Composition comprising nano-graphene oxide or variant thereof for preventing, alleviating, or treating oral diseases

Abstract

The present invention relates to a pharmaceutical composition and an oral composition, which comprise nano-graphene oxide or a variant thereof for preventing or treating oral diseases, wherein the nano-graphene oxide or the variant thereof can prevent and treat various oral diseases including gingivitis through antibacterial, anti-inflammatory and osteoclast differentiation-promoting factor reduction effects in the oral cavity, and thus the present invention can be applied to various oral care products.

Description

Composition for preventing, improving or treating oral diseases comprising nano-graphene oxide or a variant thereof

[0001] The present invention relates to a composition for preventing, improving or treating oral diseases, comprising nano-graphene oxide or a variant thereof, and more particularly, to a composition for preventing and treating oral diseases and an oral composition having an effect of preventing, improving or treating oral diseases by including nano-graphene oxide or a variant thereof as an active ingredient, thereby inhibiting the activity of oral disease-causing bacteria, inhibiting nitric oxide production and / or inhibiting osteoclast differentiation.

[0002] Skin, located at the outermost layer of the human body and intended to protect the body, is sensitive to inflammation caused by the external environment. For example, bacteria in dental plaque, a microbial film that forms on the teeth and the supporting gingiva (the gums and soft tissue surrounding the teeth), can cause gingivitis, a localized inflammation of the gums. Untreated, gingivitis can damage the gums, bone, and ligaments, ultimately leading to tooth loss. This can progress to periodontal disease, a chronic, widespread inflammation of the gums. This periodontal disease (e.g., chronic periodontitis) can worsen a patient's health by increasing the overall inflammatory burden in the body, leading to diseases such as diabetes and atherosclerosis.

[0003] Periodontal disease is prevalent in adults, but can also occur in children and adolescents. The extent of oral tissue destruction caused by gingivitis or periodontitis is generally determined by the level of plaque, the strength of host defenses, and various associated risk factors. Chronic and aggressive periodontitis are characterized by localized manifestations. The attachment and bone loss that occur with periodontal pockets are not uniform across the entire dentition. Smoking is a major risk factor for chronic periodontitis, and smokers have been shown to respond less effectively to both nonsurgical and surgical periodontal therapy compared to nonsmokers. Signs of gingival inflammation may be less pronounced in smokers than in nonsmokers due to vasoconstriction and enhanced keratinization of the gum tissue.

[0004] Oral epithelial cells function as a physical barrier against pathogens and induce innate and adaptive immune responses. Dendritic Langerhans cells within the epithelium absorb microbial antigens and transport them to lymphoid tissue for presentation to lymphocytes, leading to the infiltration of neutrophils, granulocytes, and lymphocytes into the periodontal lesion. This severe, chronic inflammatory response leads to alveolar bone resorption by osteoclasts, degradation of ligament fibers by matrix metalloproteinases, and the formation of granulation tissue. This pathophysiological situation persists until the tooth is exfoliated or the microbial biofilm and granulation tissue are successfully removed therapeutically.

[0005] When lymphocytes reach the site of injury, B cells transform into antibody-producing plasma cells. The quantity and avidity of antibodies are important for periodontal protection. In addition to antibody responses, T cells can contribute to cell-mediated immune responses by stimulating various T helper (Th) cell responses, including Th1, Th2, and Th17, although their relative importance and timing of involvement remain unclear. In particular, Th1 cells may be important in the early stages of chronic periodontitis, whereas Th2 cells may be involved in later stages. Furthermore, cytokine profiling has revealed that Th9, Th17, Th22, regulatory T (Treg) cells, and other Th cell subsets, as well as various cytokines (e.g., IL-17), are important in the immunopathology of periodontal disease.

[0006] Meanwhile, graphene is one of the allotropes of carbon and has a structure in which carbon atoms gather to form a two-dimensional plane, graphene oxide is an oxidized form of graphene, and nano graphene is a type of nano-carbon structure with nano-sized graphene. According to recent studies, it has been reported that toothpaste containing graphene oxide has a strong antibacterial effect against Staphylococcus aureus, Escherichia coli, Porphyromonas gingivalis, Prevotella intermedia, and Actinobacillus actinomycetemcomitan, and that an antibacterial dental coating composition containing graphene oxide particles can prevent and treat oral diseases such as periodontal disease by suppressing oral microorganisms. However, research on nano-carbon structures that can effectively control bacteria and inflammation without entering the oral mucosa and nano-carbon structures with various functional groups attached is lacking.

[0007] Accordingly, the present invention has been completed by confirming that nano-graphene oxide and nano-graphene oxide variants have excellent effects in suppressing the activity of oral disease-causing bacteria, suppressing nitric oxide production, and / or suppressing osteoclast differentiation as a result of extensive efforts to develop a nano-carbon structure that can effectively prevent, improve, or treat oral diseases.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] (Patent Document 1) Republic of Korea Publication No. 10-2023-0064241 (May 10, 2023)

[0011] (Patent Document 2) Republic of Korea Publication No. 10-2020-0001500 (January 6, 2020)

[0012] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0013] Another object of the present invention is to provide an oral composition comprising nano-graphene oxide or a variant thereof as an active ingredient.

[0014] Another object of the present invention is to provide a food composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0015] Another object of the present invention is to provide a cosmetic composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0016] In order to achieve the above object of the present invention, a pharmaceutical composition for preventing or treating oral diseases is provided, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0017] The present invention also provides an oral composition comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0018] The present invention also provides a food composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0019] The present invention also provides a cosmetic composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0020] The nano-oxide graphene of the present invention or its variant can be utilized in oral care products by delaying the formation of a microbial film or effectively controlling inflammation when in contact with the periodontal and gingival areas in the oral cavity.

[0021] In addition, regular use of a product containing nano-oxidized graphene of the present invention can also prevent caries by preventing oral inflammation and various oral diseases.

[0022] Figure 1 shows the results of analyzing nano-graphene oxide using X-ray diffractometer (XRD).

