Methods and agents for treating genetic diseases

The ReMax CRISPR-based approach addresses inefficiencies in DMD gene therapy by using dual endonuclease complexes for targeted genomic cuts, achieving effective exon skipping and dystrophin restoration for long-term treatment.

WO2025171435A1PCT designated stage Publication Date: 2025-08-21UNIVERSITY OF ADELAIDE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/AU2025/050109
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-03
Filing Date
2025-02-12
Publication Date
2025-08-21

AI Technical Summary

Technical Problem

Current gene therapy approaches for Duchenne muscular dystrophy (DMD) are inefficient and require frequent administration, and CRISPR-based methods face challenges such as species incompatibility, low reframing activity, and suboptimal humanized mouse models, limiting their effectiveness.

Method used

A novel CRISPR-based approach, ReMax, uses dual endonuclease complexes to make targeted double-strand cuts in specific genomic sites, creating deletions and insertion-deletion mutations to reframe frameshift-causing mutations in the DMD gene, potentially providing long-lasting treatment.

Benefits of technology

ReMax achieves high exon skipping efficiency and reframing indel generation, restoring dystrophin production and delaying disease onset, with potential for lifelong treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000029_0001
    Figure IMGF000029_0001
  • Figure IMGF000032_0001
    Figure IMGF000032_0001
  • Figure IMGF000033_0001
    Figure IMGF000033_0001
Patent Text Reader

Abstract

Novel gene editing based approaches for treating genetic diseases are disclosed. In one approach, an agent for treating a genetic disease such as Duchenne muscular dystrophy (DMD) is used to achieve reframing of a target gene in an approach referred to as ReMax ("Reframing to the Maximum"). In a second approach, an agent for treating a genetic disease such as a disease caused by a dominant gain-of-function or dominant-negative mutation(s) (e.g. certain forms of autosomal dominant retinitis pigmentosa (adRP)) is used in a strategy referred to as "Prime Chop or Change" (PCOC) to achieve the insertion of specific (correct) gene edits or inactivation of mutant alleles by the generation of inactivating mutations.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND AGENTS FOR TREATING GENETIC DISEASES TECHNICAL FIELD

[0001] The present specification to gene editing based approaches for treating genetic diseases. More particularly, the specification provides a first disclosure of an agent for treating a genetic disease such as Duchenne muscular dystrophy (DMD) by a novel gene editing-based reframing approach referred to herein as ReMax ("Reframing to the Maximum"). Then, in a second disclosure, the specification discloses an agent for treating a genetic disease such as a disease caused by a dominant gain-of- function or dominant-negative mutation(s) (e.g. certain forms of autosomal dominant retinitis pigmentosa (adRP)) in a novel strategy termed "Prime Chop or Change" (PCOC) which enables the insertion of specific (correct) gene edits or inactivation of mutant alleles by the generation of inactivating mutations. PRIORITY DOCUMENT(S)

[0002] The present application claims priority from Australian Provisional Patent Application No. 2024900324 titled "METHOD AND AGENT FOR TREATING MONOGENIC DISEASE" and filed on 12 February 2024, as well as Australian Provisional Patent Application No.2024902054 titled "AGENT FOR TREATING OR PREVENTING A GENETIC DISEASE" and filed on 3 July 2024. The content of these two applications is hereby incorporated by reference in their entirety. FIRST DISCLOSURE: GENE EDITING-BASED REFRAMING FOR TREATING GENETIC DISEASES SUCH AS DMD BACKGROUND

[0003] Duchenne muscular dystrophy (DMD) is a progressive and devastating muscle-wasting genetic disease affecting about one (1) in every 5000 boys with no effective treatment or cure. Typically, DMD patients will experience loss of ambulation by age 13 and are likely to die by the age of 20-40 years due to cardiomyopathy (Duan D et al., Nat Rev Dis Primers 7(1):13, 2021; and Schneider AE et al., Expert Opin Bio Ther 21(3):343-359, 2021). The disease is caused by mutations in the X-linked DMD gene which codes for the dystrophin protein; a cytoplasmic protein that forms an essential component of a protein complex (known as the dystrophin-associated protein complex (DAPC)) that supports muscle strength by connecting the cytoskeleton of a muscle fibre to surrounding extracellular matrix (ECM) through the cell membrane. Most of the known mutations are exon frameshifting deletions that disrupt the reading frame and introduce a premature termination codon (PTC), resulting in the expression of truncated non-functional dystrophin.

[0004] The DMD gene is large (nb. cDNA encoding dystrophin is >13 kb), which has significantly hampered the development of gene therapy using "traditional" gene supplementation approaches (Blankinship MJ et al., Mol Ther 13(2):241-249, 2006; and Gregorevic P et al., Nat Med 12(7):787- 789, 2006). Interestingly, individuals who carry DMD exon deletions that do not cause a frameshift (ie in-frame mutations), and produce instead, an internally truncated dystrophin protein develop only mild symptoms as seen in Becker Muscular Dystrophy (BMD) patients. Therefore, an attractive potential therapeutic approach for treating DMD is to reframe the frameshift by targeted exon skipping (Duan et al., 2021 supra; and Schneider et al., 2021 supra), and to this end, a number of different antisense oligonucleotide (ASO) drugs have been developed and conditionally approved by the US Food and Drug Administration (FDA) for DMD treatment, that do indeed work by this exon reframing principle. In particular, these ASOs target the primary DMD RNA transcript (ie the DMD pre mRNA) to skip exon-45, exon-51 or exon-53 and, in theory, could be of benefit to about 33% of DMD patients (Duan et al., 2021 supra; and Schneider et al., 2021 supra; and Bladen CL et al., Hum Mutat 36(4):395-402, 2015). However, their efficacy has proven to be limited and require weekly systemic administration for the lifetime of the patient. Therefore, the identification and development of an alternative approach, that may be more effective and potentially long lasting, is greatly sought after.

