Use of cyclo(his-pro) (CHP) for enhancing exercise performance, improving muscle function, or preventing, alleviating, or treating muscle diseases

Abstract

The present invention relates to uses of cyclo(his-pro) (CHP) for enhancing exercise performance, improving muscle function, or preventing, alleviating, or treating muscle diseases and, more specifically, provides a pharmaceutical composition, a food composition, a feed additive, a method for enhancing exercise performance, a method for improving muscle function or for preventing, alleviating, or treating muscle diseases, and a method for enhancing muscle strength, each using cyclo(his-pro) as an active ingredient, wherein the cyclo(his-pro) can be used not only in enhancing exercise performance and strengthening muscle strength by exhibiting effects of increasing muscle strength, movement coordination, resistance to muscle fatigue, sense of balance, and muscle energy production, but also in enhancing muscle function or preventing, alleviating, or treating muscle diseases by exhibiting effects of increasing muscle mass and muscle fiber size, inhibiting muscle loss, muscle atrophy, and improving muscle energy production.

Description

Uses of cyclo-hispro (CHP) for enhancing exercise performance, improving muscle function, or preventing, improving, or treating muscle diseases

[0001] This application claims priority to Republic of Korea Patent Application No. 10-2023-0183097, filed December 15, 2023, the entire disclosure of which is incorporated herein by reference.

[0002] The present invention relates to the use of cyclo-hispro (CHP) for improving exercise performance, improving muscle function, or preventing, improving, or treating muscle diseases, and more specifically, to a pharmaceutical composition, a food composition, a feed additive, and a method for improving exercise performance, a method for improving muscle function, or a method for preventing, improving, or treating muscle diseases, using the same, which utilizes cyclo-hispro as an active ingredient, and which exhibits effects of increasing muscle strength, increasing movement coordination, increasing resistance to muscle fatigue, increasing balance, and increasing muscle energy production, and which can be used for improving exercise performance and strengthening muscle strength, as well as effects of increasing muscle mass, increasing muscle fiber size, inhibiting muscle loss, inhibiting muscle atrophy, and increasing muscle energy production, and which can be used for improving muscle function or preventing, improving, or treating muscle diseases.

[0003] Muscle atrophy is a progressive loss of muscle mass, resulting in muscle weakness and degeneration. Muscle atrophy is accelerated by factors such as inactivity, oxidative stress, or chronic inflammation, and impairs muscle function and motor skills.

[0004] One representative method for improving muscle function by promoting energy consumption is to increase fatty acid oxidation by mitochondria to generate ATP energy. The number and capacity of mitochondria, which control this, are regulated by the coactivator PGC-1α (peroxisome proliferator-activated receptor-gamma coactivator 1 alpha), and PGC-1α activity has been found to be regulated by sirtuin 1 (SIRT1) (Non-patent Document 1).

[0005] When the transcription factor Fox (forhead box) moves from the cytoplasm to the nucleus, it increases the expression of the E3 ubiquitin ligase factors Atrogin-1 / MAFbx (muscle atrophy F-box) and MuRF-1 (muscle RINGfinger protein-1), which are involved in protein degradation (Non-patent Document 2). When their expression levels increase, protein degradation within the muscles is promoted, resulting in a decrease in muscle mass. Therefore, suppressing the expression of Atrogin-1 / MAFbx and MuRF-1 reduces the loss of muscle protein mass, thereby maintaining normal muscle function.

[0006] As the rapidly increasing elderly population leads to a focus on research investments in the development of treatments for geriatric diseases, the World Health Organization (WHO) created sarcopenia, a disease related to skeletal muscle atrophy, as a disease code (ICD-10-CM) in 2017, and treatment development for it is actively underway. However, to date, there are no drugs approved by the U.S. FDA for the treatment of sarcopenia.

[0007] Meanwhile, Cyclo-HisPro (CHP) is a naturally occurring circular dipeptide composed of histidine-proline, a metabolite of thyrotropin-releasing hormone (TRH), or a physiologically active dipeptide that is synthesized in the body de novo through the TRH metabolic process, and is widely distributed throughout the brain, spinal cord, and gastrointestinal tract.

[0008] CHP has been reported to improve diabetes and treat neurodegenerative diseases such as Alzheimer's disease. Furthermore, CHP has been reported to be effective in treating bone loss (Patent Document 1). However, its effects on improving muscle function, enhancing exercise performance, and treating muscle diseases remain unknown.

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] (Patent Document 1) Republic of Korea Publication No. 10-2019-0058346

[0012] [Non-patent literature]

[0013] (Non-patent Document 1) Gerhart-Hines Z, Rodgers JT, Bare O, Lerin C, Kim SH, Mostoslavsky R, Alt FW, Wu Z, Puigserver P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1 / PGC-1alpha. EMBO J. 2007 Apr 4;26(7):1913-23.

[0014] (Non-patent Document 2) Bonaldo P, Sandri M. Cellular and molecular mechanisms of muscle atrophy. Dis Model Mech. 2013 Jan;6(1):25-39.

[0015] The purpose of the present invention is to provide a composition for improving exercise performance, which contains cyclo-hispro as an active ingredient.

[0016] Another object of the present invention is to provide a composition for improving muscle function or preventing, improving or treating muscle disease, comprising cyclo-hispro as an active ingredient.

[0017] Another object of the present invention is to provide a composition for strengthening muscle, which comprises cyclo-hispro as an active ingredient.

[0018] Another object of the present invention is to provide a method for improving exercise performance, a method for improving muscle function, a method for preventing, improving or treating muscle disease and a method for strengthening muscle strength using cyclo-hispro.

[0019] Another object of the present invention is to provide a use of cyclo-hispro for the manufacture of a drug or health functional food for improving exercise performance, improving muscle function, preventing, improving or treating muscle diseases and strengthening muscle strength.

[0020] To solve the above-described problem, the present invention provides a pharmaceutical composition for improving exercise performance comprising cyclo-hispro or a pharmaceutically acceptable salt thereof.

[0021] In addition, the present invention provides a health functional food composition for improving exercise performance, comprising cyclo-hispro or a food-wise acceptable salt thereof.

[0022] In addition, the present invention provides a feed additive for improving exercise performance comprising cyclo-hispro or a salt thereof.

[0023] In addition, the present invention provides a method for improving exercise performance, comprising administering an effective amount of cyclo-hispro or a salt thereof to a subject in need thereof.

[0024] In addition, the present invention provides a use of cyclo-hispro or a salt thereof for the manufacture of a drug or health functional food for improving exercise performance.

[0025] In the present invention, the cyclo-hispro or a salt thereof may exhibit one or more of the following effects:

[0026] i) Increased muscle strength;

[0027] ii) Increased motor coordination;

[0028] iv) increased sense of balance; and

[0029] v) Increased muscle energy production.

[0030] Additionally, the present invention provides a pharmaceutical composition for improving muscle function or preventing or treating muscle disease, comprising cyclo-hispro or a pharmaceutically acceptable salt thereof.

[0031] In addition, the present invention provides a health functional food composition for improving muscle function or preventing or improving muscle disease, comprising cyclo-hispro or a food-wise acceptable salt thereof.

[0032] In addition, the present invention provides a feed additive for improving muscle function or preventing or improving muscle disease, comprising cyclo-hispro or a salt thereof.

[0033] The present invention also provides a method for improving muscle function or preventing, improving or treating muscle disease, comprising administering an effective amount of cyclo-hispro or a salt thereof to a subject in need thereof.

[0034] In addition, the present invention provides the use of cyclo-hispro or a salt thereof for the manufacture of a medicine or health functional food for improving muscle function or preventing, improving or treating muscle disease.

[0035] In the present invention, the muscle disease may be a muscle disease caused by muscle dysfunction, muscle atrophy, muscle wasting, or muscle degeneration.

[0036] In the present invention, the muscle disease may be at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, sarcopenia, myocardia, and acardiotrophy.

[0037] In the present invention, the cyclo-hispro or a salt thereof may exhibit one or more of the following effects:

[0038] i) Increased muscle strength;

[0039] ii) Increased motor coordination;

[0040] iii) Increased tolerance to muscle fatigue;

[0041] iv) increased sense of balance; and

[0042] v) Increased muscle energy production.

[0043] Furthermore, the present invention provides a composition for strengthening muscle comprising cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof.

[0044] The present invention also provides a method for strengthening muscle, comprising administering an effective amount of cyclo-hispro or a salt thereof to a subject in need thereof.

[0045] In addition, the present invention provides a use of cyclo-hispro or a salt thereof for the manufacture of a muscle strengthening agent or health functional food.