[0023] Figure 2 shows the results of analyzing nano-oxide graphene using X-ray photoelectron spectroscopy (XPS).

[0024] Figure 3 shows the results of Raman analysis of nano-oxidized graphene.

[0025] Figure 4 shows the results of analyzing nano-graphene oxide using Fourier Transform Infra-red (FTIR) spectroscopy.

[0026] Figure 5 shows the results of analyzing nano-oxide graphene using the atomic force microscopy (AFM) method.

[0027] Figure 6 shows the results of analyzing nano-oxidized graphene using a particle size analysis method.

[0028] Figure 7 shows the results of analyzing nano-graphene oxide before and after PEGylation using FT-IR analysis.

[0029] Figure 8 shows the results of analyzing nano-graphene oxide before and after amination using FT-IR analysis.

[0030] Figure 9a shows the results of a cytotoxicity test confirmed through a CCK-8 assay 24 hours and 72 hours after treating cells with 1 and 10 μg / mL of nano-sized (1 to 100 nm) nano-sized graphene oxide (daNGO), 1 and 10 μg / mL of submicron-sized (100 nm to 1 μm) nano-sized graphene oxide (GO-S7), and 1 and 10 μg / mL of pegylated nano-sized graphene oxide (NGO-PEG).

[0031] Figure 9b shows the results of a cytotoxicity test confirmed through a CCK-8 assay 1 hour after treating cells with 1 to 500 μg / mL of NGO-PEG.

[0032] Figure 10 shows the results of confirming the bactericidal power of nano (1 to 100 nm) and submicron (100 nm to 1 μm) sized graphene oxide against Tannerella forsythia.

[0033] Figure 11 shows the results of the antibacterial effect of nano (1 to 100 nm) and submicron (100 nm to 1 μm) sized graphene oxide, expressed in terms of the number of bacteria and the reduction rate.

[0034] Figure 12 shows a photograph of mouse macrophages treated with LPS derived from Porphyromonas gingivalis and nano-oxidized graphene.

[0035] Figure 13 shows the results of measuring the nitrite (NO) reduction amount of the control group, submicron-sized graphene oxide (GO-S7), pegylated nano-sized graphene oxide (NGO-PEG), and nano-sized graphene oxide (daNGO).

[0036] Figure 14 shows the results of measuring the amount of NO (Nitrite) reduction according to the concentration of nano-sized graphene oxide (daNGO).

[0037] Figure 15 shows the results of inhibiting the expression of oral bacteria-derived genes IL-1β and TNF-α when nano-graphene oxide (daNGO) and aminated nano-graphene oxide (NXN) were treated in macrophages.

[0038] Hereinafter, the invention will be described in detail.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well known and commonly used in the art.

[0040] In the present invention, the term “subject” or “subject” means any animal, including humans, suffering from an oral disease.

[0041] In the present invention, the term “treatment” means any act of improving or beneficially changing an oral disease by administering or applying the pharmaceutical composition of the present invention.

[0042] In the present invention, the term "administration" means an act of introducing the pharmaceutical composition of the present invention to a subject by any appropriate method, and the route of administration may be through various routes, such as oral or parenteral, as long as it can reach the target tissue.

[0043] In the present invention, the term "graphene oxide" may be abbreviated as "GO" and may include a structure in which a functional group containing an oxygen atom, such as a carboxyl group, a hydroxyl group, or an epoxy group, is bonded to graphene, but is not limited thereto.

[0044] In the present invention, the antibacterial effect of oral disease-causing bacteria, the effect of inhibiting nitric oxide production, and the effect of reducing osteoclast differentiation promoting factors were confirmed through nano-graphene oxide or its variant.

[0045] Accordingly, the present invention relates to a pharmaceutical composition for preventing or treating oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0046] The above-mentioned graphene oxide can be obtained by carbon thermo-oxidative cutting, but is not limited thereto.

[0047] When producing the above nano-graphene oxide, ethanol, acetone, and DMF can be used as solvents depending on the purpose during the nano-forming process of graphene oxide, and can be used in a mixing ratio of 1:1 to 1:1000 with respect to graphene oxide, but is not limited thereto.

[0048] The above nano graphene oxide variant may be, but is not limited to, pegylated nano graphene oxide (NGO-PEG) or aminated nano graphene oxide (NXN).

[0049] The above nano-graphene oxide may include graphene quantum dots (GQDs). In addition, it may include graphene particles having a width, length, and height of several nm manufactured through appropriate processing, but is not limited thereto.

[0050] In the present invention, the nano-graphene oxide can retain moisture through the -OH group.

[0051] In addition, nano-graphene oxide has a higher reactivity toward functional groups than other carbon materials, and can attach various functional groups. The functional groups that can be attached include, but are not limited to, polyethylene glycol (-PEG), a type of protein, and amine groups (-NH2).

[0052] The structure and chemical properties of the above nano graphene oxide can be verified by X-ray diffraction, X-ray photoelectron spectroscopy, Raman spectroscopy, and Fourier transform infrared spectroscopy. X-ray diffraction is a technique that can confirm the structural information of a material, such as chemical composition, crystal structure, crystal size, strain, preferred orientation, and layer thickness, in a laboratory, and X-ray photoelectron spectroscopy is a sensitive quantitative spectroscopy technique based on the photoelectric effect that can identify not only elements existing within a material or covering the surface, but also the overall electronic structure and density within a material. In addition, Raman spectroscopy is a technique that can distinguish the number of layers of graphene or confirm the degree of structural defects, and Fourier transform infrared spectroscopy is a technique used to obtain an infrared spectrum absorbed or emitted from a solid, liquid, or gas.

[0053] Various residues such as carboxyl groups, carbonyl groups, epoxy groups, and hydroxyl groups may exist on the surface of the above nano-graphene oxide.

[0054] In the present invention, the nano-oxide graphene may be characterized by an average diameter of 1 to 100 nm, preferably 5 to 75 nm, and more preferably 10 to 50 nm, but is not limited thereto.