[0005] Of interest to the present Applicant is the potential use of genome editing technology, such as CRISPR, in an alternative approach to a reading frame-restoring therapy for DMD.

[0006] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) methodologies are recognised as offering enormous potential for the treatment of genetic diseases. Indeed, clinical trials using CRISPR methodologies have recently commenced for a range of different diseases including sickle cell disease and hereditary transthyretin amyloidosis (hATTR)( https: / / innovativegenomics.org / news / crispr-clinical-trials-2021 / ). CRISPR comprises two main molecular components, namely a CRISPR-associated (Cas) endonuclease and a guide RNA (gRNA) that specifies a target site and which forms, with the Cas enzyme, a CRISPR-Cas ribonucleoprotein complex which functions as a pair of molecular scissors to create a DNA double-stranded cut (break) at a specific target site in the genome. Typically, these cuts are repaired by the end joining DNA repair machinery resulting in predictable and non-random insertion-deletion ("indel") mutations of varying sizes (Shen MW et al., Nature 563(7733):6446-651, 2018; and van Overbeek M et al., Mol Cell 63(4):633-646, 2016). It is also known that CRISPR can be adapted to generate "dual cuts" by employing two distinct gRNAs targeted to genomic sites close to each other in order to create large intervening deletions (Adikusuma F et al., PLoS One 12(12):p.e0187236, 2017a; and Adikusuma F et al., Mol Therap 25(8):1736-1738, 2017b). However, creating specific edits such as knocking-in large fragments is still a relatively difficult task using CRISPR since it relies on the homology-directed repair mechanism (HDR) which is generally inefficient (Adikusuma F et al., Genetics 206(3):1495-1503, 2017c); and Anzalone AV et al., Nature 576(7785):149-157, 2019).

[0007] The potential capability of CRISPR for efficiently reframing causative DNA mutations via upstream indel generation or targeted reframing exon deletion (ie exon skipping by a large intervening deletion) is an attractive approach for DMD therapy, and encouragingly, studies in animal models have shown promising results using CRISPR to reframe DMD mutations to treat DMD (see, for example, Nelson CE et al., Science 351(6271):403-407, 2016; Amoasii L et al., Sci Transl Med 9(418), 2017; and Amoasii L et al., Science 362(6410):86-91, 2018). However, there are several key limitations to these studies. First, most of the gRNAs targeted animal sequences and are not compatible with therapy in humans due to species differences in the DMD gene sequence (see, for example, Min YL et al., Mol Therap 28(9):2044-2055, 2020). Secondly, when humanised mouse models were used, the strategy was not optimal and showed a low level of reframing activity (Duchene BL et al., Mol Therap 26(11):2604-2616, 2018; and Young CS et al., Neuromuscul Dis 4(2):139-145, 2017). Thirdly, the humanised mouse model used for these studies is less than ideal as it contains two copies of the hDMD transgene duplicated in a tail-to-tail orientation (Yavas A et al., PLoS One 13(2):p.e0193289, 2020). This could affect the efficacy results of gene editing since the number of required cuts is doubled and could change the repair outcomes. For example, when a CRISPR single cut or dual cut approach is used, this duplication of the gene (in the same allele) will result in two or four cuts occurring, respectively.

[0008] The Applicant has now identified a novel approach to CRISPR-based reframing that shows considerable promise for gene editing therapies of monogenic diseases such as DMD and other genetic diseases amenable to exon reframing. SUMMARY

[0009] The first disclosure provides, in a first aspect, an agent for treating a genetic disease, preferably a monogenic disease, in a subject, wherein said agent comprises: a first endonuclease or endonuclease complex, or one or more polynucleotide molecule comprising a nucleotide sequence(s) enabling the expression or production of said first endonuclease or endonuclease complex within a cell, wherein the first endonuclease or endonuclease complex is targeted to a gene at a suitable first site positioned within a target exon , or a splice acceptor region, splice donor region or intron core of an adjacent intron of said exon; and a second endonuclease or endonuclease complex, or one or more polynucleotide molecule comprising a nucleotide sequence(s) enabling the expression or production of said second endonuclease or endonuclease complex within a cell, wherein the second endonuclease or endonuclease complex is targeted to said gene at a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon) or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonucleasecomplex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon; such that, following delivery of the agent to a suitable cell of said subject, one or both of the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA of said cell at the first and second sites thereby creating a first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site- disrupting insertion-deletion ("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift-causing mutation associated with the said genetic disease.

[0010] In accordance with particular embodiments, the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA as follows: "Dual cut Splice-Splice" At a first site located within the splice acceptor region of the target exon and at a second site within the splice donor region of said exon. "Dual cut Splice-Exon" At a first site located within the target exon and at a second site within the splice donor region, or at a first site located within the splice acceptor region of said exon and at a second site within the said exon. "Dual cut Splice-Intron" At a first site located within the intron core of the adjacent intron upstream of the target exon and at a second site within the splice acceptor region of said exon, or at a first site located within the splice acceptor region of said exon and at a second site within the intron core of the adjacent intron downstream of said exon, or at a first site located within the intron core of the adjacent intron upstream of said the target exon and at a second site within the splice donor region of said exon, or at a first site located within the splice donor region of said exon and at a second site within the intron core of the adjacent intron downstream of said exon. "Dual cut Exon-Intron" At a first site located within the intron core of the adjacent intron upstream of the target exon and at a second site within the said exon, or the first endonuclease, or at a first site located within the said the target exon and at a second site within the intron core of the adjacent intron downstream of said exon.

[0011] In some embodiments, the frameshift-causing mutation associated with the said genetic disease, is, for example, a frameshift-causing deletion or insertion (eg an exon deletion) which creates a premature termination codon (PTC) in said target exon or in a nearby downstream exon.