[0046] The composition comprising cyclo-hispro of the present invention exhibits effects of increasing muscle strength, increasing movement coordination, increasing resistance to muscle fatigue, increasing sense of balance, and increasing muscle energy production, and can be used as a medicine, health functional food, or feed additive for improving exercise performance or strengthening muscle strength. It also exhibits effects of increasing muscle mass, increasing muscle fiber size, inhibiting muscle atrophy, inhibiting muscle loss, and increasing muscle energy production, and can be used as a medicine, health functional food, or feed additive for improving muscle function or preventing, improving, or treating various muscle diseases.

[0047] Figure 1 shows the survival rate of mice in each group during the experimental period.

[0048] Figures 2a to 2c show the results of confirming the effect of CHP administration on improving muscle function and enhancing exercise performance in an aged animal model. Figure 2a shows the results of grip strength measurement, Figure 2b shows the results of limb hanging test, and Figure 2c shows the results of sensorimotor function evaluation.

[0049] Figure 3a shows the changes in the weight of gastrocnemius (GM), tibialis anterior (TA), and cardiac muscle tissues following CHP administration in aged animals.

[0050] Figures 3b to 3d show changes in the cross-sectional area of ​​muscle fibers according to CHP administration in an aged animal model. Figure 3b is a photograph of a cross-section of muscle fibers of GM muscle stained with H&E, Figure 3c shows the average cross-sectional area of ​​muscle fibers measured, and Figure 3d shows the distribution of muscle fibers by cross-sectional area size expressed as a percentage.

[0051] Figure 4 shows changes in gene expression in GM and TA muscles following CHP administration in an aged animal model.

[0052] Figure 5 shows changes in citrate synthase activity in TA muscles following CHP administration in an aged animal model.

[0053] Figure 6 shows changes in gene expression related to cardiac atrophy following CHP administration in an aged animal model.

[0054] Figure 7a shows the results of grip strength measurements according to the CHP prevention protocol in the mdx animal model.

[0055] Figure 7b shows the results of grip strength measurements according to the CHP treatment protocol in the mdx animal model.

[0056] Figure 8 shows the results of the hanging test according to the CHP treatment protocol in the mdx animal model.

[0057] Figures 9a to 9f show the results of confirming the effect of maintaining force generation according to the CHP prevention protocol in the mdx animal model. Figure 9a shows the force-frequency relationship of the extensor digitorum longus (EDL), Figure 9b shows the maximum specific isometric force of the EDL developed by 25 Hz stimulation, Figure 9c shows the maximum specific isometric force of the EDL developed during the test, Figure 9d shows the force-frequency relationship of the soleus muscles, Figure 9e shows the maximum specific isometric force of the soleus muscle developed by 25 Hz stimulation, and Figure 9f shows the maximum specific isometric force of the soleus muscle developed during the test.

[0058] Figures 10a to 10d show Ca according to the CHP prevention protocol in the mdx animal model. 2+ To evaluate the effect of CHP on dysregulation, Fig. 10a shows Ca stimulation with 2.5 mM caffeine.2+ Amplitude (SR storage) is expressed as a percentage of response of fibers isolated from BL10 mice (n=10-12), and Fig. 10b shows SR Ca after stimulation with 2.5 mM caffeine. 2+ Absorption of Ca 2+ It is expressed as a percentage of the peak (n=10-12), and Fig. 10c shows Ca after stimulation with 1 μM thapsigargin. 2+ Amplitude (SR storage) is expressed as a percentage of response of fibers isolated from BL10 mice (n=6-14), and Fig. 10d shows SR Ca after stimulation with 1 μM thapsigargin. 2+ Absorption of Ca 2+ It is expressed as a percentage of the peak (n=6-14).

[0059] Hereinafter, the present invention will be described in more detail.

[0060] As mentioned above, with the rapid increase in the elderly population, active development of treatments for sarcopenia related to skeletal muscle atrophy is underway, but to date, there are no drugs that have shown a clear therapeutic effect.

[0061] Accordingly, the present inventors have confirmed that cyclo-hispro not only significantly enhances muscle strength, motor coordination, resistance to muscle fatigue, sense of balance, and muscle energy production, but also suppresses the expression of various genes related to aging and muscle atrophy and promotes the expression of genes related to anti-aging and antioxidants, including mitochondrial function, thereby exhibiting excellent effects in improving exercise performance, strengthening muscle strength, improving muscle function, and preventing, improving, or treating muscle diseases, and have completed the present invention.

[0062] Accordingly, the first aspect of the present invention relates to a composition for improving exercise performance comprising cyclo-hispro or a salt thereof, consisting essentially of said cyclo-hispro or a salt thereof, or consisting of said cyclo-hispro or a salt thereof.

[0063] Specifically, the composition comprises cyclo-hispro or a pharmaceutically acceptable salt thereof, or consists essentially of cyclo-hispro or a pharmaceutically acceptable salt thereof, or consists of cyclo-hispro or a pharmaceutically acceptable salt thereof; a health functional food composition for improving exercise performance comprising cyclo-hispro or a food-based acceptable salt thereof, or consists essentially of cyclo-hispro or a food-based acceptable salt thereof, or consists of cyclo-hispro or a food-based acceptable salt thereof; Or it may be a feed additive for improving exercise performance comprising cyclo-hispro or a salt thereof, consisting essentially of the cyclo-hispro or a salt thereof, or consisting of the cyclo-hispro or a salt thereof.

[0064] In relation to the first aspect, the present invention provides a method for improving exercise performance, comprising administering an effective amount of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof to a subject in need thereof.

[0065] In connection with the first aspect, the present invention also provides the use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for improving exercise performance.

[0066] In relation to the first aspect, the present invention also provides the use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a drug or health functional food for improving exercise performance.

[0067] In the present invention, the cyclo-hisp may be synthesized or commercially available. Furthermore, it may be purified from substances containing cyclo-hisp, such as prostate extracts and soybean hydrolysates.

[0068] The term "purified" is intended to indicate that cyclo-hisprolate is in a more concentrated form than its natural source, such as prostate extract. Purified ingredients can be concentrated from their natural sources or obtained through chemical synthesis.

[0069] The term "exercise performance capacity" in the present invention refers to the ability to perform physical movements performed in daily life or sports quickly, strongly, for a long time, and skillfully. Exercise performance capacity is defined by factors such as muscle strength, balance, motor coordination, agility, and endurance. Furthermore, the enhancement of exercise performance capacity in the present invention is considered a beneficial physiological effect even in individuals engaged in everyday physical activities not related to exercise.

[0070] The term "muscle fatigue" in the present invention refers to a state in which the ability to perform physical activity is temporarily reduced after intense exercise or prolonged exercise, and is accompanied by a decrease in muscle contractility, etc. Muscle fatigue may manifest as symptoms such as fatigue, decreased endurance, decreased power, or lethargy.

[0071] The term "endurance" in the present invention is defined as resistance to fatigue. This refers to resistance to fatigue that occurs during submaximal (before maximal effort) sustained exercise or intense exercise. Endurance exercise typically lasts 30 minutes or longer. Specifically, exercise lasting 4-5 hours or longer is also referred to as ultra-endurance exercise. Furthermore, the enhancement of endurance is considered a beneficial physiological function for performing exercises that are not time-limited (e.g., recreational running, walking, swimming, cycling, gymnastic training, etc.).

[0072] In a specific embodiment of the present invention, the effect of cyclo-hispro on improving motor performance was evaluated by performing grip strength measurement, limb hanging test, and sensorimotor function evaluation on an aged animal model treated with cyclo-hispro.

[0073] As a result, as shown in Figures 2a to 2c, the cyclo-hispro administered group showed a significant increase in maximum muscle strength and hanging time, and a significant improvement in sensorimotor function compared to the vehicle-treated control group, demonstrating effects of enhancing muscle strength, motor coordination, tolerance to muscle fatigue, and sense of balance. Accordingly, the cyclo-hispro according to the present invention can be utilized in various ways, such as a pharmaceutical product, health functional food, and feed additive, for the purpose of improving exercise performance.

[0074] Additionally, cyclo-hispro or a salt thereof according to the present invention may be administered to a subject for the purpose of improving exercise performance. Accordingly, a method for improving exercise performance is provided, comprising administering cyclo-hispro or a salt thereof to a subject in need thereof.

[0075] A second aspect of the present invention relates to a composition for improving muscle function or preventing, improving or treating muscle disease, comprising cyclo-hispro or a salt thereof, consisting essentially of or consisting of cyclo-hispro or a salt thereof.

