Proximity - inducing compounds
The novel BDPIC compound addresses the limitations of existing PICs by inducing proximity between biological molecules, particularly phosphatases and POIs, achieving targeted dephosphorylation with minimal aberrant activity, enhancing therapeutic potential.
Patent Information
- Application Number
- PCT/GB2025/050043
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-11
- Filing Date
- 2025-01-10
- Publication Date
- 2025-07-17
AI Technical Summary
Existing proximity-inducing compounds (PICs) face limitations in effectively inducing proximity between biological molecules, particularly phosphatases and protein-of-interest (POIs), leading to challenges in targeted dephosphorylation and therapeutic applications, often requiring high concentrations and lacking wide utility across various systems.
Development of a novel PIC, BDPIC, comprising a first ligand binding to a hole-modified Brd bromodomain and a second ligand binding to an FKBP, connected by a linker, to induce proximity between biological molecules, minimizing aberrant biological activity and enabling interaction across a wider range of systems.
BDPIC effectively induces proximity between biological molecules, facilitating targeted dephosphorylation and interaction, with reduced off-target effects, offering a versatile tool for therapeutic applications.
Smart Images

Figure GB2025050043_17072025_PF_FP_ABST
Abstract
Description
[0001]PROXIMITY-INDUCING COMPOUNDS FIELD OF THE INVENTION: The present invention relates to proximity-inducing compounds (or proximity-inducingchimera, PIC) for inducing proximity between two biological molecules such that thebiological molecules are able to interact. The invention also relates to methods ofinducing such proximity, comprising the use of the PICs. The PICs comprise a first ligandcapable of binding to a biological molecule with a hole-modified Brd bromodomain, asecond ligand capable of binding to a biological molecule with an FK binding protein(FKBP), and a linker capable of joining the abovementioned ligands. BACKGROUND OF THE INVENTION:Chemically-induced proximity (CIP) is a technique that facilitates or enables theinteraction of two or more biological molecules, such as proteins, that may not naturallyinteract. Using small molecules (proximity-inducing compounds / chimera, PIC) orengineered proteins, CIP can artificially induce the proximity of biological molecules,triggering specific cellular processes or reactions. The ability to effect and control suchinteractions can provide insights into the workings of biological systems and has potentialapplications in drug development, synthetic biology, and the study of diseases at themolecular level. A notable class of PICs are proteolysis targeting chimeras (PROTACs)and molecular glues, which facilitate proximity between E3 ubiquitin ligases and aprotein-of-interest (POI) inside cells to cause POI degradation, some of which haveentered clinical trials or are already in clinical use (Sathe and Sapkota, Trends Pharmacol. Sci., 2023, 44, 786; Sakamoto et al., Proc. Natl. Acad. Sci. U. S. A., 2001, 98, 8664; Zengerle et al., ACS Chem. Biol., 2015, 10, 1770; Lai and Crews, Nat. Rev. Drug Discov., 2017, 16, 101; Samarasinghe and Crews. Cell Chem. Biol., 2021, 28, 934).Recently, it has been recognised that there is a need for PICs that can facilitateinteraction between phosphatases and POIs; many kinases and phosphatases controlmultiple substrates, and established kinase inhibitors often have off-target effects(Yamazoe et al., J. Med. Chem., 2020, 63, 2807; Chen et al., ACS Chem. Biol., 2021,16, 2808; Zhang et al., J. Am. Chem., Soc., 2023, 145, 1118; Hu et al., J. Am. Chem.Soc., 2023, 145, 4045), thus achieving a substrate-level phospho-control by using kinaseinhibitors or phosphatase activators is extremely challenging. Targeteddephosphorylation of phospho-proteins with PICs is an emerging concept to modulate55479585-1 protein function and cell signalling with substrate-level phospho-control. Redirectingphosphatase activity to elicit targeted dephosphorylation of a POI to alter POI functioncould provide a promising novel therapeutic mechanism for combatting diseases caused by POI phosphorylation. Furthermore, substrate-specific dephosphorylation may overcome some of the abovementioned undesirable issues experienced with kinase inhibitors, which target the dephosphorylation of all kinase substrates (Rosenzweig, Adv. Cancer Res., 2018, 138, 71). Previously reported is the development of the AdPhosphatase (Affinity-directed Phosphatase) system, which delivers phosphatase activity to phospho-POIs throughpolypeptide binders for targeted POI dephosphorylation (Simpson et al., Cell Chem. Biol.2023, 30, 188). Other recent studies have also explored targeted dephosphorylation. Heterobifunctional molecules comprising a Halo-tag or peptidic ligand to bind protein phosphatase PP1 and selective inhibitors to bind Akt or EGFR were shown to reduce Akt and EGFR (epidermal growth factor receptor) phosphorylation (Yamazoe et al., J. Med. Chem., 2020, 63, 2807). Another study reported development of a heterobifunctional small molecule recruiter of dTAG and Halo-tags, termed PhosTAC7, to recruit dTAG-PP2A A (the A scaffolding subunit of protein phosphatase 2A) to Halo-PDCD4 (programmed cell death 4), Halo-FOXO3a (Chen et al., ACS Chem. Biol., 2021,16, 2808) and Halo-tau (Hu et al., J. Am. Chem. Soc., 2023, 145, 4045) to elicit reduced dephosphorylation of the Halo-POIs. More recently, it was shown that recruitment of endogenous PP5 to ASK1 (Apoptosis signal-regulated kinase 1) using a heterobifunctional molecule yielded reduced phosphorylation of ASK1 and concomitant antiproliferative activity in gastric cancer cells (Zhang et al., J. Am. Chem., Soc., 2023, 145, 1118). While these proof-of-concept studies using heterobifunctional molecules have demonstrated the potential of targeted dephosphorylation, most studies have relied on overexpression model systems using sub-optimal compounds (e.g. requiring highmicromolar concentrations) with limited utility, and none have definitively establishedreliance on the target phosphatase activity for the observed reduction in POI phosphorylation.In WO 2024 / 030455 A2 (UNIV UTAH RES FOUND; UNIV CALIFORNIA) compositionscomprising a ligandable tag, a linker, and a labeling enzyme are described, wherein the55479585-1linker attaches the ligandable tag to the labeling enzyme. Nucleic acid sequencescapable of encoding one or more of the protein based compositions are also described,as are: compositions comprising a ligand conjugated to a molecule of interest; systemscomprising a labeling composition and a targeting composition, wherein the labeling composition comprises a ligandable tag, a linker, and a labeling enzyme, wherein the linker attaches the ligandable tag to the labeling enzyme, wherein the targeting composition comprises a ligand conjugated to a molecule of interest, wherein the ligand of the targeting composition is a ligand for the ligandable tag of the labeling composition; and methods of using the compositions and systems. There is a need in the art for effective PICs that have wide utility, i.e., PICs that can workwith previously inaccessible systems or POIs, which are not necessarily limited totargeted dephosphorylation or degradation, and function with minimal aberrant proteinactivity. The present invention addresses this need.SUMMARY OF THE INVENTION:The present inventors have prepared a novel proximity-inducing compound (PIC) calledBDPIC for inducing proximity between two biological molecules such that the biologicalmolecules are able to interact. The inventors have found that BDPIC is surprisinglyeffective at inducing proximity between biological molecules. Furthermore, the inventorshave found BDPIC to enable interaction between previously inaccessible – and a widerrange of – biological molecules, with the unexpected advantage of minimised aberrantbiological activity. Viewed from a first aspect, therefore, there is provided a proximity-inducing compound corresponding to formula (Ia): wherein: is a first ligand capable of binding to a biological molecule with a hole- modified Brd bromodomain;55479585-1 is a second ligand capable of binding to a biological molecule with an FKBP; and L1is a linker.For the avoidance of doubt, and represent the ligands that bind to thetags ‘BromoTag’ and ‘dTAG’ respectively, rather than the tags themselves.The present inventors have demonstrated that the PIC of the first aspect is highlyeffective for use in a method of inducing proximity between biological molecules such that they are able to interact. Thus, viewed from a second aspect, there is provided a method of inducing proximity between two biological molecules, the method comprising: contacting a first biological molecule and a second biological molecule with theproximity inducing-compound of the first aspect such that a ternary complex is formed, thereby inducing proximity between the two biological molecules such that they are able to interact; and optionally: detecting the formation of the ternary complex; and / or detecting the interaction, or lack thereof, between the two biological molecules; wherein: the first biological molecule comprises a hole modified Brd bromodomain; and the second biological molecule comprises an FKBP. Definitions In the discussion that follows, reference is made to a number of terms, which have the meanings provided below, unless a context indicates to the contrary. The nomenclature used herein for defining compounds, in particular the compounds according to the invention, is in general based on the rules of the IUPAC organisation for chemicalcompounds, specifically the “IUPAC Compendium of Chemical Terminology (GoldBook)”. For the avoidance of doubt, if a rule of the IUPAC organisation is in conflict witha definition provided herein, the definition herein is to prevail. Furthermore, if a compoundstructure is in conflict with the name provided for the structure, the structure is to prevail.55479585-1The term “comprising” or variants thereof is to be understood herein to imply the inclusionof a stated element, integer or step, or group of elements, integers or steps, but not theexclusion of any other element, integer or step, or group of elements, integers or steps.The term “consisting” or variants thereof is to be understood to imply the inclusion of astated element, integer or step, or group of elements, integers or steps, and the exclusionof any other element, integer or step or group of elements, integers or steps. The term “alkyl” is well known in the art and defines univalent groups derived from alkanes by removal of a hydrogen atom from any carbon atom, wherein the term “alkane” is intended to define acyclic branched or unbranched hydrocarbons having the general formula CnH2n+2, wherein n is an integer ≥1. Alkyl groups may be C1-6alkyl groups. In some cases, alkyl groups are C1-4alkyl groups. C1-4alkyl refers to any selected from the group consisting of methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl and tert-butyl. The term “haloalkyl” is also well known and defines univalent groups derived from alkyl groups by replacement of one or more hydrogen atoms from one or more carbon atoms with a halo group. Haloalkyl groups may comprise one or more different types of halo. For example, one or more independently selected from fluoro, chloro, bromo and iodo. In some cases, the haloalkyl is a fluoroalkyl. Halo refers to a halogen radical. Typically, halo refers to any selected from fluoro, bromo, chloro and iodo. The term “alkoxy” defines univalent groups derived from alcohols by removal of a hydrogen atom from an OH group, wherein the term “alcohol” is intended to define groups derived from alkanes by the replacement of a hydrogen atom with a hydroxy group. Often, alkoxy groups are C1-6 alkoxy groups or C1-4 alkoxy groups. The term “heteroarene” defines compounds formally derived from arenes by replacement of one or more methine (-C=) and / or vinylene (-CH=CH-) groups by trivalent or divalent heteroatoms, respectively, in such a way as to maintain the continuous π- electron system characteristic of aromatic systems. The term “heteroaryl” defines all univalent groups formed on removing a hydrogen atom from a heteroarene ring atom 55479585-1 such as carbon or nitrogen and the term “heteroarylene” defines all bivalent groups formed on removing two hydrogen atoms from a heteroarene ring atom such as carbon or nitrogen. Typically, the heteroaryl or heteroarylene groups herein comprise any one or a combination of heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur atoms.The term “enantiomer” defines one of a pair of molecular entities that are mirror imagesof each other and non-superimposable, i.e., cannot be brought into coincidence bytranslation and rigid rotation transformations. Enantiomers are chiral molecules, i.e., are distinguishable from their mirror image.The term “racemic” is used herein to pertain to a racemate. A racemate defines asubstantially equimolar mixture of a pair of enantiomers, which typically comprises a pairof enantiomers in a ratio of about 1:1.The term “diastereoisomers” (also known as diastereomers) defines stereoisomers thatare not related as mirror images.The term “solvate” is used herein to refer to a complex comprising a solute, such as acompound or salt of the compound, and a solvent. If the solvent is water, the solvate may be termed a hydrate, for example a mono-hydrate, di-hydrate, tri-hydrate etc., depending on the number of water molecules present per molecule of substrate.The term “isotope” is used herein to define a variant of a particular chemical element, inwhich the nucleus necessarily has the same atomic number but has a different massnumber owing to it possessing a different number of neutrons. The term “biological molecule” is well known in the art and relates to any moleculepresent in organisms that is involved in one or more typically biological processes.Biological molecules may include but are not limited to proteins, peptides, carbohydrates, lipids, nucleic acids, polynucleotides, vitamins, amino acids, and hormones. Biological molecules may be extracted from their natural source. They may be produced by synthetic or biotechnological means. Biological molecules may be of an unnatural origin, have no known biological purpose, or may not be known to be involved in any biological 55479585-1 process. They may be engineered or produced in such a way to differ from their natural counterparts. The term “ligand” used herein is well known in the biochemical arts and relates to any molecule that may reversibly bind to a biological molecule to form a complex. The ligand molecule may be a small-molecule, or it may be a macromolecule, such as a protein. The ligand may be a natural ligand for a biological molecule, or it may be unnatural. The ligand may also be a part of a molecule. That is to say, a ligand molecule may comprise parts that bind and other parts that do not, or parts that bind to particular biological molecules and other parts that bind to other biological molecules. The ligand may only bind to one or few biological molecules, or it may be promiscuous. The binding may occur due to any one or more non-covalent intermolecular forces, including but not limited to ionic bonding, hydrogen bonding, Van der Waals forces, London dispersion forces,dipole-dipole interactions, ion-dipole interactions, salt bridges, π-π interactions, ion-πinteractions, hydrophobic effects, hydrophilic effects and halogen bonding. As a result of the ligand binding to a biological molecule, the biological molecule may undergo someconformational change, recruit another biological molecule, be prevented from bindinganother ligand or substrate, or otherwise be affected in one or more ways. The term “complex” used herein is well known in the biochemical arts and relates to a stable association between two or more molecules to form a single unit. Complexes may form as the result of a ligand binding to a biological molecule. When one molecule is bound to one other molecule, this is often referred to as a binary complex. When one molecule is bound to two other molecules, this is often referred to as a ternary complex. As a result of the formation of the complex, the complex may gain or lose particular functions relative to the functions of the constituent molecules. For example, a ligand that binds to a biological molecule to form a complex may result in the biological molecule losing its normal function when part of the complex. On the other hand, a ligand that binds to a biological molecule to form a complex may result in the biological molecule gaining a new or unnatural function when part of the complex.The term "proximity" is well known in the biochemical arts and refers to the state orcondition wherein two or more entities are situated near or next to each other in space, with a degree of closeness that enables or facilitates interaction, influence, or a functionalrelationship between them. This closeness is not necessarily defined by a specific55479585-1distance but may be contextually determined based on the nature of the entities and thetype of interaction or effect that proximity is intended to enable or enhance. The entities may be biological molecules, small molecules, and / or ligands. The term “proximity- inducing compound” or “proximity-inducing chimera” or “PIC” is therefore understood to refer to a compound that is able to induce, enable, or facilitate proximity between two or more entities. The PIC may be a bifunctional small-molecule comprising one or more ligands and a linker. The term “contacting” is used herein to refer to any one or more of the acts of combining, reacting, mixing, stirring, slurrying, blending, dissolving, treating, incubating, joining, supplying, passing over, flowing over, or otherwise contacted in some manner, in any order, and for any length of time.Aspects of the InventionThe inventors have prepared a novel PIC called BDPIC that is surprisingly effective atinducing-proximity between two biological molecules. As described above, in the first aspect there is provided a proximity-inducing compound corresponding to formula (Ia): (Ia) wherein: is a first ligand capable of binding to a biological molecule with a hole-modified Brd bromodomain;is a second ligand capable of binding to a biological molecule with anFKBP; and L1is a linker;As described above, and represent the ligands that bind to the tags‘BromoTag’ and ‘dTAG’ respectively, rather than the tags themselves. 55479585-1A biological molecule with a hole-modified Brd bromodomain, or a biological moleculewith an FKBP, may be described as a “tagged” biological molecule. That is to say, the biological molecule, such as a protein, comprises a grafted functional peptide sequence,or a “tag”. The tag may be grafted to the C-terminus or the N-terminus of the protein, orthe tag may be integrated within the sequence of the protein: an “internal tag”. Tags may be grafted to a biological molecule to impart functionality upon the biological molecule.For example, tags may facilitate or enable the purification, identification, visualisation,quantification, solubilisation, and / or binding of biological molecules.BromoTag is a tag that incorporates a hole-modified Brd bromodomain into a protein, ofwhich a ligand may bind to. In some embodiments of the present invention, the hole-modified Brd bromodomain is selected from the group consisting of Brd4BD2L387A,Brd4BD2L387V, Brd4BD1L94A, Brd4BD1L94V, Brd2BD2L383A, Brd2BD2L383V, Brd2BD1L110A, Brd2BD1L110V, Brd3BD2L344A, Brd3BD2L344V, Brd3BD1L70A, Brd3BD1L70V, BrdTBD2L306A,BrdTBD2L306V, BrdTBD1L63A, or BrdTBD1L63V. Preferably, the hole-modified Brdbromodomain is Brd4BD2L387A. In some embodiments, the bromodomain may be grafted to the C-terminus or the N-terminus of the protein, which may be achieved through homologous recombination technology, such as CRISPR / Cas9.A bromodomain is a protein domain found in several proteins, notably the Bromo- andExtra-terminal domain (BET) family of proteins. The BET family comprises Brd2, Brd3,Brd4, and BrdT – each protein comprises two bromodomains, namely BD1 and BD2. Ahole-modified Brd bromodomain is understood to refer to a bromodomain that comprises a mutation such that there is a ‘hole’ in a site where substrates may bind. That is to say, one or more amino acid residues have been replaced with alternative residues that may accommodate a substrate that, compared to substrates of the wild type domain, comprise a ‘bump’ (hence the ‘bump-and-hole’ technique, described inWO 2023 / 047121 A1, which is incorporated herein by reference). In other words, a hole-modified Brd bromodomain has a hole in the binding site to enable highly specific andpotent binding of a complementary ‘bumped’ ligand. Therefore, in some embodiments,the first ligand is a bumped ligand. A bump may be a chemical group, such as C1-4alkylor C1-4haloalkyl (e.g., methyl, ethyl, propyl, butyl, trifluoromethyl, or perfluoroethyl,preferably ethyl) that may result in a steric clash on binding to a wild-type domain butotherwise may be accommodated in the ‘hole’ of a modified domain.55479585-1 Therefore, in some embodiments, is a first ligand designed to be capable of selectively binding to, capable of binding selectively to, or designed to selectively bindto, a biological molecule with a hole-modified Brd bromodomain. In other words, in someembodiments, is a first ligand that is complementary to a hole-modified Brdbromodomain. As described above, in some embodiments, the first ligand is a bumpedligand. That is to say, in some embodiments, is a first ligand wherein theligand is a bumped ligand for BromoTag, or a bumped ligand for a complementary hole-modified Brd bromodomain. In some embodiments, is a first ligand whereinthe ligand comprises a steric bump. Without being bound by theory, a ‘non-complementary’, or ‘non-bumped’ ligand, is not capable of binding to, binds only weaklyto, or is not designed to bind to, a hole-modified Brd bromodomain. Thus, in someembodiments, is a first ligand that is not capable of binding to, binds onlyweakly to, or is not designed to bind to, a wild-type bromodomain. Without being boundby theory, a hole-modified Brd bromodomain is not a wild-type bromodomain; it is anengineered bromodomain. Therefore, in some embodiments, the biological molecule isnot a wild-type biological molecule, or the biological molecule is an engineered biological molecule. In some embodiments, the biological molecule comprises an engineered bromodomain. dTAG is a tag that incorporates an FK binding protein (FKBP) into a protein, of which aligand may bind to. In some embodiments of the present invention, the FKBP isFKBP12F36V. FKBP12 may be referred to as FKBP1A. In some embodiments, the FKBPmay be grafted to the C-terminus or the N-terminus of the protein, which may be achieved through homologous recombination technology, such as CRISPR / Cas9.In some embodiments, the hole-modified Brd bromodomain is Brd4BD2L387A and theFKBP is FKBP12F36V.A linker is any chemical entity capable of joining the ligand with the ligand, through a covalent bond at one end of the linker to , and a covalentbond at another end of the linker to . The skilled person is aware of many differentplausible linkers of varying lengths and chemical functionality, and thus the ligands oneither end of the PIC comprise the most essential features of the PIC.55479585-1In some embodiments, the linker may be a chain of one or more monomeric units, suchthat they form a homo- or co-oligomer, or a homo- or co-polymer. Where there is morethan one monomeric unit, the monomeric units may be the same monomer (homo- oligomer or homopolymer) or they may be of two or more different monomers (co- oligomer or copolymer).In some embodiments, L1 is of formula (IIIa):⌇–(L2)w–⌇ (IIIa)wherein w is an integer from 1 to 10; each L2 is independently selected from the groupconsisting of C(O)NH, C(O)O, CH2CH2O, CH2, ethenylene, ethynylene, triazolylene,piperazinylene, and