[0012] The endonucleases or endonuclease complexes of said agent may be selected from, for example, those suitable for gene editing; for example, gene editing systems such as CRISPR complexes (ie a CRISPR-Cas endonuclease complexes), transcription activator-like effector nucleases (TALEN) and zinc-finger nucleases (ZFN).

[0013] In a particular embodiment, the disclosure provides an agent for treating a genetic disease, preferably a monogenic disease such as DMD, in a subject, wherein said agent comprises: at least one polynucleotide molecule comprising: (i) a first nucleotide sequence encoding or comprising a first guide RNA (gRNA) targeted to a gene at a suitable first site positioned within a target exon, or a splice acceptor region, splice donor region or intron core of an adjacent intron of said exon, said first gRNA capable of forming a first CRISPR- Cas complex (ie. an endonuclease complex) with a suitable CRISPR-associated (Cas) endonuclease, and wherein, where the first nucleotide sequence encodes the first gRNA, the first nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said first gRNA; and (ii) a second nucleotide sequence encoding or comprising a second guide RNA (gRNA) targeted to said gene at a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon) or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon, said second gRNA capable of forming a second CRISPR-Cas complex (an endonuclease complex) with a suitable Cas endonuclease, which may be the same or different to the said Cas endonuclease with which the first gRNA is capable of forming a CRISPR-Cas complex, and wherein, where the second nucleotide sequence encodes the second gRNA, the second nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said second gRNA; and one or more Cas endonuclease with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, or one or more nucleotide sequence encoding the Cas endonuclease(s) operably linked to a promoter and / or regulatory sequence(s) for expression of the Cas endonuclease(s), such that, upon delivery of the agent to a suitable cell of said subject, the first and second CRISPR-Cas complexes are formed from the Cas endonuclease(s) and the first and second gRNAs and one or both of the formed CRISPR-Cas complexes make double-stranded cuts in the genomic DNA at the first and second sites thereby creating a first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site-disrupting insertion-deletion("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift- causing mutation associated with the said genetic disease.

[0014] The agent may comprise one or two (or more) polynucleotide molecules such as expression vectors / constructs and / or viral vectors suitable for delivery to the subject, such that the first and second nucleotide sequences (and, if present, the one or more nucleotide sequence(s) encoding the Cas endonuclease(s)) may be provided on the same or different polynucleotide molecules (eg all of the nucleotide sequences may be provided on one vector / construct, or two of the nucleotides sequences may be provided on one vector / construct and another / other nucleotide sequence(s) provided on another vector / construct, or all nucleotide sequences may be provided on different vectors / constructs).

[0015] In some embodiments, the agent for treating DMD comprises one or two vectors / constructs (eg two viral vectors) suitable for delivery to the subject (eg particularly to a cell of the subject which expresses dystrophin such as myotubes and myoblasts). In one particular embodiment, the first and second nucleotide sequences are provided on a first vector ("vector 1") each operably linked to a suitable promoter sequence (eg a strong constitutive promoter sequence such as a polymerase III promoter such as the well-known human U6 promoter sequence, H1 promoter sequence, 7SK promoter sequence or SV40 promoter sequence) for the production of the first and second gRNAs, and a nucleotide sequence encoding a suitable Cas endonuclease is provided on a second vector ("vector 2") operably linked to a suitable promoter sequence (eg a strong constitutive promoter sequence such as a polymerase II promoter such as the well-known cytomegalovirus (CMV) promoter sequence or a muscle-specific promoter sequence such as that designated Ck8e (muscle creatine kinase 8 promoter) described in Amoasii et al., 2017 supra), or any one of the MHCK7, CbH, CAG and U1A promoter sequences) to drive expression of the Cas endonuclease. The promoter sequences for the production of the first and second gRNA may be the same; for example, in one particular embodiment, the first and second nucleotides sequences may both be operably linked to a human U6 promoter sequence such that vector 1 comprises two "U6-gRNA cassettes".

[0016] The agent may be prepared for delivery to the subject in the form of a viral delivery vector or virus-like particles (VLPs) including engineered virus-like particles (eVLPs), or in other forms well- known to those skilled in the art, such as non-viral vector systems including liposomes, lipid nanoparticles (LNPs), delivery forms incorporating a cell-penetrating peptide (CPP), nanoparticles composed of polymeric or other organic materials, and nanoparticles composed of gold (auNPs), silica and / or other inert inorganic materials.

[0017] In a second aspect, the first disclosure provides a pharmaceutical composition comprising an agent according to the first aspect in combination with a pharmaceutically acceptable carrier, diluent and / or excipient.

[0018] In a third aspect, the first disclosure provides a method for treating a subject afflicted with, or predisposed to, a genetic disease, wherein the method comprises administering the agent of the first aspect or a pharmaceutical composition of the second aspect to the said subject.

[0019] Where the method is applied for treating DMD, then preferably, the method is commenced upon diagnosis, disease onset and / or the appearance of DMD symptoms, typically during childhood, and may be continued for the remainder of the subject's life. In some embodiments, the method is commenced during infancy or early childhood (eg before about 8 years of age) such as, for example, before disease onset and / or the appearance of DMD symptoms, the child subject having been genotyped for the presence of a DMD causative mutation in the DMD gene. Such early commencement of the method may prevent or delay disease onset or the appearance of symptoms.

[0020] In a fourth aspect, the first disclosure provides the use of the agent of the first aspect for treating or preventing a genetic disease.