[0076] Specifically, the composition comprises cyclo-hispro or a pharmaceutically acceptable salt thereof, or consists essentially of cyclo-hispro or a pharmaceutically acceptable salt thereof, or consists of cyclo-hispro or a pharmaceutically acceptable salt thereof; a health functional food composition for improving muscle function or preventing or improving muscle disease, or comprising cyclo-hispro or a food-based acceptable salt thereof, or consists essentially of cyclo-hispro or a food-based acceptable salt thereof, or consists of cyclo-hispro or a food-based acceptable salt thereof; Or it may be a feed additive for improving muscle function or preventing or improving muscle disease comprising cyclo-hispro or a salt thereof, consisting essentially of the cyclo-hispro or a salt thereof, or consisting of the cyclo-hispro or a salt thereof.

[0077] In relation to the second aspect, the present invention provides a method for improving muscle function or preventing, improving or treating muscle disease, comprising administering an effective amount of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof to a subject in need thereof.

[0078] In connection with the second aspect, the present invention also provides the use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for improving muscle function or preventing, improving or treating muscle diseases.

[0079] In relation to the second aspect, the present invention also provides the use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a medicine or health functional food for improving muscle function or preventing, improving or treating muscle disease.

[0080] In the present invention, the description of cyclo-hispro used as an effective ingredient is the same as that described in the first aspect above, and therefore, its description is omitted.

[0081] In the present invention, the muscle disease is preferably a disease reported in the art as a muscle disease caused by muscle dysfunction, muscle atrophy, muscle wasting or muscle degeneration, and may be at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, sarcopenia, myocardia and acardiotrophy, but is not limited thereto.

[0082] The above-mentioned muscle dysfunction, muscle atrophy, muscle wasting or muscle degeneration may be caused by genetic factors, acquired factors, diseases that cause muscle loss or weakening, or aging, and according to one embodiment, may be caused by aging. Alternatively, the muscle dysfunction, muscle atrophy, muscle wasting or muscle degeneration may be a side effect of disease treatment, for example, a side effect of anticancer treatment. The muscle wasting is characterized by a gradual loss of muscle mass, and weakening and degeneration of muscles, particularly skeletal muscles or voluntary muscles and cardiac muscles. In particular, in the present invention, a "muscle disease" may be a disease in which muscle dysfunction, muscle atrophy, muscle wasting or muscle degeneration occurs due to aging of the muscle itself, for example, skeletal muscles or cardiac muscles, regardless of the death of motor neurons in the central nervous system, or a disease in which muscle dysfunction, muscle atrophy, muscle wasting or muscle degeneration occurs due to a genetic mutation.

[0083] As used herein, “old age” or “aging” is generally defined as a noticeable decline or loss of muscle mass beginning around age 50, with sarcopenia (age-related muscle loss) becoming more pronounced around age 60.

[0084] In a specific embodiment of the present invention, changes in muscle weight and muscle fiber size were confirmed in an aged animal model treated with cyclo-hispro.

[0085] As a result, as shown in Figures 3a to 3d, it was confirmed that the cyclo-hispro administered group had an increase in the muscle weight of the tibialis anterior (TA) muscle and an increase in the average cross-sectional area of ​​muscle fibers compared to the vehicle-treated control group. Therefore, the cyclo-hispro according to the present invention can be effectively used not only to improve muscle function through an increase in muscle mass and muscle fiber size, but also to prevent, improve, or treat muscle diseases caused by decreased muscle function, muscle atrophy, muscle wasting, or muscle degeneration.

[0086] E3 ubiquitin ligase factors Atrogin-1 / MAFbx (Muscle atrophy F-box) and MuRF-1 (Muscle RING-finger protein-1) are involved in protein degradation, and when their expression levels increase, protein degradation in muscles is promoted, resulting in a decrease in muscle mass.

[0087] PGC-1α is a key factor in regulating energy metabolism in muscle. It regulates fatty acid oxidation and increases energy production by promoting mitochondrial biogenesis. Furthermore, PGC-1α is known to activate transcription factors such as NRF1, TFAM, and Sirt-1, which influence mitochondrial proliferation, energy homeostasis, and respiration.

[0088] In addition, genes known to be related to aging and muscle atrophy include Myostatin, Foxo-1, Dystrophin, Sirt-3, and Nrf-2, and genes known to be related to mitochondrial biogenesis include Err-α, Cox-4, Drp-1, Tf1bm, and Tf2bm.

[0089] Accordingly, in a specific embodiment of the present invention, the expression levels of the genes presented in Table 2 were confirmed in an aged animal model treated with cyclo-hispro, thereby evaluating the effect of cyclo-hispro on improving muscle function and preventing, improving, or treating muscle disease.

[0090] As a result, as shown in Fig. 4, the cyclo-hispro administered group showed a significant decrease in the gene expression levels of Myostatin, Atrogin-1, Foxo-1, and Dystrophin in skeletal muscle compared to the vehicle-treated control group, confirming that cyclo-hispro can be effectively used to prevent, improve, or treat muscle diseases caused by decreased muscle function, muscle atrophy, muscle wasting, or muscle degeneration through its muscle wasting inhibition and muscle atrophy inhibition activities.

[0091] In addition, as shown in Fig. 4, it was confirmed that the cyclo-hispro administered group significantly increased the gene expression levels of PGC-1α, Nrf-2, Sirt-1, Sirt-3, Drp-1, Err-α, Cox-4, Tf1bm and Tf2bm in skeletal muscle compared to the vehicle-treated control group. Therefore, the cyclo-hispro according to the present invention helps muscle energy production by increasing the expression of mitochondrial-mediated energy metabolism regulators, and suppresses muscle atrophy, thereby improving muscle function and can be effectively used for the treatment of muscle diseases caused by decreased muscle function, muscle atrophy, muscle wasting or muscle degeneration.

[0092] Oxidative enzymes in the Krebs cycle (or TCA cycle) are used as biomarkers for energy production and supply efficiency. Citrate synthase is the enzyme that catalyzes citrate synthesis in the first step of the TCA cycle. If the TCA cycle does not function smoothly, blood lactate accumulates, leading to fatigue.

[0093] Accordingly, in a specific embodiment of the present invention, the activity changes of citrate synthase in an aged animal model treated with cyclo-hispro were confirmed, thereby evaluating the effects of cyclo-hispro on improving exercise performance, improving muscle function, and preventing, improving, or treating muscle diseases.

[0094] As a result, as shown in Fig. 5, it was confirmed that the cyclo-hispro administered group was effective in improving exercise performance, improving muscle function, and preventing, improving, or treating muscle diseases by increasing the activity of citrate synthase in skeletal muscle compared to the vehicle-treated control group, thereby promoting recovery from muscle fatigue and increasing energy production and supply efficiency.

[0095] In another specific embodiment of the present invention, to evaluate whether cyclo-hispro can suppress muscle loss and muscle atrophy of not only skeletal muscle but also cardiac muscle, the gene expression levels of Atrogin-1 and Murf-1 were determined in the cardiac muscle of an aged animal model treated with cyclo-hispro.

[0096] As a result, as shown in Fig. 6, the cyclo-hispro administration group significantly reduced the gene expression levels of Atrogin-1 and Murf-1 in the myocardium compared to the vehicle-treated control group, thereby confirming that it can be effectively used for the prevention, improvement, or treatment of diseases caused by abnormalities in the myocardium through the inhibition of myocardial loss and myocardial atrophy.

[0097] In the present invention, the disease caused by the cardiac muscle abnormality may be, for example, cardiomyopathy or cardiac atrophy that occurs primarily in the cardiac muscle itself, but is not limited thereto.

[0098] Acardiotrophy is caused by starvation, wasting diseases (such as cancer), and aging. Myocardial fibers become thin and thin, and their nuclei become condensed and immobile. Consequently, muscle fascicles also lose volume, the entire heart becomes smaller, subepicardial adipose tissue significantly decreases, and coronary arteries become tortuous. Lipofuscine, a brown pigment, appears at both ends of the nuclei of myocardial fibers, and with the decrease in adipose tissue, the entire heart takes on a brownish tint.

[0099] The most common muscular dystrophy is X-linked Duchenne / Becker muscular dystrophy, but there are also several other types, such as ligamentous, facioscapulohumeral, spastic, and Fukuyama, depending on the type of protein that makes up the muscle membrane.

