be noted that those skilled in the art may make various improvements and modifications to the present invention without departing from the principles of the present invention, and such improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A backbone plasmid, characterized in that include: Backbone plasmid 1 or backbone plasmid 2; The backbone plasmid 1 includes: the L2R gene of the virus and the inverted repeat sequences at both ends are deleted; The backbone plasmid 2 includes: the L2R gene, A30.5L gene and two terminal inverted repeat sequences of the deleted virus; The viruses include: monkeypox virus.

2. The backbone plasmid according to claim 1, characterized in that The L2R gene has: (1), the nucleotide sequence shown in SEQ ID NO: 1; or (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); The A30.5L gene has: (4) the nucleotide sequence shown in SEQ ID NO: 45; or (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

3. The backbone plasmid according to claim 1 or 2, characterized in that The two ends include a 5' end and a 3' end; The inverted repeat sequence at the 5' end has: (7), the nucleotide sequence shown in SEQ ID NO: 2; or (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or (9) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8); and / or The inverted repeat sequence at the 3' end has: (10), the nucleotide sequence shown in SEQ ID NO: 3; or (11) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as the nucleotide sequence shown in (10); or (12) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (10) or (11).

4. The method for constructing a backbone plasmid according to any one of claims 1 to 3, characterized in that: The construction of the backbone plasmid 1 comprises the following steps: S1: obtaining a viral genome fragment in which the L2R gene and the inverted repeat sequences at both ends are deleted; S2: Take the viral genome fragment obtained in S1 and connect it with the shuttle plasmid, and obtain the fusion fragment after enzyme digestion; S3: Take the fusion fragments and connect them to obtain the backbone plasmid 1.

5. The construction method according to claim 4, characterized in that: The viral genome fragment in S2 includes a fragment containing a thymidine kinase gene, which is transformed and then connected to the shuttle plasmid.

6. The construction method according to claim 5, characterized in that: The transformation comprises the steps of inserting a promoter, a fluorescent protein and a luciferase reporter gene.

7. The construction method according to claim 6, characterized in that: The promoter includes: monkeypox virus late promoter P11; the fluorescent protein includes: one or more of mGreenLantern, GFP, EGFP, mNeonGreen, TurboGFP, ZsGreen, mCherry, mIFP and mScarlet3; the luciferase reporter gene includes: one or more of Gaussia luciferase reporter gene, NanoLuc luciferase, Firefly luciferase and Renilla luciferase.

8. The construction method according to claim 6 or 7, characterized in that: The luciferase reporter gene was inserted via the P2A linker peptide.

9. The construction method according to any one of claims 4 to 8, characterized in that: The construction of the backbone plasmid 2 comprises the following steps: S1: Obtaining the sgRNA expression plasmid for deleting the A30.5L gene and the viral genome fragment for deleting the A30.5L gene; S2: Take the backbone plasmid 1 and the Cas9 expression plasmid and transfer them into cells to obtain competent cells; S3: The sgRNA expression plasmid and the viral genome fragment in S1 are transferred into the competent cells obtained in S2, and after resistance screening, the backbone plasmid 2 is obtained.

10. A recombinant plasmid, characterized in that include: Recombinant plasmid 1 or recombinant plasmid 2; The recombinant plasmid 1 comprises: any of the following and fragments of inverted repeat sequences at both ends of the virus; (I), the backbone plasmid 1 in the backbone plasmid according to any one of claims 1 to 3; and / or (II), a backbone plasmid 1 obtained by the construction method according to any one of claims 4 to 8; The recombinant plasmid 2 comprises: any of the following and fragments of inverted repeat sequences at both ends of the virus; (I), the backbone plasmid 2 in the backbone plasmid according to any one of claims 1 to 3; and / or (II), backbone plasmid 2 obtained by the construction method according to claim 9; The viruses include: monkeypox virus.

11. The method for constructing a recombinant plasmid according to claim 10, characterized in that: The steps include: S1: Amplify the reverse repeat sequences at both ends respectively, connect them, and obtain fragments; S2: respectively taking the backbone plasmid 1 and the backbone plasmid 2, digesting and purifying them, and then connecting them with the fragments to obtain the recombinant plasmid 1 and the recombinant plasmid 2, respectively.