[0021] In a fifth aspect, the first disclosure provides the use of the agent of the first aspect in the manufacture of a medicament (eg a pharmaceutical composition) for treating or preventing a genetic disease. BRIEF DESCRIPTION OF THE FIGURES

[0022] Figure 1 provides a schematic diagram showing different CRISPR-based reframing approaches for gene editing therapy of DMD. A four exon part of the wild type (WT) dystrophin gene is illustrated against a DMD-causing mutant form of the gene wherein exon B has been deleted ("delEx-B") leading to a premature termination codon (PTC) in exon C and a consequent truncated and non-functional dystrophin protein. Two conceivable reframing approaches involve deleting exon C or generating reframing indels to remove the PTC in exon C are depicted;

[0023] Figure 2 provides a schematic diagram showing "traditional" approaches and "ReMax" approaches (ie novel CRISPR-based approaches according to the first disclosure) to potential CRISPR-based DMD therapy. Those provided with a circled number (eg ①) denote the approaches described and tested in Example 1 hereinafter, and for which results are shown in Figure 3;

[0024] Figure 3 provides the results of experimentation (RT-PCR of cDNA) to determine the level of exon-53 skipping in myotubes (expressing dystrophin) produced from C2C12 mouse myoblasts transfected with various CRISPR constructs (described in Example 1) for "traditional" and ReMax approaches to potential CRISPR-based DMD therapy. Lane 1 (ie ①) shows the result with a traditional single cut approach using the gRNA designated mDmd-53A targeting the splice acceptoradjacent to exon-53, lane 2 shows the result achieved with a traditional single cut approach using mDmd-53F targeting the splice donor adjacent to exon-53, lane 3 shows the result achieved with a traditional approach producing cuts in introns either side of exon-53 (using the gRNAs designated mDmd-int52F and mDmd-int53B, lane 4 shows the result achieved with a ReMax Splice-Splice approach (gRNAs: mDmd-53A + mDmd-53F), lane 5 shows the result achieved with a ReMax Splice- Exon approach (gRNAs: mDmd-53E + mDmd-53F), lane 6 shows the result achieved with a ReMax Splice-Intron approach (gRNAs: mDmd-int52F + mDmd-53A), lane 7 shows the result achieved with another ReMax Splice-Intron approach (gRNAs: mDmd-int52F + mDmd-53F), and lane 8 shows the result achieved with a ReMax Exon-Intron approach (gRNAs: mDmd-53E + mDmd-int53B). The ReMax Splice-Splice and ReMax Splice-Exon approaches produced nearly complete exon skipping. For the ReMax Exon-Intron approach, an exon skipping efficiency of 75% was observed, but significantly, where exon-53 was not skipped ("unskipped"), the unskipped RT-PCR band contained a high frequency (49%) of potentially reframing indels;

[0025] Figure 4 (A) provides graphical results showing the editing efficiencies of gRNAs targeting sequences located in the exon, intron core or splice regions of human DMD exon-53 in the human HEK293T cell line, as analysed by Sanger and ICE analysis; and (B) graphically shows the editing efficiencies and the frequency of the generation of reframing indels of a number of the same gRNAs targeting sequences associated with human DMD exon-53. Again, the experiment was conducted in human HEK293T cell line, but this time, as analysed by Next Generation Sequencing (NGS);

[0026] Figure 5 provides results achieved with a ReMax Splice-Exon approach to achieve skipping and / or reframing of exon-53 of the DMD gene; (A) shows the results of three experiments (R1, R2 and R3) involving PCR analysis of the genomic DNA of HEK293T cells transfected with a CRISPR construct encoding gRNA-h53D and gRNA-h53H (h53D+H) as compared untreated control (WT) cells. The creation of a genomic sequence deletion (ie. a large intervening deletion between the cut sites of ~170 bp (bottom bands) is clearly apparent; and (B) shows the results of quantitative PCR (qPCR) targeting the genomic DNA between the cut sites. About 90% of the alleles comprised a large intervening deletion (n=3) with the h53D+H experiment compared to untreated control (WT) cells (n=3);

[0027] Figure 6: (A) provides Western blot data showcasing dystrophin restoration in human DMD patient primary myoblasts with exon-52 deletion following transfection of CRISPR constructs with single-cut exonic gRNAs (gRNA h53B, h53C, or h53D) or ReMax Splice-Exon constructs (h53B-H, h53C-H, or h53D-H). (B) depicts Western blot data demonstrating dystrophin restoration in human DMD patient primary myoblasts with exon-52 deletion after transfection of CRISPR constructs with a single-cut Splice gRNA (gRNA h53H); and (C) provides Western blot data showcasing dystrophin restoration in human DMD patient primary myoblasts with exon-52 deletion following transfection ofCRISPR constructs with dual-cut Intron-Intron gRNA combination (Li3-Ri3) or ReMax Exon-Intron (Li3-h53C) or Splice-Intron (Li3-h53H) constructs. In all of the Western blots of this figure, patient cells without CRISPR treatment were used as the untreated controls, and primary myoblast cells from a healthy individual (WT) were employed as the positive controls. Vinculin served as the loading controls;

[0028] Figure 7 graphically presents the data of Figure 6 quantitatively;

[0029] Figure 8 provides graphical results of experiments (using NGS analysis) to assess the cutting efficiency (ie editing efficiency) of gRNA candidates targeting the human DMD exon-51 and using a rage of CRISPR systems. Analysis was conducted by by Sanger and ICE analysis (A) and NGS (B). It was found that the editing efficiencies were >about 90% for all of the gRNAs tested;