[0100] Duchenne muscular dystrophy (DMD) is one of the most devastating and progressive inherited muscular dystrophies that appears in childhood. It is caused by mutations in the dystrophin gene and is a recessive X-linked genetic disorder that affects 1 in 3,500 male births. Notably, female carriers can also develop the condition. Dystrophin is a key member of the dystrophin-associated protein complex (DAPC), which is the basic link between the cytoskeleton of muscle fibers and the extracellular matrix (ECM). A lack of functional dystrophin leads to the degradation of DAPC, resulting in the loss of stable cytoskeleton-ECM connections, weakening the sarcolemma and predisposing muscle fibers to contractile damage.

[0101] The first clinical signs appear between the ages of two and three, with children exhibiting motor developmental delays that make it difficult to walk or jump. Dystrophy first affects the proximal muscles and then spreads to the distal limbs, leaving children wheelchair-bound by age 12. Dystrophy eventually affects the respiratory muscles, necessitating mechanical ventilation. The heart muscle also weakens, ultimately leading to cardiomyopathy. Indeed, respiratory and heart failure are the two leading causes of death in DMD.

[0102] Despite all the therapeutic advances over the past several decades, there is still no approved cure for DMD. Nevertheless, improvements in treatment protocols and symptom management can delay the progression of DMD and improve patients' quality of life. With appropriate treatment, the life expectancy of DMD patients today is approximately 28 years. The current standard of care is corticosteroid therapy, which reduces chronic inflammation and delays inflammation-induced muscle damage. However, long-term use of corticosteroids can lead to various side effects, including weight gain, growth retardation, and osteoporosis.

[0103] The most widely used animal model of DMD is the Dmdmdx (mdx) mouse. This model, generated on a C57BL / 10ScSn background, carries a nonsense mutation in exon 23 of the dystrophin gene, resulting in an early stop codon and, therefore, a truncated form of the protein.

[0104] In a specific embodiment of the present invention, the effect of cyclo-hispro on improving exercise performance was evaluated by measuring grip strength and performing a limb hanging test according to the cyclo-hispro prevention and treatment protocol in an mdx mouse model. As a result, as shown in Figures 7a, 7b, and 8, the cyclo-hispro administration group showed a significant increase in grip strength and hanging time compared to the water-treated mdx control group, confirming the effect of increasing limb muscle strength and exercise endurance.

[0105] In another specific embodiment of the present invention, the contractile and force production effects were evaluated in extensor digitorum longus (EDL) and soleus muscles isolated from an mdx mouse model to which a cyclo-hispro prophylactic protocol was applied. As a result, as shown in Figures 9a to 9f, the muscles of mdx mice showed overall lower force production and a downward shift in the force-frequency relationship compared to BL10 mice. The performance of the EDL and soleus muscles was improved by CHP, and the maximal contractile force was partially restored. This suggests that the known cyclo-hispro treatment maintains force production.

[0106] In another specific embodiment of the present invention, Ca 2+ To evaluate the effect of cyclo-hispro on dysregulation, Ca was collected from the sarcoplasmic reticulum (SR) of flexor digitorum brevis (FDB) muscle isolated from the mdx mouse model subjected to the cyclo-hispro prophylaxis protocol. 2+ The release / absorption recovery effect was evaluated. As a result, as shown in Fig. 10a, caffeine-induced Ca in SR 2+ The response to release was restored by cyclo-hispro, and Ca release through store-operated calcium channels (SOC) after SR depletion was shown in Fig. 10b. 2+ Absorption is generally Ca 2+ Although upregulated in mdx as a compensatory mechanism for depletion, CHP is Ca 2+ Normalizing absorption to Ca 2+ Handling was maintained appropriately. In addition, to directly quantify SOCE, thapsigargin was used instead of caffeine to measure SR Ca 2+As a result of performing the release stimulation, a similar trend of cyclo-hispro-induced normalization was confirmed as shown in Figures 10c and 10d.

[0107] Additionally, cyclo-hispro or a salt thereof according to the present invention may be administered to a subject for the purpose of improving muscle function or preventing, improving, or treating muscle diseases. Accordingly, a method for improving muscle function or preventing, improving, or treating muscle diseases is provided, comprising administering cyclo-hispro or a salt thereof to a subject in need thereof.

[0108] A third aspect of the present invention relates to a composition for strengthening muscle, comprising cyclo-hispro or a salt thereof, consisting essentially of said cyclo-hispro or a salt thereof, or consisting of said cyclo-hispro or a salt thereof.

[0109] Specifically, the composition comprises a pharmaceutical composition for muscle strengthening comprising cyclo-hispro or a pharmaceutically acceptable salt thereof, consisting essentially of the cyclo-hispro or a pharmaceutically acceptable salt thereof, or consisting of the cyclo-hispro or a pharmaceutically acceptable salt thereof; a health functional food composition for muscle strengthening comprising cyclo-hispro or a food-based acceptable salt thereof, consisting essentially of the cyclo-hispro or a food-based acceptable salt thereof, or consisting of the cyclo-hispro or a food-based acceptable salt thereof; Or it may be a muscle strengthening feed additive comprising cyclo-hispro or a salt thereof, consisting essentially of said cyclo-hispro or a salt thereof, or consisting of said cyclo-hispro or a salt thereof.

[0110] In relation to the third aspect, the present invention provides a method for strengthening muscle, comprising administering an effective amount of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof to a subject in need thereof.

[0111] In connection with the third aspect, the present invention also provides the use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for muscle strengthening.

[0112] In relation to the third aspect, the present invention also provides the use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a muscle strengthening agent or health functional food.

[0113] In the present invention, the description of cyclo-hispro used as an effective ingredient is the same as that described in the first aspect above, and therefore, its description is omitted.

[0114] The term "strength enhancement" of the present invention refers to the effects of enhancing physical performance, enhancing maximum endurance, increasing muscle mass, enhancing muscle recovery, reducing muscle fatigue, improving energy balance, or a combination thereof.

[0115] Cyclo-hispro or a salt thereof according to the present invention, as described in the first and second aspects, not only exhibits effects of increasing muscle strength, increasing movement coordination, increasing resistance to muscle fatigue, and increasing sense of balance, but also exhibits effects of increasing muscle mass, increasing muscle fiber size, inhibiting muscle atrophy, inhibiting muscle loss, and increasing muscle energy production, and thus can be utilized in various ways as a medicine, health functional food, and feed additive for the purpose of strengthening muscle strength.

[0116] Additionally, cyclo-hispro or a salt thereof according to the present invention can be administered to a subject for the purpose of strengthening muscle strength. Accordingly, a method for strengthening muscle strength is provided, comprising administering cyclo-hispro or a salt thereof to a subject in need thereof.

[0117] The term "prevention" as used in the present invention means any act of inhibiting or delaying the onset of a muscle disease by administering a composition according to the present invention.

[0118] The term "improvement" as used in the present invention means any action that at least reduces a parameter related to the condition being treated, for example, the severity of a symptom.

[0119] The term "treatment" used in the present invention means any action in which symptoms of a muscle disease are improved, symptoms are prevented from worsening, or symptoms are beneficially changed by administration of a composition according to the present invention.

[0120] The term "increase" as used herein means, for example, an increase in the expression of a specific biomarker gene or protein, which is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more higher, compared to a control group that is not administered the active ingredient or the composition comprising, consisting essentially of, or consisting of the active ingredient of the present invention under the same conditions.

[0121] The term "decrease or reduction" or "suppression" as used herein, for example, decrease or suppression of the expression of a specific biomarker gene or protein, means that the expression of a specific biomarker gene or protein is lower by about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, when compared to a control group that is not administered the active ingredient or the composition comprising, consisting essentially of, or consisting of the active ingredient of the present invention under the same conditions.

[0122] The term "improvement" as used in the present invention, for example, improvement in exercise performance or improvement in muscle function, means an increase of about 5% or more, about 10% or more, about 15% or more, about 20% or more, when compared under the same conditions with a control group that was not administered the active ingredient or the composition comprising, consisting essentially of, or consisting of the active ingredient of the present invention.

[0123] In the present invention, the term "pharmaceutically acceptable" means physiologically acceptable and does not typically cause an allergic reaction or similar reaction when administered to a human, and the salt is preferably an acid salt formed by a pharmaceutically acceptable free acid.

[0124] The pharmaceutically acceptable salt may be an acid addition salt formed using an organic acid or an inorganic acid, wherein the organic acid includes, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxy acetic acid, benzenesulfonic acid, p-toluenesulfonic acid or methanesulfonic acid. The inorganic acid includes, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid or boric acid. The acid addition salt may preferably be in the form of a hydrochloride or an acetate salt, and more preferably in the form of a hydrochloride salt.