[0055]

[0056] *In the present invention, the average diameter refers to the average diameter in the lateral size of graphene oxide having a certain thickness, and the lateral size can be interpreted as the relatively longer length among the horizontal and vertical lengths when the length of graphene oxide having a certain thickness is measured based on a rectangular frame, or the longest distance among the distances connecting any two ends of graphene oxide having a certain thickness.

[0057] In the present invention, the nano-graphene oxide may be characterized by a thickness of 0.01 to 10 nm, preferably 0.1 to 10 nm, and more preferably 0.5 to 5 nm, but is not limited thereto.

[0058] In the present invention, the aminated nano-graphene oxide may be characterized by including an amine functional group and a basic component of the nano-graphene oxide in a ratio of 1:10000 to 1:1, preferably 1:1000 to 1:1, and more preferably 1:100 to 1:1, but is not limited thereto.

[0059] In the present invention, the above ratio is a comparison value of the number of functional groups (e.g., nitrogen) relative to the number of carbons. In GO-NH2, the ratio of carbon to nitrogen may be 5 to 20 based on 1 nitrogen, but is not limited thereto.

[0060] In the present invention, the PEG functional group of the PEGylated nano graphene oxide may be characterized as being 4arm-PEG or 6arm-PEG, but is not limited thereto.

[0061] The above oral disease may be at least one selected from the group consisting of gingivitis, periodontitis, pulpitis, peri-implantitis, and caries, but is not limited thereto.

[0062] The above gingivitis refers to a case where the inflammation is limited to the gums, and periodontitis refers to a case where the inflammation has progressed to the gum bone.

[0063] The above-mentioned pulpitis refers to a case where inflammation occurs in the pulp tissue, which includes blood vessels, nerves, and associated tissues within the tooth.

[0064] The above peri-implantitis refers to a case where inflammation occurs in the tissue around the implant.

[0065] The above dental caries can also be called dental caries, and refers to an irreversible disease that invades the enamel or dentin of the teeth.

[0066] The above composition is ( ) Inhibition of the activity of oral disease-causing bacteria, ( ) inhibition of nitric oxide production; and / or ( ) may have an effect of preventing or treating oral diseases through inhibition of osteoclast differentiation, but is not limited thereto.

[0067] The above oral disease-causing bacteria may include, but are not limited to, Tannerella forsythia, Porphyromonas gingivalis, and Treponema denticola. The above bacteria may act in a complex manner when causing oral diseases, and the bacteria may cause an inflammatory response in the surrounding tissues, which may result in damage to the tissues supporting the teeth, thereby causing the above oral diseases.

[0068] The above-mentioned Tannerella forsythia expresses inflammatory cytokines through membrane proteins, glycolipids, etc., and is also present in human gingival fibroblasts. The above-mentioned Porphyromonas gingivalis is a Gram-negative bacterium and contains lipopolysaccharide (LPS), a cell wall component of Gram-negative bacteria. iNOS (induced nitric oxide synthase) is an enzyme that produces nitric oxide directly synthesized in host cells, and its activity is induced by LPS of Porphyromonas gingivalis, leading to excessive production of NO. Excessive production of NO causes cell damage and oxidative stress, and can destroy periodontal tissue.

[0069] When the disease is gingivitis, periodontitis or peri-implantitis mediated by Tannerella forsythia, an oral disease-causing bacterium, the nano-graphene oxide or a variant thereof may be included at a concentration of 0.01 to 0.5 wt%, preferably 0.05 to 0.3 wt%, but is not limited thereto. In this case, when the concentration of the nano-graphene oxide or a variant thereof is 0.01 wt% or less, the antibacterial effect against Tannerella forsythia may not occur, and therefore, the concentration of the nano-graphene oxide or a variant thereof for the prevention or treatment of gingivitis, periodontitis or peri-implantitis mediated by Tannerella forsythia is preferably 0.01 wt% or more.

[0070] When the disease is gingivitis, periodontitis, caries or peri-implantitis mediated by Porphyromonas gingivalis, an oral disease-causing bacterium, the nano-graphene oxide or its variant may be included at a concentration of 10 to 200 μg / ml, preferably 50 to 150 μg / ml, but is not limited thereto. In this case, when the concentration of the nano-graphene oxide or its variant is 10 μg / ml or less, the NO reduction effect induced by the Porphyromonas gingivalis may not occur, and therefore, the concentration of the nano-graphene oxide or its variant for the prevention or treatment of gingivitis, periodontitis, caries or peri-implantitis mediated by Porphyromonas gingivalis is preferably 10 μg / ml or more.

[0071] LPS interacts with TLR-4 (Toll-like receptor 4) to induce activation of MAPK, a downstream cell signaling pathway, thereby promoting the secretion of various interleukins (ILs). Interleukin-β (IL-1β), an inflammatory cytokine, is known to attract bone marrow macrophages, which are osteoclast precursor cells, to the site of inflammation and stimulate their differentiation into osteoclasts, and to activate differentiated osteoclasts to induce resorption of surrounding bone.

[0072] IL-1β (Interleukin 1 β) and TNF-α (tumor necrosis factor α) activate the synthesis of IL-6 in osteoblasts, and these cytokines play an important role in the development of diseases related to bone loss by regulating the differentiation of osteoblasts and osteoclasts (Int J Biomed Sci. 2010 Jun; 6(2): 135-140), and these cytokines are known to be overexpressed in patients with dental caries.

[0073] When the disease is gingivitis or periodontitis induced by osteoclast hyperactivity, the nano-oxidized graphene or its variant may be included at a concentration of 1 to 50 μg / ml, preferably 1 to 30 μg / ml, but is not limited thereto. At this time, osteoclast hyperactivity may be achieved by increased osteoclast differentiation due to overexpression of the IL-1β gene, and when the concentration of the nano-oxidized graphene or its variant is 1 μg / ml or less, osteoclast hyperactivity by IL-1β may not occur, and therefore, the concentration of the nano-oxidized graphene or its variant for the prevention or treatment of gingivitis or periodontitis induced by osteoclast hyperactivity is preferably 1 μg / ml or more.