piperidinylene; and wherein ⌇ indicates the positions of attachment.That is to say, each L2 is independently one of formulae (IIId) to (IIIk), and (IIIq): wherein the wavy line indicates the position of attachment. Each L2may independently join together from either position of attachment of the aforementioned moieties, or the above formulae. Furthermore, and may join to the linker from eitherposition of attachment. In some embodiments, L1 is of formulae (IIIm) to (IIIp):55479585-1 In some embodiments, the general formulae and may relate to onlythe essential core structures of a ligand capable of binding to a biological molecule witha hole-modified Brd bromodomain and a ligand capable of binding to a biologicalmolecule with an FKBP, respectively. In some embodiments, the general formulaeand may encompass the essential core structures of the aforementioned ligands, and the necessary functional groups and / or chemical moietiesnecessary to covalently bond to the linker. The skilled addressee would understandwhether and which particular functional groups and / or chemical moieties would beencompassed by the abovementioned general formulae depending on the terminalmonomeric units of the linker. In some embodiments, L1is a chain of polyethylene glycol. That is to say, the linker is offormula (IIIc): wherein t is an integer from 1 to 10. Preferably, t is from 2 to 8. More preferably, t is 3.In some embodiments, the hole-modified Brd bromodomain is Brd4BD2L387A, the FKBPis FKBP12F36V, and L1 is of formula (IIIc), wherein t is an integer from 1 to 10. Preferably,t is from 2 to 8. More preferably, t is 3.In some embodiments, the proximity-inducing compound is of formula (Ib):55479585-1 wherein: X is halo; each R1, R4, and R6are independently selected from the group consisting of C1-6alkyl, C1-6haloalkyl, C1-6alkoxy, halo, and hydroxy; G1is a 5-membered heteroarene, optionally substituted with one or two substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy, halo, hydroxy and amino, or G1 is a 6-membered arene orheteroarene, optionally substituted with one or two substituents selected frommethyl, halo, hydroxy and thiol;G2is a 5-membered N-heteroarene selected from the group consisting of pyrrolidine, pyrrole, imidazolidine, pyrazole, imidazole, triazole, and tetrazole, optionally substituted with one or more substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy, halo, hydroxy and amino; R2is H, C1-3alkyl, C1-3haloakyl, or halo; R3is C1-4alkyl or C1-4haloalkyl; B1and B2are independently of formula (IIa): ⌇–(A2)a–(CH2)b–(A3)c–(C(O))d–(CH2)e–(A4)f–(CH2)g–⌇ (IIa) wherein A2, A3, and A4are independently selected from the group consisting of NH, NC1-4alkyl, O, and S; a, c, d, and f are integers independently selected from 0 and 1; b, e, and g are integers independently selected from 0 to 4; and wherein ⌇indicates the positions of attachment;L3is a linker; 55479585-1 A1is selected from the group consisting of O, NH, and NC1-4alkyl; h is an integer selected from 0 or 1; R5is C1-4alkyl or C1-4haloalkyl; and n-i, n-ii, and n-iii are integers independently selected from 0 to 3. As described above, X is halo, such as fluoro, chloro, bromo, or iodo. In some embodiments, X is chloro. In some embodiments, R1, R4, and R6are independently selected from the group consisting of C1-4alkyl, C1-4haloalkyl, C1-3alkoxy, halo, and hydroxy; and n-i, n-ii, and n-iiiare integers independently selected from 0 to 3. In some embodiments, R1, R4, and R6are independently selected from the group consisting of C1-4alkyl, C1-4haloalkyl, C1-3alkoxy; and n-i, n-ii, and n-iii are integers independently selected from 0 to 3. Preferably, R1, R4, and R6are independently selected from the group consisting of C1-4alkyl, C1-2alkoxy; n-i is 0; n-ii is 2; and n-iii is 3. More preferably, R1, R4, and R6are methoxy; n-i is 0; n-ii is 2; and n-iii is 3. In some embodiments, X is chloro; R1, R4, and R6are independently selected from the group consisting of C1-4alkyl, C1-4haloalkyl, C1-3alkoxy; and n-i, n-ii, and n-iii are integersindependently selected from 0 to 3. Preferably, X is chloro; R1, R4, and R6 areindependently selected from the group consisting of C1-4alkyl, C1-2alkoxy; n-i is 0; n-ii is2; and n-iii is 3. More preferably, X is chloro; R1, R4, and R6are methoxy; n-i is 0; n-ii is 2; and n-iii is 3. As described above, G1is a 5-membered heteroarene, optionally substituted with one ortwo substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy,halo, hydroxy and amino, or G1is a 6-membered arene or heteroarene, optionally substituted with one or two substituents selected from the group consisting of methyl, halo, hydroxy and thiol. That is to say, when G1is a 5-membered heteroarene, it is fusedto C5 and C6 of the 2H-1,4-diazepine of formula (Ib) as such: 55479585-1 In some embodiments, G1is selected from the group consisting of thiophene, pyrrole,and furan. In some embodiments wherein G1 is selected from the group consisting ofthiophene, pyrrole, and furan, the heteroarene is fused to C5 and C6 of the2H-1,4-diazepine of formula (Ib) as such: wherein the heteroatom of the 5-membered heteroarene is represented by “Het”.In some embodiments, G1 is a 5-membered heteroarene substituted with one or twosubstituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy,halo, hydroxy and amino. In some embodiments, the 5-membered heteroarene isthiophene, pyrrole, or furan, substituted with one or two substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, and hydroxy. Preferably, the 5-memberedheteroarene is thiophene, pyrrole, or furan, substituted with two substituents selectedfrom the group consisting of C1-3alkyl, C1-3haloalkyl, and hydroxy. More preferably, the 5-membered heteroarene is thiophene, pyrrole, or furan, substituted with two methylgroups. Even more preferably, the 5-membered heteroarene is thiophene substitutedwith two methyl groups.In some embodiments wherein the 5-membered heteroarene is thiophene, pyrrole, orfuran, substituted with two substituents selected from the group consisting of C1-3alkyl,C1-3haloalkyl, and hydroxy, the 5-membered heteroarene is fused to C5 and C6 of the2H-1,4-diazepine of formula (Ib) as such:G2HetN R2 55479585-1 wherein R7corresponds to the two substituents selected from the group consisting of C1- 3alkyl, C1-3haloalkyl, and hydroxy. In some embodiments, G1is a 6-membered arene or heteroarene, optionally substitutedwith one or two substituents selected from methyl, halo, hydroxy and thiol. In someembodiments, the 6-membered arene or heteroarene is selected from the group consisting of benzene, pyridine, pyridazine, pyrimidine, pyrazine, and triazine, each of which is optionally substituted. As described above, G2is a 5-membered N-heteroarene selected from the group consisting of pyrrolidine, pyrrole, imidazolidine, pyrazole, imidazole, triazole, and tetrazole, optionally substituted with one or more substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy, halo, hydroxy and amino. In some embodiments, G2is a 5-membered N-heteroarene selected from the groupconsisting of imidazole, triazole, and tetrazole, optionally substituted with one or moresubstituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy, halo, hydroxy and amino. That is to say, G2is fused to C3 and N4 of the 2H-1,4-diazepine of formula (Ib) as such: wherein R8corresponds to the optional substituents independently selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy, halo, hydroxy and amino. In some embodiments wherein G2is a 5-membered N-heteroarene selected from thegroup consisting of imidazole, triazole, and tetrazole, the 5-membered N-heteroarene isoptionally substituted with one or more substituents selected from the group consistingof C1-3alkyl, C1-3haloalkyl, C1-2alkoxy, and halo. In some embodiments, the 5-memberedN-heteroarene is triazole, optionally substituted with one substituent selected from the55479585-1group consisting of C1-3alkyl, C1-3haloalkyl, C1-2alkoxy, and halo. Preferably, the triazoleis substituted with C1-3alkyl. More preferably, the triazole is substituted with methyl.In some embodiments, R2is H, C1-3alkyl, or C1-3haloakyl. Preferably, R2is H or C1-3alkyl. More preferably, R2is H. In some embodiments, R3is C1-4alkyl, such as methyl, ethyl, propyl, or butyl; R3is C1-4haloalkyl. Preferably, R3is C1-4alkyl. Wherein R3is propyl, R3may be 1-propyl or 2-propyl. Wherein R3 is butyl, R3 may be 1-butyl, 2-butyl, or tert-butyl. More preferably, R3is selected from the group consisting of methyl, ethyl, 2-propyl, and tert-butyl. Even more preferably, R3is methyl or ethyl. Even further preferably, R3is ethyl.In some embodiments, X is chloro; R1 is selected from the group consisting of C1-4alkyl,C1-4haloalkyl, C1-3alkoxy; n-i is an integer selected from 0 to 3; G1 is a 5-memberedheteroarene selected from the group consisting of thiophene, pyrrole, or furan,substituted with one or two substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, and hydroxy; G2is a 5-membered N-heteroarene selected from the group consisting of imidazole, triazole, and tetrazole, optionally substituted with one or more substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-2alkoxy, and halo; R2is selected from the group consisting of H, C1-3alkyl, or C1-3haloakyl; and R3isC1-4alkyl or C1-4haloalky.Preferably, X is chloro; R1 is C1-4alkyl or C1-3alkoxy; n-i is 0 or 1; G1 is a 5-memberedheteroarene selected from the group consisting of thiophene, pyrrole, or furan,substituted with two C1-3alkyl; G2is triazole, optionally substituted with one substituentselected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-2alkoxy, and halo; R2 isH or C1-3alkyl; and R3 is C1-4alkyl.More preferably, X is chloro; R1is C1-3alkyl or C1-2alkoxy; n-i is 0 or 1; G1is thiophene,substituted with two C1-2alkyl; G2 is triazole, substituted with one substituent of C1-3alkylor halo; R2 is H; and R3 is C1-2alkyl.As described above, B1and B2are independently of formula (IIa): ⌇–(A2)a–(CH2)b–(A3)c–(C(O))d–(CH2)e–(A4)f–(CH2)g–⌇ 55479585-1 (IIa) wherein A2, A3, and A4are independently selected from the group consisting of NH, NC1- 4alkyl, O, and S; a, c, d, and f are integers independently selected from 0 and 1; b, e, andg are integers independently selected from 0 to 4; and wherein ⌇ indicates the positionsof attachment. When the abovementioned variables A2, A3, A4, a, b, c, d, e, f, and g are selected to create an embodiment, conventional chemical rules must apply. That is to say, embodiments of the first aspect must comprise chemically feasible compounds. Forexample, a hypothetical embodiment wherein A2, A3, and A4 are O; a, c, and f are 1; andb, d, e, and g are 0 would provide a chemically infeasible compound. The person skilled in the art will understand what does and does not constitute a chemically feasible compound, and therefore understand what embodiments are feasibly described by formula (IIa). In some embodiments, B1is of formula (IIa), wherein a, b, c, e, and g are 0; d and f are 1; and A4is selected from the group consisting of NH, NC1-4alkyl, O, and S; and B2is of formula (IIa), wherein a and g are 0; b is from 0 to 3; c, d, e, and f are 1; and A3and A4are independently selected from the group consisting of NH, NC1-4alkyl, O, and S.Preferably, B1 is of formula (IIa), wherein a, b, c, e, and g are 0; d and f are 1; and A4 isNH or O; and B2 is of formula (IIa), wherein a and g are 0; b is 2; c, d, e, and f are 1; andA3and A4are independently selected from the group consisting of NH, O, and S. More preferably, B1is of formula (IIa), wherein a, b, c, e, and g are 0; d and f are 1; and A4is O; and B2is of formula (IIa), wherein a and g are 0; b is 2; c, d, e, and f are 1; A3and A4is NH; and A4is O. In some embodiments, B1and B2are independently selected from formulae (IIa1) to (IIa2): ⌇–(C(O))d–(CH2)e–(A4)f–(CH2)g–⌇ (IIa1) ⌇–(CH2)b–(A3)c–(C(O))d–(CH2)e–(A4)f–⌇ (IIa2) 55479585-1wherein A3, A4, and b to g are as defined above.In some embodiments: B1is of formula (IIa1), wherein d is 1; e is from 0 to 2; A4is selected from the group consisting of NH, NC1-4alkyl, O, and S; f is 1; and g is from 0 to 2; and B2is of formula (IIa2), wherein b is from 0 to 4; A3is selected from the group consisting of NH, NC1-4alkyl, O, and S; c is 1; d is 1; e is from 0 to 4; A4is selected from the group consisting of NH, NC1-4alkyl, O, and S; and f is 1. Preferably: B1is of formula (IIa1), wherein d is 1; e is from 0 to 1; A4is NH or O; f is 1; and g is from 0 to 1; and B2 is of formula (IIa2), wherein b is from 1 to 3; A3 is NH or O; c is 1; d is 1; e isfrom 0 to 2; A4 is selected from the group consisting of NH, O, and S; and f is 1.More preferably: B1is of formula (IIa1), wherein d is 1; e is 0; A4is NH; f is 1; and g is 0; and B2is of formula (IIa2), wherein b is 2; A3is NH; c is 1; d is 1; e is ; A4is O; and f is 1.As described above, L3 is a linker, capable of joining B1 to B2. In some embodiments, thelinker may be a chain of one or more monomeric units, such that they form a homo- orco-oligomer, or a homo- or co-polymer. Where there is more than one monomeric unit,the monomeric units may be the same monomer (homo-oligomer or homopolymer) or they may be of two or more different monomers (co-oligomer or copolymer).In some embodiments, L3 is of formula (IIIa):⌇–(L2)w–⌇ (IIIa)wherein w is an integer from 1 to 10; each L2 is independently selected from the groupconsisting of C(O)NH, C(O)O, CH2CH2O, CH2, ethenylene, ethynylene, triazolylene,piperazinylene, and piperidinylene; and wherein ⌇ indicates the positions of attachment.That is to say, each L2is independently one of formulae (IIId) to (IIIk), and (IIIq): 55479585-1 wherein the wavy line indicates the position of attachment. Each L2may independently join together from either position of attachment of the aforementioned moieties, or the above formulae. Furthermore, B1and B2may join to the linker from either position ofattachment. In some embodiments, L3 is of formulae (IIIm) to (IIIp): In some embodiments, where: B1is of formula (IIa), wherein a, b, c, e, and g are 0; d and f are 1; and A4is selected from the group consisting of NH, NC1-4alkyl, O, and S; and B2is of formula (IIa), wherein a and g are 0; b is from 0 to 3; c, d, e, and f are 1; and A3and A4are independently selected from the group consisting of NH, NC1-4alkyl, O, and S; L3is of formula (IIIa) wherein L2is CH2CH2O; and w is from 1 to 10. Preferably, where: B1is of formula (IIa), wherein a, b, c, e, and g are 0; d and f are 1; and A4is NH or O; and B2is of formula (IIa), wherein a and g are 0; b is 2; c, d, e, and f are 1; and A3and A4are independently selected from the group consisting of NH, O, and S; L3is of formula (IIIa) wherein L2is CH2CH2O; and w is from 2 to 7. 55479585-1 More preferably, where: B1is of formula (IIa), wherein a, b, c, e, and g are 0; d and f are 1; and A4is O; and B2is of formula (IIa), wherein a and g are 0; b is 2; c, d, e, and f are 1; A3and A4is NH; and A4is O; L3is of formula (IIIa) wherein L2is CH2CH2O; and w is 3.In some embodiments, B1 is selected from any one of formula (IIb) to (IIe): wherein p is an integer from 0 to 4; and the wavy lines indicate the positions ofattachment. Preferably, where B1 is of formula (IIb) or (IIc), p is 0 or 1. More preferably,where B1is of formula (IIb) or (IIc), p is 0.In some embodiments, B2 is of formula (IIf) or (IIg): wherein A5is O or NH; A6is O, NH, or S; m and q are integers independently selectedfrom 0 to 4; and the wavy lines indicate the positions of attachment. Preferably, whereB2 is of formula (IIf), A5 is NH and A6 is O. More preferably, where B2 is of formula (IIf),A5 is NH and A6 is O: m is 2; and q is 1.In some embodiments, L3 is of formula (IIIc):55479585-1 wherein t is an integer selected from 1 to 10; and the wavy lines indicate the positions ofattachment. Preferably, t is selected from 1, 2, 3, 4, 5, 6, 7, and 8. More preferably, t isselected from 2, 3, 4, and 5. More preferably, t is 3.In some embodiments, where: B1is selected from any one of formula (IIb) to (IIe), wherein p is described as above; and B2is of formula (IIf) or (IIg), wherein A5, A6, m and q are as described above; L3 is of formula (IIIc), wherein t is as described as above.Preferably, where: B1 is of formula (IIb) or (IIc), wherein p is 0 or 1; and B2 is of formula (IIf), whereinA5is NH; A6is O; and m and q are independently selected from 0, 1, and 2; L3 is of formula (IIIc), wherein t is selected from 1, 2, 3, 4, 5, 6, 7, and 8.More preferably, where: B1is of formula (IIb), wherein p is 0; and B2is of formula (IIf), wherein A5is NH;A6 is O; m is 2; and q is 1;L3 is of formula (IIIc), wherein t is 3.In some embodiments, A1is O or NH. Preferably, A1is O. In some embodiments, h is 0 or 1. Preferably, h is 1. In some embodiments, R5is C1-4alkyl, such as methyl, ethyl, propyl, or butyl; R5is C1-4haloalkyl. Preferably, R5is C1-4alkyl. Wherein R5is propyl, R5may be 1-propyl or 2- propyl. Wherein R5is butyl, R5may be 1-butyl, 2-butyl, or tert-butyl. More preferably, R5is selected from the group consisting of methyl, ethyl, 2-propyl, and tert-butyl. Even more preferably, R5is methyl or ethyl. More preferably, R5is ethyl. 55479585-1 In some embodiments, h is 0 or 1; A1is O or NH; and R5is selected from the group consisting of methyl, ethyl, 2-propyl, and tert-butyl. Preferably, h is 1; A1is O; and R5is ethyl.In some embodiments, the proximity-inducing compound is of the formula (IVa): wherein B1, L3, and B2are independently as defined in any preceding embodiment.In some embodiments, the proximity-inducing compound is of the formula (IVb): 55479585-1 (IVb)It is an object of the present invention to provide a PIC for use in a method of inducingproximity between biological molecules such that they are able to interact. Thus, in thesecond aspect there is provided a method of inducing proximity between two biologicalmolecules, the method comprising: contacting a first biological molecule and a second biological molecule with the proximity inducing-compound of the first aspect such that a ternary complex is formed, thereby inducing proximity between the two biological molecules such that they are able to interact; and optionally: detecting the formation of the ternary complex; and / or detecting the interaction, or lack thereof, between the two biological molecules; wherein: the first biological molecule comprises a hole modified Brd bromodomain; and the second biological molecule comprises an FKBP. For the avoidance of doubt, any of the embodiments described in relation to the PIC ofthe first aspect may apply to the method of the second aspect. That is to say, in someembodiments of the second aspect, the PIC is as described in any one of theembodiments of the first aspect.In some embodiments of the second aspect, the PIC is of formula (IVa), wherein B1, L3,and B2are independently as defined in any preceding embodiment of the first aspect. In some embodiments of the second aspect, the PIC is of formula (IVb).The term “contacting” is defined above. In some embodiments, the contacting comprisesaddition of the PIC to a biological molecule. In alternative embodiments, a biologicalmolecule is added to the PIC. The PIC and the biological molecules may eachindependently be in a solution, suspension or slurry on contacting. In some embodiments, each are in solution, for example a buffer solution, on contacting. Alternatively, one may be in solution, such as a buffer solution, and the other may be added neat or in a concentrated sample. 55479585-1In some embodiments, one biological molecule is a protein. In some embodiments, bothbiological molecules are proteins. In some embodiments, one biological molecule is atagged protein. In some embodiments, both biological molecules are tagged proteins. As described above, BromoTag is a tag that incorporates a hole-modified Brd bromodomain into a protein, of which a ligand may bind to. In some embodiments of thesecond aspect, one biological molecule is a protein tagged with BromoTag. That is tosay, the biological molecule comprises a hole-modified Brd bromodomain.Wherein one biological molecule is a protein tagged with BromoTag, or comprises a hole-modified Brd bromodomain, the hole-modified Brd bromodomain is selected from thegroup consisting of Brd4BD2L387A, Brd4BD2L387V, Brd4BD1L94A, Brd4BD1L94V,Brd2BD2L383A, Brd2BD2L383V, Brd2BD1L110A, Brd2BD1L110V, Brd3BD2L344A, Brd3BD2L344V, Brd3BD1L70A, Brd3BD1L70V, BrdTBD2L306A, BrdTBD2L306V, BrdTBD1L63A, or BrdTBD1L63V. Preferably, the hole-modified Brd bromodomain is Brd4BD2L387A. In some embodiments, the bromodomain may be grafted to the C-terminus or the N-terminus of the protein, which may be achieved through homologous recombination technology, such as CRISPR / Cas9. As described above, dTAG is a tag that incorporates an FK binding protein (FKBP) into a protein, of which a ligand may bind to. In some embodiments of the second aspect,one biological molecule is a protein tagged with dTAG. That is to say, the biologicalmolecule comprises an FKBP.Wherein one biological molecule is a protein tagged with dTAG, or comprises an FKBP,the FKBP is FKBP12. Preferably, the FKBP is FKBP12F36V. FKBP12 may be referred toas FKBP1A. In some embodiments, the FKBP may be grafted to the C-terminus or the N-terminus of the protein, which may be achieved through homologous recombination technology, such as CRISPR / Cas9. In some embodiments, wherein one biological molecule is a protein tagged with BromoTag and the other biological molecule is a protein tagged with dTAG, the hole-modified Brd bromodomain is selected from the group consisting of Brd4BD2L387A,Brd4BD2L387V, Brd4BD1L94A, Brd4BD1L94V, Brd2BD2L383A, Brd2BD2L383V, Brd2BD1L110A, Brd2BD1L110V, Brd3BD2L344A, Brd3BD2L344V, Brd3BD1L70A, Brd3BD1L70V, BrdTBD2L306A, 55479585-1BrdTBD2L306V, BrdTBD1L63A, or BrdTBD1L63V; and the FKBP is FKBP12. Preferably, thehole-modified Brd bromodomain is Brd4BD2L387A; and the FKBP is FKBP12F36V.As defined above, a binary complex forms when one molecule is bound to one other molecule. Further, a ternary complex forms when one molecule is bound to two other molecules. In some embodiments of the present invention, the ternary complex formswhen a binary complex is bound to one other molecule. In some embodiments, the binarycomplex is a complex between a biological molecule and the PIC. In some embodiments, the binary complex is a complex between a protein and the PIC. In some embodiments, the protein may be a tagged protein, such as a protein tagged with BromoTag or dTAG. Wherein the protein is a protein tagged with BromoTag, one of the ligands or termini ofthe PIC may be bound to the hole-modified Brd bromodomain of the tagged protein.Wherein the protein is a protein tagged with dTAG, one of the ligands or termini of thePIC may be bound to the FKBP of the tagged protein. In some embodiments, the ligandof the PIC may bound to the hole-modified Brd bromodomain of the taggedprotein to form a binary complex. In some embodiments, the ligand of the PICmay be bound to the FKBP of the tagged protein to form a binary complex.In some embodiments, the ternary complex is a complex between the PIC and both thefirst and second biological molecules. That is to say, both biological molecules areindependently bound to the PIC. In some embodiments, the ternary complex is the result of the formation of a complex between any abovementioned binary complex and one other biological molecule. In some embodiments, the ternary complex is the result of the formation of a complex between any abovementioned biological molecule with a binary complex. In some embodiments, both biological molecules are proteins. In some embodiments, both biological molecules are independently tagged proteins. In some embodiments, one tagged protein is tagged with BromoTag, and the other tagged proteinis tagged with dTAG. Wherein one protein is a protein tagged with BromoTag, and theother protein is a protein tagged with dTAG: one of the ligands, the ligand , ortermini of the PIC may be bound to the hole-modified Brd bromodomain of one taggedprotein; and one of the ligands, the ligand , or termini of the PIC may be bound tothe FKBP of the other tagged protein. 