[0125] In addition, other possible salt forms include gabapentin salt, gabapentin salt, pregabalin salt, nicotinate salt, adipate salt, hemimalonate salt, cysteine ​​salt, acetylcysteine ​​salt, methionine salt, arginine salt, lysine salt, ornithine salt, or aspartate salt, etc.

[0126] In addition, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may further include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Carriers for parenteral administration may include water, suitable oils, saline solutions, aqueous glucose, and glycols, and the like. In addition, stabilizers and preservatives may further be included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

[0127] The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.

[0128] The pharmaceutical composition of the present invention may be formulated as a preparation for oral administration or parenteral administration according to the administration route as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS), carbohydrates (e.g., glucose, mannose, sucrose, or dextran, etc.), antioxidants, bacteriostats, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.

[0129] Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

[0130] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents, such as water or liquid paraffin, various excipients may be included, such as wetting agents, sweeteners, flavoring agents, or preservatives.

[0131] Additionally, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrating agent in some cases, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.

[0132] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. In the case of injections, they must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the above injection from microbial contamination, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal, may be additionally included. In addition, the above injection may, in most cases, additionally include an isotonic agent, such as sugar or sodium chloride.

[0133] Transdermal administration agents include ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" as used herein refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

[0134] For inhalation administration, the compounds used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. For pressurized aerosols, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0135] The pharmaceutical composition of the present invention, when containing an effective amount of cyclo-hispro or a pharmaceutically acceptable salt thereof, can provide a desirable effect of improving exercise performance, improving muscle function, and / or preventing, improving, or treating muscle disease. As used herein, the term "effective amount" refers to an amount that exhibits a greater response than a negative control, and preferably refers to an amount sufficient to improve exercise performance, improve muscle function, and / or prevent, improve, or treat muscle disease. The pharmaceutical composition of the present invention may contain 0.01 to 99.9% of cyclo-hispro or a pharmaceutically acceptable salt thereof based on the total amount of the composition, and the remainder may be comprised of a pharmaceutically acceptable carrier. The effective amount of cyclo-hispro or a pharmaceutically acceptable salt thereof contained in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is commercialized, etc.

[0136] The total effective amount of the pharmaceutical composition of the present invention can be administered to a patient as a single dose, or can be administered as multiple doses over a long period of time using a fractionated treatment protocol. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the patient's condition. For example, the pharmaceutical composition may be administered once or several times in an amount of preferably 0.001 to 100 mg, more preferably 0.01 to 10 mg per kg of body weight per day, based on cyclo-hispro or a pharmaceutically acceptable salt thereof. However, since the dosage of the cyclo-hispro or a pharmaceutically acceptable salt thereof is determined as an effective dosage for a patient by taking into consideration various factors such as the route of administration and number of treatments of the pharmaceutical composition as well as the patient's age, weight, health condition, sex, severity of disease, diet, and excretion rate, taking these into consideration, a person having ordinary skill in the art will be able to determine an appropriate effective dosage of the cyclo-hispro or a pharmaceutically acceptable salt thereof for a specific use for improving exercise performance, improving muscle function, and / or preventing, improving, or treating muscle disease. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route, and administration method as long as it exhibits the effects of the present invention.

[0137] In the present invention, the term "food-wise acceptable" means physiologically acceptable and does not typically cause an allergic reaction or similar reaction when ingested by humans, and the salt is preferably an acid salt formed by a food-wise acceptable free acid.

[0138] In the present invention, preferred examples of “food-grade acceptable salt” may include the types of “pharmaceutically acceptable salt” described above.

[0139] In the present invention, the term “health functional food” includes both the meanings of “functional food” and “health food.”

[0140] In the present invention, the term "functional food" is the same as food for special health use (FoSHU), and refers to a food with high medical and therapeutic effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition.

[0141] In the present invention, the term "health food" refers to a food that has a more active health maintenance or promotion effect than regular food, and "health supplement food" refers to a food for health supplement purposes. In some cases, the terms "functional food," "health food," and "health supplement food" may be used interchangeably. The aforementioned food may be manufactured in various forms, such as tablets, capsules, powders, granules, liquids, and pills.

[0142] As a specific example of such functional foods, processed foods can be manufactured by using the composition to improve the storage properties of agricultural, livestock or marine products while simultaneously modifying them to preserve their characteristics.

[0143] The health functional food composition of the present invention can also be manufactured in the form of nutritional supplements or dietary supplements, food additives, etc., and is intended for human consumption.

[0144] The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (e.g., ham, sausages, corned beef, etc.), breads and noodles (e.g., udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (e.g., butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.), etc., which can be manufactured by adding cyclo-hyspro or a food-chemically acceptable salt thereof.

[0145] In addition, nutritional supplements may be manufactured by adding cyclo-hispro or a food-based acceptable salt thereof to capsules, tablets, pills, etc., but are not limited thereto.

[0146] In addition, as a health functional food, it is not limited thereto, but for example, the cyclo-hispro or its food-scientifically acceptable salt can be manufactured in the form of tea, juice, and drink and consumed by being liquefied, granulated, encapsulated, and powdered so that it can be consumed (health drink). In addition, in order to use the cyclo-hispro or its food-scientifically acceptable salt in the form of a food additive, it can be manufactured in the form of a powder or concentrate. In addition, the cyclo-hispro or its food-scientifically acceptable salt can be manufactured in the form of a composition by mixing it with a known active ingredient known to be effective in improving exercise performance, improving muscle function, and / or preventing, improving, or treating muscle diseases.

[0147] When the food composition of the present invention is used as a health beverage composition, the health beverage composition may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages. The natural carbohydrates described above may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. The sweetener may be a natural sweetener such as thaumatin and stevia extract; or a synthetic sweetener such as saccharin and aspartame. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 mL of the composition of the present invention.

[0148] Cyclo-hispro or a food-based acceptable salt thereof may be contained as an active ingredient in a food composition for improving exercise performance, improving muscle function, and / or preventing or improving muscle disease, and the amount thereof is an amount effective to achieve the above effects, for example, preferably 0.01 to 100 wt% based on the total weight of the entire composition, but is not particularly limited thereto.

[0149] In addition to the above, the health functional food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, or carbonating agents. In addition, the health functional food of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in mixtures. The proportion of these additives is not particularly important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

[0150] In the present invention, the term "feed" refers to a substance that supplies organic or inorganic nutrients necessary for sustaining the life of an animal. The feed includes nutrients such as energy, protein, lipid, vitamins, and minerals required by animals such as livestock, and may be plant-based feed such as grains, roots, fruits, food processing by-products, algae, fiber, oils, starches, meal, and grain by-products, or animal-based feed such as proteins, inorganic substances, oils, minerals, oils, and single-cell proteins, but is not limited thereto.

[0151] In the present invention, "feed additive" means a substance added to feed to improve animal productivity or health, and is not particularly limited thereto, but may additionally include amino acids, vitamins, enzymes, flavoring agents, silicates, buffers, extractants, oligosaccharides, etc. for growth promotion, disease prevention, etc.

[0152] The content of cyclo-hispro or its salt included in the feed additive of the present invention is not particularly limited thereto, but may be, for example, 0.001 to 1% (w / w), 0.005 to 0.9% (w / w), or 0.01 to 0.5% (w / w).

[0153] Preferred examples of the "cyclo-hispro salt" included in the feed additive of the present invention may include the types of the "pharmaceutically acceptable salt" and the "food-wise acceptable salt" described above.

[0154] As used herein, the term "subject" refers to a normal subject in need of improvement in exercise performance, improvement in muscle function, or enhancement of muscle strength, as well as a subject that has already developed or may develop a muscle disease. The subject refers to all mammals including humans, dogs, cows, horses, rabbits, mice, rats, chickens, or humans, but the mammals of the present invention are not limited by the above examples. This term does not indicate a specific age or gender. Therefore, it is intended to include adult / adult and newborn subjects, as well as fetuses, whether female / female or male / male. A patient refers to a subject suffering from a disease or disorder. The term patient includes human and veterinary subjects.

[0155] In one embodiment, the subject may be a human aged at least about 50 years, at least about 55 years, at least about 60 years, or at least about 65 years. In another embodiment, the subject may exclude a human aged at least about 50 years, at least about 55 years, at least about 60 years, or at least about 65 years.

[0156] In another embodiment, the subject may be a human patient with type 2 diabetes who has excessive loss of skeletal muscle mass. In another embodiment, the subject may be a human patient who has excessive loss of skeletal muscle mass but does not have diabetes. In another embodiment, the subject may exclude patients with diabetes.