[0030] Figure 9: (A) provides gDNA PCR-generated evidence of dual cutting activities of ReMax Exon-Intron SpCas9 gRNA combinations using eSpCas9(1.1) targeting exon-51 in DMD patient myoblasts with an exon-48-50 deletion. The WT amplicon should be 2.9 kb, and the lower bands indicate the occurrence of large genomic intervening sequence deletions arising from the dual cuts; (B) displays NGS data showcasing the editing efficiencies and the frequency of the generation of reframing 3n-2 indels at the genomic exonic cut sites after treating the patient myoblasts with ReMax gRNA combinations or single cut gRNAs (for comparison) using the high-fidelity eSpCas9(1.1); (C) provides PCR-generated evidence from cDNA of patient myoblasts treated with ReMax gRNA combinations or single cut gRNAs (for comparison) using eSpCas9(1.1), with smaller bands (ie smaller than the cDNA from the untreated patient cells (denoted DMD Ex48-50- del myo) clearly indicating exon skipping in the RNA transcripts of the DMD gene; (D) provides quantitated results (from Western blot) for dystrophin restoration in Ex48-50 deletion DMD patient differentiated myoblasts after treatment with ReMax gRNA combinations or single cut gRNAs, or a Intron-Intron gRNA combination using eSpCas9(1.1). The quantitation was based on band densitometry and using results with a control protein, vinculin, to normalise the quantitation; (E) provides quantitated results (from Western blot) for dystrophin restoration in Ex48-50 deletion DMD patient differentiated myoblasts after treatment with further ReMax gRNA combinations or single cut gRNAs, or an Intron- Intron gRNA combination using SaCas9. The quantitation was based on band densitometry and using results with a control protein, vinculin, to normalise the quantitation; and (F) provides quantitated results (from Western blot) for dystrophin restoration in Ex48-50 deletion DMD patient myoblasts after treatment with further ReMax gRNA combinations or single cut gRNAs using SpCas9-VQR. The quantitation was based on band densitometry and using results with a control protein, vinculin, to normalise the quantitation;

[0031] Figure 10 provides the results of experiments conducted with a humanised DMD transgenic mouse model with an exon-50 deletion (denoted TgScΔ50) treated with AAV vectors for expressing ReMax h51 Sa-A+F (where "F" denotes a filler sequence replacing one of the gRNAs with sham sequences), h51 Sa-A+A (where both gRNA expression cassettes express gRNA Sa-A), h51 Sa- A+LaB, h51 Sa-A+RaC, and h51 Sa-LaB+RaC; wherein successful dystrophin restoration was assessed by Western blot analysis of protein extracted from quadriceps (A), and muscle strength assessed via a grip strength test (B). A humanised DMD transgenic mouse model without deletions (denoted as TgSc) was used as the WT control;

[0032] Figure 11 provides the results of experiments conducted with a DMD myoblast model (Myo) bearing an exon-44 deletion to evaluate the merits of ReMax in achieving exon-45 skipping for therapeutic gene editing. The cells were treated using SpCas9 and with the dual-gRNA combinations h45 Sp-A+E and h45 Sp-A+F, as well as with the individual gRNAs h45 Sp-A, h45 Sp-E, and h45 Sp- F. (A) cDNA analysis conducted to assess exon-45 skipping and showing Δ44-45 skipping in cells treated with dual cut Splice-Splice ReMax approaches (ie h45 Sp-A+E and h45 Sp-A+F); (B) Western blot analysis showing dystrophin protein restoration in samples treated with the dual-gRNA ReMax approaches;

[0033] Figure 12 provides the results of experiments conducted with a DMD myoblast model (Myo) bearing to evaluate editing with SaCas9 and various gRNA combinations or individual gRNAs, namely h45 Sa-A1+I1, h45 Sa-A1+I2, h45 Sa-R1+I1, h45 Sa-R1+I2, h45 Sa-A1, h45 Sa-R1, and h45 Sa-I1+I2. The figure shows the results of cDNA analysis revealing robust exon-45 skipping in cells treated with the dual-cut approaches; and

[0034] Figure 13 provides the results of experiments to assess the effect of alternative scaffold sequences on CRISPR-effected cutting of various target genes: (A) shows the sequences of the original 4T and 3TC Sp scaffolds, wherein the highlighted nucleotides indicates nucleotide differences between the two sequences; (B) shows that the use of the 3TC scaffold led to higher levels of gRNA expression in transfected HEK293T cells; (C) shows that the editing efficiency for a "low" dose transfection was significantly improved by the use of the 3TC Sp scaffold (ie as compared to an "original scaffold"); (D) shows the sequences of the original Sa and 3TC Sa scaffolds, wherein the highlighted nucleotides indicates nucleotide differences between the two sequences; (E) shows that the use of the 3TC scaffold led to increased expression of exon-53 targeted gRNAs h53 Sa-E and gRNA h53 Sa-F in the human HEK293T cell line; and (F) shows the editing efficiencies and the frequencies of reframing indels for gRNA h53 Sa-E or h53 Sa-F with the original Sa scaffold and when using the 3TC scaffold.DETAILED DESCRIPTION

[0035] The first disclosure relates to a novel approach to gene editing-based reframing referred to herein as ReMax ("Reframing to the Maximum"). While particularly described herein in the context of treating Duchenne muscular dystrophy (DMD), those skilled in the art will immediately appreciate that the approach will have broader applicability; particularly for gene editing therapies of other genetic diseases including other monogenic diseases (eg sickle cell disease, cystic fibrosis (CF), Huntingdon disease and hereditary transthyretin amyloidosis (hATTR), limb-girdle muscular dystrophy type 2b (LGMD2B), merosin-deficient congenital muscular dystrophy type 1A (MDC1A), Usher syndrome, and deficient epidermolysis bullosa) and especially those amenable to exon reframing.

[0036] The first disclosure provides, in a first aspect, an agent for treating a genetic disease, preferably a monogenic disease, in a subject, wherein said agent comprises: a first endonuclease or endonuclease complex, or one or more polynucleotide molecule comprising a nucleotide sequence(s) enabling the expression or production of said first endonuclease or endonuclease complex within a cell, wherein the first endonuclease or endonuclease complex is targeted to a gene at a suitable first site positioned within a target exon, or a splice acceptor region, splice donor region or intron core of an adjacent intron of said exon; and a second endonuclease or endonuclease complex, or one or more polynucleotide molecule comprising a nucleotide sequence(s) enabling the expression or production of said second endonuclease or endonuclease complex within a cell, wherein the second endonuclease or endonuclease complex is targeted to said gene at a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon) or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon; such that, following delivery of the agent to a suitable cell of said subject, one or both of the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA of said cell at the first and second sites thereby creating a first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site- disrupting insertion-deletion ("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift-causing mutation associated with the said genetic disease.