55479585-1 In some embodiments, the detecting the formation of the ternary complex is carried outby any one or more methods selected from the group consisting of immunoprecipitation(IP), protein complex immunoprecipitation (Co-IP), protein tagging, mass spectrometry (MS), X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, surface plasmon resonance (SPR), yeast two-hybrid (Y2H) screening, fluorescence resonance energy transfer (FRET), cryo-electron microscopy (cryo-EM), bimolecular fluorescence complementation (BiFC), affinity chromatography, SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), Blue Native (BN)-PAGE, pull-down assays, and isothermal titration calorimetry (ITC). In some embodiments, the detecting the formation of the ternary complex is carried out by one or more methods selected from the group consisting of immunoprecipitation,Western blotting, and mass spectrometry. In some embodiments, the detecting theformation of the ternary complex is carried out by immunoprecipitation; and Western blotting or mass spectrometry. As described above, the method comprises contacting a first biological molecule and a second biological molecule with the proximity inducing-compound of the first aspect such that a ternary complex is formed, thereby inducing proximity between the two biological molecules such that they are able to interact. The term proximity is defined above and refers to the state or condition wherein two or more entities are situated near or next to each other in space, with a degree of closeness that enables or facilitates interaction,influence, or a functional relationship between them. Thus, a PIC is therefore understoodto refer to a compound that is able to induce, enable, or facilitate proximity between twoor more entities. The entities may be biological molecules, such as proteins or taggedproteins. The interactions that may result from the induced proximity between twobiological molecules include but are not limited to targeting to proteasome fordegradation, targeting to lysosome for degradation, protein inhibition, protein stabilisation, enzyme-substrate interactions, signal transduction, scaffold protein interactions, protein complexation in DNA replication and repair, transcription factor binding, protein transport, regulatory protein interaction, immune response interactions,allosteric interactions, post-translational modification, phosphorylation, anddephosphorylation. Phosphorylation and dephosphorylation may be considered to betypes or subsets of post-translational modification, as may ubiquitination, acetylation, 55479585-1methylation, glycosylation, sulfation, lipidation, and sumoylation (SUMO – smallubiquitin-like modifier). In some embodiments, the interaction or lack thereof to be detected is selected from thegroup consisting of targeting to proteasome for degradation, targeting to lysosome fordegradation, protein inhibition, protein stabilisation, enzyme-substrate interactions, signal transduction, scaffold protein interactions, protein complexation in DNA replication and repair, transcription factor binding, protein transport, regulatory protein interaction, immune response interactions, allosteric interactions, post-translational modification, phosphorylation, and dephosphorylation. In some embodiments, the interaction or lack thereof to be detected is selected from the group consisting of targeting to proteasome for degradation, targeting to lysosome for degradation, protein inhibition, proteinstabilisation, signal transduction, scaffold protein interactions, post-translationalmodification, phosphorylation, and dephosphorylation. Preferably, the interaction or lackthereof to be detected is selected from the group consisting of post-translationalmodification, phosphorylation, and dephosphorylation. More preferably, the interactionor lack thereof to be detected is dephosphorylation.In some embodiments wherein the interaction is an enzyme-substrate interaction, or apost-translational modification, the interaction may be a dephosphorylation reaction. Insome embodiments wherein the interaction is a dephosphorylation reaction, one or twobiological molecules may be a tagged protein. In some embodiments, the tagged protein may be tagged with either BromoTag or dTAG. In some embodiments, the tagged proteinmay be a phosphatase. In some embodiments wherein the tagged protein is aphosphatase, the phosphatase may be tagged with BromoTag or dTAG. In some embodiments, the phosphatase is tagged with BromoTag. That is to say, in someembodiments, the phosphatase comprises a hole-modified Brd bromodomain. In someembodiments, the hole-modified Brd bromodomain is selected from the group consistingof Brd4BD2L387A, Brd4BD2L387V, Brd4BD1L94A, Brd4BD1L94V, Brd2BD2L383A, Brd2BD2L383V,Brd2BD1L110A, Brd2BD1L110V, Brd3BD2L344A, Brd3BD2L344V, Brd3BD1L70A, Brd3BD1L70V, BrdTBD2L306A, BrdTBD2L306V, BrdTBD1L63A, or BrdTBD1L63V. Preferably, the hole-modified Brd bromodomain is Brd4BD2L387A. In some embodiments wherein theinteraction is a dephosphorylation reaction, one of the biological molecules may be a phosphorylated protein. In some embodiments, the phosphorylated protein may betagged. In some embodiments, the tag is BromoTag or dTAG. In some embodiments,55479585-1 the phosphorylated protein is a protein tagged with dTAG. That is to say, thephosphorylated protein comprises an FKBP. In some embodiments, the FKBP isFKBP12. In some embodiments, the FKBP is FKBP12F36V. In some embodiments, thephosphatase is PPM1H, PPP2CA, PPP1CA, or PPM1A. Preferably, the phosphatase isPPM1H or PPP2CA. In some embodiments wherein the phosphatase is tagged withBromoTag, the phosphatase is BromoTag-PPM1H or BromoTag-PPP2CA. In some embodiments, the phosphorylated protein is SMAD3 or TFEB. In some embodiments wherein the phosphorylated protein is a protein tagged with dTAG, the protein is dTAG- SMAD3 or dTAG-TFEB. In some embodiments, the phosphatase is tagged with dTAG, for example, in some embodiments the phosphatase is dTAG-PPP2CA. In some embodiments, the phosphorylated protein is tagged with BromoTag, for example, in some embodiments the phosphorylated protein is Tau-BromoTag. In some embodiments, the detecting the interaction, or lack thereof, between the two biological molecules is carried out by any one or more methods selected from the group consisting of immunoprecipitation (IP), protein complex immunoprecipitation (Co-IP), protein tagging, mass spectrometry (MS), X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, surface plasmon resonance (SPR), yeast two-hybrid (Y2H) screening, fluorescence resonance energy transfer (FRET), cryo-electron microscopy (cryo-EM), bimolecular fluorescence complementation (BiFC), affinity chromatography, SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), Blue Native (BN)-PAGE, pull-down assays, and isothermal titration calorimetry (ITC). In some embodiments, the detecting the interaction or lack thereof is carried out by one or more methods selected from the group consisting of immunoprecipitation, Westernblotting, and mass spectrometry. In some embodiments, the detecting the interaction orlack thereof is carried out by Western blotting or mass spectrometry. In some embodiments, the detecting the formation, and / or the detecting the interactionor lack thereof, is carried out by one or more methods selected from the group consistingof immunoprecipitation, Western blotting, and mass spectrometry. 55479585-1 In some embodiments of the second aspect, the biological molecules are proteins; the interaction or lack thereof to be detected is selected from the group consisting of targeting to proteasome for degradation, targeting to lysosome for degradation, protein inhibition, protein stabilisation, post-translational modification, phosphorylation, and dephosphorylation; and the detecting the formation, and / or the detecting the interaction or lack thereof, is carried out by one or more methods selected from the group consisting of immunoprecipitation, Western blotting, and mass spectrometry. The compounds of the present invention may exist in more than one stereoisomeric form. For the avoidance of doubt, all stereoisomeric forms of any compound of any one previous embodiment of either the first or second aspect are included within the scope of the invention. Stereoisomeric forms include but are not limited to racemic mixtures, scalemic or non-equimolar enantiomeric mixtures, single enantiomers, diastereomeric mixtures, single diastereomers, and mixtures of stereoisomers in any proportion. Whilst some formulae of the abovementioned embodiments may be depicted with a particular stereochemistry, for example, a racemate, a particular enantiomer, or a particular diastereomer, this does not preclude the alternative stereoisomers or stereoisomeric forms from the scope the invention.Also included are solvates and isotopically-labelled compounds of the invention.Isotopically-labelled compounds are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number predominantly found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine and chlorine, such as2H (i.e.,deuterium), 3H, 13C, 14C, 15N, 18O, 17O, 35S, 18F, and 36Cl, respectively.A protium atom (H) is a hydrogen atom with zero neutrons. A deuterium atom (D or2H) is a hydrogen atom with one neutron. Naturally occurring hydrogen contains about0.02 mol% deuterium and 99.98% protium. Physical chemical properties betweenprotium and deuterium are small but measurable. Deuterium is slightly less lipophilic than protium, has a smaller molar volume and carbon-deuterium bonds are shorter than carbon-protium bonds. Deuterium keeps the 3D surface, shape and steric flexibility of a molecule unaltered compared to H. A ratio of deuterium:protium in a compound greater than 1:99 is considered to be greater than that found naturally in hydrogen. In particular 55479585-1 embodiments, where a moiety is specified as being “H”, the ratio of deuterium:protium at this position is greater than the natural isotopic abundance of deuterium, i.e. the percentage of deuterium found at his position of the compounds of the invention is greater than its natural isotopic abundance in hydrogen, which is about 0.02 mol%. All amorphous and crystalline forms of the compounds of the invention are included. BRIEF DESCRIPTION OF THE FIGURES: Figure 1 (A) Schematic representation of BDPIC-mediated induction of proximity between TFEB-dTAG and HA-BromoTag-PPP2CA. (B-E) U2OS cells stably co-expressing TFEB-dTAGand HA-BromoTag-empty, HA-BromoTag-PPP2CA or HA-BromoTag-PPP2CAH118Q. (B) Cells treated with BDPIC at indicated concentrations for 24 h before lysis and extractssubjected to immunoblot analysis. (C-D) Cells treated with 100 nM BDPIC for indicatedtimes prior to lysis. TFEB and PPP2CA protein abundance analysed by immunoblottingusing the indicated antibodies. (E) Cells treated with 100 nM BDPIC for 2 h. BDPICwashed off by PBS and fresh culture media without BDPIC added to cells. Cells subsequently cultured for indicated times prior to lysis and immunoblot analysis performed as indicated. Figure 2(A) Schematic representation of BDPIC-mediated induction of proximity between TFEB-BromoTag and dTAG-PPP2CA. (B) U2OS cells stably co-expressing TFEB-BromoTagand dTAG-empty, dTAG-PPP2CA or dTAG-PPP2CAH118Qtreated with BDPIC for 24 h before lysis. Immunoblot analysis performed on extracts (10 μg protein) with the indicated antibodies. Figure 3 (A) Schematic representation of HDPIC-mediated induction of proximity between TFEB- Halo and dTAG-PPP2CA. (B-C) U2OS cells stably expressing TFEB-Halo or those co- expressing TFEB-Halo and dTAG-PPP2CA or dTAG-PPP2CAH118Qwere generated. Cells treated with HDPIC (B) or PhosTAC7 (C) at indicated concentrations for 24 h prior to lysis. Immunoblotting analysis performed on extracts (10 μg protein) with the indicated antibodies. 55479585-1 Figure 4 (A) TFEBGFP / GFP / TFE3- / -C2C12 myoblast cells generated using a two-step CRISPR / Cas9 genome editing approach. In the first, GFP was knocked in at the C-terminus of the TFEB locus homozygously and a single clone (clone 2-28) selected. Inthis clone, TFE3 was knocked out by CRISPR / Cas9 genome editing and a single clone (clone 1-3) isolated. Validation by immunoblotting is included. For immunoblotting, cells were lysed before extracts (20 ^^g protein) were resolved by SDS-PAGE, transferred to nitrocellulose membrane and subjected to immunoblotting with the indicated antibodies.(B) Immunoblotting validation of U2OS TFEBdTAG / dTAG / BromoTag / +PPP2CA (clone 2) doubleknock-in clonal isolate compared with wild-type (WT) U2OS cells. (C) Confirmation ofTFEBdTAG / dTAG / BromoTag / +PPP2CA knock-in (clone 2) by PCR amplification of the targetPPP2CA genomic region with two different sets of primers. DNA from WT U2OS cellsincluded as a negative control. (D) Confirmation of TFEBdTAG / dTAG / BromoTag / +PPP2CAknock-in by PCR amplification of the target TFEB genomic region as in (C) using the indicated primers. Samples run on the same gel but non-relevant samples (from otherclonal isolates) omitted from the image.Figure 5 (A-D) TFEBdTAG / dTAGU2OS cells stably expressing HA-BromoTag-empty, HA-BromoTag- PPP2CA or HA-BromoTag-PPP2CAH118Qgenerated. (A) Cells treated with DMSO (D), MK-8722 (M) (10 ^^M), Torin 1 (T) (100 nM) or BDPIC (B) (100 nM) for 2 h before lysis and extracts (10 μg protein) subjected to immunoblot analysis as indicated. (B) Cells treated with 100 nM BDPIC for 2 h prior to lysis. Extracts (10 μg protein) subjected to immunoblot analysis as indicated. (C) Cells treated with 100 nM BDPIC for 2 h. DSP- crosslinking was performed prior to lysis. Cell extracts subjected to anti-HA pull down. TFEB-dTAG and BromoTag-PPP2CA proteins analysed by immunoblotting. (D) Cells treated with excess (10 ^M) dTAGV1-inactive PROTAC compound for 30 min prior to treating cells with 100 nM BDPIC. After 2 h, cells lysed and subjected to immunoblot with the indicated antibodies. Figure 6 (A) Immunostaining of TFEB performed in TFEBdTAG / dTAGknock-in U2OS cells stably expressing HA-BromoTag-empty, HA-BromoTag-PPP2CA or HA-BromoTag- PPP2CAH118Qtreated with DMSO, Torin 1 (100 nM) or BDPIC (100 nM) for 2 h prior to fixation. Nucleus stained with DAPI. Scale bars, 10 ^m. (B) TFEBdTAG / dTAGknock-in U2OS 55479585-1 cells stably expressing HA-BromoTag-empty, HA-BromoTag-PPP2CA or HA- BromoTag-PPP2CAH118Qtreated with DMSO or 100 nM BDPIC for 2 h prior to lysis. Cytoplasmic and nuclear fractions isolated and subjected to immunoblot analysis withthe indicated antibodies. (C) TFEBdTAG / dTAG knock-in U2OS cells treated with DMSO or100 nM BDPIC for 8 h prior to lysis. The expression of Hexa, Fnip1, Flcn and Gpnmbtranscripts examined by qRT-PCR. All quantitative data are mean ± SEM from 3independent experiments. * P < 0.05 compared with DMSO treatment.Figure 7 (A-E) TFEBdTAG / dTAG / BromoTag / +PPP2CA U2OS cells generated by CRISPR / Cas9 technology. (A) Cells treated with DMSO, MK-8722 (10 ^M), Torin 1 (100 nM) or BDPIC (100 nM) for 2 h prior to lysis and extracts (20 μg protein) subjected to immunoblot analysis. (B) Cells treated with either DMSO or 100 nM BDPIC for 2 h prior to lysis. Extracts (20 μg protein) subjected to immunoblot analysis as indicated. (C) Cytoplasmic and nuclear fractions from cells treated with DMSO or 100 nM BDPIC for 2 h extracted and subjected to immunoblot with the indicated antibodies. (D) Cells treated with DMSO, MK-8722 (10 ^M) or BDPIC (100 nM) for 2 h before fixation and immunostaining for TFEB. Nucleus stained with DAPI. Scale bars, 10 ^m. (E) Cells treated with DMSO, Torin 1 (100 nM), MK-8722 (10 ^M) or BDPIC (100 nM) for 4 h prior to lysis. The expressionof Hexa, Flcn Gpnmb and Fnip1 transcripts examined by qRT-PCR. All quantitative dataare mean ± SD from 3 independent experiments, with statistical analysis involving paired t-tests to compare to DMSO treatment. * P < 0.05 and **P < 0.01 compared with DMSO treatment. Figure 8(A) U2OS TFEBdTAG / dTAG / BromoTag / +PPP2CA (clone 2) cells treated for 2 h with BDPIC (100nM) or DMSO before cells lysed and extracts (20 μg protein) resolved by SDS-PAGE, transferred to nitrocellulose membrane and subjected to immunoblotting with the indicated antibodies. (B-C) HEK293 cells transiently transfected with plasmids encoding TFEB-FLAG wild type (WT), Ser109Ala (B) or Ser138Ala (C) mutants. Protein lysates collected 48 h post-transfection and subjected to immunoblot analysis of TFEB-FLAG and phosphorylated TFEB-FLAG on Ser109 (B) or Ser138 (C) using the specifiedantibodies. Vinculin used as a loading control. (D) Cells from (A) treated with DMSO orBDPIC at the indicated concentrations for 48 h. Values normalized with the DMSO group.55479585-1 All quantitative data are mean ± SEM from 5 independent experiments. MG132 (20 ^M)treatment was used as positive control for cytotoxicity. * P < 0.05.Figure 9 (A) Schematic representation of BDPIC-mediated induction of proximity between a BromoTag-phosphatase and dTAG-SMAD3 to elicit targeted dephosphorylation ofdTAG-SMAD3. (B) Screening of BDPIC-mediated recruitment of different BromoTag-phosphatases to target dTAG-SMAD3 dephosphorylation. U2OS cells retrovirallytransduced to co-express dTAG-SMAD3 and the indicated BromoTag-phosphatases.Cells serum-starved (16 h) prior to stimulation with TGFβ (1 h, 5 µg / L). 0 h time pointswere lysed at this moment. For 2 h time points, TGFβ stimulation was removed bywashout and fresh serum-free medium without TGFβ was added to cells, along withDMSO or BDPIC treatment at the indicated concentrations for 2 h. Cells were then lysedbefore extracts were resolved by SDS-PAGE, transferred to nitrocellulose membraneand subjected to immunoblot with the indicated antibodies. (C) As in (B) except U2OScells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1H orcatalytically dead BromoTag-PPM1HH153D were used. (D) As in (B) except U2OS cellsexpressing dTAG-SMAD3 alone or in combination with BromoTag-PPP2CA orcatalytically dead BromoTag-PPP2CAH118Q were used. (E) As in (B) except U2OS cellsexpressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1A orcatalytically dead BromoTag-PPM1AD239A were used. Figure 10 (A) dTAG-SMAD3 phosphorylation stimulated by treating U2OS dTAG-SMAD3 cells with recombinant TGFβ (5 µg / L) for the indicated durations prior to lysis. Extracts resolved bySDS-PAGE, transferred to nitrocellulose membrane and subjected to immunoblot withthe indicated antibodies. (B) Quantification of relative phospho-dTAG-SMAD3 / totaldTAG-SMAD3 from (A). (C) dTAG-SMAD3 dephosphorylation monitored following 1 hstimulation of U2OS dTAG-SMAD3 cells with TGFβ (5 µg / L), followed by either lysis (0h after washout) or replacement with fresh serum-free medium and lysis after theindicated time. Unstimulated cells (treated with solution in which TGFβ wasreconstituted) included as a control. Cells were lysed and extracts were processed as in(A). (D) Quantification of relative phospho-dTAG-SMAD3 / total dTAG-SMAD3 from (C).Values are shown relative to cells treated with TGFβ at 0 h after washout, displayed asmean±SD. 55479585-1 Figure 11 (A) U2OS cells co-expressing dTAG-SMAD3 and BromoTag-PPM1H serum-starvedbefore 2 h co-treatment of TGFβ (5 µg / L) and the indicated compounds or equivalentvolumes of DMSO. Extracts resolved by SDS-PAGE, transferred to nitrocellulosemembrane and subjected to immunoblot with the indicated antibodies. (B) U2OS FLAG-dTAG-SMAD3 3HA-BromoTag-PPM1H cells serum-starved overnight before 2 htreatment with either control or TGFβ (5 µg / L) in addition to DMSO, SB-505125 (1 µM),BDPIC (250 nM) or a combination of BDPIC (250 nM) and cis-AGB1 (2500 nM). Cells then lysed and extracts or anti-HA-immunoprecipitates (IP) were processed for immunoblot as in (A). Figure 12 (A) Schematic representation of phospho-dependent function of dTAG-SMAD3 uponTGFβ stimulation and upon BDPIC-mediated dephosphorylation. (B) dTAG-SMAD3nuclear translocation probed by cellular fractionation. U2OS cells retrovirally transducedto express dTAG-SMAD3 alone or in combination with either BromoTag-PPM1H orBromoTag-PPM1HH153D . Cells were serum-starved (16 h) prior to 2 h co-treatmentwith control or TGFβ (5 µg / L), SB-505124 (1 µM) and BDPIC (100 nM) as indicated.Cytoplasmic and nuclear fractions were then isolated before extracts were resolved bySDS-PAGE, transferred to nitrocellulose membrane and subjected to immunoblot withthe indicated antibodies. (C) The impact of dTAG-SMAD3 dephosphorylation on PAI-1levels investigated by serum-starving U2OS cells expressing dTAG-SMAD3 alone or incombination with BromoTag-PPM1H or BromoTag-PPM1HH153D , before 6 h treatmentwith TGFβ (5 µg / L) and DMSO, SB-505124 (1 µM) or BDPIC (100 nM). Cells were lysedand extracts were processed as in (B).Figure 13 (A) Western blot of A549 wild-type (WT) and A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 clone 51 cells. Cells lysed before extractsresolved by SDS-PAGE, transferred to nitrocellulose membrane and subjected toimmunoblot with the indicated antibodies. (B) Confirmation of knock-in by amplificationof the target SMAD3 genomic region through polymerase chain reaction, with clone 51highlighted in red. DNA from parental A549 BromoTag / BromoTagPPM1H cells included as anegative control while DNA from knock-in A549 dTAG / dTAGSMAD3 clone 5 cells included55479585-1as a positive control. Samples run on the same gel and non-relevant samples omittedfrom between samples of interest. (C) Validation that endogenous dTAG-SMAD3 in A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 clone 51 cells retain endogenous function and isresponsive to TGFβ stimulation and capable of subsequently increasing PAI-1 proteinlevels. Cells stimulated for 6 h with TGFβ (5 µg / L) prior to being processed as in (A). (D)Preliminary dose response of BDPIC-mediated targeted dephosphorylation of dTAG-SMAD3 in A549 BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 cells. Following serum-starvation(16 h), cells were stimulated with TGFβ (5 µg / L) for 1 h.0 h time points were lysed at thismoment. For 2 h time points, TGFβ stimulation was removed by washout and freshserum-free medium without TGFβ was added to cells, along with DMSO or the indicatedconcentrations of BDPIC for 2 h. SB-505124 was employed as a control. Cells were thenlysed and processed as in (A).Figure 14 (A) BDPIC employed to mediate targeted dephosphorylation of dTAG-SMAD3 in A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 knock-in cells (cl.51). Following serum-starvation(16 h), cells were stimulated with control or TGFβ (5 µg / L) for 1 h. For TGFβ-treatedsamples, 0 h time points were lysed at this moment. For 2 h time points, TGFβ stimulationwas removed by washout and fresh serum-free medium without TGFβ was added tocells, along with DMSO or BDPIC (250 nM or 1000 nM) for 2 h. Cells were then lysedbefore extracts were resolved by SDS-PAGE, transferred to nitrocellulose membraneand subjected to immunoblot with the indicated antibodies. (B) Exploration of BDPIC’sability to impact PAI-1-induction by dTAG-SMAD3 at the endogenous level. A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 (cl. 51) cells were serum-starved (16 h) prior toco-treatment (6 h) with control or TGFβ (5 µg / L) and DMSO, SB-505124 (1 µM) or BDPIC(250 nM or 500 nM) as indicated. Cells were then lysed and extracts were processed asin (A). (C-D) RT-qPCR performed to confirm BDPIC’s impact on TGFβ target genetranscription, including PAI-1 (C) and SMAD7 (D). Data are shown as mean±SD of targetgene transcripts normalized to GAPDH, relative to TGFβ control cells (column 1), fromn=3 independent experiments. Each experiment included three technical replicates.Statistical analysis involved one-way analysis of variance (ANOVA) with Tukey’s multiplecomparisons post-hoc test. Figure 15 55479585-1 (A) Schematic of recruitment of Halo-POI to a dTAG-phosphatase to mediate targetedHalo-POI dephosphorylation HDPIC. (B) Structure of HDPIC. (C) Cytotoxicity of HDPICmeasured using CellTox Green Assay (Promega) by treating wild-type (WT) U2OS orA549 cells with HDPIC at the indicated concentrations for 24 h, with DMSO as a negativecontrol and with MG132 (20 μM, 24 h) or the lysis buffer as a positive control.Fluorescence measured using a PHERAstar plate reader (ex: 480 nm em: 530 nm).Values shown as a mean fluorescence reading normalized to DMSO controls±SD. (D)Engagement of Halo-POI by HDPIC shown by band-shift of small (~35 kDa) artificial FLAG-NLS(nuclear localisation signal)-Halo-HiBiT protein upon HDPIC treatment. U2OScells stably expressing FLAG-NLS-Halo-HiBiT were treated for 2 h with the indicatedconcentrations of HDPIC or an equivalent volume of DMSO. Cells were lysed beforeextracts were resolved by SDS-PAGE, transferred to nitrocellulose membrane andimmunoblotted with the indicated antibodies. (E) Engagement of dTAG-POI by HDPICshown by means of a competition-style assay. HEK293 WT or HEK293 dTAG / dTAGPPP2CAcells were treated for 24 h with DMSO, dTAG-13 PROTAC (100 nM), HDPIC (1 µM) ora combination of dTAG-13 and HDPIC. Cells were lysed and processed as in (D). (F)U2OS cells stably expressing Halo-SMAD3 alone or in combination with dTAG-PPM1H serum-starved (16 h) before 1 h stimulation with TGFβ (5 µg / L).0 h samples were lysed at this point. For other samples, TGFβ stimulation was removed and cells were placedin fresh serum-free medium without TGFβ with DMSO, HDPIC (1 µM) or no treatment.Samples were then lysed and processed as in (D). (G) Western blot screening of multipleA549 HaloSMAD3 knock-in clones, with the clone of interest, Clone 19, highlighted in red.Cells were lysed and processed as in (D). (H) Confirmation of knock-in in multiple clones,with clone 19 highlighted in red, by amplification of the target SMAD3 genomic regionthrough polymerase chain reaction. DNA from parental WT A549 cells was included asa negative control. (I) To show effect of covalent Halo-ligand binding on Halo-SMAD3phosphorylation, A549 Halo / WTSMAD3 knock-in cells were serum-starved (16 h) prior to 1h co-treatment with TGFβ (5 µg / L) and SB-505124 (1 µM) / DMSO. 0 h time points werelysed at this moment. For 4 h time points, TGFβ stimulation was removed by washoutand fresh serum-free medium without TGFβ was added to cells, along with DMSO,HDPIC (200 nM) or PhosTAC7 (200 nM) for 4 h. Samples were then lysed and processedas in (D). (J) Structure of PhosTAC7.Figure 16 55479585-1(A) Structure of HDPIC-Neg. (B) Cytotoxicity of HDPIC-Neg measured using CellToxGreen Assay (Promega) as in (Fig.15C), in wild-type (WT) U2OS and A549 cells. Valuesare shown as a mean fluorescence reading normalized to DMSO controls±SD. (C)Engagement of Halo-POI by HDPIC-Neg probed by a band-shift assay in U2OS FLAG-NLS-Halo-HiBiT cells following 2 h treatment with the indicated concentrations of HDPIC-Neg or an equivalent volume of DMSO. Samples were lysed before extracts were resolved by SDS-PAGE, transferred to nitrocellulose membrane and immunoblotted withthe indicated antibodies.Figure 17 (A) TAUdTAG / dTAGSK-N-MC cells stably expressing HA-bromoTAG-empty, HA- bromoTAG-PPP2CA or HA-bromoTAG-PPP2CAH118Qwere treated with 0, 100 and 250nm BDPIC followed by lysis. The lysate were separated on 4-12% SDS-PAGE and thewestern blot were carried out with indicated antibodies. (B) TAUBromoTAG / BromoTAG SK-N-MC cells stably expressing FLAG-dTAG-PPP2CA or FLAG-dTAG-PPP2CAH118Qweretreated with 0, 100, 250 and 500 nm BDPIC followed by lysis. The lysate was separatedon 4-12% SDS-PAGE and the western blot were carried out with indicated antibodies.