[0157] In another embodiment, the subject may be a human patient suffering from muscle dysfunction, muscle atrophy, muscle wasting or muscle degeneration due to a genetic mutation.

[0158] In another embodiment, the subject may be a patient who has received, is receiving, or will receive anticancer treatment, particularly chemotherapy.

[0159] In another embodiment, the subject is a subject in need of improved motor performance, who may be in a state of poor or inadequate motor performance in relation to specific training requirements. The subject in need of improved motor performance may be experiencing symptoms of fatigue and / or muscle fatigue. The subject in need of improved motor performance may be a subject who intends to engage in physical exertion, particularly in athletic competitions or competitions.

[0160] In another embodiment, the subject may be a subject who desires to improve or enhance athletic performance. A subject who desires to improve athletic performance may not necessarily have inadequate or insufficient athletic performance, but may desire to increase or enhance athletic performance compared to their normal state. A subject who desires improved athletic performance may be a subject who intends to engage in physical exertion, particularly in athletic competitions or competitions.

[0161] The optimal dosage and dosing interval for individual administration of cyclo-hispro or its salts will depend on the nature and severity of the condition being treated, the dosage form, route, and site of administration, as well as the age and health of the particular patient being treated. Those skilled in the art will recognize that the physician will ultimately determine the appropriate dosage to be used. These administrations may be repeated as often as appropriate. If adverse effects occur, the dosage and frequency may be modified or reduced according to routine clinical practice.

[0162] Cyclo-hispro or its salt may be administered via any conventional route as long as it can reach the target tissue. Cyclo-hispro or its salt according to the present invention may be administered intraperitoneally, intravenously, subcutaneously, intradermally, or orally, depending on the intended use, but is not limited thereto. Furthermore, cyclo-hispro or its salt may be administered via any device capable of transporting it to target cells.

[0163] Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be modified in various ways and can take various forms. Therefore, the specific examples and descriptions described below are only intended to aid in understanding the present invention and are not intended to limit the present invention to a specific disclosed form. It should be understood that the scope of the present invention includes all modifications, equivalents, and substitutes included in the spirit and technical scope of the present invention.

[0164] [Example 1]

[0165] Evaluation of muscle function improvement following CHP treatment

[0166] 1-1. Breeding of laboratory animals and CHP administration

[0167] For experiments in older animals, 18-month-old C57BL6 / J male mice were purchased from the Korea Basic Science Institute (KSBI). Purina mouse diet was purchased from Purina, and Cyclo-His-Pro (CHP) was purchased from Bachem.

[0168] Mice were housed in a thermo-hygrostat maintained at 23±3°C, 50% humidity, and a 12-h light-dark cycle, with free access to food and water. The mice were weighed and randomly distributed to ensure uniform average body weights, as shown in Table 1, into two groups. The CHP-administered group received 35 mg / kg of CHP orally once daily for four months. The control group received the same amount (200 μl) of distilled water.

[0169] Control group CHP administration group Administration (oral) Vehicle (distilled water) CHP (35 mg / kg) Number of animals 77

[0170] 1-2. Survival rate

[0171] As confirmed in Figure 1, the control group showed a survival rate of 71.4% with two animals dying of natural aging during the experimental period, but the CHP administration group showed normal vital signs and a survival rate of 100%.

[0172] 1-3. Grip strength test

[0173] To measure changes in muscle strength due to CHP, grip strength tests were performed on animals in the control and CHP-administered groups. Mice were held by the tail and instructed to grasp the grid of the grip strength test apparatus. The maximum grip strength of the forepaws and hind paws, generated when the tail was pulled backward, was measured using a grip strength meter (Bioseb). Grip strength was measured three times, and the average value was adjusted for body weight. As shown in Figure 2a, the results showed that the maximum muscle strength of the CHP-administered group significantly increased by approximately 23.6% compared to the control group.

[0174] 1-4. Four-limb-wire hanging test

[0175] The limb hanging test is a muscle function measurement method that comprehensively measures muscle strength, coordination, and fatigue tolerance in rodents. It is a method for measuring continuous muscle function in mice against body weight (Lee et al., The Effects of 8-week Acetic Acid Feeding on Endurance Performance and Fat Metabolism in Skeletal Muscle of Mice, Exerc Sci, 2021). Mice were placed on a 10x10 cm wire grid and carefully turned over to measure the time it took for them to fall to the floor. The height to the floor was set to 40 cm, and a cushion was placed on the surface where the mouse fell to prevent shock from falling. The longest hanging time among two measurements was recorded. As a result of the experiment, as shown in Figure 2b, the hanging time in the CHP-administered group significantly increased by approximately 1.9 times compared to the control group.

[0176] 1-5. Sensorimotor function assessment (Rota-rod test)

[0177] Sensorimotor function assessment is a method to measure motor coordination and balance in animals (Robert MJ Deacon, Measuring motor coordination in mice, J Vis Exp, 2013). Mice were placed on a rotating cylinder of a rotarod (Harvard Apparatus) that rotated at 4 rpm. The speed was steadily increased to 40 rpm over 5 minutes, and the time until they lost their balance and fell to the floor was measured. The experiment was conducted three times per day for a total of three days, and the average value of the three measurements was used. As shown in Figure 2c, the CHP-administered group showed improved sensorimotor function compared to the control group, and statistical significance was confirmed on the third day.

[0178] From the above results, it was found that CHP intake significantly improved muscle strength, motor coordination, resistance to muscle fatigue, and sense of balance.

[0179] [Example 2]

[0180] Changes in muscle weight and muscle fiber size following CHP treatment

[0181] 2-1. Muscle weight measurement

[0182] When the mice in Example 1 reached 24 months of age, they were euthanized, and gastrocnemius (GM), tibialis anterior (TA), and cardiac muscle tissues were isolated. The weights of each tissue were measured and compared, and as shown in Fig. 3a, it was confirmed that the weight of the TA muscle significantly increased due to CHP administration.

[0183] 2-2. Measurement of muscle fiber size improvement

[0184] Formalin-fixed GM tissue was sliced ​​into paraffin sections, and muscle fibers were stained using H&E. As shown in Figures 3b, 3c, and 3d, the cross-sectional area of ​​each muscle fiber was measured. As a result, the distribution of muscle fibers over a wide area increased in the CHP-administered group, and the average muscle fiber cross-sectional area significantly increased by approximately 22% compared to the control group.

[0185] From the above results, it was found that CHP had a positive effect on changes in muscle fiber size as well as quantitative changes in muscle.

[0186] [Example 3]

[0187] Measurement of changes in muscle gene expression following CHP treatment

[0188] Muscle tissue was extracted with NucleoZOL (MACHEREY-NAGEL) according to the manufacturer's total RNA isolation protocol, and 1 μg of RNA was subjected to reverse transcription polymerase chain reaction (RT-PCR) to synthesize cDNA using ReverTra Ace qPCR RT Master Mix (Toyobo). The synthesized cDNA was analyzed by real-time PCR using primer sets for myostatin, atrogin-1, foxo-1, dystrophin, sirt-1, sirt-3, and nrf-2 genes known to be involved in aging and muscle atrophy and SYBR Green Realtime PCR Master mix (Toyobo) to quantify the expression level. The expression value of each gene was corrected by dividing it by the expression value of the housekeeping gene β-actin. Each primer set was synthesized by request from Bioneer, and the base sequence information is shown in Table 2.