[0037] In accordance with particular embodiments, the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA in an approach (strategy) asfollows: "Dual cut Splice-Splice" The first endonuclease or endonuclease complex cuts at a first site located within the splice acceptor region of the target exon (preferably within the splice acceptor of the adjacent intron upstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the splice donor region of said exon (preferably within the splice donor of the adjacent intron downstream of said exon). "Dual cut Splice-Exon" The first endonuclease or endonuclease complex cuts at a first site located within the target exon and the second endonuclease or endonuclease complex cuts at a second site within the splice donor region (preferably within the splice donor of the adjacent intron downstream of said exon), or the first endonuclease or endonuclease complex cuts at a first site located within the splice acceptor region of the target exon (preferably within the splice acceptor of the adjacent intron upstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the said exon. "Dual cut Splice-Intron" The first endonuclease or endonuclease complex cuts at a first site located within the intron core of the adjacent intron upstream of the target exon and the second endonuclease or endonuclease complex cuts at a second site within the splice acceptor region of said exon (preferably within the splice acceptor of the adjacent intron upstream of said exon), or the first endonuclease or endonuclease complex cuts at a first site located within the splice acceptor region of the target exon (preferably within the splice acceptor of the adjacent intron upstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the intron core of the adjacent intron downstream of said exon, or the first endonuclease or endonuclease complex cuts at a first site located within the intron core of the adjacent intron upstream of the target exon and the second endonuclease or endonuclease complex cuts at a second site within the splice donor region of said exon (preferably within the splice donor of the adjacent intron downstream of said exon), or the first endonuclease or endonuclease complex cuts at a first site located within the splice donor region of the target exon (preferably within the splice donor of the adjacent intron downstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the intron core of the adjacent intron downstream of said exon. "Dual cut Exon-Intron" The first endonuclease or endonuclease complex cuts at a first site located within the intron core of the adjacent intron upstream of the target exon and the second endonuclease or endonuclease complex cuts at a second site within the said exon, or the first endonuclease or endonuclease complex cuts at a first site located within the target exon and the secondendonuclease or endonuclease complex cuts at a second site within the intron core of the adjacent intron downstream of said exon.

[0038] In accordance with some particular embodiments, it may be preferred that the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA in accordance with the Dual cut Splice-Exon, Dual cut Splice-Intron or Dual cut Exon-Intron approach as described in the preceding paragraph. In some embodiments, where the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA in accordance with the Dual cut Splice-Splice approach as described in the preceding paragraph, then the said exon is not exon 45 of the human DMD gene or, in an alternative, is not an exon of the human DMD gene.

[0039] Preferably, where the first or second endonuclease or endonuclease complex cuts at a site within the target exon, and the frameshift-causing mutation associated with the said genetic disease is, for example, a frameshift-causing deletion or insertion (eg an upstream exon deletion) which creates a premature termination codon (PTC) in said exon, then the cut site is preferably within a sequence of the target exon where an indel (if generated within that sequence) can potentially reframe the frameshifted codon. Sequences of an exon where an indel (if generated within that sequence) can potentially reframe the frameshifted codon are sometimes referred to as "reframing boundary sequences", which is usually before the PTC, and not at a position where a reframing indel (if generated within that sequence) creates an unwanted PTC in that exon such that the exon is no longer functional (ie the sequence deletion leaves the said gene in a non-functional form such that no functional protein can be expressed).

[0040] Also, where the first or second endonuclease or endonuclease complex cuts at a site within the intron core of an intron adjacent to the target exon, preferably the first or second endonuclease or endonuclease complex cuts at a site within about 20 to 20000 nucleotides, more preferably within about 2000 nucleotides, of the exon-intron junction (eg within 2000 nucleotides of the exon) or, still more preferably, within about 1000 nucleotides of the exon-intron junction.

[0041] The endonucleases or endonuclease complexes of said agent may be selected from, for example, those suitable for gene editing; for example, gene editing systems such as CRISPR complexes (ie a CRISPR-Cas endonuclease complexes) including those adapted for use in "double nickase" strategies (see Ran FA et al., Cell 154(6):1380-1389, 2013), transcription activator-like effector nucleases (TALEN) (eg as reviewed in Bhardway A and V Nain., J Genet Eng Biotechnol 19:125, 2021) and zinc-finger nucleases (ZFN) (eg as reviewed in Carroll D., Genetics 188(4):773- 782, 2011), and Chandrasegaran S., Cell Gene Ther Insights 3(1):33-41, 2017). Hereinafter, the agent for use in the ReMax approach of the present first disclosure is particularly exemplified in the context of using CRISPR-based editing to achieve the dual cuts of the genomic DNA. Those skilled in the artwill however appreciate how such exemplification may be readily adapted for use with other gene editing techniques such as those mentioned above.

[0042] In a particular embodiment, the disclosure provides an agent for treating a genetic disease, preferably a monogenic disease, in a subject, wherein said agent comprises: at least one polynucleotide molecule comprising: (i) a first nucleotide sequence encoding or comprising a first guide RNA (gRNA) targeted to a gene at a suitable first site positioned within a target exon, or a splice acceptor region, splice donor region or intron core of an adjacent intron of said exon, said first gRNA capable of forming a first CRISPR- Cas complex (ie. an endonuclease complex) with a suitable CRISPR-associated (Cas) endonuclease, and wherein, where the first nucleotide sequence encodes the first gRNA, the first nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said first gRNA; and (ii) a second nucleotide sequence encoding or comprising a second guide RNA (gRNA) targeted to said gene at a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon) or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon, said second gRNA capable of forming a second CRISPR-Cas complex (an endonuclease complex) with a suitable Cas endonuclease, which may be the same or different to the said Cas endonuclease with which the first gRNA is capable of forming a CRISPR-Cas complex, and wherein, where the second nucleotide sequence encodes the second gRNA, the second nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said second gRNA; and one or more Cas endonuclease with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, or one or more nucleotide sequence encoding the Cas endonuclease(s) operably linked to a promoter and / or regulatory sequence(s) for expression of the Cas endonuclease(s), such that, upon delivery of the agent to a suitable cell of said subject, the first and second CRISPR-Cas complexes are formed from the Cas endonuclease(s) and the first and second gRNAs and one or more of the formed CRISPR-Cas complexes make double-stranded cuts in the genomic DNA at the first and second sites thereby creating a first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site-disrupting insertion-deletion ("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift- causing mutation associated with the said genetic disease.