(C) TAUBromoTAG / BromoTAGSK-N-MC cells stably expressing FLAG-dTAG-PPP2CA orFLAG-dTAG-PPP2CAH118Q were treated with DMSO and 250 nm BDPIC followed bylysis the anti-FLAG beads were used for the immunoprecipitation. The immunoprecipitate separated on 4-12% SDS-PAGE and the western blot were carried out with indicated antibodies. Figure 18(A) TAUBromoTAG / BromoTAG / dTAG / dTAG PPP2CA SK-N-MC cells were generated byCRISPR / Cas9 technology. Cells treated with BDPIC (0-1000 nM) for 24 h prior to lysisand extracts (20 μg protein) subjected to immunoblot analysis. (B)TAUBromoTAG / BromoTAG / dTAG / dTAGPPP2CA SK-N-MC cells were treated with BDPIC (100nM) for 0-24 h prior to lysis and extracts (20 μg protein) subjected to immunoblot analysis. (C) WT SK-N-MC cells were treated with BDPIC (0-1000 nM) for 24 h prior to lysis andextracts (20 μg protein) subjected to immunoblot analysis.Figure 19(A, B) Principles of the NanoBRET assay (Promega) for assessing BDPIC-inducedternary complex formation between BromoTAG and dTAG transfected in cells. An 55479585-1increase in the ratio of acceptor signal relative to donor signal implies proximity betweenBromoTAG and dTAG. (C) U2OS cells were transfected with different combinations ofconstructs as indicated expressing either the BromoTAG or dTAG, which were modifiedat the N- or C-termini with either a Halo-tag or a Nanoluciferase. Cells were then treatedwith 250 nM BDPIC or DMSO control for 24 h in a 96-well format and the BRET ratio(acceptor signal / donor signal) analysed using the Promega NanBRET kit according tothe manufacturer's instructions. Figure 20(A) Tau-bromoTAG knockin SKNMC cells were retrovirally transduced with dTAG-KLHL6 and treated with DMSO control (0) or the indicated concentrations of BDPIC for24 h prior to lysis. (B) TFEB-BromoTAG knockin U2OS osteosarcoma cells weretransduced with dTAG-RNF125 and treated with DMSO control (0) or the indicatedconcentrations of BDPIC for 24 h prior to lysis.Figure 21FAM83D-KO U2OS cells expressing FAM83D-dTAG-Flag & HA-BromoTAG-CK1^ withDMSO control (0) or the indicated concentrations of BDPIC for 24 h prior to lysis.20uglysate proteins were subjected to SDS-PAGE and immunoblot analysis using indicatedantibodies. DETAILED DESCRIPTION OF THE INVENTION:The present inventors describe a novel heterobifunctional small molecule, or proximity-inducing compound (PIC), named BDPIC (BromoTag-dTAG proximity-inducing chimera). The inventors have employed BDPIC at nanomolar concentrations to screen different phosphatases tagged with BromoTag for successful targeted dephosphorylation of phospho-SMAD3 (mothers against decapentaplegic homolog 3) tagged with dTAG, and phospho-TFEB (transcription factor EB) tagged with dTAG. Targeted Dephosphorylation of TFEB IntroductionTranscription factor EB (TFEB) belongs to the microphthalmia / transcription factor E(MiT / TFE) family of basic helix–loop–helix leucine zipper (bHLH-Zip) transcription factorsalso comprising of TFE3, MITF and TFEC (Steingrimsson et al., Annu. Rev. Genet.,2004, 38, 365; Sardiello et al., Science, 2009, 325, 473; Settembre et al., Science, 2011, 55479585-1332, 1429). Upon translocation to the nucleus TFEB directly binds to a well-defined DNAbinding element known as coordinated lysosomal expression and regulation (CLEAR) motif, which is conserved in the proximal promoters of numerous components of thelysosome and autophagy related genes (Settembre et al., Science, 2011, 332, 1429).Emerging evidence suggests TFEB also plays a crucial role in the control of metabolicprocesses in response to nutrient and energy stress (Malik et al., Science, 2023, 380,eabj5559; Mansueto et al., Cell Metab., 2017, 25, 182; Markby and Sakamoto, Am. J.Physiol. Endocrinol. Metab., 2020, 319, E763; Settembre et al., Nat. Cell. Biol., 2013,15, 647). Given the breadth of biological processes that TFEB controls, its dysregulationis linked to many human diseases, including cardiovascular diseases, metabolicsyndromes, cancers and neurodegeneration (Fraldi et al., Annu. Rev. Neurosci., 2016,39, 277; Wen et al., Metabolism, 2023, 147, 155662; Zoncu and Perera, Trends Cancer,2023, 9, 817). The transcriptional activity of TFEB is tightly controlled and is regulatedby post-translational modifications, primarily through reversible phosphorylation(Puertollano et al., EMBO J., 2018, 37, e98804; Zhu et al., Front. Cell Dev. Biol., 2021,9, 667750; Raben and Puertollano, Annu. Rev. Cell Dev. Biol., 2016, 32, 255; Franco-Juárez et al., Cells, 2022, 11, 3153; Takla et al., EMBO Rep., 2023, 24, e57574). Phosphorylation status of TFEB on multiple different residues, which is regulated via concerted actions of different kinases and phosphatases depending on specific environmental and signalling cues, is known to regulate its nuclear cytoplasmic shuttling,interaction with other partners and, ultimately, transcriptional activity (Puertollano et al.,EMBO J., 2018, 37, e98804; Zhu et al., Front. Cell Dev. Biol., 2021, 9, 667750; Rabenand Puertollano, Annu. Rev. Cell Dev. Biol., 2016, 32, 255; Franco-Juárez et al., Cells,2022, 11, 3153). Under nutrient replete and stressor-free conditions, serine / threonine kinase mTORC1 is involved in the phosphorylation of TFEB at S122, S142 and S211and promotes its retention in the cytoplasm (Pena-Llopis et al., EMBO J., 2011, 30, 3242;Martina et al., Autophagy, 2012, 8, 903; Settembre et al., EMBO J., 2012, 31, 1095; Vega-Rubin-de-Celis et al., Autophagy, 2017, 13, 464; Roczniak-Ferguson et al., Sci.Signal., 2012, 5, ra42). Phosphorylation of TFEB at S211 is known to promote 14-3-3binding, leading to the retention of TFEB in the cytoplasm (Roczniak-Ferguson et al.,Sci. Signal., 2012, 5, ra42). Upon inactivation of mTORC1 under amino acid and growthfactor starvation or pharmacological inhibition, TFEB phosphorylation is blocked, whichleads to its dissociation from 14-3-3 and translocation from cytosol to nucleus, where itinitiates its transcriptional activity (Roczniak-Ferguson et al., Sci. Signal., 2012, 5, ra42).Activation of AMP-activated protein kinase (AMPK) also promotes TFEB55479585-1dephosphorylation and nuclear translocation (Collodet et al., FASEB J., 2019, 33, 12374;Paquette et al., Autophagy, 2021, 17, 3957; Young et al., Genes Dev., 2016, 30, 535), which has recently been proposed to be mediated through direct phosphorylation of folliculin-interacting protein 1 (FNIP1) and subsequent suppression of the function of thefolliculin (FLCN)–FNIP1 complex (Malik et al., Science, 2023, 380, eabj5559). Proteinphosphatases PP2A and calcineurin (also known as PPP3 or PP2B) are reported to dephosphorylate and activate TFEB upon oxidative stress and enhanced calciumsignalling, respectively (Medina et al., Nat. Cell Biol., 2015, 17, 288; Martina andPuertollano, J. Biol. Chem., 2018, 293, 12525). Collectively, altering TFEB phosphorylation is central to its subcellular distribution and transcriptional activity. Since TFEB activity stimulates autophagy and lysosomal activity, among other functions, if targeted dephosphorylation of TFEB leads to its activation, then it could offer a promising novel strategy for therapeutic targeting against lysosomal-related diseases, such as neurodegenerative diseases, cystinosis, acute kidney injury, and diabetic nephropathy. Furthermore, such an approach would also allow one to investigate thefunctions of phosphorylation of TFEB on different residues. By employing a novel PIC,the present inventors set out to investigate the feasibility of targeted dephosphorylationof TFEB and its consequences on TFEB localisation and transcriptional activity. Usingthe novel heterobifunctional small molecule, the BromoTag-dTAG proximity-inducingchimera (BDPIC), the present inventors demonstrate that redirecting BromoTag-PPP2CA (protein phosphatase 2 catalytic subunit A) to TFEB-dTAG leads to an inducible dephosphorylation of TFEB-dTAG, its nuclear translocation and transcription of TFEB target genes. Results and DiscussionThe present inventors have developed a heterobifunctional small molecule with a ligandbinding to dTAG on one end (Nabet et al., Nat. Chem. Biol., 2018, 14, 431) and a ligandbinding to BromoTag on the other end (Bond et al., J. Med. Chem., 2021, 64, 15477)connected through 3-polyethylene glycol (PEG) linker, named BDPIC (BromoTag-dTAGproximity-inducing chimera). It was reasoned that in cells expressing BromoTag-PPP2CA and TFEB-dTAG, this molecule would induce the proximity between thempotentially allowing PPP2CA to dephosphorylate TFEB (Fig. 1A). This clever strategywas identified through the novel combination of a ligand that binds to BromoTag, and aligand that binds to dTAG. The inventors employed the robust downward electrophoretic55479585-1 mobility shift of TFEB as a reporter for dephosphorylation. U2OS cells stably expressing TFEB-dTAG-FLAG and HA-BromoTag-PPP2CA or -PPP2CAH118Qwere generated by means of retroviral transduction. When cells were treated with increasing concentrationsof BDPIC for 24 h, a robust downward electrophoretic shift of TFEB-dTAG-FLAG wasevident in cells co-expressing HA-BromoTag-PPP2CA at all doses (100-10000 nM) of BDPIC compared to DMSO treated control (Fig. 1B). Strikingly, no apparent mobility shift was detected in cells co-expressing HA-BromoTag-PPP2CAH118Q(Fig. 1B), suggesting that the phosphatase activity of PPP2CA was essential for BDPIC-induced mobility shift of TFEB-dTAG-FLAG. A 2-8 h time-course treatment of cells with 100 nM BDPIC to assess the kinetics of dephosphorylation showed complete dephosphorylation of TFEB-dTAG-FLAG at 2 h, which was sustained until 8 h, in cells co-expressing HA- BromoTag-PPP2CA (Fig.1C). No mobility shift of TFEB-dTAG-FLAG was observed withBDPIC treatment at any time points in cells co-expressing HA-BromoTag alone or HA-BromoTag-PPP2CAH118Q(Fig. 1C). A shorter time-course experiment revealed that BDPIC-mediated dephosphorylation of TFEB-dTAG-FLAG in cells co-expressing HA-BromoTag-PPP2CA started as early as 5 min and peaked at around 15-30 min (Fig.1D).Next, the inventors explored if BDPIC-mediated dephosphorylation of TFEB-dTAG isreversible by undertaking a washout experiment. Cells co-expressing TFEB-dTAG- FLAG and HA-BromoTag-PPP2CA were treated with 100 nM BDPIC for 2 h and washed twice with PBS and replaced with fresh culture medium without BDPIC. The TFEB- dTAG-FLAG phospho-dependent electrophoretic mobility shift recovered almost completely back to DMSO-treated conditions within 1 h of BDPIC washout and completely after 4 h following BDPIC washout (Fig.1E). To demonstrate that the nature of the tag on the PPP2CA or TFEB did not influence the efficacy of BDPIC-mediateddephosphorylation, the tags were switched by introducing BromoTag on TFEB and dTAGon PPP2CA or PPP2CAH118Q(Fig. 2A). Indeed, BDPIC induced TFEB-BromoTag dephosphorylation in cells expressing dTAG-PPP2CA but not dTAG or dTAG- PPP2CAH118Qcontrols (Fig. 2B). Collectively, these data validate BDPIC’s cellpermeability, ability to engage both dTAG and BromoTag and induce their proximity, andthe reversible nature of the BDPIC-induced proximity.The inventors also developed another bivalent small molecule with a ligand binding todTAG on one end and a ligand binding to Halo-tag on the other end connected with 4-PEG linker, named HDPIC (Halo-tag-dTAG proximity-inducing chimera) (Fig. 3A).Increasing doses of HDPIC treatment failed to cause TFEB-Halo electrophoretic mobility 55479585-1 shift in U2OS cells co-expressing dTAG-PPP2CA compared to DMSO control, and also did not cause any shift in control cells or those co-expressing dTAG-PPP2CAH118Q(Fig. 3B). Interestingly, HDPIC had a destabilising effect on TFEB-Halo in all conditions with increasing concentrations of HDPIC leading to lower levels of TFEB-Halo (Fig. 3B). Recently, PhosTAC7, a compound that resembles HDPIC but is structurally distinct, was reported to recruit dTAG-PP2A-A subunit to different Halo-tagged proteins, includingPDCD4 and FOXO3a, for proximity-induced dephosphorylation (Chen et al., ACS Chem.Biol., 2021, 16, 2808). When the inventors employed increasing amounts of PhosTAC7in U2OS cells co-expressing TFEB-Halo and dTAG-PPP2CA or dTAG-PPP2CAH118Q,they did not observe any electrophoretic mobility shift of TFEB-Halo under anyconditions. Like HDPIC, increasing concentrations of PhosTAC7 also caused a reductionin levels of TFEB-Halo. Essentially, neither HDPIC nor PhosTAC7 appeared to causeany TFEB-Halo dephosphorylation by dTAG-PPP2CA, and instead seemed to cause itto be destabilised. This establishes the greater efficacy and wider utility of BDPIC over other PICs. To investigate the consequences of targeted dephosphorylation of TFEB, the presentinventors generated TFEBdTAG / dTAG homozygous knock-in U2OS cells by CRISPR / Cas9genome editing (Fig.4B). Treatment of TFEBdTAG / dTAGU2OS cells stably expressing HA-BromoTag alone, HA-BromoTag-PPP2CA or HA-BromoTag-PPP2CAH118Q with DMSOdid not affect TFEB-dTAG mobility. In contrast, treatment of the TFEBdTAG / dTAGU2OS cells with MK-8722 (to activate AMPK) or Torin 1 (to inhibit mTORC1) caused the expected downward mobility shift of TFEB-dTAG (Fig. 5A). This indicates that incorporation of dTAG on endogenous TFEB or overexpressing HA-BromoTag, HA- BromoTag-PPP2CA or HA-BromoTag-PPP2CAH118Qdoes not appear to affect homeostatic levels of TFEB phosphorylation (Fig. 5A). Treatment of TFEBdTAG / dTAGU2OS cells stably expressing HA-BromoTag-PPP2CA, but not those expressing HA-BromoTag and HA-BromoTag-PPP2CAH118Q, with BDPIC caused dephosphorylation ofTFEB-dTAG, to a greater extent than that caused by MK-8722 or Torin 1 treatment (Fig. 5A). There was a marked decrease in phosphorylation of TFEB at Ser122, Ser142 and Ser211 in cells stably expressing HA-BromoTag-PPP2CA compared to those expressingHA-BromoTag and HA-BromoTag-PPP2CAH118Q following treatment with BDPIC (Fig.5B). The fact that BDPIC mediates targeted dephosphorylation of TFEB-dTAG by HA- BromoTag-PPP2CA implies a ternary complex formation between TFEB-dTAG and HA- BromoTag-PPP2CA in the presence of BDPIC. To examine this, TFEBdTAG / dTAGU2OS 55479585-1cells stably expressing HA-BromoTag alone, HA-BromoTag-PPP2CA or HA-BromoTag-PPP2CAH118Q and treated with either DMSO or BDPIC were subjected to anti-HAimmunoprecipitation (IP) (Fig. 5C). TFEB-dTAG was co-precipitated in IPs of HA-BromoTag, HA-BromoTag-PPP2CA and HA-BromoTag-PPP2CAH118Qwhen cells were treated with BDPIC but not DMSO (Fig. 5C). Moreover, the faster-migrating form of TFEB-dTAG was only detected in the anti-HA IPs from cells expressing HA-BromoTag- PPP2CA treated with BDPIC (Fig. 5C). The inventors also performed a competitionassay by using inactive dTAG-directed PROTAC, dTAGV-1-NEG (Nabet et al., Nat.Commun.2020, 11, 4687), which shares the same dTAG binder as BDPIC but is unableto degrade dTAG protein. Pre-treatment of cells with excess of dTAGV-1-NEG compoundprevented the dephosphorylation of TFEB-dTAG in TFEBdTAG / dTAG U2OS cells stablyexpressing HA-BromoTag-PPP2CA caused by BDPIC (Fig.5D). This data confirms thatBDPIC-mediated targeted dephosphorylation of TFEB-dTAG relies on the binding ofBDPIC with TFEB-dTAG.Next, it was investigated whether BDPIC-mediated TFEB-dTAG dephosphorylation inTFEBdTAG / dTAGknock-in U2OS cells can trigger its nuclear translocation and transcriptional activity. In TFEBdTAG / dTAGU2OS cells stably expressing HA-BromoTag-PPP2CA, but not in those expressing HA-BromoTag or HA-BromoTag-PPP2CAH118Q,BDPIC treatment caused a robust nuclear TFEB-dTAG immunostaining signal, whichoverlapped with DAPI staining, while DMSO treatment showed a predominantly cytoplasmic TFEB-dTAG staining in all cell lines (Fig. 6A). Employed as a positivecontrol, Torin 1 caused nuclear staining of TFEB-dTAG in all cell lines (Fig. 6A). Theinventors also observed a larger amount of faster migrating TFEB-dTAG signal in thenuclear fractions of BDPIC-treated cells stably expressing HA-BromoTag-PPP2CA than in the cytoplasmic fraction, while DMSO treatment did not cause increased nuclear accumulation of TFEB-dTAG nor did it induce TFEB-dTAG dephosphorylation (Fig.6B).In TFEBdTAG / dTAG U2OS cells stably expressing HA-BromoTag or HA-BromoTag-PPP2CAH118Q controls, neither DMSO nor BDPIC caused dephosphorylation or nucleartranslocation of TFEB-dTAG (Fig. 4B). The inventors analysed the mRNA expression ofsome known TFEB-target genes in TFEBdTAG / dTAGU2OS cells stably expressing HA- BromoTag, HA-BromoTag-PPP2CA or HA-BromoTag-PPP2CAH118Qby RT-PCRfollowing 8 h of BDPIC treatment. They observed that compared to DMSO control,BDPIC treatment induced only a slight but significant increase in expression of Fnip, Flcnand Gpnmb transcripts in cells expressing HA-BromoTag-PPP2CA but not in those55479585-1expressing HA-BromoTag or HA-BromoTag-PPP2CAH118Q (Fig. 6C), suggesting thattargeted dephosphorylation of TFEB-dTAG by BDPIC is potentially sufficient to cause transcriptional activation of TFEB.The present inventors have demonstrated that induced proximity between endogenouslyknocked-in TFEB-dTAG and over-expressed BromoTag-PPP2CA causes dephosphorylation and potentially transcriptional activation of TFEB. However, to avoid the possibility of any unanticipated artefacts resulting from PPP2CA overexpression, such as dephosphorylation of native PPP2CA substrates and their physiologicalconsequences, the inventors generated TFEBdTAG / dTAG / BromoTag+PPP2CA double knock-inU2OS cells by employing CRISPR / Cas9 gene editing technology (Fig.4B-D). Treatmentof these cells with 100 nM BDPIC resulted in a downward electrophoretic mobility shiftof TFEB-dTAG, to a similar extent to that caused by the treatment of cells with MK-8722 or Torin 1, compared to DMSO treatment (Fig. 7A), indicating that through BDPIC, endogenous BromoTag-PPP2CA activity can be redirected to dephosphorylate TFEB- dTAG. However, this BDPIC-induced mobility shift of TFEB-dTAG at the endogenous level was smaller than that observed when BromoTag-PPP2CA was overexpressed (Fig. 5). BDPIC treatment of TFEBdTAG / dTAG / BromoTag / +PPP2CA cells did not cause a mobility shift of the related transcription factor TFE3 at the endogenous level (Fig.8A). Similarly, redirecting endogenous BromoTag-PPP2CA to dephosphorylate TFEB-dTAGwith BDPIC did not appear to substantially alter the phosphorylation of GSK3^^ / ^ atSer21 / 9, which are endogenous targets of PPP2CA (Fig. 8A) (Brewer et al.,10.1101 / 2023.09.19.558429). By immunoblotting, upon BDPIC treatment, the inventorsobserved a slight reduction in the phosphorylation of TFEB-dTAG at Ser122, Ser138, Ser142 and Ser211, while there was no obvious change in the phosphorylation of Ser109(Fig. 7B). It was also observed that upon BDPIC treatment, all of the faster migrating(dephosphorylated) pool of TFEB-dTAG was detected in the nuclear fraction, while the slower migrating (i.e. phosphorylated) pool resembling TFEB-dTAG from DMSO treated control cells or BDPIC treated cells remained in the cytosol (Fig. 7B). Byimmunostaining, the inventors were able to show that both Torin 1 and BDPIC induceda similar, robust nuclear localisation of TFEB-dTAG, while cells treated with DMSO showed TFEB-dTAG staining predominantly in the cytosol (Fig. 7C). The inventorstested the transcription of TFEB target genes Hexa, Flcn, Gpnmb and Fnip inTFEBdTAG / dTAG / BromoTag / +gPPP2CA cells upon Torin 1, MK-8722 or BDPIC treatment (Fig.7E). Both Torin 1 and MK-8722 induced an increase in expression of all 4 genes by 55479585-1 between 1.5-2 fold over DMSO-treated controls (Fig. 7E). Under these conditions,BDPIC induced a 1.2 fold increase in transcription of Gpnmb over DMSO treated controlbut did not significantly alter the transcription of other genes (Fig.7E).As a novel compound, it was tested whether BDPIC caused any cytotoxicity, especiallyat doses that were used to induce targeted dephosphorylation of TFEB-dTAG. Treatmentof TFEBdTAG / dTAG / BromoTag / +PPP2CA U2OS cells with BDPIC at concentrations rangingfrom 10 nM to 10 ^^M for 48 h did not show any effect on cell viability, even at the highest concentration of 10 ^^M (Fig.8D). Employed as a positive control, treatment of cells with MG132 for 48 h led to profound inhibition of cell proliferation as well as cell death (Fig. 8D).By using BDPIC, the present inventors have demonstrated that BromoTag-PPP2CA,knocked in at the native PPP2CA locus, can be redirected to dephosphorylate TFEB. This dephosphorylation was sufficient to trigger nuclear translocation of TFEB and transcription of Gpnmb, without the need for modulation of specific signalling pathways controlling