[0074] At this time, when the size of the nano-graphene oxide is nano (1 to 100 nm) compared to submicron (100 nm to 1 μm), the prevention and treatment effect of the disease may be more excellent.

[0075] In the present invention, the oral disease can occur when the balance between the microbiome and the host is disrupted due to microbial imbalance or an overreaction of the host's immune system to the presence of microorganisms. This imbalance varies significantly depending on the patient's dental plaque status, host genetics, and immune system, and can increase inflammation, leading to tissue damage observed in oral diseases.

[0076] In the present invention, the formation of a microbial film can be delayed or eradicated at regular intervals through the composition.

[0077] The above "pharmaceutical composition" refers to a mixture comprising the nano-graphene oxide of the present invention and a pharmaceutically acceptable excipient, such as a diluent or carrier. The pharmaceutical composition includes not only compositions for therapeutic use but also cosmetic compositions. In some embodiments, a method of administering a pharmaceutical composition comprising the composition of the present invention to a subject according to need is provided. In some embodiments, the composition of the present invention can be administered to a human.

[0078] In the present invention, the description of pharmaceutical compositions primarily relates to pharmaceutical compositions intended for administration to humans. However, those skilled in the art will understand that such compositions are generally suitable for administration to all types of animals. A skilled veterinary pharmacologist, with a thorough understanding of the various modifications of pharmaceutical compositions intended for administration to various animals, can design and / or implement such modifications, if necessary, through routine experimentation.

[0079] In the present invention, the pharmaceutical composition may be prepared by any method known in the art of pharmacology or described herein. Typically, such methods for preparing tablets include the steps of associating the active ingredient with excipients and / or one or more other auxiliary ingredients, followed by, if necessary or desired, shaping and / or packaging the product into desired single- or multi-dose units.

[0080] In the present invention, the pharmaceutical composition may be manufactured, packaged, and / or sold unpackaged as a single unit dose and / or multiple single unit doses. A "unit dose" is an individual amount of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient to be administered to a subject and / or a convenient fraction of such a dosage, such as, for example, 1 / 2 or 1 / 3 of the dosage.

[0081] In the present invention, the relative amounts of the active ingredient, pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical composition will vary depending on the identity, size, and / or disorder of the subject being treated and the route by which the composition is administered. For example, the composition may comprise 0.1% to 100% (w / w) active ingredient.

[0082] In the present invention, pharmaceutically acceptable excipients include any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surface active agents, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, and the like suitable for a particular dosage form purpose. Remington's publication [The Science and Practice of Pharmacy, 21st Edition, AR Gennaro, (Lippincott, Williams & Wilkins, Baltimore, MD, 2006]] discloses various excipients used in the preparation of pharmaceutical compositions and known techniques for their preparation. Except that any conventional carrier medium is incompatible with the substance or its derivatives, e.g., by providing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition, its use is contemplated to be within the scope of the present invention. A pharmaceutically acceptable excipient is at least 105%, 96%, 97%, 98%, 99%, or 100% pure.

[0083] The above excipients are approved for human and veterinary use. In some embodiments, the excipients are approved by the U.S. Food and Drug Administration. In some embodiments, the excipients are pharmaceutical grade. In some embodiments, the excipients meet the standards of the United States Pharmacopeia (USP), European Pharmacopeia (EP), British Pharmacopeia, and / or International Pharmacopeia (EP).

[0084] In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopeia (EP), British Pharmacopeia, and / or International Pharmacopeia (EP).

[0085] Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersing and / or granulating agents, surface active and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants, and / or oils.

[0086] These excipients may optionally be included in the formulations of the present invention. Excipients such as cocoa butter and suppository wax, colorants, coating agents, sweeteners, flavoring agents, and perfumes may be present in the compositions at the discretion of the formulator.

[0087] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and combinations thereof.

[0088] Exemplary granulating and / or dispersing agents include, but are not limited to, potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponges, cation-exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose (croscarmellose), methylcellulose, pregelatinized starch (Starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Vegum), sodium lauryl sulfate, quaternary ammonium compounds, and combinations thereof.

[0089] Exemplary surface active agents and / or emulsifiers include natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan gum, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and veegum [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxy polymethylene, polyacrylic acid, acrylic acid polymers, and carboxyvinyl polymers), carrageenan, cellulose derivatives (e.g., carboxymethylcellulose sodium, powdered cellulose, Hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g., polyoxyethylene monostearate [Miruz 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor), polyoxyethylene ethers (e.g. polyoxyethylene lauryl ether [Breeze 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laureate, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188,Including but not limited to cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and / or combinations thereof.

[0090] Exemplary binders include, but are not limited to, starches (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., extracts of acacia, sodium alginate, Irish moss, Panwar gum, Shatty gum, mucilage of Isaphol fuskus, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (veegum), and larch arabogalactan; alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohols; and combinations thereof.

[0091] Exemplary preservatives may include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate. Exemplary antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include, but are not limited to, butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acid preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopherol acetate, deteroxymethylene mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Fenonib, methylparaben, Germoll 115, Germaben II, Neolon, Carton, and Euxyl. In certain embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent.

[0092] Exemplary buffers include citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium globionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixture, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, Pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof, including but not limited to.

[0093] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0094] Exemplary oils include almond, apricot kernel, avocado, babassu, bergamot, black currant seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, pumpkin, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litchia cubeba, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange-colored orange raffi, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquamana, savory, sea buckthorn, sesame, Shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oils are included, but are not limited to. Exemplary oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and combinations thereof.

[0095] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, the liquid dosage forms may also contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizers, and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (particularly, cottonseed, peanut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents, and perfumes. In certain embodiments for parenteral administration, the nano-graphene oxide of the present invention is mixed with solubilizing agents such as Cremophor, alcohols, oils, denatured oils, glycols, polysorbates, cyclodextrins, polymers, and combinations thereof.