[0043] Preferably, the agent comprises at least one polynucleotide molecule comprising (i) and (ii) as described thereof, and (iii) one or more nucleotide sequence encoding the Cas endonuclease(s) with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, wherein said one or more nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for expression of said Cas endonuclease(s). In some embodiments, the one or more nucleotide sequence encoding the Cas endonuclease(s) are provided as one or more mRNA for expression of the Cas endonuclease(s), but may otherwise be provided on an expression vector (eg as described below) or as naked plasmid DNA, where the nucleotide sequence may be, for example, operably linked to a strong constitutive promoter sequence.

[0044] Where the agent comprises more than one Cas endonuclease (or nucleotide sequences encoding more than one Cas endonuclease), then it will be appreciated by those skilled in the art that each Cas endonuclease may recognise different protospacer adjacent motif (PAM) sequences. For instance, a first Cas endonuclease may form, with the first gRNA, a first CRISPR-Cas complex to cut at a suitable first site comprising a first PAM sequence, and a second Cas endonuclease may form, with the second gRNA, a second CRISPR-Cas complex to cut at a suitable second site comprising a second PAM sequence (eg the first Cas endonuclease may be SpCas9 which cuts at a target site comprising an NGG PAM sequence, and the second Cas endonuclease may be SpCas9-VQR which cuts at a target site comprising an NGG PAM sequence). However, in some embodiments, one or more different Cas endonucleases may cut at a target site comprising the same PAM sequence.

[0045] In addition to the specific Cas endonucleases mentioned in the preceding paragraph, other Cas endonuclease(s) that may comprise the agent (or nucleotide sequence(s) encoding such other Cas endonucleases) include, for example, SpCas9, Cas9-NG, SpCas9-VQR, SaCas9, SaCas9-KKH, and high-fidelity variants such as HypaCas9, eSpCas9(1.1) and SpCas9-HF1.

[0046] The first gRNA may be targeted to a first site within the splice acceptor region of the target exon (ie in the splice acceptor of the adjacent intron upstream of the target exon) and the second gRNA targeted to a second site within the splice donor region of the target exon (ie in the splice donor of the adjacent intron downstream of said exon) in a Dual cut Splice-Splice approach, or the first gRNA may be targeted to a first site within the target exon and the second gRNA is targeted to a second site within the splice donor region of the target exon (ie in the splice donor of the adjacent intron downstream of said exon) (one example of a Dual cut Splice-Exon), or the first gRNA may be targeted to a first site within the splice acceptor region of the target exon (ie in the splice acceptor of the adjacent intron upstream of the exon) and the second gRNA is targeted to a second site within the target exon (another example of a Dual cut Splice-Exon), or the first gRNA may be targeted to a first site within the intron core of the upstream intron of the target exon and the second gRNA is targeted to a second site within the splice acceptor region of the target exon (ie in the splice acceptor of theadjacent intron upstream of the exon) (Dual cut Splice (acceptor)-Intron), or the first gRNA may be targeted to a first site within the splice acceptor of the target exon and the second gRNA is targeted to a second site within the intron core of the downstream intron of the target exon (Dual cut Splice (acceptor)-Intron), or the first gRNA is targeted to a first site within the intron core of the upstream intron of the target exon and the second gRNA is targeted to a second site within the splice donor region of the target exon (ie in the splice donor of the adjacent intron upstream of the exon) (Dual cut Splice (donor)-Intron), or the first gRNA is targeted to a first site within the splice donor region of the target exon and the second gRNA is targeted to a second site within the intron core of the downstream intron of the target exon (Dual cut Splice (donor)-Intron), or the first gRNA is targeted to a first site within the intron core of the upstream intron of the target exon and the second gRNA is targeted to a second site within the target exon (Dual cut Exon-Intron), or the first gRNA is targeted to a first site within the target exon and the second gRNA is targeted to a second site within the intron core of the downstream intron the target exon (Dual cut Exon-Intron).

[0047] As described in relation to the agent of the particular embodiment, the agent may comprise one or two (or more) polynucleotide molecules such as expression vectors / constructs and / or viral vectors suitable for delivery to the subject, such that the first and second nucleotide sequences encoding the guide RNAs (and the operably linked promoter and / or regulatory sequences), as well as any nucleotide sequences encoding a Cas endonuclease(s) may be provided on the same or different polynucleotide molecules (eg all three nucleotide molecules may be provided on one vector / construct, or two of the nucleotides sequences may be provided on one vector / construct and the other nucleotide sequence provided on another vector / construct, or all three nucleotide sequences may be provided on different vectors / constructs). Alternatively, the agent of the particular embodiment may be in the form of at least one ribonucleoprotein complex (RNP), more specifically a composition comprising at least one formed CRISPR-Cas complex (which is an RNP) such as, for example, the first CRISPR-Cas complex, or a combination of CRISPR-Cas complexes (eg a combination of the first and second CRISPR-Cas complexes).

[0048] The agent of the particular embodiment may be administered to the subject by any of the suitable routes of administration including systemic or local routes of administration such as, for example, intravenous (iv), intramuscular (im) or intraperitoneal (ip) injection.