TFEB. Strikingly, BDPIC action is transient and reversible, and can perform with great efficacy within the nM range. In a like-for-like comparison, BDPIC performed much better than other proximity-inducing bivalent molecules HDPIC and the previouslyreported PhosTAC7 (Chen et al., ACS Chem. Biol., 2021, 16, 2808). The presentinventors’ findings demonstrate targeted dephosphorylation of TFEB as an effectiveapproach to target nuclear translocation of TFEB and it could be considered as a novel therapeutic approach in pathologies, such as metabolic disorders, where enhanced TFEB-dependent transcription leading to increased lysosomal and mitochondrialbiogenesis in metabolic tissues such as muscle and liver may be beneficial. It similarlydemonstrates proof-of-concept proximity-induction through BDPIC. The present findingsimply that by developing a phosphatase recruiting chimera (PhosTAC) molecule that connects to a POI on one end and another one to a phosphatase of interest could in principle be used for targeted dephosphorylation. Targeted Dephosphorylation of SMAD3 Introduction TGFβ (transforming growth factor-β) is a cytokine implicated in a plethora of cellular processes, such as proliferation, regeneration, differentiation, adhesion, cell migrationand apoptosis (Flanders, Int. J. Exp. Pathol., 2004, 85, 47; Massague, Annu. Rev.55479585-1Biochem., 1998, 67, 753). Canonical TGFβ signalling involves binding of the TGFβ ligandto a constitutively active transmembrane Ser / Thr kinase receptor, TGFβR2 (type IIreceptor), which then recruits, phosphorylates and activates TGFβR1 (type I receptor).Transcription factors SMAD2 and SMAD3 (mothers against decapentaplegic homolog2 / 3) are recruited to the active receptor complex. SMAD2 and SMAD3 comprise a linkerregion that separates two conserved domains: MH1 (Mad homology 1), which enables interactions with DNA in the case of SMAD3, and MH2 (Mad homology 2), whichmediates protein-protein interactions, such as with TGFβR1 and transcriptional co-activators / repressors (Tsukazaki et al., Cell, 1998, 95, 779; Wu et al., Science, 2000,287, 92; Macias et al., Trends Biochem. Sci., 2015, 40, 296). Once at the receptorcomplex, SMAD2 and SMAD3 are phosphorylated by TGFβR1 at a C-terminal tail Ser-X-Ser motif (Ser465 / Ser467 on SMAD2 and Ser423 / Ser425 on SMAD3). As such, several small molecule inhibitors of TGFβR1, including SB-505124, result in complete attenuation of TGFβ-induced transcriptional responses (DaCosta Byfield et al., Mol.Pharmacol., 2004, 65, 744; Vogt et al., Cell Signal., 2011, 23, 1831). PhosphorylatedSMAD2 and SMAD3 are released from the receptor complex and bind to co-SMAD,SMAD4, before translocating to the nucleus, where they control the transcription ofhundreds of target genes that dictate cell fate decisions (Massague et al., Genes Dev., 2005, 19, 2783). Despite sharing 83.9% amino acid sequence, SMAD2 and SMAD3 arebelieved to possess distinct cellular roles. It is thought that most TGFβ-inducedtranscriptional responses in adult tissues and cells, which can activate cytostatic andapoptotic responses, are mediated by SMAD3, while SMAD2 is essential duringdevelopment, where TGFβ signalling promotes growth and differentiation (Nomura andLi, Nature, 1998, 393, 786; Aragon et al., Genes Dev., 2019, 33, 1506; Waldrip et al.,Cell, 1998, 92, 797; Weinstein et al., Proc. Natl. Acad. Sci. U. S. A., 1998, 95, 9387; Massague and Gomis, FEBS Lett., 2006, 580, 2811). TGFβ signalling has been implicated in numerous pathologies and previous studies have identified SMAD3 as a key contributor to the progression of TGFβ-associated diseases(Dzwonek et al., Mol. Cancer Res., 2009, 7, 1342; Kohn et al., Breast Cancer Res., 2010,12, R83). Gain-of-function mutation of SMAD3, which leads to increased TGFβsignalling, has been implicated in melorheostosis, a rare sporadic disorder involvingexcessive bone formation on the bone surface (Kang et al., 10.1084 / jem.20191499; Velchev et al., 10.1084 / jem.20200185). Furthermore, increased TGFβ pathwayactivation and subsequent SMAD3 phosphorylation have also been linked to fibrotic55479585-1diseases through promotion of influx of inflammatory cells and fibroblasts to the site ofinjury followed by their production of cytokines and ECM (extracellular matrix),respectively (Border and Noble, N. Engl. J. Med., 1994, 331, 1286). Accumulation ofECM is then further promoted by TGFβ through simultaneously increasing secretion ofprotease inhibitors (such as SMAD3-dependent PAI-1) and reducing secretion ofproteases (such as MMP-1 (matrix metalloproteinase-1)) (Dennler et al., EMBO J., 1998,17, 3091; Yuan and Varga, J. Biol. Chem., 2001, 276, 38502; Phanish et al., Biochem.J., 2006, 393, 601). Fibrotic disease is thought to arise following incomplete resolutionof tissue repair. Dysregulation of TGFβ signalling is also thought to trigger a shift fromnormal function, which is considered to perform a tumour suppressor role, to oncogenicfunction, particularly in the later stages of tumour growth (Massague and Gomis, FEBSLett., 2006, 580, 2811) and this can be driven by SMAD3. SMAD3 transcriptional activityis also regulated by phosphorylation of the linker region, which can be mediated by theMAPK (mitogen-activated protein kinase) family, the CDK (cyclin-dependent kinase)family and GSK3β (glycogen synthase kinase-3β) on multiple sites, including Thr179,Ser204, Ser208 and Ser213 (Alarcon et al., Cell, 2009, 139, 757; Ooshima et al., CancerSci., 2019, 110, 481). SMAD3 linker phosphorylation is thought to contribute to tumourprogression by promoting EMT (epithelial mesenchymal transdifferentiation) of cells(Ooshima et al., Cancer Sci., 2019, 110, 481). Given that SMAD3 function is controlledby phosphorylation, targeted dephosphorylation of SMAD3 could potentially affordinhibition of TGFβ signalling responses, which may be of therapeutic benefit.Results and Discussion The present inventors have found that, in addition to the targeted dephosphorylation ofTFEB, BromoTag-PPM1H phosphatase activity can be redirected to dTAG-SMAD3 fortargeted dephosphorylation of TGFβ-induced phospho-dTAG-SMAD3 and investigatesubsequent inhibition of TGFβ-transcriptional responses.The inventors sought to assess the ability of BDPIC to induce dephosphorylation ofdTAG-SMAD3 in cells co-expressing a BromoTag-phosphatase (Fig. 9A). To explore arange of phosphatase modalities with promiscuous or more selective substratespecificities, the inventors tested four BromoTag-phosphatases, including PPP1CA,PPP2CA, PPM1A and PPM1H. Previously, PPM1A has been reported as a physiologicalphosphatase of SMAD3 (Lin et al., Cell, 2006, 125, 915). PP2A has also been reportedto dephosphorylate SMAD3 upon hypoxic conditions (Heikkinen et al., J. Biol. Chem.,55479585-1 2010, 285, 3740). As a first step, the phosphorylation of dTAG-SMAD3 was characterised in serum-starved U2OS cells stably expressing dTAG-SMAD3 uponstimulation with recombinant TGFβ ligand over a period of 6 h (Fig. 10A&B). Maximaltail phosphorylation of dTAG-SMAD3 and endogenous SMAD3 was observed 1 hfollowing stimulation, with phosphorylation decreasing over the remaining treatmentdurations, likely due to receptor turnover (Huang and Chen, Cell Biosci., 2012, 2, 9), butremaining higher than in unstimulated cells (Fig.10A&B). Importantly, this indicates thatconjugation of dTAG to SMAD3 has not impeded SMAD3 phosphorylation by TGFβR1. Increased protein levels of PAI-1, a SMAD3 target gene, were detected as soon as 2 hafter initiation of TGFβ stimulation (Fig. 10A&B). Next, the endogenous rate of dTAG-SMAD3 dephosphorylation in serum-starved cells was monitored. Following 1 hstimulation with TGFβ, U2OS cells expressing dTAG-SMAD3 were either lysed (termed0 h after washout) or washed and placed in fresh serum-free medium without TGFβ andlysed at the specified time intervals (Fig.10C&D). In comparison to no stimulation controlcells, TGFβ-treated cells displayed a marked increase in dTAG-SMAD3 and endogenousSMAD3 tail phosphorylation. A reduction in this peak dTAG-SMAD3 phosphorylationwas detected as soon as 10 min following withdrawal of TGFβ, with a ~60% reduction inphosphorylation apparent by 2 h and ~80% by 6 h (Fig. 10C&D).For the targeted dephosphorylation approach, the inventors first sought to design awashout-style assay whereby they first establish maximal dTAG-SMAD3phosphorylation by stimulation with TGFβ and subsequently monitor the rate of dTAG-SMAD3 dephosphorylation at 2 h following TGFβ washout as above. Successful targeteddephosphorylation of dTAG-SMAD3 by BDPIC in the presence of a BromoTag-phosphatase would be expected to accelerate the rate of dTAG-SMAD3 dephosphorylation compared to DMSO-treated controls. Indeed, compared to DMSO treatment, BDPIC at both 100 nM and 500 nM concentrations caused a robust further reduction in levels of phosphorylated dTAG-SMAD3 in cells co-expressing BromoTag- PPM1A or BromoTag-PPM1H (Fig. 9B). Cells co-expressing BromoTag-PPP2CAexhibited a more subtle reduction in phospho-dTAG-SMAD3 levels upon BDPICtreatment, while no robust substantial reduction was observed in cells expressingBromoTag-PPP1CA (Fig. 9B). No effect was observed on the phosphorylation ofendogenous SMAD3, which lacks the dTAG, with BDPIC treatment in any of the cells,indicating that BDPIC treatment specifically reduced the phosphorylation, or acceleratedthe dephosphorylation, through targeting of dTAG-SMAD3.55479585-1 To confirm that the accelerated dTAG-SMAD3 dephosphorylation was due to recruitmentof the phosphatase activity of BromoTag-phosphatases, no phosphatase controls as wellas the previously reported phosphatase-dead point mutants were employed:PPM1HH153D, PPP2CAH118Q and PPM1AD239A (Ogris et al., J. Virol., 1999, 73, 7390;Jackson et al., Biochemistry, 2003, 42, 8513; Ofek et al., J. Biol. Chem., 2003, 278,14299; Lee-Hoeflich et al., Cancer Discov., 2011, 1, 326; Tanoue et al., Biochemistry,2013, 52, 5830; Berndsen et al., 10.7554 / eLife.50416) (Fig. 9C,D&E). In the absence ofany BromoTag-phosphatase, in comparison to DMSO treatment, BDPIC yielded further reduction in the levels of dTAG-SMAD3 phosphorylation in U2OS cells expressing only dTAG-SMAD3 (Fig.9C,D&E), suggesting that BDPIC by itself does not affect the levels of dTAG-SMAD3 phosphorylation. For BromoTag-PPM1H and BromoTag-PPP2CA, therespective phosphatase-dead mutants, BromoTag-PPM1HH153D and BromoTag-PPP2CAH118Q, were unable to elicit the same acceleration in dTAG-SMAD3dephosphorylation upon BDPIC treatment, in comparison to DMSO treatment,confirming that the recruitment of phosphatase catalytic activity of BromoTag-PPM1H orBromoTag-PPP2CA is required for BDPIC-induced dephosphorylation (Fig. 9C&D).However, a partial acceleration in the rate of dTAG-SMAD3 dephosphorylation was stillobserved following BDPIC treatment of cells co-expressing the reported phosphatase-dead BromoTag-PPM1AD239A mutant (Fig. 9E). The washout-style assay, where theinventors monitor the rate of dephosphorylation, was designed to minimise any confounding blocking of dTAG-SMAD3 phosphorylation by BDPIC-recruited BromoTag- phosphatases (due to, for example, impeding kinase access). Taking this into account, the observations could imply that, under these conditions, the PPM1AD239Amutant alsorecruited phosphatase activity, for example through dimerization with endogenousPPM1A, or potentially that PPM1AD293A still retained some phosphatase activity.Interestingly, a noticeable decrease in dTAG-SMAD3 phosphorylation was observed inDMSO-treated U2OS dTAG-SMAD3 BromoTag-PPM1A / -PPM1AD239Acells both 0 h and2 h after TGFβ washout in comparison to U2OS dTAG-SMAD3 cells, suggesting that theover-expression of these conjugates perhaps affects dTAG-SMAD3 phosphorylation.Importantly, phospho-dTAG-SMAD3 and phospho-endogenous SMAD3 levels remainedsimilar across DMSO-treated samples expressing either dTAG-SMAD3 alone or incombination with an active BromoTag-phosphatase. This suggests that phosphorylationof both dTAG-SMAD3 and endogenous SMAD3 was not affected simply by the over-expression of any of the BromoTag-phosphatases employed, despite some having been 55479585-1reported as physiological SMAD3 phosphatases. As the observations clearlydemonstrated that PPM1H catalytic activity can be redirected to target SMAD3dephosphorylation, the inventors sought to characterise this further.To confirm that BDPIC-mediated targeted dephosphorylation of dTAG-SMAD3 is relianton the recruitment of BromoTag-PPM1H, a competition assay was conducted using cis-AGB1, an inactive enantiomer of the AGB1 BromoTag-degrader (Bond et al., J. Med.Chem., 2021, 64, 15477), which shares the same BromoTag ligand as BDPIC. U2OSdTAG-SMAD3 BromoTag-PPM1H cells were serum-starved prior to TGFβ-stimulationand treatment with either DMSO, TGFβR1 inhibitor SB-505124, BDPIC (100 nM) or acombination of BDPIC and excess cis-AGB1 (1000 nM) for 2 h (Fig.11A). As expected,SB-505124 treatment led to full attenuation of both dTAG-SMAD3 and endogenousSMAD3 tail phosphorylation in comparison to DMSO-treated controls. BDPIC treatmentled to a robust reduction in phosphorylation of dTAG-SMAD3 in comparison to DMSO-treated controls, with no effect apparent on endogenous SMAD3 phosphorylation, asexpected. Co-treatment with BDPIC and excess of cis-AGB1 almost completelyprevented the BDPIC-induced dephosphorylation of dTAG-SMAD3. The levels ofphospho-dTAG-SMAD3 were comparable to those seen in cells treated with DMSO (Fig.11A). This confirms that BDPIC-mediated targeted dephosphorylation of dTAG-SMAD3is reliant on BDPIC binding to dTAG-SMAD3 and recruiting BromoTag-PPM1H.To validate that BDPIC could mediate the formation of an active ternary complexbetween BromoTag-PPM1H and dTAG-SMAD3 that enables targeteddephosphorylation, the present inventors tested whether FLAG-dTAG-SMAD3 could beco-immunoprecipitated with 3HA-BromoTag-PPM1H in the presence of BDPIC. Extractsfrom U2OS cells stably co-expressing FLAG-dTAG-SMAD3 and 3HA-BromoTag-PPM1H and treated either with DMSO, SB-505124, BDPIC or a combination of BDPICand cis-AGB1 were subjected to HA-immunoprecipitation (IP). FLAG-dTAG-SMAD3 wasdetected in anti-HA IP samples from BDPIC-treated cells but not from those treated withDMSO, SB-505124 or BDPIC+cis-AGB1 controls (Fig. 11B), confirming that BDPICinduces an interaction between dTAG-SMAD3 and BromoTag-PPM1H.The present inventors sought to explore the impact of targeted dephosphorylation ofdTAG-SMAD3 on downstream biology (Fig. 12A). Tail phosphorylation of SMAD3 byTGFβ type I receptors triggers a nuclear translocation, enabling SMAD3 to regulate the55479585-1transcription of TGFβ target genes (Tsukazaki et al., Cell, 1998, 95, 779; Zhang et al.,Nature, 1998, 394, 909; Hayes et al., Cancer Res., 2001, 61, 2112). U2OS cellsexpressing dTAG-SMAD3 alone or in combination with either BromoTag-PPM1H orBromoTag-PPM1HH153D mutant were treated for 2 h with control solution or TGFβ (5µg / L) along with DMSO, SB-505124 (1 µM) or BDPIC (100 nM) before nuclear andcytoplasmic fractions were collected (Fig.12B). As expected, no phosphorylated dTAG-SMAD3 was evident in the cytoplasmic fractions regardless of the treatments (Fig.12B).TGFβ stimulation resulted in substantial accumulation of phospho-dTAG-SMAD3 andendogenous phospho-SMAD3 in the nuclear fraction, while SB-505124 treatmentstrongly inhibited this accumulation (DaCosta Byfield et al., Mol. Pharmacol., 2004, 65,744; Vogt et al., Cell Signal., 2011, 23, 1831). Co-treatment of U2OS cells expressingonly dTAG-SMAD3 with TGFβ and BDPIC yielded no substantial change in nuclearabundance of phospho-dTAG-SMAD3 or endogenous phospho-SMAD3 in comparisonto cells treated with TGFβ and DMSO, supporting that binding of BDPIC alone does notinterfere with dTAG-SMAD3 or endogenous-SMAD3 phosphorylation or subsequentnuclear translocation (Fig.12B). U2OS dTAG-SMAD3 cells co-expressing BromoTag- PPM1H displayed similar phospho-dTAG-SMAD3 nuclear abundance as U2OS dTAG-SMAD3 cells upon treatment with TGFβ and DMSO, suggesting that BromoTag-PPM1Hoverexpression does not impede dTAG- or endogenous-SMAD3 phosphorylation ornuclear translocation (Fig. 12B). Excitingly, a distinct reduction in nuclear phospho-dTAG-SMAD3, but not endogenous phospho-SMAD3, was observed in BDPIC-treatedU2OS dTAG-SMAD3 cells co-expressing BromoTag-PPM1H, suggesting that BDPIC-mediated recruitment of BromoTag-PPM1H and subsequent dTAG-SMAD3dephosphorylation reduces the accumulation of phospho-dTAG-SMAD3 in the nucleus(Fig. 12B). Since endogenous phospho-SMAD3 nuclear abundance was unchanged byBDPIC treatment in these cells, this reinforces that BDPIC specifically targets BromoTag- PPM1H to dephosphorylate dTAG-SMAD3. Furthermore, U2OS dTAG-SMAD3 cells co-expressing phosphatase-dead BromoTag-PPM1HH153D mutant displayed no obviousreduction in nuclear abundance of phospho-dTAG-SMAD3 upon BDPIC treatment in comparison to cells only expressing dTAG-SMAD3 (Fig. 12B), indicating that thereduction observed in U2OS dTAG-SMAD3 BromoTag-PPM1H cells treated with BDPICis reliant on PPM1H phosphatase activity.To further explore the extent of the impact of targeted dephosphorylation of dTAG-SMAD3, the inventors focussed on the transcription of a well-characterised TGFβ-55479585-1 induced and SMAD3-dependent gene, PAI-1 (plasminogen activator inhibitor-1)(Dennler et al., EMBO J., 1998, 17, 3091). For this, U2OS cells expressing dTAG-SMAD3 alone or in combination with BromoTag-PPM1H or BromoTag-PPM1HH153Dwere co-treated with TGFβ and DMSO, SB-505124 or BDPIC (100 nM) for 6 h (Fig.12C). TGFβ stimulation of U2OS dTAG-SMAD3 yielded robust phosphorylation of bothdTAG-SMAD3 and endogenous SMAD3 and increased protein levels of PAI-1, all of which were completely attenuated by SB-505124 co-treatment. As expected, BDPIC treatment of U2OS cells expressing dTAG-SMAD3 alone resulted in no obviousreduction in PAI-1 levels or dTAG-SMAD3 phosphorylation in comparison to DMSO-treated cells (Fig. 12C), indicating that BDPIC treatment alone does not affect TGFβ-induced PAI-1 transcription. In TGFβ-stimulated U2OS dTAG-SMAD3 cells co-expressing BromoTag-PPM1H, BDPIC treatment induced dephosphorylation of dTAG-SMAD3 and a marked reduction in PAI-1 levels in comparison to TGFβ- and DMSO-treated controls (Fig. 12C). This suggests that BDPIC-mediated dTAG-SMAD3dephosphorylation, through BromoTag-PPM1H recruitment, impedes the ability ofdTAG-SMAD3 to activate the transcription of target gene PAI-1, likely due to theconcurrent reduction of nuclear phospho-dTAG-SMAD3 abundance seen in Fig.12B. Given that the same reduction was not observed in U2OS dTAG-SMAD3 cells co- expressing BromoTag-PPM1HH153D mutant upon BDPIC treatment, it can beconcluded that the BDPIC-dependent reduction in PAI-1 levels is due to the phosphataseactivity of BromoTag-PPM1H and subsequent dTAG-SMAD3 dephosphorylation uponBDPIC-induced proximity. The present data suggest that induced proximity betweenphosphatases and POIs can be employed to mediate target protein dephosphorylationand that this change in phospho-status can impact downstream signalling.The inventors next aimed to explore whether BDPIC could mediate targeteddephosphorylation by inducing proximity between dTAG-SMAD3 and BromoTag-PPM1H at the endogenous level. For this, the inventors generated A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 knock-in cells using CRISPR / Cas9 genomeediting (Cong et al., Science, 2013, 339, 819; Ran et al., Nat. Protoc., 2013, 8, 2281).The knock-in cells were verified by Western blotting (Fig.13A), PCR (polymerase chainreaction) (Fig.13B) and DNA sequencing. Molecular weight shifts of native SMAD3 andPPM1H corresponding to the added dTAG and BromoTag, respectively, were evident inthe knock-in cells relative to the wild-type controls (Fig. 13A&B). Of note, in the knock-in cells, also detected was a very weak signal for a higher molecular weight species that55479585-1cross-reacted with the anti-SMAD3 Western blotting, although the inventors did notdetect any aberrant dTAG-SMAD3 species by DNA sequencing. More importantly, it wasdemonstrated that the knocked-in dTAG-SMAD3 responded to TGFβ stimulation in asimilar manner to that expected by endogenous SMAD3 and yielded the expectedincrease in PAI-1 levels (Fig.13C). A similar targeted dephosphorylation assay as before (Fig. 9B) was conducted in A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 knock-in cells (Fig.14A). In comparison tounstimulated cells, TGFβ-treated cells displayed a robust dTAG-SMAD3phosphorylation, indicating that incorporation of dTAG has not impeded SMAD3phosphorylation. Again, phosphorylation was completely attenuated by co-treatment withinhibitor SB-505124. When dTAG-SMAD3 phosphorylation was monitored 2 h afterTGFβ withdrawal, the reduction in dTAG-SMAD3 phosphorylation observed with DMSOcontrol treatment was taken as the natural rate of dephosphorylation of dTAG-SMAD3.In comparison to this, cells treated with 250 nM or 1000 nM BDPIC displayed a muchgreater decrease in phospho-dTAG-SMAD3 (Fig. 14A), suggesting that BDPIC canaccelerate dephosphorylation of endogenous dTAG-SMAD3 by endogenous recruitingBromoTag-PPM1H. 250 nM was chosen for BDPIC treatment after observing a slightlymore pronounced dephosphorylation of endogenous dTAG-SMAD3 with thisconcentration in preliminary optimisation than with the 100 nM used in the stableexpression model (Fig. 13D). Little difference was apparent between 250 nM- and 1000nM-treated samples, suggesting both concentrations to be equally as effective (Fig.14A). To explore whether BDPIC could affect the SMAD3-dependent stimulation of PAI-1 production by targeting the dephosphorylation of dTAG-SMAD3 at the endogenouslevel, a similar experiment was conducted with 6 h co-treatment, as before (Fig.12C), inA549 BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 knock-in cells (Fig.14B). In comparison tounstimulated cells, TGFβ-treated cells displayed a substantial increase in PAI-1 levels,again confirming that knock-in of dTAG on SMAD3 has not prevented SMAD3-dependent PAI-1 production. In cells stimulated with TGFβ, co-treatment with 250 nM or500 nM BDPIC resulted in a marked reduction of PAI-1 production as well as levels ofphospho-dTAG-SMAD3, reinforcing the notion that BDPIC-mediated targeteddephosphorylation can inhibit the phospho-dependent function of dTAG-SMAD3 at theendogenous level. Again, little difference was apparent between different BDPICtreatment concentrations, therefore, the lower concentration of 250 nM was used forfurther experiments. By RT-qPCR (reverse transcription-quantitative PCR), TGFβ-55479585-1induced transcription of PAI-1 in A549 BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 cells wassignificantly decreased upon BDPIC (250 nM) treatment in comparison to DMSOtreatment (Fig. 14C). The inventors also monitored the level of transcription of anotherSMAD3-responsive gene, SMAD7 (Fig.14D), an inhibitory SMAD protein that acts as anegative regulator of canonical TGFβ signalling (Nakao et al., Nature, 1997, 389, 631;von Gersdorff et al., J. Biol. Chem., 2000, 275, 11320), which showed a similar significantdecrease upon BDPIC (250 nM) treatment in comparison to DMSO-treated controls (Fig.14D). As described above, to compare BDPIC to other PICs in the art, the present inventorstested whether inducing proximity between a phosphatase and a phospho-POI to yieldtargeted POI dephosphorylation could be achieved using a bivalent molecule comprisingthe established ligands binding to Halo-tag (Los et al., ACS Chem. Biol., 2008, 3, 373) and dTAG (Clackson et al, Proc. Natl. Acad. Sci. U. S. A., 1998, 95, 10437; Nabet et al., Nat. Chem. Biol., 2018, 14, 431) separated by a small PEG linker (Fig.15A), termed HDPIC (Halo-tag-dTAG proximity-inducing chimera). Firstly, the inventors observed noobvious cytotoxicity when U2OS and A549 cells were treated with a range ofconcentrations (0-16 µM) of HDPIC, in contrast to positive control MG132 treatment,which caused cell death (Fig. 15C). Next, using a previously established method forHalo-ligand engagement, where FLAG-NLS-Halo-HiBiT stably