[0189] 유전자 정방향 (5'-3')서열번호역방향 (5'-3')서열번호MyostatinACCCGTCAAGACTCCTACAA1CCTGGGCTCATGTCAAGTTT2Atrogin-1TCAAAGGCCTCACGATCACC3TCAAACGCTTGCGAATCTGC4Foxo-1CCTTTCCTCCTCCCTCTG5TGCCTCTACTGAATGATTACA6DystrophinAAGAGGAAGAAATGCCCCCG7CCATGCGGGAATCAGGAGTT8Drp-1AGGAGAAGAGGAAGCAAGCG9TAGGCTTTCCAGCACTGAGC10Err-αCAGGAGGCAGACACTGAT11CGGATTAAGCAGCAGCAA12Sirt-1GTTGACCGATGGACTCCTCAC13GAGCTGGCGTGTGACGTTC14Sirt-3ATGTCACTCACTACTTCCTG15ATCCCAGATGCTCTCTCA16Nrf-2CAGCATAGAGCAGGACATGGAG17GAACAGCGGTAGTATCAGCCAG18Pgc-1αAAGGACTCTGAGAACACTTG19CAACTGACCCAAACACTTTAC20Cox-4TACTTCGGTGTGCCTTCGA21TGACATGGGCCACATCAG22Tfb1mGGCTGAGAGACTTGTAGCCACT23AGGTGCACCACTCCTACATCAA24Tfb2mTTTGGCAAGTGGCCTGTGAC25ACTGATTCCCCGTGCTTTGACT26Murf-1GCTACCTTCCTCTCAAGTGC27CTCAAGGCCTCTGCTATGTG28β-actinGGGAAGGTGACAGCATTG29ATGAAGTATTAAGGCGGAAGATT30

[0190] As shown in Fig. 4, the experimental results confirmed that the expression of genes related to aging and muscle atrophy was maintained at a lower level in the CHP-administered group compared to the control group. In particular, sirt-1, a representative anti-aging gene, was confirmed to be increased equally in GM and TA muscles. Sirt-1 acts as a key regulator of energy and metabolic homeostasis and is known to be a major indicator reflecting the rate of cellular aging as it decreases with aging (Lagouge et al., Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha, Cell, 2006). This revealed that CHP could suppress muscle aging and muscle atrophy. In addition, as the expression of the nrf-2 gene, which is at the core of antioxidant action, was higher in the CHP-administered group, it was found that CHP also exhibited an antioxidant effect on muscles that increases resistance to oxidative stress.

[0191] Meanwhile, Sirt-1 is known to regulate pgc-1α, which is important for maintaining mitochondrial biogenesis and function (Handschin et al., Peroxisome Proliferator-Activated Receptor γ Coactivator 1 Coactivators, Energy Homeostasis, and Metabolism, Endocrine Reviews, 2006). Therefore, the expression of Err-α, Cox-4, Drp-1, Tf1bm, and Tf2bm, which are genes related to mitochondrial biogenesis and function, was investigated in GM and TA muscles. Similarly, the expression value of each gene was corrected by dividing it by the expression value of β-actin, a housekeeping gene. Each primer set was synthesized and used by Bioneer, and the base sequence information is shown in Table 2.

[0192] As a result of the experiment, as shown in Fig. 4, it was confirmed that the expression of related genes was significantly increased by CHP administration.

[0193] From the above results, it was found that CHP improved muscle function by suppressing the expression of factors related to aging and muscle atrophy and promoting the expression of anti-aging and antioxidant genes, including mitochondrial function.

[0194] [Example 4]

[0195] Measurement of citrate synthase activity in muscle

[0196] Citrate synthase is an enzyme that catalyzes citrate synthesis in the first step of the mitochondrial TCA cycle, and the activity of this enzyme is used as a biomarker reflecting the amount of mitochondria in the muscles (Vigelso et al., The relationship between skeletal muscle mitochondrial citrate synthase activity and whole body oxygen uptake adaptations in response to exercise training, Int J Physiol Pathophysiol Pharmacol, 2014.). To measure citrate synthase activity in the muscles, proteins were extracted from TA muscles and reacted with oxaloacetate and acetyl-CoA at 37°C to generate CoA-SH. Subsequently, the absorbance was measured at 412 nm using the chromogenic reagent 5,5'-dithiose (2-nitrobenzoic acid) and corrected for the total protein concentration value.

[0197] As shown in Figure 5, the experimental results confirmed that CHP significantly increased citrate synthase activity in TA muscles by approximately 12% compared to the control group. This result indicates that the increased expression of genes related to mitochondrial biogenesis and function was reflected in an actual quantitative increase in mitochondria.

[0198] [Example 5]

[0199] Measurement of gene expression changes associated with myocardial atrophy

[0200] Based on the results showing that CHP reduces skeletal muscle aging and atrophy and improves muscle function, changes in indicators of cardiac atrophy caused by aging were also investigated. The expression of atrogin-1 and murf-1, known risk factors for cardiac atrophy, was measured using the same method as in Example 3, and it was confirmed that the expression of both genes was significantly reduced by CHP.

[0201] From the above results, it was found that CHP very effectively improves muscle function by reducing risk factors for muscle atrophy not only in skeletal muscle but also in cardiac muscle, and by increasing antioxidant and mitochondrial activity, thereby inhibiting muscle aging.

[0202] Statistical analysis

[0203] The statistical significance of the data in Figs. 1, 2a to 2c, 3a to 3d, 4, 5, and 6 was analyzed using the t-test statistical method. *p<0.05, **p<0.01, ***p<0.001.

[0204] [Example 6]

[0205] Confirmation of the effects of CHP in DMD animal models

[0206] 6-1. Animal models and CHP treatment

[0207] C57BL / 10ScSn (BL10) and C57BL / 10ScSn-Dmdmdx (mdx) mice were used in this study. Mice were housed at 22°C and had free access to food and water. After a week of acclimatization, the mice were divided into three groups: CHP-treated mdx, water-treated mdx (control), and water-treated BL10 (control). Administration was via oral gavage three times a week.

[0208] For the preventive protocol, mice were administered 20 mg / kg of CHP or water (control) from 3 to 20 weeks of age. For the treatment protocol, mice were administered 35 mg / kg of CHP or water (control) from 7 to 22 weeks of age. At the end of the study, mice were euthanized and tissues were collected. For biochemical analysis, tissues were collected, rapidly frozen, and stored at -80°C.

[0209] 6-2. Grip strength test

[0210] Grip strength tests were performed at week 10 in the prevention protocol and week 16 in the treatment protocol, respectively. Grip strength of each mouse on each limb was measured using a pull-down grid assembly connected to a grip dynamometer (Columbus Instruments). Each individual mouse was pulled along a straight line parallel to the grid until the grip broke, exerting the maximum force (grams). This test was repeated three times with a 5-minute interval between measurements.

[0211] As a result, as confirmed in Figures 7a and 7b, the mdx mouse group treated with water in the prevention protocol and the treatment protocol showed a significant decrease in limb muscle strength, but the mdx mouse group treated with CHP showed a significant increase in grip strength.

[0212] 6-3. Hanging Test

[0213] The hanging test was performed at week 15 of the treatment protocol as follows. Thirty minutes prior to the experiment, mice were acclimated to the testing room. The animals were placed on a wire grid and allowed to grasp the grid with their limbs. The grid was then flipped over so that the animals hung upside down, and the time the mice remained on the grid was measured. The maximum test length was 2 minutes and 30 seconds (150 seconds). The latency to fall was measured five times for each mouse, with 10-minute intervals between trials.

[0214] As a result, as confirmed in Fig. 8, the average hanging time of the mdx mouse group treated with water was significantly reduced, but the average hanging time of the mdx mouse group treated with CHP was significantly increased.

[0215] The above results confirmed that CHP has the effect of increasing limb muscle strength and exercise endurance.

[0216] [Example 7]

[0217] Contractile and force-generating effects of CHP

[0218] 7-1. Ex vivo muscle strength assessment

[0219] Force production in limb muscles was tested ex vivo in extensor digitorum longus (EDL) and soleus muscles isolated from mice treated with CHP for 17 weeks.

[0220] Muscle mechanical measurements were assessed using the method described previously [N. Zanouet et al., "Role of TRPC1 channel in skeletal muscle function," Am. J. Physiol. Cell Physiol., vol. 298, no. 1, Jan. 2010] with minor modifications. All analyses were performed in a blinded manner. BL10, mdx, and CHP-treated mdx mice were euthanized by cervical dislocation. The EDL and soleus muscles were rapidly dissected and immersed in a 10 mL horizontal chamber containing continuously oxygenated Krebs solution (25°C, pH 7.4) consisting of 135.5 mM NaCl, 5.9 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 11.6 mM HEPES sodium, and 11.5 mM glucose. The muscle was tied between a dual-mode lever arm and a fixed hook, and stimulation was delivered via platinum electrodes (1500A Intact Muscle Test System, Aurora Scientific Inc., Canada) running parallel to the muscle. Resting muscle length (L0) was carefully adjusted for maximal isometric force using 125 Hz maximal fusion tetani. The force-frequency relationship was determined by sequentially stimulating the muscle at 25, 50, 75, 100, 125, and 150 Hz stimulus streams of 300 ms duration, with 1 min of rest between each contraction. Normalized muscle specific force (mN / mm 2 ) was expressed based on the cross-sectional area (CSA) obtained by dividing the muscle blotting weight (mg) by the length and considering the fiber length as 0.5 L0 for EDL and 1 for soleus. Data from each experiment were analyzed using Aurora's DMA software (Aurora Scientific Inc., 2002, Solwood Enterprises, Inc., 2002) and Microsoft Excel.