[0096] To prolong the effect of a drug, it is often desirable to slow its absorption from subcutaneous or intramuscular injection. This is achieved by using liquid suspensions of crystalline or amorphous substances with low water solubility. The rate of drug absorption then ultimately depends on the dissolution rate, which can be influenced by crystal size and crystalline form. Alternatively, delayed absorption of parenteral drugs is achieved by dissolving or suspending the drug in an oil vehicle.

[0097] In the present invention, the nano-graphene oxide is typically prepared in dosage unit form for easy administration and uniform dosing. However, it will be understood that the total daily dosage of the composition of the present invention will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dosage level for any particular subject will depend on various factors, including the disease, disorder, or disorder being treated and its severity; the activity of the specific active ingredient employed; the specific composition employed; the age, weight, general health, sex, and diet of the subject; the time of administration, route of administration, and excretion rate of the specific active ingredient employed; the duration of treatment; medications used in combination or concurrently with the specific active ingredient employed; and other factors well known in the medical field.

[0098] It will be understood that the dosage ranges in the present invention provide guidance for administering the pharmaceutical composition to adults. For example, the dosage administered to children or adolescents can be determined by a physician or a person skilled in the art, and may be less than or equal to that administered to adults. The precise amount of the peptide according to the present invention required to achieve an effective dose will vary from subject to subject, depending on, for example, the subject's species, age, overall disorder, side effects, or severity of the disorder, the identity of the specific compound, the route of administration, and other factors.

[0099] It will be appreciated that the pharmaceutical compositions comprising nano-graphene oxide of the present invention may be used in combination therapy. The specific combination of treatments (therapeutics or procedures) to be used in combination therapy will take into account the desired therapeutic effect to be achieved and the suitability of the desired treatments and / or procedures.

[0100] The pharmaceutical compositions of the present invention may be administered alone or in combination with one or more therapeutically active agents. The term "combination" is not intended to imply that the agents must be administered at the same time and / or formulated for co-delivery, although the following delivery methods are within the scope of the present invention. The compositions may be administered simultaneously with, prior to, or subsequent to, one or more other therapeutic agents or medical procedures. Typically, each agent will be administered at the dosage and / or time schedule established for that agent. Additionally, the present invention encompasses delivering the pharmaceutical compositions of the present invention in combination with agents capable of improving their bioavailability, reducing and / or modifying their metabolism, inhibiting their secretion, and / or modifying their distribution within the body. It will be further understood that the nanographene oxide of the present invention and the therapeutically active agents used in this combination may be administered together in a single composition or separately in different compositions.

[0101] The specific combination used in combination therapy will take into account the desired therapeutic effect to be achieved and / or the suitability of the procedures and / or therapeutically active agents comprising the peptides of the present invention. It will be appreciated that the combination used may achieve the desired effect for the same disorder (e.g., the nano-graphene oxide of the present invention may be administered in combination with another therapeutically active agent used to treat the same disorder), and / or they may achieve different effects (e.g., controlling any side effects).

[0102] In the present invention, "therapeutic active agent" refers to any substance used as a medicine for treating, preventing, delaying, reducing or improving a disease, and refers to a substance used for treatment, including preventive and curative treatment.

[0103] In some embodiments, the pharmaceutical compositions of the present invention may be administered in combination with any therapeutically active agent or procedure (e.g., surgery, radiation therapy) useful for treating, alleviating, ameliorating, alleviating, delaying the onset, inhibiting the progression, reducing the severity, and / or reducing the incidence of one or more symptoms or features of an oral disease.

[0104] From another perspective, the present invention relates to an oral composition comprising nano-graphene oxide or a variant thereof as an active ingredient.

[0105] The composition may be characterized by being in the form of at least one formulation selected from the group consisting of toothpaste, mouthwash, mouthwash, mouth spray, oral ointment, oral varnish, mouthwash, and gum massage cream, but is not limited thereto.

[0106] If the oral product is toothpaste, it may additionally contain abrasives, moisturizers, foaming agents, sweeteners, whitening agents, or flavoring agents.

[0107] The above abrasive may be aluminum hydroxide, anhydrous silicic acid, aluminum silicate, dibasic calcium phosphate dihydroxide and anhydride, tribasic calcium phosphate, calcium carbonate, calcium pyrophosphate, insoluble sodium metaphosphate, tribasic magnesium phosphate, magnesium carbonate, calcium sulfate, polymethyl methacrylate, etc., which may be used alone or in combination. The content of the above abrasive may be typically 20 wt % to 90 wt % based on the entire composition, but is not limited thereto.

[0108] If the oral product is a mouthwash or mouth freshener, it may additionally contain a carrier such as a non-toxic alcohol.

[0109] From another aspect, the present invention relates to a food composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0110] The composition may be characterized as being in the form of a gum or candy, but is not limited thereto.

[0111] The above food composition may be added to various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, and health functional foods, but is not limited thereto.

[0112] In addition, the food composition may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition according to the present invention may contain fruit pulp for the production of natural fruit juice and vegetable beverages. These ingredients may be used independently or in combination.

[0113] From another aspect, the present invention relates to a cosmetic composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

[0114] The above cosmetic composition may contain excipients as auxiliary agents. The excipients may include, but are not limited to, skin softeners, skin penetration enhancers, colorants, fragrances, emulsifiers, thickeners, and solvents, for example. In addition, fragrances, pigments, bactericides, antioxidants, preservatives, and moisturizers may be additionally included, and thickeners, inorganic salts, synthetic polymers, and the like may be included for the purpose of improving physical properties. For example, when preparing a cleanser and soap using the cosmetic composition of the present invention, the biarylamide derivative of the present invention may be easily prepared by adding it to a typical cleanser and soap base. When preparing a cream, the biarylamide derivative of the present invention may be prepared by adding it to a typical oil-in-water (O / W) cream base. To this, fragrances, chelating agents, pigments, antioxidants, preservatives, and synthetic or natural materials such as proteins, minerals, and vitamins for the purpose of improving physical properties may be additionally added.

[0115] The description of nano-graphene oxide or a variant thereof, its effects and all related descriptions in the oral composition, food composition for preventing or improving oral diseases and cosmetic composition for preventing or improving oral diseases are the same as those described above, and therefore, the description thereof is omitted to avoid excessive complexity of the present specification due to redundant description.