expressed in U2OS cellsundergoes a molecular weight shift upon Halo-ligand binding (Simpson et al., Cell Chem.Biol., 2022, 29, 1482), the inventors showed that HDPIC at 1 μM concentration induceda robust mobility shift in FLAG-NLS-Halo-HiBiT (Fig. 15D), indicating both cell-permeability of the compound and Halo-tag engagement. To assess dTAG engagement,the inventors have shown above that HDPIC could partially rescue the degradation ofdTAG-PPP2CA mediated by dTAG-13 (Nabet et al., Nat. Chem. Biol., 2018, 14, 431) inHEK293dTAG / dTAGPPP2CA knock-in cells, indicating that HDPIC engages dTAG in cells(Fig. 15E). Given that HDPIC demonstrated interaction with both Halo-tag and dTAG incells, the inventors sought to explore whether HDPIC could be employed to mediatedephosphorylation of Halo-SMAD3 through inducing proximity to a dTAG-phosphatase.To this end, they tested the effect of HDPIC compound engagement on the rate ofdephosphorylation of Halo-SMAD3 in U2OS cells stably expressing Halo-SMAD3 aloneor in combination with dTAG-PPM1H (Fig.15F). Using a similar washout-style assay tothat described previously (Fig. 9B & 4A), cells were stimulated with TGFβ beforewashout and treatment with DMSO or HDPIC (or left untreated) for 2 h or 4 h. 55479585-1Surprisingly, in U2OS cells expressing Halo-SMAD3 alone, in comparison to untreatedor DMSO-treated cells, 4 h after TGFβ withdrawal, HDPIC treatment accelerated Halo-SMAD3 dephosphorylation. No difference was observed between untreated and DMSO-treated cells, confirming that DMSO solvent (in which HDPIC was dissolved) is notresponsible for the increased dephosphorylation observed in HDPIC-treated cells.Furthermore, no additional increase in the rate of Halo-SMAD3 dephosphorylation wasobserved upon co-expression of dTAG-PPM1H (Fig. 15F), suggesting that theaccelerated dephosphorylation observed is due to HDPIC engagement with Halo-SMAD3. The inventors observed a similar effect in A549 Halo / WTSMAD3 knock-in cells(validated by Western blot, PCR and genomic sequencing (Fig. 15G&H)). Again, theinventors found that, even in these cells that do not express a dTAG-phosphatase, incomparison to DMSO-treated cells 4 h after TGFβ withdrawal, HDPIC treatmentaccelerated Halo-SMAD3 dephosphorylation (Fig. 15I). Furthermore, PhosTAC7, amolecule closely related to HDPIC, was reported to induce proximity between dTAG-PP2A-A subunit and Halo-PDCD4, and Halo-FOXO3a for targeted dephosphorylation(Chen et al., ACS Chem. Biol., 2021, 16, 2808). Like HDPIC, PhosTAC7 treatmentcaused an accelerated rate of dephosphorylation of Halo-SMAD3 in comparison toDMSO treatment, even in the absence of dTAG-phosphatase (Fig.15I). Together, thesedata indicate that the increased dephosphorylation observed with HDPIC or PhosTAC7treatment in comparison to DMSO treatment is due to binding of chloroalkane to Halo-SMAD3. It is also interesting to note that the negative control compound that theinventors synthesised, HDPIC-Neg, in which the Halo-tag-binding chloroalkane issubstituted for a fluoroalkane, and which yielded no obvious cytotoxicity in U2OS or A549cells (Fig. 16B), still displayed evidence of Halo-POI engagement at micromolarconcentrations (Fig. 16C). Similar to HDPIC, HDPIC-Neg treatment of U2OS FLAG-NLS-Halo-HiBiT cells resulted in the appearance of a higher molecular weight mobilityshift in FLAG-NLS-Halo-HiBiT, which is observed upon chloroalkane covalentlyengaging the Halo-tag (Simpson et al., Cell Chem. Biol., 2022, 29, 1482) (Fig.16C). Theintensity of the upper band for FLAG-NLS-Halo-HiBiT was weaker in cells treated with HDPIC-Neg than HDPIC, suggesting that HDPIC-Neg still engages FLAG-NLS-Halo-HiBiT, albeit weakly and at higher concentrations. These data suggested the potentialissues with targeted dephosphorylation studies using the Halo-tag system and so furtherconfirmed the greater utility of BDPIC.55479585-1The present inventors identify BromoTag-PPM1H as a promising phosphatase that canbe redirected to dephosphorylate dTAG-SMAD3, which is not known to be a naturalsubstrate for PPM1H. Importantly, in stable cell lines expressing dTAG-SMAD3, thephosphorylation of endogenous SMAD3 was unaffected, indicating that BDPIC was ableto selectively dephosphorylate dTAG-SMAD3. In contrast to BDPIC, with HDPIC andPhosTAC7 compounds, which contain a chloroalkane ligand that covalently binds Halo-tag, the inventors noted a robust impact on Halo-SMAD3 phosphorylation from moleculeengagement alone. Co-expression of dTAG-PPM1H phosphatase failed to yield a furtherincrease in Halo-SMAD3 dephosphorylation upon HDPIC / PhosTAC7 treatment,suggesting the observed effect to be wholly due to compound engagement. Excitingly,BDPIC-induced targeted dephosphorylation of dTAG-SMAD3 by BromoTag-PPM1Hrecruitment inhibited dTAG-SMAD3 nuclear translocation and the transcription ofSMAD3 target gene, PAI-1. The inventors subsequently confirmed their findings at theendogenous level by using CRISPR / Cas9 technology to generate A549BromoTag / BromoTagPPM1H / dTAG / dTAGSMAD3 cells, in which they demonstrated that BDPIC canrecruit endogenous BromoTag-PPM1H to target the dephosphorylation of endogenousdTAG-SMAD3 and impact downstream TGFβ pathway outcomes. A phosphatase-redirecting approach such as this offers the ability to achieve substrate-level phospho-control of a POI. Indeed, as described above, the inventors have shown that BDPIC cantarget the dephosphorylation of another transcription factor TFEB (transcription factorEB), by recruiting PPP2CA, thus affecting TFEB transcriptional activity. In the case ofSMAD3, which is a downstream mediator of TGFβ signalling, a phosphatase-redirectingapproach could provide finer tuning of biological outcomes in comparison to inhibitorcompounds that inhibit the upstream TGFβ receptor kinases, thus impacting all ensuingTGFβ pathways. Targeted Dephosphorylation of Tau Introduction Further, the present inventors have demonstrated the utility of BDPIC in targeted dephosphorylation of Tau, through induced proximity between dTAG-PP2CA and BromoTag-Tau. Hyperphosphorylation of Tau is a contributory factor for so-called “Tauopathies”, which constitute a spectrum of neurodegenerative disorders including Alzheimer’s disease (AD). Tauopathies are characterized by the aggregation of abnormally folded Tau protein within the brain, culminating in cognitive and motor deficits. Studies targeting the inhibition of multiple Tau kinases or activation of the Tau 55479585-1 phosphatase PP2A to reverse Tau hyperphosphorylation have shown limited therapeutic promise, due primarily to a lack of Tau selectivity. An innovative strategy to potentially circumvent these limitations and treat tauopathies would be to selectively target the dephosphorylation of hyperphosphorylated Tau. Herein, the present inventors have demonstrated the targeted dephosphorylation of phospho-Tau at the endogenous level.By using the compounds disclosed herein, such as BDPIC, in cells harbouringbromoTAG and dTAG knockins on Tau and PPP2CA, respectively, the inventorsdemonstrate highly selective targeted dephosphorylation of Tau, further demonstratingthat targeted dephosphorylation of Tau results in its stabilization on microtubules. Results and DiscussionIn this study, the present inventors generated homozygous Tau-dTAG knock-in SK-N-MC cells using CRISPR / Cas9 genome editing, by incorporating FKBP12F36V on MAPTalleles, and validated these by immunoblotting. In Tau-dTAG KI SK-N-MC cells thatexpressed HA-bromoTAG-PPP2CA, compared to DMSO-treated controls, BDPICtreatment at both 100 nM and 250 nM for 24 h resulted in a robust Tau-dTAGdephosphorylation at S396, S202 / T205, S181 and S404 (Fig.17A). In contrast, in cells expressing empty vector, HA-bromoTAG, or HA-bromoTAG-PPP2CAH118Q, BDPICtreatment did not alter the Tau-dTAG dephosphorylation at S396, S202 / T205, S181 andS404 compared to DMSO-treated controls (Fig. 17A). The inventors then generatedhomozygous Tau-bromoTAG KI SK-N-MC cells using CRISPR / Cas9 genome editing, byincorporating bromoTAG on MAPT alleles, and validated these by immunoblotting. InTau-bromoTAG KI SK-N-MC expressing FLAG-dTAG-PPP2CA, relative to DMSO-treated controls, BDPIC treatment at 100 nM, 250 nM or 500 nM for 24 h resulted in arobust Tau-bromoTAG dephosphorylation at S396, and S202 / T205 (Fig.17B). However, BDPIC treatment did not cause any Tau-bromoTAG dephosphorylation in cellsexpressing empty vector or FLAG-dTAG-PPP2CAH118Q compared to DMSO treatment(Fig. 17B). These data demonstrate that induced proximity between catalytically activePPP2CA, but not the inactive mutant, and Tau induces targeted dephosphorylation ofTau. The observation that BDPIC facilitates the targeted dephosphorylation of TAU-dTAG by HA-bromoTAG-PPP2CA and TAU-bromoTAG by FLAG-dTAG-PPP2CAsuggests the formation of a ternary complex. Indeed, anti-FLAG IPs from Tau-bromoTAG KI SK-N-MC cells expressing FLAG-dTAG-PPP2CA or FLAG-dTAG-PPP2CAH118Qbothco-precipitated Tau-bromoTAG only when cells were treated with BDPIC but not DMSO(Fig.17C). 55479585-1 To assess whether PPP2CA at the endogenous level could be redirected todephosphorylate Tau, the inventors knocked-in dTAG homozygously on PPP2CA alleleson Tau-bromoTAG KI SK-N-MC cells using CRISPR / Cas9 genome editing technology.Knock-ins were confirmed by immunoblotting. Treatment of two different clones of theTAU-bromoTAG / dTAG- PPP2CA double KI SK-N-MC cells with increasing concentrationof BDPIC for 24 h elicited a similar dose dependent reduction in phosphorylation of TAU-bromoTAG at S396 and S202 / T205 compared to DMSO controls, with maximaldephosphorylation observed at 100 nM (Fig. 18A), indicating that BDPIC-inducedproximity between endogenous dTAG-PPP2CA and Tau-bromoTAG can cause targeteddephosphorylation of Tau. When TAU-bromoTAG / dTAG- PPP2CA double KI SK-N-MCcells were treated with 100 nM BDPIC over a period of 24 h, robust Tau-bromoTAGdephosphorylation at S396 was observed after 2 h, while maximal dephosphorylationwas first observed after 4 h and was sustained for 24 h following BDPIC treatment (Fig.18B). In parallel, treatment on WT SK-N-MC cells (Fig. 18C) or Tau-bromoTAG KIcontrol cells with increasing concentrations of BDPIC did not induce anydephosphorylation of Tau compared to DMSO treatment (Fig. 18D), suggesting therequirement of induced- proximity between the dTAG-PPP2CA and Tau-bromoTAG fortargeted dephosphorylation of Tau.Ternary complex formation using BDPICThe present inventors have confirmed that BDPIC can induce a ternary complex betweentwo biological molecules in cells (Fig. 19). The inventors utilised a NanoBRET assay(Promega) to assess the formation of a ternary complex between BromoTag and dTAFtransfected in cells (Fig. 19A, Fig. 19B). An increase in the ratio of acceptor signalrelative to donor signal implies proximity between BromoTAG and dTAG. U2OS cells were transfected with different combinations of constructs as indicated expressing eitherthe BromoTAG or dTAG, which were modified at the N- or C-termini with either a Halo-tag or a Nanoluciferase. Cells were then treated with 250 nM BDPIC or DMSO controlfor 24 h in a 96-well format and the BRET ratio (acceptor signal / donor signal) analysedusing the Promega NanBRET kit according to the manufacturer's instructions (Fig.19C).The data demonstrates that BDPIC induces ternary complexes between NLuc-dTAG & BromoTAG-Halo, dTAG-NLuc & BromoTAG-Halo and BromoTAG-NLuc & dTAG-Halo orientations. 55479585-1 Targeted protein degradation (TPD) using BDPIC The present inventors have found that BDPIC can induce the degradation of different BromoTAG-POIs (protein-of-interest) via recruitment of different dTAG-E3 ligases(Fig. 20). Tau-bromoTAG knockin SKNMC cells were retrovirally transduced with dTAG-KLHL6 and treated with DMSO control (0) or the indicated concentrations of BDPIC for24 hours prior to lysis (Fig.20A). TFEB-BromoTAG knockin U2OS osteosarcoma cellswere transduced with dTAG-RNF125 and treated with DMSO control (0) or the indicatedconcentrations of BDPIC for 24 hours prior to lysis (Fig.20B).20 ug lysate proteins weresubjected to SDS-PAGE and immunoblot analysis using indicated antibodies. Thesedata demonstrate the utility of BDPIC in screening different combinations of bromoTAG-POIs and dTAG-E3s (or vice versa with regards to the tags) for proximity-induceddegradation of the POI. Targeted phosphorylation using BDPIC The present inventors have found that BDPIC can induce phosphorylation of adTAG-POI via recruitment of a BromoTag-kinase (Fig. 21). FAM83D-KO U2OS cellsexpressing FAM83D-dTAG-Flag & HA-BromoTAG-CK1^ with DMSO control (0) or theindicated concentrations of BDPIC for 24 hours prior to lysis.20ug lysate proteins were subjected to SDS-PAGE and immunoblot analysis using indicated antibodies. The data demonstrates a clear upward mobility shift of FAM83D-dTAG by BDPIC at all concentrations, suggesting phosphorylation. Conclusion In summary, the present disclosure demonstrates that BDPIC is an efficient proximity inducer between dTAG and BromoTag, with wider utility and greater efficacy than similarPICs. The present inventors have shown its utility in targeted dephosphorylation throughinduced proximity between BromoTag-PPP2CA and TFEB-dTAG here, as well as dTAG- SMAD3 and BromoTag-PPM1H, and finally between dTAG-PPP2CA and Tau-BromoTag. Furthermore, the inventors have described the use of BDPIC in targeted protein degradation and targeted phosphorylation. Additionally, the inventors have demonstrated the formation of a ternary complex in cells. These exemplary use casesact as proof-of-concept studies to demonstrate that BDPIC could be applied to induceproximity between any two proteins inside cells. The novel and clever combination of aligand for dTAG and a ligand for BromoTag offers an excellent platform to test whethermodulating any of the more than 500 protein post-translational modifications on target 55479585-1 proteins by recruiting the modifying enzymes in proximity affects the target protein function. Such approaches could potentially reveal novel drug modalities, as the presentinventors have done here with targeted dephosphorylation. As the inventors have shown,the CRISPR / Cas9 gene editing technology allows for efficient knock-ins of dTAG andBromoTag onto target proteins and enzymes of interest in any cell type.EXPERIMENTAL: Targeted Dephosphorylation of TFEB Materials: The following primary antibodies were used: From Cell Signalling Technology (CST), anti-phospho-TFEB Ser211 (Cat.37681S) and anti-phospho-TFEB Ser122 (Cat.87932); from Merck, anti-phospho-TFEB Ser142 (ABE1971-I); from Proteintech, anti-TFEB(13372-1-AP). Rabbit anti-phospho-TFEB Ser109 and anti-phospho-TFEB Ser138 werecustom generated via YenZym by immunizing rabbits with the following antigens: forphospho-TFEB Ser109 - human TFEB peptide incorporating residues 102–113(NKFAAHI-pS-PAQG) with pS at 109; for phospho-TFEB Ser138 - human TFEB peptideincorporating residues 128–140 (GHVLSSSAGN-pS-AP) with pS at 138. The antibodies were affinity purified using the phospho-peptide antigens and further cleared through the corresponding immobilized dephospho-peptides to remove any non-phospho binding. These antibodies were tested for specificity by immunoblotting using HEK293 extractsexpressing TFEB WT, S109A and S138A mutants (Fig. 8B&C). Sheep anti-GFP, sheepanti-dTAG and sheep anti-BromoTag antibodies were produced by MRC-PPU Reagentsand Services, University of Dundee. Rabbit-anti GFP (598) for immunofluorescence was obtained from MBL. Secondary antibodies used were: goat anti-Rabbit IgG (H+L), HRPconjugate, horse anti-mouse IgG (H+L), HRP conjugate were purchased from CST. Goatanti-Rabbit IgG (H+L), rabbit anti-sheep IgG (H+L), HRP conjugate were purchased from Thermo Fisher Scientific. MK-8722 was purchased from MedChemExpress. Torin 1 was obtained from Tocris. RNA extraction was performed by using Monarch total RNA miniprep kit. cDNA synthesis was performed using iSCRIPT cDNA Synthesis kit (Bio- Rad). Dulbecco’s Modified Eagle Medium (DMEM) was purchased from Life Technologies. Foetal Bovine Serum (FBS) was purchased from Thermo Fisher Scientific. Dithiobis Succinimidyl Propionate (DSP) was purchased from Thermo Fisher Scientific. All plasmids used in this study were generated by MRC-PPU Reagents and Services, University of Dundee, and details are available at https: / / mrcppureagents.dundee.ac.uk. dTAGV-1-NEG was purchased from Tocris (Cat. 55479585-16915). BDPIC, HDPIC and PhosTAC7 (Chen et al., ACS Chem. Biol., 2021, 16, 2808)were synthesized by Natalia Shpiro. Cell culture:Mouse myoblast C2C12, human embryonal kidney cells 293FT and humanosteosarcoma U2OS cells were cultured in DMEM with 10% FBS, 2 mM L-glutamine and1% streptomycin / penicillin. All cell lines were maintained at 37 °C and under 5% CO2 ina humidified tissue culture incubator. Cells were exposed to different stimuli and compounds as described in the appropriate figure legends prior to lysis. Plasmids: For production of retroviral vectors, the following were cloned into pBABED-puromycin plasmids: FLAG-aGFP6M-PPP1CA (DU62917), FLAG-aGFP6M-PPP1CAH125Q(DU62964), FLAG-aGFP6M-PPP2CA (DU62902), FLAG-aGFP6M-PPP2CAH118Q(DU62960), 3HA-5Gly-BromoTag-5Gly (DU71673), 3HA-5Gly-BromoTag-5Gly- PPP2CA (DU75905), 3HA-5Gly-BromoTag-5Gly-PPP2CAH118Q(DU75906). All constructs were sequence-verified by the DNA Sequencing Service, University of Dundee (http: / / www.dnaseq.co.uk). For CRISPR / Cas9 gene editing, the following guideRNAs (gRNA) and donor cDNAs were used: mouse TFEB C-terminal GFP knock-in (KI):sense gRNA (DU69664), antisense gRNA (DU69669), GFP donor (69673). Mouse TFE3knockout: sense gRNA (DU69717), antisense gRNA (DU69720). Human TFEB C-terminal dTAG KI: single gRNA (DU69426), dTAG-IRES2-GFP donor (DU74451).Human PPP2CA N-terminal BromoTag KI: single guide (DU69331), mCherry-IRES2-BromoTag donor (DU74520). These constructs are available to request from the MRC-PPU Reagents and Services webpage (http: / / mrcppureagents.dundee.ac.uk) and the unique identifier (DU) numbers also provide direct links to the cloning strategies and sequence details. Generation of cell lines using CRISPR / Cas9: To generate mouse TFEB-GFP KI cells, C2C12 cells were transfected with vectors encoding a pair of guide RNAs (pBabeD-puro-sgRNA1 (1 ^g) and pX335-CAS9-D10A- sgRNA2 (1 ^g)) targeting close to the stop codon of TFEB, along with the respectivedonor plasmid carrying the in-frame GFP KI insert and flanking TFEB homology arms (3^g). For the generation of mouse TFE3 KO cells, C2C12 TFEBGFP / GFPcells were transfected with vectors encoding a pair of guide RNAs (pBABED-Puro-sgRNA1 (1 ^g) 55479585-1 and pX335-CAS9-D10A-sgRNA2 (1 ^g)) targeting on the exon 3 of TFE3. To generate human TFEB-dTAG KI cells, U2OS cells were transfected with vectors encoding a singlegRNA (pX459-CAS9-gRNA (1 ^g)) targeting close to the stop codon of TFEB(TFEBdTAG / dTAG) and donor plasmid carrying the dTAG-IRES2-GFP KI cassette flankedby TFEB homology arms (3 ^g). For the generation of human BromoTag-PPP2CA KIcells, U2OS TFEBdTAG / dTAGcells were transfected with vectors encoding a single gRNA (pX459-Puro-CAS9-gRNA (1 ^g)) targeting on the N-terminal of PPP2CA(BromoTag / BromoTagPPP2CA) and donor plasmid carrying mCherry-IRES2-BromoTag KIcassette flanked by PPP2CA homology arms (3 ^g). One day post-transfection, cellswere selected with 2 ^g / mL puromycin for a further 48 h. For KO cells, cells wereexpanded in fresh medium before western blotting analysis to confirm knockdown efficiency. For KI cells, the transfection process was repeated one more time when the cell confluency reached 60-70% following selection in puromycin.24 h post-transfection, cells were maintained in fresh medium until single cell isolation. For the acquisition ofsingle-cell clones of KOs, and GFP, dTAG and BromoTag KIs, single cells were isolatedby fluorescence-activated cell sorting (FACS) using an Influx cell sorter (Becton Dickinson). Single cell clones were plated on individual wells of 96-well plates, pre- coated with 1% (w / v) gelatin to help with cell adherence. Viable clones were expanded,and successful KO or integration of GFP, dTAG or BromoTag cDNA at the target locuswas confirmed by both Western blotting and genomic DNA sequencing. CRISPR / Cas9 approaches used here for KI and KO have been described previously (Brewer et al., 10.1101 / 2023.09.19.558429; Dunbar et al., 10.26508 / lsa.202000805; Fulcher et al., 10.1098 / rsob.160255; Rojas-Fernandez et al., Sci. Rep., 2015, 5, 9811; Roth et al., Cell Chem. Biol., 2020, 27, 1151). Retroviral generation of stable cell lines: Stable cell lines were generated by retroviral transduction. The cDNA of interest was inserted into a pBabeD-puromycin vector (6 ^g) and co-transfected with pCMV5- GAG / POL (3.2 ^g) and pCMV5-VSV-G plasmids (2.8 ^g) (Clontech) into a 10-cm dishof ~60% confluent 293FT cells by using 36 ^L of 1 mg / mL PEI as described previously(Fulcher et al., 10.1098 / rsob.160255). The medium containing the retroviral particles was harvested 48 h post-transfection, passed through a 0.45 mm filter and added to target cells in the presence of 10 ^g / mL polybrene (Sigma-Aldrich). Cells were selected with 2^g / mL puromycin (Sigma-Aldrich) for 48 h after exposure to retroviral particles. A pool oftransduced cells was utilized for subsequent experiments following selection. 