[0221] 7-2. Ex vivo Eccentric Contraction of the EDL Muscle

[0222] Eccentric contractions were performed as described in the literature [N. Zanou, Y. Iwata, O. Schakman, J. Lebacq, S. Wakabayashi, and P. Gailly, "Essential role of TRPV2 ion channels in the sensitivity of dystrophic muscle to eccentric contractions," FEBS Lett., vol. 583, no. 22, pp. 3600-3604, Nov. 2009]. Briefly, the EDL muscle underwent a series of seven eccentric contractions, consisting of a 1-mm stretch applied 160 ms after stimulus onset, followed by a 500-ms tonic twitch that lasted up to 250 ms after stimulus onset (with a 10-s interval between two consecutive tetani). Isometric force was measured for each tetanus immediately before the onset of the stretch, and the percentage force decrease associated with the first tonic twitch was calculated.

[0223] When tested for concentric contractions, mdx mice showed overall lower force production and a downward shift in the force-frequency relationship compared to BL10 mice, as shown in Figures 9A-9F. The performance of the EDL and soleus muscles was improved by CHP, with a partial recovery of maximal contractile force. Indeed, this is consistent with the preservation of muscle strength observed in vivo. These results suggest that CHP treatment maintains force production.

[0224] [Example 8]

[0225] Ca of CHP 2+ Release / absorption recovery effect

[0226] Damage to the sarcolemma in DMD muscle fibers as a result of DAPC instability is Ca 2+There is increasing evidence that it also causes disruption of homeostasis. Ca in muscle fibers 2+ Inflow and outflow are impaired in DMD patients, and the mdx model reports a similar phenotype. Ca 2+ To evaluate the effect of CHP on dysregulation, flexor digitorum brevis (FDB) muscles were isolated from healthy control and mdx control mice as well as from mice administered CHP at the end of the study in the prophylactic protocol. Ca from the sarcoplasmic reticulum (SR) 2+ Cytosolic Ca release was stimulated in isolated fibers treated ex vivo with caffeine. 2+ The results were monitored using the indicator Fluo-4 / AM. The detailed experimental procedures are as follows.

[0227] FDB muscle fibers were incubated in Krebs Ca for 20 minutes in an incubator 2+ Cytosolic Ca dissolved in solution [in mM: NaCl 135.5, MgCl2 1.2, KCl 5.9, glucose 11.5, HEPES 11.5, CaCl2 1.8 (pH 7.3)] 2+ The indicator Fluo-4 / AM (5 μM, Invitrogen, Basel, Switzerland) was loaded and rinsed twice with Krebs solution.

[0228] Double-washed fiber for caffeine stimulation and Krebs Ca 2+ The fibers were stored in solution. Fluo-4 fluorescence was monitored using a confocal microscope system (Zeiss LSM 5 Live, 40x oil immersion lens, excitation wavelength 488 nm, emitted fluorescence recorded between 495–525 nm) in a time-lapse acquisition framework. After recording the baseline fluorescence, the fibers were stimulated with a final concentration of 2.5 mM caffeine (O1728-500, Thermofisher Scientific) to induce Ca release from the SR. 2+Caused release. Storage operation Ca 2+ Inflow (store operated Ca 2+ For SOCE measurements, the fiber is placed in the Ca position just before image acquisition. 2+ Washed twice with Krebs solution without Ca 2+ Stored in Krebs solution without .

[0229] After recording the baseline fluorescence, the fibers were stimulated with a final concentration of 1 μM thapsigargin (Tg; T9033, Thermofisher Scientific) to release Ca from the SR. 2+ The release was induced. 2 mM CaCl2 was finally used to evaluate SOCE. Zen software (products / microscopy-software / zenlite / zen-2-lite) was used for acquisition, and data were exported to Excel files for analysis. The use of a single excitation / emission dye, fluo-4, necessitates normalization to pre-stimulation values ​​to account for possible differences in dye loading. SR Ca 2+ The amplitude of the storage was calculated by subtracting the peak fluorescence from the baseline. Ca induced by caffeine stimulation 2+ The amplitude of the transient plateau is SR Ca 2+ It was calculated and expressed as a percentage of peak amplitude and indirectly reflects the contribution of SOCE. The actual SOCE assessed by Tg stimulation was the calcium amplitude after addition of 2 mM CaCl2 and the smallest Ca before addition of CaCl2. 2+ It was calculated as the difference between the levels. The lowest Ca before CaCl2 addition 2+ The level is Ca 2+ Reabsorption level (SR Ca 2+ (calculated as a percentage of peak) was used to estimate the

[0230] As confirmed in Fig. 10a, caffeine-induced Ca in SR 2+The response to release is that mdx fibers release intracellular Ca 2+ Ca2+ was impaired in mdx mice due to continuous depletion of stores, but was recovered by CHP. As confirmed in Fig. 10b, Ca2+ through store-operated calcium channels (SOC) after SR depletion 2+ Absorption is generally Ca 2+ Although upregulated in mdx as a compensatory mechanism for depletion, CHP is Ca 2+ Normalizing absorption to Ca 2+ Indicates that handling is properly maintained. To directly quantify SOCE, thapsigargin was used instead of caffeine to measure SR Ca 2+ Release stimulation was performed, which shows a similar trend of CHP-induced normalization as confirmed in Figures 10c and 10d.

[0231] Statistical analysis

[0232] Statistical significance for the data in Figures 7a to 7b, 8, 9a to 9f, and 10a to 10d was analyzed by one-way analysis of variance (ANOVA) and Dunnett's multiple comparison test. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

Claims

1. A pharmaceutical composition for improving exercise performance comprising cyclo-hispro or a pharmaceutically acceptable salt thereof.

2. A pharmaceutical composition having any one or more of the following effects: i) to v) in paragraph 1: i) Increased muscle strength; ii) Increased motor coordination; iii) Increased tolerance to muscle fatigue; iv) increased sense of balance; and v) Increased muscle energy production.

3. A health functional food composition for improving exercise performance comprising cyclo-hispro or a food-related acceptable salt thereof.

4. In paragraph 3, a health functional food composition exhibiting any one or more of the following effects: i) to v): i) Increased muscle strength; ii) Increased motor coordination; iii) Increased tolerance to muscle fatigue; iv) increased sense of balance; and v) Increased muscle energy production.

5. Feed additive for improving exercise performance containing cyclo-hispro or a salt thereof.

6. A pharmaceutical composition for improving muscle function or preventing or treating muscle disease, comprising cyclo-hispro or a pharmaceutically acceptable salt thereof.

7. A pharmaceutical composition according to claim 6, wherein the muscle disease is a muscle disease caused by decreased muscle function, muscle atrophy, muscle wasting or muscle degeneration.

8. A pharmaceutical composition according to claim 6, wherein the muscle disease is at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, sarcopenia, myocardia, and acardiotrophy.

9. A pharmaceutical composition having any one or more of the following effects: i) to v) in paragraph 6: i) Increased muscle mass; ii) Increase in muscle fiber size; iii) Inhibition of muscle wasting; iv) inhibition of muscle wasting; and v) Increased muscle energy production.

10. A health functional food composition for improving muscle function or preventing or improving muscle disease, comprising cyclo-hispro or a food-wise acceptable salt thereof.

11. A health functional food composition according to claim 10, wherein the muscle disease is a muscle disease caused by decreased muscle function, muscle atrophy, muscle wasting, or muscle degeneration.

12. A health functional food composition in claim 10, wherein the muscle disease is at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, sarcopenia, myocardia, and acardiotrophy.

13. A health functional food composition having one or more of the following effects: i) to v) in clause 10: i) Increased muscle mass; ii) Increase in muscle fiber size; iii) Inhibition of muscle wasting; iv) inhibition of muscle wasting; and v) Increased muscle energy production.

14. Feed additive for improving muscle function or preventing or improving muscle disease, containing cyclo-hispro or a salt thereof.

15. A composition for strengthening muscle, comprising cyclo-hispro or a salt thereof.

16. A method for improving exercise performance, comprising administering an effective amount of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof to a subject in need thereof.

17. A method for improving muscle function or preventing, improving or treating muscle disease, comprising administering an effective amount of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof to a subject in need thereof.

18. A method for strengthening muscle, comprising administering to a subject in need thereof an effective amount of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof.

19. Use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a drug or health functional food for improving exercise performance.

20. Use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a medicine or health functional food for improving muscle function or preventing, improving or treating muscle disease.

21. Use of cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a muscle-strengthening drug or health functional food.

Images