12. The construction method according to claim 11, characterized in that: The amplification described in S1 uses primer set 1 and primer set 2; The primer set 1 has: (13), the nucleotide sequence shown in SEQ ID NO: 4 and SEQ ID NO: 5; or (14) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (13), and having the same or similar function as the nucleotide sequence shown in (13); or (15) a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (13) or (14); and / or The primer set 2 has: (16), the nucleotide sequence shown in SEQ ID NO: 6 and SEQ ID NO: 7; or (17) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (16), and having the same or similar function as the nucleotide sequence shown in (16); or (18) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (16) or (17).

13. A reverse complementation system for monkeypox virus, characterized in that include: Any of the following and a cell line expressing the monkeypox virus L2R gene or a cell line expressing the monkeypox virus L2R gene and the A30.5L gene; (I), the recombinant plasmid according to claim 10; and / or (II) A recombinant plasmid obtained by the construction method according to claim 11 or 12.

14. The reverse complementation system according to claim 13, characterized in that: The cell line expressing the monkeypox virus L2R gene is obtained by the following steps: S1: After obtaining the plasmid containing the L2R gene, transfect cells with the lentivirus packaging plasmid to obtain lentivirus; S2: After the lentivirus is used to transduce CV-1 cells, the cell line expressing the monkeypox virus L2R gene is obtained.

15. The reverse complementation system according to claim 14, characterized in that: The 5' end of the L2R gene described in S1 contains a protein tag.

16. The reverse complementation system according to claim 15, characterized in that: The protein tag includes: HA tag.

17. The reverse complementation system according to claim 13, characterized in that: The cell line expressing the monkeypox virus L2R gene and A30.5L gene is obtained by the following steps: S1: After obtaining the plasmid containing the A30.5L gene, transfect cells with the lentivirus packaging plasmid to obtain lentivirus; S2: The cell line expressing the monkeypox virus L2R gene is transduced with the lentivirus to obtain the cell line expressing the monkeypox virus L2R gene and the A30.5L gene.

18. The reverse complementation system according to claim 17, characterized in that: The 5' end of the A30.5L gene described in S1 contains a protein tag.

19. The reverse complementation system according to claim 18, characterized in that: The protein tag includes: a FLAG tag.

20. A method for preparing monkeypox virus particles, characterized in that: Take the reverse complementation system as described in any one of claims 13 to 19 to transfect cells, and after culturing, obtain the monkeypox virus particles.

21. Monkeypox virus particles obtained by the preparation method according to claim 20.

22. Use of the backbone plasmid as described in any one of claims 1 to 3, the backbone plasmid obtained by the construction method as described in any one of claims 4 to 9, the recombinant plasmid as described in claim 10, the recombinant plasmid obtained by the construction method as described in claim 11 or 12, the reverse complementation system as described in any one of claims 13 to 19 and / or the monkeypox virus particle as described in claim 21 in antiviral drug screening.

23. Use of the backbone plasmid according to any one of claims 1 to 3, the backbone plasmid obtained by the construction method according to any one of claims 4 to 9, the recombinant plasmid according to claim 10, the recombinant plasmid obtained by the construction method according to claim 11 or 12, the reverse complementation system according to any one of claims 13 to 19 and / or the monkeypox virus particle according to claim 21 in immune evaluation.

24. Use of the backbone plasmid as described in any one of claims 1 to 3, the backbone plasmid obtained by the construction method as described in any one of claims 4 to 8, the recombinant plasmid as described in claim 10, the recombinant plasmid obtained by the construction method as described in claim 11 or 12, the reverse complementation system as described in any one of claims 13 to 19 and / or the monkeypox virus particle as described in claim 21 in the study of viral infection mechanism.

25. Use of the backbone plasmid according to any one of claims 1 to 3, the backbone plasmid obtained by the construction method according to any one of claims 4 to 8, the recombinant plasmid according to claim 10, the recombinant plasmid obtained by the construction method according to claim 11 or 12, the reverse complementation system according to any one of claims 13 to 19 and / or the monkeypox virus particle according to claim 21 in the preparation of a drug or preparation for treating and / or preventing monkeypox virus.

26. A drug or a preparation, characterized in that It comprises the backbone plasmid as described in any one of claims 1 to 3, the backbone plasmid obtained by the construction method as described in any one of claims 4 to 9, the recombinant plasmid as described in claim 10, the recombinant plasmid obtained by the construction method as described in claim 11 or 12, the reverse complementation system as described in any one of claims 13 to 19 and / or the monkeypox virus particle as described in claim 21 and acceptable excipients.

27. A method for treating a disease, characterized in that Taking the medicine or preparation as claimed in claim 26; the disease includes: monkeypox.

Images