55479585-1 Cell Lysis: Cells were harvested by washing twice with phosphate-buffered saline (PBS) andscraping into ice-cold lysis buffer containing 50 mM HEPES pH 7.4, 150 mM NaCl, 1 mMEDTA, 10% glycerol, 0.5% NP-40, 1 mM DTT, 1 mM PMSF, 1.15 mM sodium molybdate,4 mM sodium tartrate, 10 mM β-glycerophosphate, 1 mM sodium fluoride, 1 mM sodiumorthovanadate and 1x complete protease inhibitor cocktail (Roche). After incubation for10 min on ice, lysates were cleared by centrifugation at 20,000 x g for 10 min at 4 °C.Protein concentration was determined using Bradford protein assay. For chemical cross- linking by DSP, cells were treated with compounds for 2 h before lysis. For this, after washing cells with pre-warmed PBS twice, cells were incubated with pre-warmed PBScontaining 1 mM DSP and compounds for further 30 min at 37 °C. The reaction wasquenched by adding 20 mM Tris-HCl in PBS for 20 min. Cells were then lysed in lysis buffer without reducing agents. Immunoprecipitation: Following determination of protein concentration by Bradford assay, immunoprecipitation (IP) was performed to isolate a particular protein of interest. For anti-FLAG IPs, anti- FLAG M2 resin (Sigma-Aldrich) was used; for anti-HA IP, anti-HA frankenbody Sepharose beads (MRC-PPU Reagents and Services) was used. Before an IP was performed, a small amount of each lysate (10^^g protein) was retained to compare anddetermine IP efficiency. Samples (1 mg total protein) were incubated with 10^^L packedbeads overnight at 4 °C on a rotating wheel. Beads were collected by centrifugation at1000 x g for 5 min at 4 °C and a sample of the supernatant was retained. IPs weresubsequently washed twice with 1 mL lysis buffer in the presence of 500 mM NaCl, oncein 1 mL of lysis buffer and then resuspended in 20 ^L of lysis buffer. Input, IP and post-IP flow through extract (equivalent to input) samples were reduced in 1X LDS samplebuffer (Invitrogen) and boiled at 95 °C for 5 min prior to SDS-PAGE.Immunoblotting: Reduced and denatured cell lysates containing equal amounts of protein (10-30 ^g) were resolved by SDS-PAGE and transferred to nitrocellulose membranes. After blocking in 5% (w / v) non-fat milk in TBS-T (20 mM Tris, 150 mM NaCl, 0.1% Tween-20) for 1 h at room temperature, membranes were incubated with primary antibody diluted in 5% milkTBS-T overnight at 4 °C in a shaker. Membranes were then washed 3x10 min in TBS-T55479585-1 with constant shaking and subsequently incubated with HRP-conjugated secondary antibody diluted in 5% milk TBS-T solution for 1 h at room temperature. Membranes were then washed 3x10 min in TBS-T and the signal detection via chemiluminescence (Promega) was performed using ChemiDoc imaging system (Bio-Rad).Immunofluorescence microscopy:Cells were seeded onto sterile glass coverslips in 12-well dishes. After treatments, cells were washed twice with PBS and fixed with pre-chilled methanol for 20 min. The cells were blocked by washing twice and incubation for 30 min in blocking buffer (1% (w / v)BSA / PBS). Coverslips were incubated for 1 h at 37 °C with primary antibodies in blockingbuffer and washed three times in blocking buffer. Coverslips were then incubated for 1 h at room temperature with Alexa Fluor coupled secondary antibodies (Life Technologies) in blocking buffer and washed an additional three times in blocking buffer. After submerging in ddH2O, cells were mounted onto glass slides using prolong gold antifade mountant containing DAPI (Life Technologies) and visualized with a Zeiss LSM880 Airyscan or LSM710 Confocal Scanning microscope (ZEISS; Plan Apochromat X63 objective, NA 1.4). Images were processed using ZEISS Zen Software. Quantitative reverse transcription PCR (qRT-qPCR): Total cellular RNA was isolated from C2C12 or U2OS cells using a RNeasy® Micro Kit (Qiagen) according to the manufacturer’s instructions. A 1 ^g total RNA was converted to cDNA by using SuperScript cDNA kit. The obtained cDNA samples were used as templates for qPCR by CFX384 real-time qPCR machine (Bio-Rad). Data was normalized with the mean of housekeeping gene Tbp. The following primer sequenceswere used: mouse Hexa: sense 5’- GCT GAG GGC ACG TTC TTT ATC-3’, antisense5’- GCG AGA TGT ATC CAG CAG TAC G-3’; mouse Fnip1: sense 5’- GAT GCG TGTTCA TGT CAA GG-3’, antisense 5’- GGA GAG TGG GTG CTT GCT AC-3’; mouse Flcn:sense 5’- TGG ATC GGA TCT ACC TCA TCA-3’, antisense 5’- TGG ACA TCC AAACTG CTC TG-3’;mouse Tbp: sense 5’-CCT TGT ACC CTT CAC CAA TGA C -3’,antisense 5’-ACA GCC AAG ATT CAC GGT AGA -3’; human Hexa: sense 5’- CAA CCAACA CAT TCT TCT CCA-3’, antisense 5’- CGC TAT CGT GAC CTG CTT TT; humanFnip1: sense 5’- GGT TCT CGG TGC TCT TCT GAT-3’, antisense 5’- GCT GTG GAGGGG AAC GAA T-3’; human Flcn: sense 5’- GAT TGA AGC GGC TCT GAC CAA C-3’,antisense 5’- TCG ACT GTC CAC CTT GGT GAA C-3’; human Gpnmb sense 5’- GATGCC AAA AGG AAG ATG CC-3’, antisense 5’- CTC TGA CCA TGC TGT CCA GTT-3’;55479585-1human Tbp: sense 5’- AGG GTT TCT GGT TTG CCA AGA-3’, antisense 5’- CTG AATAGG CTG TGG GGT CA-3’. Cell viability assay: 0.5X103cells were plated onto each well of 96-well plate overnight and incubated in ahumidified incubator with 5% CO2 at 37 °C. BDPIC compound with variousconcentrations were added to culture medium for another 48 h. Following incubation, 10μL of alamarBlue reagent (Thermo) in an amount equal to 10% of the total volume wereadded into each well and incubated for 2 h in a culture incubator at 37 °C. Absorbanceat 570 nm and 600 nm wavelengths was measured.Phospho-TFEB analysis by mass spectrometry: Cells were first lysed in NP-40 lysis buffer. Clarified lysates (5 mg protein) were incubatedwith Flag resin (25 μL packed beads) for 4 h on a rotating wheel at 4 °C. Followingincubation, beads were washed 3x with standard lysis buffer. Bead-bound proteins weredenatured and eluted in 2x LDS for 5 min at 95 °C. Samples were then filtered throughSpin-X columns to remove the beads from the eluate. The filtered eluate was loaded onto a 4-12% Bis-Tris gradient gel and proteins were separated by SDS-PAGE. Gels were stained with InstantBlue and subsequently de-stained in deionised water. A small portion of the eluate was retained for analysis and validation by Western blotting. To minimise potential protein contaminants, all steps from this point were performed under a laminar flow hood. Disposable scalpels were used to cut protein bands of interest from the InstantBlue stained gels into 1-2 cm cubes, which were subsequently transferred intoLoBind 1.5 mL Eppendorf tubes. Gel pieces were washed once in HPLC grade water,and then shrank in anhydrous acetonitrile (MeCN) for 5 min with gentle shaking. TheMeCN was aspirated, and gel pieces were re-swollen with 50 mM Tris-HCl pH 8.0 for 5min with shaking. The shrinking-swelling process was repeated once more, and the proteins within the gel pieces were reduced with 5 mM DTT in 50 mM Tris-HCl pH 8.0for 20 min at 65 °C. Next, the proteins within the gel pieces were alkylated with 20 mMiodoacetamide (IAA) in 50 mM Tris-HCl pH 8.0 for 20 min at room temperature. Gelpieces were then shrunk again in MeCN for 5 min, dried and re-swollen in 50 μL of 50mM triethylammonium bicarbonate (TEAB) pH 8.0 containing 5 mg / mL trypsin forovernight incubation at 37 °C for digestion. An equivalent volume of MeCN was addedto the digest for 15 min with shaking and the supernatant was collected into a freshLoBind 1.5 mL Eppendorf tube. Gel pieces were then re-swollen with 0.1% (v / v)55479585-1 trifluoroacetic acid (TFA) for 5 min with shaking, and peptides were extracted twice withMeCN for 5 min each with shaking. After each extraction, the supernatant was collectedand combined with the previous supernatants. The supernatants were then dried by vacuum centrifugation using a SpeedVac. Digested peptides were reconstituted inHPLC-grade 5% (v / v) MeCN containing 0.1% (v / v) formic acid (FA) and injected into aU3000 RSLC (rapid separation liquid chromatography) HPLC chromatography system (Thermo Fisher Scientific) coupled to a linear ion trap-orbitrap hybrid mass spectrometer (Orbitrap Velos Pro, Thermo Fisher Scientific). Peptides were trapped on a nanoViper Trap column (2 cm x 100 μM, C18 5 μM, 100 Å, Thermo Fisher Scientific) and subsequently separated on a 15-cm EasySpray column (Thermo Fisher Scientific) equilibrated with a flow rate of 300 nL / min. Data was acquired in the data-dependent mode, automatically switching between MS1 and MS2 acquisition. Full scan spectra (m / z 400-1,600) were acquired in the orbitrap with resolution set to 60,000 at m / z 400. The 20 most intense ions, above a specified minimum signal threshold of 2,000, were fragmented by collision induced dissociation and recorded in the linear ion trap (full automatic gain control (AGC) target; 30,000, Msn AGC target; 5,000). Raw files were subsequently converted into a list of identified peptides, along with the precursor intensity of the identified peptides, and submitted to the in-house Mascot server (MRC-PPU, University of Dundee). Data was searched against the SwissProt human database with variable modifications allowing for oxidation of Met, phosphorylation of Ser / Thr or Tyr residues, along with oxidation or dioxidation modifications. Carbamidomethylation of Cys was set as a fixed modification. Error tolerances were set to 10 ppm (parts per million) for MS1 and 0.6 Da for MS2. Data analysis was performed using Scaffold v 4.4.6 (Proteome Software). Quantification and statistical analysis: Statistical significance was determined using unpaired Student’s t-test for 2 group comparisons and one-way ANOVA with Dunnett’s multiple comparison test for comparing the means of >2 groups to the control. For multiple comparisons, significance was determined by two-way ANOVA with Bonferroni post-test. The statistical significance is denoted on graphs. Targeted Dephosphorylation of SMAD3 Cell Lines: 55479585-1 All procedures were carried out under aseptic conditions meeting biological safety requirements. A549 cells (ATCC, Cat# CVCL_0023) are human lung adenocarcinomacells derived from a 58-year-old male, HEK293-FT cells (Invitrogen, Cat# R70007) are aclonal isolate of HEK293 cells transformed with the SV40 large T antigen and U2OS cells(ATCC, Cat# HTB-96) are human epithelial bone osteosarcoma cells derived from a 15-year-old female. For growth, A549, HEK293-FT and U2OS cells were maintained inDMEM (Life Technologies) containing 10% (v / v) foetal bovine serum (FBS, ThermoFisher Scientific), 2 mM L-glutamine (Lonza), 100 U / mL penicillin (Lonza) and 0.1 mg / mLstreptomycin (Lonza). Cells were grown at 37 °C with 5% CO2 in a water-saturatedincubator. For passaging, cells were incubated with trypsin / EDTA at 37 °C to detachcells. Plasmids: For production of retroviral vectors, the following were cloned into pBABED plasmids: FLAG-BromoTag(L387A)-PPP2CA (DU78036), FLAG-BromoTag(L387A)-PPP2CA(H118Q) (DU78037), FLAG-dTAG-SMAD3 (DU71496), FLAG-NLS-Halo-HiBiT(DU61387), 3HA-BromoTag(L387V)-PPM1A (DU71699), 3HA-BromoTag(L387A)-PPM1A(D239A) (DU77740), 3HA-BromoTag(L387A)-PPM1H (DU78038), 3HA-BromoTag(L387A)-PPM1H(H153D) (DU77739), 3HA-BromoTag(L387V)-PPP1CA (DU71698), HA-dTAG-PPM1H (DU77742), Halo-SMAD3 (DU77738). All constructswere sequence-verified by the DNA Sequencing Service, University of Dundee(http: / / www.dnaseq.co.uk). These constructs are available to request from the MRC PPUReagents and Services webpage (http: / / mrcppureagents.dundee.ac.uk) and the uniqueidentifier (DU) numbers provide direct links to the cloning strategies and sequencedetails. Retroviral generation of stable cell lines: Retroviral pBABED-puromycin or -hygromycin vectors encoding the desired construct (6μg) were co-transfected with pCMV5-gag-pol (3.2 μg) and pCMV5-VSV-G (2.8 μg) (CellBiolabs) into a 10 cm diameter dish of ~70% confluent HEK293-FT cells. Plasmids wereadded to 1 mL Opti-MEM medium in addition to 24 μL of 1 mg / mL PEI before gentlemixing and incubation at room temperature for 20 min. The transfection mix was thenadded dropwise to HEK293-FT cells.16 h post-transfection, fresh medium was added tothe cells. After 24 h, the retroviral medium was collected and passed through 0.45 μmsterile syringe filters. Target cells (~60% confluent) were transduced with the optimised55479585-1titre of the retroviral medium diluted in fresh medium (typically 1:1) containing 8 μg / mLpolybrene (Sigma-Aldrich) for 24 h. Then the cells were placed in fresh mediumcontaining the appropriate concentration of antibiotic to select cells which had integratedthe construct with a control non-transduced plate put under selection in parallel. A poolof transduced cells was utilised for subsequent experiments following complete death ofthe control plate. Generation of cell lines using CRISPR / Cas9 technology: The CRISPR / Cas9 genome editing system (Cong et al., Science, 2013, 339, 819; Ranet al., Nat. Protoc., 2013, 8, 2281) was used to generate HEK293 homozygous dTAG / dTAGPPP2CA cells, A549 heterozygous Halo / WT SMAD3 cells and A549 BromoTag / BromoTag PPM1Hhomozygous dTAG / dTAG SMAD3 cells.For the generation of HEK293 dTAG / dTAG PPP2CA cells, cells were transfected with vectorsencoding a guide RNA (gRNA) targeting the PPP2CA exon 1 locus (DU69331 pX459 puromycin Cas9D10APPP2CA) (1 µg) and donor (DU69361 pMA PPP2CA Nter GFPIRES2 FKBP12F36V ) (3 µg), as well as PEI. For A549 Halo / WT SMAD3 cells, a pair of gRNAstargeting SMAD3 exon 1 was transfected (DU52711 and DU52710, pX335 sgRNA1Cas9n and pBABED puromycin U6 sgRNA2) (1 µg each) alongside donor (3 µg)(DU69866 pMA SMAD3 Nter mCherry IRES2 Halo-tag) and PEI. ForA549 BromoTag / BromoTag PPM1H cells, R. Fasimoye transfected a pair of gRNAs targetingPPM1H exon 1 (1 µg each) (DU64667 and DU64673 pX335 sgRNA1 Cas9n andpBABED puromycin U6 sgRNA2) alongside donor (3 µg) (DU64751 pMK-RQ PPM1HNter GFP IRES2 BRD4 333-460 L387A donor). For A549 BromoTag / BromoTagPPM1H / dTAG / dTAG SMAD3 cells, a pair of gRNAs targeting SMAD3 exon 1 wastransfected (1 µg each) (DU52710 and DU52711 pX335 sgRNA1 Cas9n and pBABED puromycin U6 sgRNA2) alongside donor (3 µg) (DU74453 pMA SMAD3 Nter mCherryIRES2 FKBP12F36V ) and PEI. 16 h post-transfection, selection with 1 μg / mL puromycin(Sigma-Aldrich) was carried out for HEK293 cells, or 3.5 µg / mL for A549 cells, andcontinued for 48 h. The transfection process was repeated (without a further round ofselection). Cells were sorted by flow cytometry and single cells were plated in individualwells of 96-well plates. Viable clones were expanded, and integration of the knock-in atthe target locus was verified by Western blotting, polymerase chain reaction (PCR) andgenomic sequencing. Treatment of cells with stimuli / compounds: 55479585-1 The following reagents were added to the cell medium at indicated concentrations andtimes: Recombinant TGFβ1 (Peprotech, Cat# 100-21) (reconstituted in 4 mM HCl / 1µg / mL BSA), SB- 505124 (Sigma, Cat# S4696-5MG), BDPIC, HDPIC, HDPIC-Neg,PhosTAC7. For serum- starvation, cells were washed with phosphate-buffered saline(PBS) before incubation in serum-free medium for 16 h.Reverse transcription quantitative PCR (RT-qPCR):The Qiagen RNeasy kit was used to isolate RNA from cells. cDNA was produced using1 μg of isolated RNA using the iScript cDNA kit (Bio-Rad) as per the manufacturer’sinstructions. qPCR reactions were performed in triplicate, in 10 μL final volumes for 384-well plates. Each well contained 5 µL of PowerUp SYBR Green mastermix, 1 µL of a 20µM mixture of both Forward and Reverse primers and 2 µL of cDNA. qPCR wasperformed with a CFX384 real-time qPCR machine (Bio-Rad). Primers used include (5’-3’): GAPDH Fw (TGCACCACCAACTGCTTAGC), GAPDH Rev(GGCATGGACTGTGGTCATGAG), PAI-1 Fw (AGCTCCTTGTACAGATGCCG), PAI-1Rev (ACAACAGGAGGAGAAACCCA), SMAD7 Fw (CTGTGCAAAGTGTTCAGGTG)and SMAD7 Rev (TTGAGAAAATCCATCGGGTA). Data was normalised to the mean ofthe housekeeping gene (GAPDH) and analysed using the 2-ΔΔCt method for comparingrelative gene expression (Livak and Schmittgen, 2001). Data analysis and plotgeneration were carried out using Microsoft Excel and GraphPad Prism software.Cell lysis and immunoprecipitation: Cells were harvested by washing twice with PBS and scraped into ice-cold lysis buffer(50 mM Tris-HCl pH 7.5, 0.27 M sucrose, 150 mM NaCl, 1 mM EGTA, 1 mM EDTA,1 mM sodium orthovanadate, 10 mM sodium β-glycerophosphate, 50 mM sodiumfluoride, 5 mM sodium pyrophosphate and 1% NP-40) supplemented with 1x completeEDTA-free protease inhibitor cocktail (Roche). After incubation for 10 min on ice, lysateswere clarified by centrifugation at 17,000 G for 20 min at 4 °C. Protein concentration wasdetermined according to the Bradford assay to enable normalisation between samples.For immunoprecipitation (IP), cells were lysed as above and a 1 mL solution containinga minimum of 1 mg protein was then subjected to immunoprecipitation using 20 µL of a50 / 50 (v / v) slurry made using HA-frankenbody resin slurry (MRC Reagents and Services)with lysis buffer supplemented with protease inhibitor cocktail. 40 µL was removed forinput samples and added to 8 µL 6X SDS sample buffer. IP samples were then incubatedfor 2 h with rotation at 4 °C. Flow-through samples were then removed (40 µL). IP55479585-1samples were eluted in 40 µL 2X SDS sample buffer and 20 µL of IP and input sampleswere subjected to immunoblot. IP:input ratio is ~25:1.Cytoplasmic / nuclear fractionation:Cells were washed twice with PBS, scraped and pelleted by centrifugation at 4 °C (2 minat 1200 rpm). For extraction of the cytoplasmic fraction, cells were resuspended incytoplasmic lysis buffer (20 mM Tris–HCL (pH 7.5), 0.1 mM EDTA, 2 mM MgCl2, 1%NP40, 50 nM β-glycerophosphate, and 1x complete EDTA-free protease inhibitorcocktail (Roche)). Samples were incubated at room temperature for 2 min and then onice for 10 min, before centrifugation at 4 °C (3000 rpm, 5 min).The supernatant wascollected as the cytoplasmic fraction and the pellet was then washed with wash buffer(20 mM Tris–HCL (pH 7.5), 0.1 mM EDTA, 2 mM MgCl2, 50 nM β-glycerophosphate, and1x complete EDTA-free protease inhibitor cocktail (Roche)) three times. The residualpellet was resuspended in nuclear lysis buffer (20 mM Hepes, 0.4 M NaCl, 25% glycerol,1 mM EDTA, 0.5 mM NaF, 0.5 mM Na3VO4, 0.5 mM DTT, and 1x complete EDTA-freeprotease inhibitor cocktail (Roche)) and the pellet was disrupted by three quickfreeze / thaw cycles. Lysates were subsequently incubated on ice for 30 min with regularvortexing, followed by clarification at 17,000 G for 20 min at 4 °C with the supernatantthen collected as the nuclear fraction. SDS-PAGE and Western blotting: Cell lysates containing equal amounts of protein (15-20 μg) were resolved by SDS-PAGEand transferred onto nitrocellulose membrane. Membrane was blocked in 5% (w / v) non-fat milk (Marvel) in TBS-T (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.2% Tween-20) andincubated overnight at 4 °C in 5% (w / v) BSA / TBS-T or 5% (w / v) milk / TBS-T with theappropriate primary antibodies. Primary antibodies used at indicated dilutions include:anti-BRD4 BD2 (SA599, MRC PPU Reagents & Services, 1 µg / mL), anti-dTAG (DA179,MRC PPU Reagents and Services, 1 µg / mL), anti-FKBP12 (ab24373, Abcam, 1:1000),anti-FLAG M2-Peroxidase (A8592-.2MG, Sigma, 1:500), anti-GAPDH (10494-1-APProteintech, 1:5000), anti-GAPDH-HRP (HRP-60004, Proteintech, 1:30000), anti-HA- HRP (11867423001, Roche, 1:1000), anti-Halo-tag (G9281, Promega, 1:1000), anti-LaminA / C (2032S, CST, 1:1000), anti-PAI-1 (ab66705, Abcam, 1:1000), anti-PPM1H(DA064, MRC PPU Reagents and Services, 1 µg / mL), anti-SMAD2 / 3 (8685S, CST,1:1000), anti-SMAD3 (9523S, CST, 1:1000), anti-SMAD3 p-S423 / S425 (600-401-919,Rockland, 1:1000), anti-α-tubulin (MA1-80189, Invitrogen, 1:5000), anti-vinculin55479585-1 (ab129002, Abcam, 1:10000), Membrane was subsequently washed with TBS-T andincubated with HRP (horseradish peroxidase)- or IRDye800-conjugated secondaryantibody for 1 h at room temperature. HRP-coupled secondary antibodies used atindicated dilutions include: goat anti-rabbit-IgG (7074, CST, 1:5000), rabbit anti-sheep-IgG (31480, Thermo Fisher Scientific, 1:5000), goat anti-rat IgG (62-9520, Thermo FisherScientific, 1:5000), goat anti-mouse-IgG (31430, Thermo Fisher Scientific, 1:5000).IRDye800-coupled secondary antibodies used include: IRDye800CW Donkey anti-Rabbit IgG (H + L) (926-32213, Licor, 1:5000). After further washing, signal detectionwas performed using ECL (Merck) for HRP-conjugated secondaries and ChemiDoc MPSystem (Bio-Rad). ImageLab (version 6.0.1) (Bio-Rad) was used to analyse proteinbands by densitometry.Cell cytotoxicity assay: CellTox Green Assay (Promega, Cat. #G8742) was used to assess the cytotoxicity ofBDPIC, HDPIC and HDPIC-Neg in A549 and U2OS cells at the indicated concentrationsand treatment durations. The fluorescent signal produced by the CellTox Green dye,upon selective binding to the DNA of cells with impaired membrane integrity, isproportional to cytotoxicity. Fluorescence was measured using ex: 480 nm em: 530 nmby a PHERAstar FS plate reader before subtracting blank measurements (made usingwells containing medium only, no cells) and normalising to DMSO treatment. MG132treatment (20 µM) or the lysis solution from the kit was included as a positive control ateach time point. Data was analysed using Excel (Microsoft) and GraphPad Prismsoftware (Version 8). Quantification and statistical analysis: Statistical analysis was determined using unpaired Student’s t-test for singlecomparisons and for multiple treatments analysis of variance was performed followed bythe post-hoc tests described in figure legends using Prism® Version 8.0.Targeted Dephosphorylation of Tau Cell lysis Cells were collected by rinsing twice with phosphate-buffered saline (PBS) and thengently scraped into ice-cold lysis buffer. The lysis buffer composition consisted of 50 mMHEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 1 mM DTT,1 mM PMSF, 1.15 mM sodium molybdate, 4 mM sodium tartrate, 10 mM55479585-1β-glycerophosphate, 1 mM sodium fluoride, 1 mM sodium orthovanadate, and 1xcomplete protease inhibitor cocktail (Roche). Following a 10-minute incubation on ice,the lysates were clarified by centrifugation at 20,000 x g for 10 minutes at 4°C. Theprotein concentration was determined using the BCA protein assay.Immunoprecipitation Following determination of protein concentration by BCA protein assay,immunoprecipitation (IP) was performed to pull down protein of interest. For anti-FLAGIPs, anti-FLAG M2 resin (Sigma-Aldrich) was used; for anti-GFP IP, anti-GFP Sepharosebeads (MRC-PPU Reagents and Services) was used. Before an IP was performed, asmall amount of each lysate (20 ^g protein) was retained to compare and determine IPefficiency. Samples (1 mg total protein) were incubated with 10 ^l packed beadsovernight at 4 °C on a rotating wheel. Beads were collected by centrifugation at 1000 x gfor 5 min at 4 °C and a sample of the supernatant was retained. IPs were subsequentlywashed twice with 1 ml lysis buffer three time and then resuspended in 20 ^l of lysisbuffer. Input, IP and post-IP flowthrough extract (equivalent to input) samples werereduced in 1X LDS sample buffer (Invitrogen) and boiled at 95 °C for 5 min prior to SDS-PAGE. Immunoblotting Reduced and denatured cell lysates containing equal amounts of protein (30 ^g) were resolved by SDS-PAGE and transferred to nitrocellulose membranes. After blocking in5% (w / v) non-fat milk in TBS-T (20 mM Tris, 150 mM NaCl, 0.1% Tween-20) for 1 h atroom temperature, membranes were incubated with primary antibody diluted in 5% milkTBS-T overnight at 4 °C in a shaker. Membranes were then washed 3 × 10 min in TBS-Twith constant shaking and subsequently incubated with HRP-conjugated secondaryantibody diluted in 5% milk TBS-T solution for 1 h at room temperature. Membranes werethen washed 3 × 10 min in TBS-T and the signal detection via chemiluminescence(Promega) was performed using ChemiDoc imaging system (Bio-Rad).Chemical Synthesis Abbreviations: AcOH Acetic acidDCE 1,2-DichloroethaneDCM Dichloromethane55479585-1DIC N,N-DiisopropylcarbodiimideDIPEA N,N-DiisopropylethylamineDMA 4-(Dimethylamino)pyridineDMF N,N-DimethylformamideDMSO Dimethyl sulfoxideEt3N TriethylamineEt3SiH TriethylsilaneEtOAc Ethyl acetateHATU 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium-3-oxidhexafluorophosphate LiHMDS Lithium bis(trimethylsilyl)amideMeCN AcetonitrileMeOH MethanolNH4Cl Ammonium chloridePd(OAc)2Palladium(II) acetate PyBOP Benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphoniumhexafluorophosphate T3P Propanephosphonic acid anhydrideTFA Trifluoroacetic acidTHF TetrahydrofuranGeneral comments: All chemicals were purchased from commercial vendors and used without further purification. Ortho-AP1867 were prepared as described in (Simpson et al., Cell Chem. Biol., 2022, 29, 1482). Flash column chromatography and Prep HPLC were performed by using Buchi PrepChrom C-700, prepacked Buchi Sepacore Flash Cartridges andHPLC C18 column Gemini NY(RP)C18110, 21.2×150 mm, 10 µm particle size. Detailsabout the conditions for preparative HPLC are provided in the experimental procedures. NMR spectra were recorded on a Bruker Ascend 500 MHz. Chemical shifts are reported in parts per million referenced to residual solvent peaks (CDCl3= 7.26 ppm). Only the chemical shifts of the major rotamer are reported. The following abbreviations were usedin reporting spectra, s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), dd(doublet of doublets), bs (broad signal). Low resolution mass spectra and analytical HPLC traces were recorded on an Agilent Technologies 1200 series HPLC connected to an Agilent Technologies 6130 quadrupole LC / MS, connected to an Agilent diode array 55479585-1detector. The column used was a Waters XBridge column (50 mm × 2.1 mm, 3.5 μmparticle size), with a gradient from 5 % to 95% of acetonitrile in water (with 0.1 % of formicacid or aqueous ammonia solution) over 3 or 7 minutes. The flow rate was 0.7 mL / min. Synthesis of BDPIC: 1-(tert-butyl) 4-methyl (2S,3R)-2-(((benzyloxy)carbonyl)amino)-3-ethylsuccinate (2) and 1-(tert-butyl) 4-methyl (2S,3S)-2-(((benzyloxy)carbonyl)amino)-3-ethylsuccinate (3)To a solution of 1-(tert-butyl) 4-methyl ((benzyloxy)carbonyl)-L-aspartate 1 (Nowak et al.,J. Med. Chem., 2021, 64, 11637) (9.38 g, 27.80 mmol) in 250 mL of anhydrous THF wasadded dropwise 1.3 M solution of LiHMDS in THF (45 mL, 58.5 mmol) at -68 °C. Thereaction mixture was stirred at -68 °C for 1 h, then at -40 °C for 1 h, and cooled downagain to -68 °C. Iodoethane (5.6 mL, 10.86 g, 69.62 mmol) was then added dropwiseand the reaction was stirred for 1 h at -10 °C, quenched with saturated NH4Cl solution(75 mL) and extracted with EtOAc (2 x 100 mL). The organic layers were washed with brine (75 mL), combined, and concentrated. The crude residue (10 g) was purified by flash column chromatography on silica (200 g), gradient from petroleum spirit to 40%EtOAc in petroleum spirit to afford compound 2 (5.79 g, 15.84 mmol, 57%) and 3 (2.28g, 6.23 mmol, 22%).2: 1H NMR (500 MHz, CDCl3,): δ = 7.40-7.37 (m, 4H); 7.36-7.30 (m, 1H); 5.70 (d, J=9.3Hz, 1H); 5.15 (s, 2H); 4.55 (dd, J=4.0 Hz, J=9.75 Hz, 1H); 3.69 (s, 3H); 2.96 (ddd, J=4.0Hz, 1H); 1.85-1.73 (m, 1H); 1.64-1.55 (m, 1H); 1.45 (s, 9H); 1.01 (t, J=7.4 Hz, 3H).3:1H NMR (500 MHz, CDCl3,): δ = 7.40-7.37 (m, 4H); 7.36-7.31 (m, 1H); 5.49 (d, J=7.2Hz, 1H); 5.12 (s, 2H); 4.56 (dd, J=5.0 Hz, J=8.3 Hz, 1H); 3.71 (s, 3H); 2.78-2.72 (m, 1H);1.90-1.80 (m, 1H); 1.62-1.53 (m, 1H); 1.48 (s, 9H); 0.98 (t, J=7.2 Hz, 3H).C19H27NNaO6, expected for [M+Na]+388.17, found [M+Na]+388.0. 