[0116]

[0117] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0118]

[0119] Example 1. Fabrication of nano-graphene oxide

[0120]

[0121] 1-1. Production of graphene oxide

[0122]

[0123] Graphite (Qingdao Kropfmuehl, China) was used as a carbon structure, and nano-graphene oxide was synthesized through the Couette-Tayler flow method, which generates a vortex in a container containing a graphite mixture to allow sulfuric acid to penetrate the graphite layers and promote a chemical reaction. Sulfuric acid (H2SO4), sodium nitrate (NaNO3), and potassium permanganate (KMnO4) below were all purchased from Samchun Pure Chemicals. Graphite (graphite) and sulfuric acid (H2SO4) were mixed in a ratio of 1:40 to 1:70, and sodium nitrate (NaNO3), which lowers the viscosity of the mixed solution and facilitates stirring, was mixed in a ratio of 1:0.2 to 1:0.7 to graphite (graphite). At this time, sulfuric acid (H2SO4) is inserted between the interlayer structures of the graphite, expanding the interlayer spacing.

[0124] The above mixture is mixed at 150 rpm to 500 rpm for 1 to 3 hours. Thereafter, the mixture and potassium permanganate (KMnO4) are mixed at a ratio of 1:5 to 1:15, and a rotational force of 1,200 rpm to 5,000 rpm is applied for 1 to 72 hours to promote interlayer expansion and separation of graphite.

[0125] At this time, appropriately managing the reaction time and rotational force through oxidation reaction control is crucial for controlling the interlayer spacing and producing single-layer graphene oxide. The graphene oxide produced through the above process is nanosized by applying ultrasonic waves of at least 10 W to 900 W. Nano-ization conditions vary depending on the size of the graphene oxide being nanosized.

[0126]

[0127] 1-2. Nano-firing of graphene oxide

[0128]

[0129] To enhance the frictional strength of the obtained graphene oxide, 50 to 100 times the amount of deionized water (DI water) or PBS solvent is added relative to the solid content of graphene oxide. A certain amount of graphene oxide mixed in the solvent is fed into a nano-processing device that uses a physical method to physically reduce the particle size of the graphene oxide. In addition, the ratio of each material applied when producing graphene oxide can act as a ratio that promotes the nano-processing of graphene oxide. In this experiment, nano-processed graphene oxide can be separated through a physical method in the nano-processing device. In addition, it can be separated by size through a centrifugal process. At this time, the centrifuge can be used by applying a rotation speed of 8,000 to 20,000 rpm depending on the size.

[0130]

[0131] Example 2. Confirmation of the structural and chemical properties of nano-graphene oxide.

[0132]

[0133] The structure and chemical properties of each nano-graphene oxide were verified through X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), Raman analysis, and Fourier-transform infrared spectroscopy (FT-IR), and the types of functional groups and bonds were confirmed. Furthermore, the microstructure and shape of the nano-graphene oxide were precisely analyzed through atomic force microscopy (AFM), and the nano-size and precision were confirmed through particle size analysis (laser diffraction).

[0134] As a result of X-ray diffractometer (XRD) analysis, it was confirmed that the nano-graphene oxide of the present invention was made by splitting graphene oxide into small pieces of 30 nm or less using high energy, and thus a peak was formed at around 10° (10.56°), which is similar to the 2θ value that fundamentally appears in graphene oxide (Fig. 1).

[0135] X-ray photoelectron spectroscopy (XPS) analysis results showed that the XPS wide peaks of nano graphene oxide represented C=0, C-O-C, and C-C bonds, respectively, and that oxygen accounted for approximately 30% / weight (Fig. 2).

[0136] Raman analysis results show that the main peaks of graphene, D, G, and 2D, are at 1342 cm -1 D peak at 1584cm -1 It was confirmed that a G peak was formed (Fig. 3). The nano-oxidized graphene of the present invention was manufactured to a small size using strong energy. As the particle size decreases, the disordered surface structure increases, so it can be confirmed that the ID / IG ratio gradually increases. In addition, the ID / IG ratio of the nano-oxidized graphene shows a value of 0.98.

[0137] As a result of Fourier-transform infrared spectroscopy (FT-IR) analysis, the FT-IR peak of the nano graphene oxide of the present invention was CO (1045 cm -1 ), C=O(1630cm -1 , 1729cm -1 ), CH(2859cm -1 ) is observed (Fig. 4). In addition, it was confirmed that the OH peak broadened due to damage caused by high energy during the nano-process.

[0138] Furthermore, as a result of analysis using the atomic force microscopy (AFM) method, it was confirmed that the particle size of the nano-graphene oxide was less than 35 nm in diameter, the thickness of the nano-graphene oxide was 0.34 nm, and the gap between layers was 0.7 nm. Since the gap between layers measured by AFM was less than about 1.2 nm, it was a single layer, and it was confirmed that the nano-graphene oxide of the present invention was made up mostly of single layers by minimizing the area and number of layers for nano-fabrication (Fig. 5).

[0139] In addition, the particle size of nano-graphene oxide was measured with a parameter count of more than 20,000 and was confirmed to be less than 35 nm, as analyzed by a particle size analysis method (laser diffraction method), and the average particle size (lateral size) was 16 nm (Fig. 6).

[0140]

[0141] Example 3. Fabrication of a variant of nano-graphene oxide

[0142]

[0143] 3-1. Fabrication of PEGylated nano-graphene oxide

[0144]

[0145] To attach nano-graphene oxide to PEG, nano-graphene oxide powder with a concentration of 0.1 to 1 wt% dispersed in deionized water (DI) was mixed with PEG powder at a ratio of 1:1 to 1:3 and mixed at room temperature for 5 to 60 minutes. EDC-HCl (Product No. 171440100, Thermo Scientific) was added to the mixture up to 5 to 20 wt% (weight ratio) of the PEG powder and mixed at room temperature for 10 minutes to 2 hours with a rotational force of 150 to 350 rpm. Upon completion of this process, EDC-HCl was additionally added up to 30 to 60% (weight ratio) of the PEG powder and mixed at a rotational force of 150 to 350 rpm for 12 to 24 hours. After the reaction is complete, the unreacted solvent is removed through a high-speed centrifuge, and the resulting slurry is used. When nano-graphene oxide and PEG react, the resulting nano-graphene oxide floats in ionized water due to its hydrophilic nature, so the supernatant is used after the high-speed centrifuge. The PEGylated nano-graphene oxide thus produced was analyzed using FT-IR (Figure 7).

[0146]

[0147] 3-2. Fabrication of aminated nano-graphene oxide (NXN)

[0148]

[0149] In order to amine nano-graphene oxide, dispersed in deionized water (DI) and mixed with sodium bisulfate having a concentration of 0.01 to 1.0 wt %, graphene oxide is mixed in a ratio of 1:0.001 to 1:0.1, and mixed for 30 minutes to 4 hours. After mixing in this way, the mixture is mixed in a weight ratio of 1:0.1 to 1:0.5 with ammonia water (concentration 25 to 30%) and heated to 150℃ in a high-pressure reactor to react ammonia water with nano-graphene oxide and attach amine groups to the graphene oxide. At this time, the pressure of the high-pressure reactor is set to 20 bar, and the reaction time is set to 12 to 24 hours depending on the amount. The reacted mixture is filtered through a filter with 0.22 mm pores to remove unreacted sodium bisulfate and ammonia water, thereby completing the process. The aminized nano-graphene oxide produced in this way was analyzed using FT-IR (Fig. 8).

[0150]

[0151] Example 4. Cytotoxicity test of nano graphene oxide

[0152]

[0153] To evaluate the toxicity of daNGO, GO-S7, and NGO-PEG to human dermal fibroblast cell lines, experiments were conducted to measure changes in cell viability by treating them at concentrations of 1 μg / mL and 10 μg / mL, respectively, for 24 and 72 hours (Fig. 9a). The experimental results showed that, compared to the control group and DI water, cell viability did not decrease significantly in most treatment groups despite increasing treatment concentration and time. In particular, NGO-PEG showed no cytotoxicity, as cell viability was stably maintained under all concentration and treatment time conditions.

[0154] Additionally, to evaluate the toxicity of human immune cell (Jurkat) cell lines, an experiment was conducted to measure changes in cell viability by treating NGO-PEG at seven concentrations ranging from 1 μg / mL to 500 μg / mL for 1 hour (Fig. 9b). The results showed that compared to the control group, no significant changes in cell viability were observed at any concentration of NGO-PEG, confirming that no cytotoxicity occurred.

[0155]

[0156] Example 5. Confirmation of the oral antibacterial effect of nano-graphene oxide.

[0157]

[0158] Tannerella forsythia, an oral bacterium that causes oral diseases such as gingivitis, periodontitis, and peri-implantitis, was cultured with agar medium (NAM agar) at 37°C under anaerobic conditions. The adjusted bacterial suspension (2.6 x 10 4 CFU / mL) was added to 1 mL of the test group and the control group (peptone water), stirred vigorously for 10 seconds, and then left at room temperature for 30 minutes. Centrifuged at 13,000 rpm for 2 minutes, the supernatant was removed, and PBS was added to wash twice. The original solution was serially diluted and inoculated into the medium, and the CFU was counted to measure the bacterial reduction rate using the following formula 1.

[0159]

[0160] [Formula 1]

[0161] Decrease rate (%) = [(Number of inoculations - Number of bacteria after time) / Number of inoculations] x 100

[0162]

[0163] As a result, when the nano-oxidized graphene (daNGO) of the present invention was treated at 0.1 wt% (1 μg / ml), the Tannerella forsythia bacteria reduction rate was 99.9% in a concentration-dependent manner, showing a similar reduction to the ethanol treatment group, which was the positive control group, confirming that the antibacterial effect was excellent (Figs. 10 and 11).

[0164] In addition, it was confirmed that the bacterial reduction rates were 42.4% and 27.4% when 0.1 wt% (1 μg / ml) and 0.01 wt% (0.1 μg / ml) of graphene oxide (GO-S7) were treated, while the bacterial reduction rates were 99.9% and 23.2% when 0.1 wt% (1 μg / ml) and 0.01 wt% (0.1 μg / ml) of nano graphene oxide (daNGO) were treated, confirming that the antibacterial effect was significantly greater in the nano (1 to 100 nm) size than in the submicron (100 nm to 1 μm) size. In other words, it was confirmed that the nano graphene oxide of the present invention has an antibacterial function and is excellent in removing bacteria in the oral cavity.

[0165]

[0166] Example 6. Confirmation of inhibition of nitric oxide (NO) production by nano-graphene oxide.

[0167]

[0168] We also evaluated the inflammatory response mediated by Porphyromonas gingivalis, another pathogen causing gingivitis, periodontitis, dental caries or peri-implantitis, and nitric oxide involved in the inflammatory mechanism.

[0169] 2.5 x 10 in a 24-well plate 5After seeding to cells / well, cultured RAW264.7 mouse macrophages (provided by the Korea Cell Line Bank) were treated with 1 μg / ml or 100 μg / ml of Porphyromonas gingivalis-derived LPS, and 10 μg / ml of nano-graphene oxide (daNGO), graphene oxide (GO-S7), and PEGylated nano-graphene oxide to conduct an experiment to produce NO (Fig. 12). The produced nitric oxide was calculated by measuring the absorbance at 535 nm using an NO assay kit (G2930, Griess Reagent System). Through this, it was confirmed whether the nano-graphene oxide of the present invention could inhibit the production of nitric oxide, and thereby prevent cell damage, oxidative stress, and destruction of periodontal tissue.

[0170] As a result, it was confirmed that submicron-sized (100 nm to 1 μm) graphene oxide (GO-S7) and PEGylated nano-graphene oxide (NGO-PEG) did not show a significant decrease in the amount of NO at a concentration of 10 μg / ml, whereas nano-sized (1 to 100 nm) graphene oxide (daNGO) significantly reduced the amount of nitric oxide (Fig. 13).