55479585-1 (2S,3R)-2-(((benzyloxy)carbonyl)amino)-3-(methoxycarbonyl)pentanoic acid (4) To a solution of 1-(tert-butyl) 4-methyl (2S,3R)-2-(((benzyloxy)carbonyl)amino)-3-ethylsuccinate (2) (2.10 g, 5.75 mmol) in DCM (5 mL) was added solution of TFA in DCM(40 mL, 1:3 v / v) and the reaction mixture was stirred at RT for 16 h and concentrated.Crude residue was purified by RP C18 flash column chromatography (SVP D40-RP1825-40 µm 90 g), in a gradient of MeOH / H2O (5% to 95%) to afford compound 4 (1.39 g,4.50 mmol, 78%).1H NMR (500 MHz, CDCl3,): δ = 7.40-7.33 (m, 5H); 5.89 (d, J=9.4 Hz, 1H); 5.17 (s, 2H);4.68 (dd, J=3.6 Hz, J=9.4 Hz, 1H); 3.73 (s, 3H); 3.08 (ddd, J=3.5 Hz, 1H); 1.89-1.80 (m,1H); 1.70-1.60 (m, 1H); 1.05 (t, J=7.4 Hz, 3H).C15H19NNaO6, expected for [M+Na]+332.11, found [M+Na]+332.1. Methyl (2R,3S)-3-(((benzyloxy)carbonyl)amino)-4-((3-(4-chlorobenzoyl)-4,5- dimethylthiophen-2-yl)amino)-2-ethyl-4-oxobutanoate (6)To a solution of 4 (1.53 g, 4.94 mmol) in DCE (45 mL) were added 5 (Michio et al., J.Med. Chem., 1973, 16, 214) (1.31 g, 4.94 mmol), DIPEA (4.30 mL, 24.7 mmol) andPyBOP (6.42 g, 12.35 mmol) at RT. The reaction mixture was stirred at 50 °C for 48 h,55479585-1 cooled to RT, diluted with water (25 mL) and extracted with DCM (2×50 mL). The organic layer was washed with brine (25 mL) and concentrated. The crude residue was purified by column chromatography on silica (160 g), gradient from petroleum spirit to 40% EtOAcin petroleum spirit to give crude material (1.57 g) which was further purified by RP C18flash column chromatography (SVP D40-RP18 25-40 µm 90 g) in a gradient ofMeCN / H2O (5% to 95%) to afford compound 6 (1.13 g, 2.02 mmol, 41%).1H NMR (500 MHz, CDCl3,): δ = 11.74 (s,1H); 7.56(d, J=8.4 Hz, 2H); 7.45 (d, J=8.4Hz,4H); 7.34-7.29 (m, 3H); 6.24(d, J=9.4 Hz,1H); 5.30 (d, J=12.1 Hz, 1H); 5.18 (d, J=12.1Hz,1H); 4.75 (dd, J=3.4 Hz, J=9.6 Hz, 1H); 3.68 (s, 3H); 3.34-3.27 (m, 1H); 2.27 (s, 3H);1.89-1.79 (m, 1H); 1.71 (s, 3H); 1.67-1.59 (m, 1H); 1.05 (t, J=7.4 Hz, 3H).C28H29ClN2NaO6S, expected for [M+Na]+579.13, found [M+Na]+579.0. Methyl (R)-2-((S)-5-(4-chlorophenyl)-6,7-dimethyl-2-oxo-2,3-dihydro-1H-thieno[2,3- e][1,4]diazepin-3-yl)butanoate (8)To a solution of 6 (0.98 g, 1.76 mmol) in DCM (18 mL) were added Pd(OAc)2 (0.04 g,0.17 mmol) and Et3N (0.1 mL, 0.71 mmol) and the reaction was heated at 45 °C for 5 minwhile triethylsilane (1.40 mL,1.01 g, 8.76 mmol) was added dropwise. The reactionmixture was further stirred at 45 °C for 2 h, cooled to RT, diluted with DCM (20 mL),filtered through Celite, and concentrated. The crude residue of methyl(2R,3S)-3-amino- 4-((3-(4-chlorobenzoyl)-4,5-dimethylthiophen-2-yl)amino)-2-ethyl-4-oxobutanoate (7) was used in the next step without further purification. C20H24ClN2O4S, expected for [M+H]+423.11, found [M+H]+423.1. 55479585-1 To a solution of 7 (crude residue 1.1 g) in DCE (10 mL) 10% of acetic acid was addedand the reaction mixture was kept at 60 °C for 16 h and concentrated. The crude residuewas purified by flash column chromatography on silica (160 g), gradient from petroleumspirit to 50% EtOAc in petroleum spirit to afford compound 8 (0.37 g, 0.91 mmol, 51%for two steps) as yellow shiny crystals. Enantiomeric purity of 8 was determined as 99%ee on chiral column CHIRALPAC IA (20x250 mm, 5 µm particle size, DAICEL), 20%EtOAc in heptane, 220 nm, v=6 mL / min with tR=15.1 min.1H NMR (500 MHz, CDCl3,): δ = 8.70 (br s,1H); 7.34 (m, 4H); 3.88 (d, J=10.4 Hz, 1H);3.83 (s, 3H); 3.66 (ddd, J=4.5 Hz, 1H); 2.31 (s, 3H); 1.97-1.89 (m, 1H); 1.62 (s, 3H); 1.63-1.57 (m, 1H); 1.03 (t, J=7.5 Hz, 3H).C20H22ClN2O3S, expected for [M+H]+405.10, found [M+H]+405.1. [α]20D= +44.1 (c 0.5, CHCl3). Methyl (R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3- a][1,4]diazepin-6-yl)butanoate (9) The title compound was obtained as described in Filippakopoulos et al., Nature, 2010,468, 1067, starting from 8 (0.25 g, 0.61 mmol) in 73% yield (0.20 g, 0.45 mmol) as whitecrystals. Enantiomeric purity of 9 was determined as 99% ee on chiral columnCHIRALPAC IA (20x250 mm,5 µm particle size, DAICEL), 20% EtOAc in heptane, 220nm, v=6 mL / min with tR=19.2 min.1H NMR (500 MHz, CDCl3,): δ = 7.34 (m, 4H); 4.26 (d, J=10.9 Hz,1H); 4.01 (ddd, J=3.8Hz, 10.7 Hz, 10.9 Hz, 1H); 3.87 (s, 3H); 2.69 (s, 3H); 2.44 (s, 3H); 2.25-2.15 (m, 1H);1.70 (s, 3H); 1.74-1.63 (m, 1H); 1.04 (t, J=7.4 Hz, 3H).55479585-113C NMR (126 MHz, CDCl3) δ = 175.4, 163.2, 154.45, 149.9, 149.8, 136.8, 136.6, 132.1,130.9, 130.5, 129.8, 128.7, 59.4, 51.6, 49.7, 23.3, 14.5, 13.2, 11.9, 11.7. C22H24ClN4O2S, expected for [M+H]+443.13, found [M+H]+443.1. [α]20D = +70.1 (c 0.5, CHCl3).To a solution of 9 (0.20 g, 0.45 mmol) in a mixture of THF:EtOH 1:1 (5 mL) was added0.5M solution of LiOH (2.7 mL, 1.35 mmol) and the mixture was stirred at 45 °C for 24 h,cooled to RT, acidified with 1 M HCl (1.5 mL, 1.5 mmol), and concentrated. To a cruderesidue was added water (5 mL) and the precipitate was collected on sintered glass filter. It was purified by RP C18 flash column chromatography (SVP D40-RP1825-40 µm 90g), in a gradient of MeCN / H2O (5% to 95%) to afford compound 10 (0.115 g, 0.26 mmol,59%).1H NMR (500 MHz, CDCl3,): δ = 7.44 (d, J=8.6 Hz, 2H); 7.36(d, J-8.6 Hz, 2H); 4.25 (d,J=6.1, 1H); 3.73-3.63 (m, 1H); 2.71 (s, 3H); 2.46 (s, 3H); 2.12-2.02 (m, 1H); 2.00-1.90(m, 1H); 1.74 (s, 3H); 1.12 (t, J=7.4 Hz, 3H).13C NMR (126 MHz, CDCl3) δ = 174.8, 164.7, 154.8, 150.0, 137.4, 135.8, 132.4, 131.4,131.2, 130.1, 128.8, 58.0, 48.4, 23.8, 14.7, 13.2, 11.8. C21H22ClN4O2S, expected for [M+H]+429.12, found [M+H]+429.1. [α]20D= +103.5 (c 0.5, CHCl3). 2,2-dimethyl-4-oxo-3,8,11,14-tetraoxa-5-azahexadecan-16-yl(R)-2-((S)-4-(4- chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6- yl)butanoate (11) 55479585-1To a solution of 10 (0.030 g, 0 07 mmol) in DCM (2 mL) was added DIC (0.043 mL,0.035g, 0.277 mmol), DMAP (0.011 g, 0.09 mmol) and the mixture was stirred at RT for 30 min. A solution of t-butyl-N-(2-(2-[2-(2-hydroxyethoxy)ethoxy]ethoxy)ethyl)carbamate14 (0.082 g, 0.28 mmol) in DCM (0.5 mL) was then added and the reaction was heatedat 40 °C for 4 h and concentrated. The crude residue (0.15 g) was purified on HPLC RPC18 column with gradient MeCN / H2O (5% to 95%) to give 11 (0.028 g, 0.039 mmol, 56%)as amorphous solid.1H NMR (500 MHz, CDCl3,): δ = 7.36 (d, J=8.6 Hz, 2H); 7.33(d, J-8.6 Hz, 2H); 5.03 (brs, 1H); 4.49-4.37 (m, 2H); 4.27 (d, J=10.8 Hz, 1H); 4.02 (ddd, J=3.6 Hz, 1H); 3.86-3.78(m, 2H); 3.74-3.70 (m, 2H); 3.68-3.61 (m, 6H); 3.55 (t, J=5.2 Hz, 2H); 3.35-3.30 (m, 2H);2.68 (s, 3H); 2.44 (s, 3H); 2.25-2.16 (m, 1H), 1.76-1.66 (m, 1H); 1.71 (s, 3H); 1.46 (s 9H);1.06 (t, J=7.4 Hz, 3H).C34H47ClN5O7S, expected for [M+H]+704.29, found [M+H]+704.3. 2-(2-(2-(2-aminoethoxy)ethoxy)ethoxy)ethyl(R)-2-((S)-4-(4-chlorophenyl)-2,3,9- trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate (12)A solution of 11 (0.028 g, 0.039 mmol) in formic acid (1 mL) was kept at RT for 16 h. Thevolatiles were removed in vacuo to yield 12 (0.028 g, 0.039 mmol), the crude residue was used in the next step without further purification. C29H39ClN5O5S, expected for [M+H]+604.24, found [M+H]+604.2. 55479585-1 (R)-1-(2-(((R)-17-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-2,16-dioxo-6,9,12,15-tetraoxa-3- azanonadecyl)oxy)phenyl)-3-(3,4-dimethoxyphenyl)propyl (S)-1-((S)-2-(3,4,5- trimethoxyphenyl)butanoyl)piperidine-2-carboxylate (13, BDPIC)To a solution of acid ortho-AP1867 (Simpson et al., Cell Chem. Biol., 2022, 29, 1482)(0.027 g, 0.038 mmol) in DCM (0.5 mL) were added a solution of 12 (0.028g, 0.038mmol) in DCM (1 mL), DIPEA (0.093 mL, 0.53 mmol) and 50% solution of T3P in ethylacetate at RT. The mixture was stirred at RT for 16 h, diluted with water (2 mL) and extracted with EtOAc (20 mL). The organic layer was washed with brine (5 mL) and concentrated. The crude residue was purified on HPLC RP C18 column with gradientMeCN / H2O (5% to 95%) to give 13, BDPIC (0.021 g, 0.016 mmol, 42%) as white powder.1H NMR (500 MHz, CDCl3,mixture of rotamers, only peaks of the major rotamer arereported): δ = 7.42-7.37 (m, 1H); 7.36 (d, J=8.6 Hz, 2H); 7.32 (d, J-8.6 Hz, 2H); 7.22 (dt,J=1.7 Hz, J=7.8 Hz, 1H); 7.10-6.99 (m, 1H); 6.89 (t, J=7.6 Hz,1H); 6.86-6.76 (m, 2H);6.73-6.69 (m, 1H); 6.68 (s, 1H); 6.52-6.41 (m, 2H); 6.49 (s, 1H); 6.17 (dd, J=1.8 Hz, J=6.0Hz, 1H); 5.51 (d, J=4.6 Hz, 1H); 4.67-4.56 (m, 1H); 4.50 (q, J=14.8 Hz, 2H); 4.47-4.34(m, 2H); 4.27 (d, J=10.8 Hz, 1H); 4.00 (ddd, J=3.6 Hz, 1H); 3.88-3.84 (m, 12H); 3.80 (s,3H); 3.70 (s, 3H); 3.69-3.64 (m, 2H); 3.62-3.51 (m, 11H); 3.50-3.40 (m, 2H); 2.68 (s, 3H); 2.69-2.46 (m, 2H); 2.43 (s, 3H); 2.33-1.93 (m, 6H); 1.82-1.73 (m, 1H); 1.72-1.64 (m, 1H);1.70 (s, 3H); 1.05 (t, J=7.4 Hz, 3H); 0.90 (t, J=7.2 Hz, 3H).C67H84ClN6O15S, expected for [M+H]+1279.54, found [M+H]+1279.6. Synthesis of HDPIC and HDPIC-Neg: Tert-butyl (18-chloro-3,6,9,12-tetraoxaoctadecyl)carbamate (15) 55479585-1 To a solution of tert-butyl (2-(2-(2-(2-hydroxyethoxy)ethoxy)ethoxy)ethyl)carbamate 14(1.46 g, 5.0 mmol) in anhydrous DMF (20 mL) was added sodium hydride 60% in mineraloil (0.24g, 6.0 mmol) at 0 °C and the mixture was stirred at 0 °C for 1 h followed byaddition of a solution of 1-chloro-6-iodohexane (1.35 g, 5.5 mmol) in anhydrous DMF (5mL). Reaction mixture was stirred at RT for overnight, diluted with water (25 mL) andextracted with EtOAc (50 mL). Organic layer washed with brine (20 mL) andconcentrated. The crude residue was purified by column chromatography on silica (80g), gradient from petroleum spirit to 100% EtOAc to yield 15 (0.75 g, 1.82 mmol, 35%).1H NMR (400 MHz, CDCl3) δ = 5.04 (bs, 1H), 3.70-3.63 (m, 10 H); 3.62-3.58 (m, 2H), 3.58-3.52 (m, 4H); 3.48 (t, 2H), 3.33 (q, 2H); 1.84-1.75 (m, 2H), 1.65-1.57(m, 4H), 1.47(s, 9H); 1.44-1.36 (m, 2H).C19H38ClNO6, expected for [M+H]+412.25, found [M−Boc+H]+312. 18-Chloro-3,6,9,12-tetraoxaoctadecan-1-amine hydrochloride (16)To a solution of 15 (0.75 g, 1.82 mmol) in a mixture of DCM:MeOH 9:1 (10 mL) wasadded 4 M solution of HCl in dioxane (1.82 mL, 7.28 mmol) and the mixture was stirredat RT for 16 h. The reaction mixture was concentrated, crude residue of 16 (0.63 g,1.80 mmol, 99%) as HCl salt used into next step without further purification.1H NMR (400 MHz, MeOD-d4) δ = 3.74 (t, J=5.06 Hz, 2H), 3.72-3.63 (m, 10 H); 3.63-3.59 (m, 2H), 3.57 (t, J=6.5 Hz, 2H); 3.51 (t, J=6.5 Hz,2H), 3.14 (t, J=5.06 Hz, 2H); 1.83-1.75 (m, 2H), 1.65-1.57(m, 2H), 1.54-1.38 (m, 4H).C14H30ClNO4, expected for [M+H]+312.19, found [M+H]+312. 55479585-1 (R)-1-(2-((21-Chloro-2-oxo-6,9,12,15-tetraoxa-3-azahenicosyl)oxy)phenyl) 3-(3,4- dimethoxyphenyl)propyl (S)-1-((S)-2-(3,4,5-trimethoxyphenyl)butanoyl)piperidine-2-carboxylate 17 (HDPIC)To a solution of acid ortho-AP1867 (0.08 g, 0.115 mmol) in DCM (5 mL) were added 16 (0.044g, 0.126 mmol), DIPEA (0.1 mL, 0.575 mmol) followed by addition of HATU (0.065g, 0.172 mmol) at RT. The reaction mixture was stirred at RT for 16 h and concentrated.The crude residue was purified by column chromatography on silica (16 g), gradient fromDCM to 100% EtOAc, then to 20% of MeOH in EtOAc. Thus obtained crude material(0.09 g) was further purified on HPLC RP C18 column with gradient MeCN / H2O (5% to95%) to give 17 (HDPIC) (0.084 g, 0.085 mmol, 73%) as amorphous solid.1H NMR (500 MHz, CDCl3, mixture of rotamers, only peaks of the major rotamer arereported): δ = 7.40 (t, J=5.5 Hz, 1H); 7.22 (dt, J=1.5 Hz, J=7.8 Hz, 1H); 7.19-7.15 (m,1H); 7.09-7.06 (m, 1H); 6.91-6.87 (m, 1H); 6.84-6.77 (m, 2H); 6.73-6.66 (m, 1H); 6.69 (s,1H); 6.49 (s, 1H); 6.51-6.42 (m, 1H); 6.41-6.32 (m, 1H); 6.17 (t, J=6.8 Hz, 1H); 5.51(d,55479585-1J=4.4 Hz, 1H); 4.66-4.44 (m, 3H); 3.90-3.85 (m, 12H); 3.80 (s, 2H); 3.71 (s, 3H); 3.64-3.52 (m, 20H); 3.46 (t, J=6.5 Hz, 2H); 2.71-2.44 (m, 3H); 2.32-1.93 (m, 4H); 1.83-1.75(m, 2H); 1.64-1.55 (m, 2H); 1.50-1.34 (m, 4H); 0.90 (t, J=7.2 Hz, 3H).C52H75ClN2O14, expected for [M+H]+987.50, found [M+H]+988, 989. Tert-butyl (2,2-dimethyl-3,3-diphenyl-4,11,14,17,20-pentaoxa-3-siladocosan-22- yl)carbamate (18) To a solution of tert-butyl (2-(2-(2-(2-hydroxyethoxy)ethoxy)ethoxy)ethyl)carbamate 14(0.89 g, 3.05 mmol) in anhydrous DMF (15 mL) was added sodium hydride 60% inmineral oil (0.146 g, 3.66 mmol) at 0 °C and the mixture was stirred at 0 °C for 1 hfollowed by addition of a solution of ((6-bromohexyl)oxy)(tert-butyl)diphenylsilane(1.27 g, 3.05 mmol) in anhydrous DMF (3 mL). Reaction mixture was stirred at RT forovernight, diluted with water (20 mL) and extracted with EtOAc (50 mL). Organic layerwashed with brine (20 mL) and concentrated. The crude residue was purified by columnchromatography on silica (80 g), gradient from petroleum spirit to 50% EtOAc inpetroleum spirit to yield 18 (0.85 g, 1.34 mmol, 44%).1H NMR (500 MHz, CDCl3) δ = 7.68 (d, J=7.7 Hz,4H); 7.46-7.37 (m, 6H); 5.09 (bs, 1H);3.69-3.58 (m, 14 H); 3.56 (t, J=5.0 Hz, 2H); 3.45 (t, J=6.8 Hz, 2H); 3.33 (q, 2H); 1.64-1.54 (m, 4H); 1.46 (s, 9H); 1.42-1.27 (m, 4H); 1.06 (s, 9H).C35H57NO7Si, expected for [M+Na]+654.38, found [M+Na]+654.4. 55479585-1 Tert-butyl (18-hydroxy-3,6,9,12-tetraoxaoctadecyl)carbamate (19)To a solution of 18 (0.85 g, 1.34 mmol) in THF (5 mL) was added 1 M solution of TBAFin THF (1.47 mL, 1.47 mmol) at 0 °C and the mixture was stirred at RT for overnight.Water (5 mL) was added and extracted with EtOAc twice, organic layer washed withbrine and concentrated. The crude residue was purified by column chromatography onsilica (40 g), gradient from DCM to 10% MeOH in DCM gave 19 (0.38 g, 0.965 mmol,72%).1H NMR (500 MHz, CDCl3) δ = 5.15 (bs, 1H); 3.70-3.59 (m, 14 H); 3.56 (t, J=5.0 Hz, 2H);3.48 (t, J=6.6 Hz, 2H); 3.33 (q, 2H); 1.64-1.56 (m, 4H); 1.46 (s, 9H); 1.42-1.38 (m, 4H).C19H39NO7, expected for [M+H]+394.28, found [M-Boc+H]+294.3. Tert-butyl (18-fluoro-3,6,9,12-tetraoxaoctadecyl)carbamate (20)To a solution of diethylaminosulfur trifluoride (DAST) (0.089 g, 0.072 mL, 0.552 mmol) inDCM (0.5 mL) was added a solution of 19 (0.087 g, 0.221 mmol) in DCM (1 mL) at -70 °C. The mixture was stirred for 12 h at room temperature, quenched with saturatedNaHCO3 (2 mL) and extracted with DCM (10 mL). The organic layer washed with brine55479585-1and concentrated. The crude residue was purified by column chromatography on silica(12 g), gradient from DCM to 10% MeOH in DCM gave 20 (0.055 g, 0.139 mmol, 62%).1H NMR (500 MHz, CDCl3) δ = 5.09 (bs, 1H); 4.45 (dt, J=6.2 Hz, J=47.4 Hz, 2H); 3.71-3.58 (m, 10 H); 3.56 (t, J=5.0 Hz, 2H); 3.48 (t, J=6.6 Hz, 2H); 3.33 (m, 2H); 3.23 (m, 2H);1.65-1.58 (m, 4H); 1.46 (s, 9H); 1.43-1.39 (m, 4H).19F NMR: δ = −218.1. C19H38FNO6, expected for [M+H]+396.28, found [M-Boc+H]+296.3. 18-Fluoro-3,6,9,12-tetraoxaoctadecan-1-amine (21)To a solution of 20 (0.053 g, 0.134 mmol) in DCM (2 mL) was added TFA (0.5 mL) at RTand reaction mixture was stirred at RT for 2 h, concentrated and crude residue of 21(0.050 g, 0.122 mmol) as a TFA salt used into next step without further purification.1H NMR (500 MHz, CDCl3) δ = 7.69 (bs, 2H); 4.46 (dt, J=6.2 Hz, J=47.4 Hz, 2H); 3.90-3.50 (m, 16 H); 3.21-3.14 (m, 2H); 1.65-1.38 (m, 8H).19F NMR: δ = −75.1, −76.0.C14H30FNO4, expected for [M+H]+296.22, found [M+H]+296.2. 55479585-1 (R)-3-(3,4-Dimethoxyphenyl)-1-(2-((21-fluoro-2-oxo-6,9,12,15-tetraoxa-3- azahenicosyl)oxy)phenyl)propyl-(S)-1-((S)-2-(3,4,5trimethoxyphenyl)butanoyl)piperidine-2-carboxylate 22 (HDPIC-Neg)To a solution of acid ortho-AP1867 (0.018 g, 0.0259 mmol) in DCM (0.5 mL) were added21 (0.05 g, 0.122 mmol), DIPEA (0.05 mL, 0.259 mmol) followed by addition of HATU(0.015 g, 0.039 mmol) at RT. The reaction mixture was stirred at RT for 16 h andconcentrated. The crude residue was purified by column chromatography on silica (12 g),gradient from Petroleum spirit :DCM (4:1) to 10% MeOH in Petroleum spirit : DCM (4:1).Thus obtained crude material (0.02 g) was further purified on HPLC RP C18 column withgradient MeCN / H2O (5% to 95%) to give 22 (HDPIC-Neg) (0.012 g, 0.0122 mmol, 47%)as oil.1H NMR (500 MHz, CDCl3, mixture of rotamers, only peaks of the major rotamer arereported): δ = 7.40 (t, J=5.5 Hz, 1H); 7.38-7.24 (m, 1H); 7.24-7.18 (m, 1H); 7.10-7.01 (m,1H); 6.88 (t, J=7.2 Hz, 1H); 6.86-6.76 (m, 1H); 6.73-6.66 (m, 1H); 6.69 (s, 1H); 6.49 (s,55479585-11H); 6.44-6.25 (m,2H); 6.16 (t, J=6.6 Hz, 1H); 5.51(d, J=4.4 Hz, 1H); 4.67-4.51 (m, 4H);4.45 (dt, J=6.2 Hz, J=47.4 Hz, 2H); 3.90-3.85 (m, 12H); 3.80 (s, 3H); 3.70 (s, 3H); 3.64-3.52 (m, 20H); 3.46 (t, J=6.5 Hz, 2H); 2.68-2.43 (m, 3H); 2.32-1.93 (m, 4H); 1.83-1.75(m, 2H); 1.45-1.38 (m, 2H); 1.34-1.18 (m, 2H); 0.90 (t, J=7.2 Hz, 3H).19F NMR: δ = −218.13.C52H75FN2O14, expected for [M+H]+971.53, found [M+H]+971.5. Synthesis of PhosTAC7:Synthesised as previously reported (Chen et al., ACS Chem. Biol., 2021, 16, 2808), witha yield of 24%. 55479585-1
Claims
CLAIMS:
1. A proximity-inducing compound, for inducing proximity between two biologicalmolecules such that the biological molecules are able to interact, wherein the proximity-inducing compound corresponds to formula (Ia):(Ia) wherein: is a first ligand capable of binding to a biological molecule with a hole-modified Brd bromodomain; is a second ligand capable of binding to a biological molecule with anFKBP; and L1is a linker.
2. The proximity-inducing compound of claim 1, wherein the hole-modified Brdbromodomain is a Brd4BD2L387A, Brd4BD2L387V, Brd4BD1L94A, Brd4BD1L94V, Brd2BD2L383A, Brd2BD2L383V, Brd2BD1L110A, Brd2BD1L110V, Brd3BD2L344A, Brd3BD2L344V, Brd3BD1L70A, Brd3BD1L70V, BrdTBD2L306A, BrdTBD2L306V, BrdTBD1L63A, or BrdTBD1L63Vbromodomain.
3. The proximity-inducing compound of claim 1 or 2, wherein the FKPB isFKBP12F36V.
4. The proximity-inducing compound of any one preceding claim, wherein L1 is offormula (IIIa):wherein w is an integer from 1 to 10; each L2 is independently selected from the groupconsisting of C(O)NH, C(O)O, CH2CH2O, CH2, ethynylene, triazolylene, piperazinylene,and piperidinylene; and wherein ⌇ indicates the positions of attachment.55479585-15. The proximity-inducing compound of claim 1, wherein the proximity-inducingcompound is of formula (Ib):wherein X is halo; each R1, R4, and R6are independently selected from the group consisting of C1-6alkyl, C1-6haloalkyl, C1-6alkoxy, halo, and hydroxy; G1is a 5-membered heteroarene, optionally substituted with one or two substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy,halo, hydroxy and amino, or G1 is a 6-membered arene or heteroarene, optionallysubstituted with methyl, halo, hydroxy and thiol;G2is a 5-membered N-heteroarene selected from the group consisting of pyrrolidine, pyrrole, imidazolidine, pyrazole, imidazole, triazole, and tetrazole, optionally substituted with one or more substituents selected from the group consisting of C1-3alkyl, C1-3haloalkyl, C1-3alkoxy, halo, hydroxy and amino; R2is H, C1-3alkyl, C1-3haloakyl, or halo; R3is C1-4alkyl or C1-4haloalkyl; B1and B2are independently of formula (IIa): ⌇–(A2)a–(CH2)b–(A3)c–(C(O))d–(CH2)e–(A4)f–(CH2)g–⌇ (IIa) wherein A2, A3, and A4are independently selected from the group consisting of NH, NC1-4alkyl, O, and S; a, c, d, and f are integers independently selected from 0 and 55479585-11; b, e, and g are integers independently selected from 0 to 4; and wherein ⌇ indicatesthe positions of attachment;L3is a linker; A1is selected from the group consisting of O, NH, and NC1-4alkyl; h is an integer selected from 0 or 1; R5 is C1-4alkyl or C1-4haloalkyl; andn-i, n-ii, and n-iii are integers independently selected from 0 to 3.
6. The proximity-inducing compound of claim 5, wherein L3 is of formula (IIIb):⌇–(L4)s–⌇ (IIIb) wherein s is an integer from 0 to 4; each L4is independently selected from the group consisting of CH2CH2O, CH2, ethynylene, triazolylene, piperazinylene, andpiperidinylene; and wherein ⌇ indicates the positions of attachment.
7. The proximity-inducing compound of claim 5 or 6, wherein B1 is selected fromany one of formula (IIb) to (IIe):wherein p is an integer from 0 to 4; and the wavy lines indicate the positions of attachment.
8. The proximity-inducing compound of claim 7, wherein B1 is of formula (IIb) or (IIc);and p is 0.
9. The proximity-inducing compound of any one preceding claim, wherein B2 is offormula (IIf) or (IIg):55479585-1wherein A5 is O or NH; A6 is O, NH, or S; m and q are integers independently selectedfrom 0 to 4; and the wavy lines indicate the positions of attachment.
10. The proximity-inducing compound of claim 9, wherein B2 is of formula (IIf); A5 isNH; A6is O; m is 2; and q is 1.
11. The proximity-inducing compound of any one of claims 5, and 7 to 10, whereinL3is of formula (IIIc):wherein t is an integer selected from 1 to 10; and the wavy lines indicate the positions ofattachment.
12. The proximity-inducing compound of claim 11, wherein t of formula (IIIc) isselected from 1, 2, 3, 4, 5, 6, and 7.
13. The proximity-inducing compound of claim 11, wherein t of formula (IIIc) is 3.
14. The proximity-inducing compound of any one of claims 5-13, wherein R4 isC1-6alkoxy; R5is C1-4alkyl; and R6is C1-6alkoxy.
15. The proximity-inducing compound of any one of claims 5-14, wherein h is 1; A1is O; R4is methoxy; R5is ethyl; R6is methoxy; n-ii is 2; and n-iii is 3.
16. The proximity-inducing compound of any one of claims 5-15, wherein n-i is 0.55479585-117. The proximity-inducing compound of any one of claims 5-16, wherein R2 is H;and R3is C1-4alkyl.
18. The proximity-inducing compound of any one of claims 5-17, wherein G1 isthiophene, substituted twice with methyl; G2 is triazole, substituted once with methyl; Xis chloro; and R3is ethyl.
19. The proximity-inducing compound of claim 1, wherein the proximity-inducingcompound is of the formula (IVa):wherein B1, L3, and B2are independently as defined in any one preceding claim.
20. The proximity-inducing compound of claim 1, wherein the proximity-inducingcompound is of the formula (IVb): 55479585-121. A method of inducing proximity between two biological molecules, the methodcomprising: contacting a first biological molecule and a second biological molecule with the proximity inducing-compound of any one preceding claim such that a ternary complex is formed, thereby inducing proximity between the two biological molecules such that they are able to interact; and optionally: detecting the formation of the ternary complex; and / or detecting the interaction, or lack thereof, between the two biological molecules;wherein: the first biological molecule comprises a hole modified Brd bromodomain; and the second biological molecule comprises an FKBP.
22. The method of claim 21, wherein the detecting the formation, and / or the detectingthe interaction or lack thereof, is carried out by one or more methods selected from thegroup consisting of immunoprecipitation, Western blotting, and mass spectrometry.
23. The method of claims 21 or 22, wherein the interaction is a post-translationalmodification.
24. The method of any one of claims 21 to 23, wherein:55479585-1the first biological molecule is a tagged protein comprising a hole-modified Brdbromodomain as defined in claim 2; andthe second biological molecule is a tagged protein comprising an FKBP as defined inclaim 3.
25. The method of claim 24, wherein the tagged protein comprising a hole-modifiedBrd bromodomain is a phosphatase.55479585-1
Citation Information
Patent Citations
Compositions and methods for labeling and detecting binding partners
WO2024030455A2
Protein degrader
WO2023047121A1