[0171] To confirm the nitric oxide inhibitory effect of daNGO according to concentration, LPS was treated at 1 μg / mL and daNGO was treated at 10, 50, and 100 μg / mL. As a result, compared to the control group, the group treated with 1 μg / mL of LPS showed a significant increase in nitrate production, confirming that the inflammatory response was activated. However, when daNGO was treated with LPS at concentrations of 10, 50, and 100 μg / mL, respectively, the nitric oxide production tended to decrease significantly depending on the concentration. These results show that daNGO exhibits an anti-inflammatory effect in a concentration-dependent manner (Fig. 14).

[0172]

[0173] Example 7. Confirmation of reduction in osteoclast differentiation promoting factors by nano-graphene oxide.

[0174]

[0175] Genetic analysis was performed to determine whether the expression of IL-1β gene and inflammatory cytokine TNF-α gene induced by LPS derived from Porphyromonas gingivalis was reduced by nano-graphene treatment. RAW264.7 mouse macrophages were treated with 1 μg / ml of LPS to induce the expression of oral bacteria-derived genes IL-1β and TNF-α, and the gene expression pattern was confirmed after treatment with nano-graphene at 10 μg / ml. For this purpose, 1x10 6 Cells were seeded at 10 cells / well and cultured for 24 hours. Afterwards, 1 μg / ml LPS was added to the culture medium as a control group, and 10 μg / ml nano-graphene oxide (daNGO) and aminated nano-graphene oxide (NXN) were mixed with 1 μg / ml LPS as an experimental group, and then cultured for 24 hours.

[0176] For genetic analysis, cells were washed in PBS, RNA was extracted using Trizol, and cDNA was synthesized using Superscript enzyme. Gene expression analysis was performed using real-time RT-PCR equipment with 40 cycles of annealing at 60°C.

[0177]

[0178] Gene Primer Species Sequence Product m IL-1β FForwardMouseGCCTCGTGCTGTCGGACCCATAT143bpm IL-1β RReverseMouseTCCTTTGAGGCCCAAGGCCACAm TNF-α FForwardMouseCCCCAAAGGGATGAGAAGTT132bpm TNF-α RReverseMouseCACTTGGTGGTTTGCTACGA

[0179]

[0180] As a result, it was confirmed that the IL-1β gene was not expressed by aminated nano-oxidized graphene (NXN) and nano-oxidized graphene when treated with nano-oxidized graphene (daNGO) of the present invention (Fig. 15). In addition, it was confirmed that the expression level of the inflammatory cytokine TNF-α gene was significantly reduced by nano-oxidized graphene of the present invention.

[0181] That is, it was confirmed that the nano-oxidized graphene of the present invention has an excellent effect in preventing tooth destruction by inhibiting osteoclast differentiation.

Claims

1. A pharmaceutical composition for preventing or treating oral diseases, comprising nano-oxide graphene or a variant thereof as an active ingredient.

2. In paragraph 1, A pharmaceutical composition, characterized in that the nano-oxide graphene variant is pegylated nano-oxide graphene or aminated nano-oxide graphene.

3. In paragraph 1, A pharmaceutical composition, wherein the average diameter of the nano-graphene oxide or its variant is 1 to 100 nm.

4. In paragraph 1, A pharmaceutical composition, characterized in that the oral disease is at least one selected from the group consisting of gingivitis, periodontitis, pulpitis, peri-implantitis, and caries.

5. In paragraph 1, The above composition ( ) Inhibition of the activity of oral disease-causing bacteria ( ) inhibiting nitric oxide production; and / or ( ) A pharmaceutical composition characterized by having an oral disease prevention or treatment effect through inhibition of osteoclast differentiation.

6. In paragraph 1, A pharmaceutical composition for preventing or treating gingivitis, comprising nano-graphene oxide or a variant thereof at a concentration of 0.01 to 0.5 wt%, wherein the disease is gingivitis, periodontitis or peri-implantitis mediated by Tannerella forsythia.

7. In paragraph 1, A pharmaceutical composition characterized in that it comprises nano-graphene oxide or a variant thereof at a concentration of 10 to 200 μg / ml, when the disease is gingivitis, periodontitis, caries or peri-implantitis mediated by Porphyromonas gingivalis.

8. In paragraph 1, A pharmaceutical composition characterized in that it comprises nano-oxide graphene or a variant thereof at a concentration of 1 to 50 μg / ml, when the disease is gingivitis or periodontitis induced by osteoclast hyperactivity.

9. An oral composition comprising nano-oxide graphene or a variant thereof as an active ingredient.

10. In paragraph 9, An oral composition, characterized in that the nano-oxide graphene variant is pegylated nano-oxide graphene or aminated nano-oxide graphene.

11. In paragraph 9, The above composition (ⅰ) Inhibition of the activity of oral disease-causing bacteria (ⅱ) inhibition of nitric oxide production; and / or (ⅲ) An oral composition characterized by having an oral disease prevention or treatment effect through inhibition of osteoclast differentiation.

12. In paragraph 9, An oral composition, characterized in that the composition is in at least one formulation selected from the group consisting of toothpaste, mouthwash, mouthwash, mouthwash, mouth spray, oral ointment, oral varnish, mouthwash, and gum massage cream.

13. A food composition for preventing or improving oral disease, comprising nano-oxide graphene or a variant thereof as an effective ingredient.

14. A food composition according to claim 13, characterized in that the nano-oxide graphene variant is pegylated nano-oxide graphene or aminated nano-oxide graphene.

15. A food composition according to claim 13, characterized in that the composition is in the form of a gum or candy.

16. A cosmetic composition for preventing or improving oral diseases, comprising nano-oxide graphene or a variant thereof as an effective ingredient.

17. A cosmetic composition according to claim 16, characterized in that the nano-oxide graphene variant is pegylated nano-oxide graphene or aminated nano-oxide graphene.

Images