[0049] The agent may be particularly adapted for treating Duchenne muscular dystrophy (DMD) in a subject, wherein said agent comprises at least one polynucleotide molecule comprising: (i) a first nucleotide sequence encoding or comprising a first guide RNA (gRNA) targeted to a first site positioned within a target exon (of the DMD gene), or a splice acceptor region, splice donor region or intron core of an adjacent intron of the exon, said first gRNA capable of forming a first CRISPR- Cas complex with a suitable CRISPR-associated (Cas) endonuclease, and wherein, where the firstnucleotide sequence encodes the first gRNA, the first nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said first gRNA; and (ii) a second nucleotide sequence encoding or comprising a second guide RNA (gRNA) targeted to a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon), or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon, said second gRNA capable of forming a second CRISPR-Cas complex with a suitable Cas endonuclease, which may be the same or different to the said Cas endonuclease with which the first gRNA is capable of forming a CRISPR-Cas complex, and wherein, where said second nucleotide sequence encodes the second gRNA, the second nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said second gRNA; and one or more Cas endonuclease with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, or one or more nucleotide sequence encoding the Cas endonuclease(s) operably linked to a promoter and / or regulatory sequence(s) for expression of the Cas endonuclease(s), such that, upon delivery of the agent to a suitable cell of said subject, the first and second CRISPR-Cas complexes are formed from the Cas endonuclease(s) and the first and second gRNAs and one or both of the formed CRISPR-Cas complexes make double-stranded cuts in the genomic DNA at the first and second sites thereby creating a first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site-disrupting insertion-deletion ("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift- causing mutation associated with said DMD.

[0050] Preferably, where the first or second endonuclease or endonuclease complex cuts at a site within the target exon and the DMD frameshift-causing mutation is, for example, a frameshift-causing deletion or insertion (eg an upstream exon deletion such as a deletion of all or part of exon-50 or exon- 52) which creates a premature termination codon (PTC) in said target exon (eg exon-53) and the cut site is within the reframing boundary sequences of the target exon where an indel (if generated within that sequence) can potentially reframe the frameshifted codon. For example, where the DMD frameshift causing mutation is an exon-52 deletion and the target exon is exon-53, the reframing boundary sequences may consist of the first 66 nucleotides of exon-53. Or, where the DMD frameshift causing mutation is an exon-52 deletion and the target exon is exon-51, the reframing boundary sequences may consist of the last 34 nucleotides of exon-51 (nb. those skilled in the art will be aware that exon-51 or exon-53 may be skipped without the DMD gene becoming non-functional). In anotherexample, where the DMD frameshift causing mutation is an exon-44 deletion and the target exon is exon-45, the reframing boundary sequences may consist of the first 49 nucleotides of exon-45. Or, where the DMD frameshift causing mutation is an exon-44 deletion and the target exon is exon-43, the reframing boundary sequences may consist of the last 27 nucleotides of exon-43. Also, where the first or second endonuclease or endonuclease complex cuts at a site within the intron core of intron adjacent to the exon affected by a DMD frameshift-causing mutation, preferably the first or second endonuclease or endonuclease complex cuts at a site within about 20 to 20000 nucleotides, more preferably within about 2000 nucleotides of the exon-intron junction (eg within 2000 nucleotides of the exon) or, still more preferably, within about 1000 nucleotides of the exon-intron junction.

[0051] More particularly, upon delivery of the agent to a suitable cell of a subject afflicted with DMD, or predisposed to DMD (ie the subject has a disease-causing mutation in the X-linked DMD gene), CRISPR-Cas complexes comprising the first gRNA and CRISPR-Cas complexes comprising the second gRNA are formed which are capable of specifically targeting and cutting in both DNA strands of the DMD gene within the genome. Subsequently, these cuts are repaired by the end joining DNA repair machinery which ligates the ends and which may introduce indel mutations, to result in: the creation of a genomic sequence deletion (eg a large intervening deletion between the two cut sites) to cause a frameshift "skipping" of an exon affected by a DMD frameshift-causing mutation such that an internally truncated (but still functional) dystrophin protein is produced which avoids or reduces symptoms of DMD (eg as seen in subjects with Becker Muscular Dystrophy (BMD)); and / or a frameshift indel mutation (eg a "3n-1" or "3n-2"deletion). Such a frameshift indel mutation may be responsible for the frameshift nature of the frameshift exon skipping and / or, in the case where the cutting of the DMD gene has been incomplete and no intervening sequence deletion has occurred, cause a frameshift such that a DMD frameshift-causing mutation which creates a PTC in an affected exon is corrected (ie by reframing) to enable the production of a functional dystrophin protein.

[0052] As such, it may be an advantage of the agent of the present first disclosure that it provides two potential repair outcomes to overcome a disease-causing mutation in the DMD gene. In contrast to a "traditional" CRISPR-based approach targeting two introns (ie in a Dual cut Intron-Intron approach), where local indels in the intron core sequences will not reframe the frameshifted codon, targeting a splice acceptor region and splice donor region (Dual cut Splice-Splice), splice donor region and exon site (Dual cut Splice-Exon), splice acceptor region and intron core site (Dual cut Splice-Intron) or an exon site and an intron core site (Dual cut Exon-Intron), would not only create large intervening deletions that may skip a target exon but the other repair outcome, a local indel, may also give a reframing effect because they are located at critical locations that could contribute to reframing or a splice-site disruption leading to the skipping of a target exon so as to reframe the mutation. That is, a local indel in the splice sites could disrupt the splicing that results in exon skipping, while a local indel within the reframing boundary sequences of the exon could create a reframing indel. Therefore, thecombined reframing effect from both repair outcomes (large genomic intervening sequence deletions and local indels) may enhance the reframing efficiency of CRISPR-based gene editing for DMD mutations.

[0053] The agent for treating DMD may comprise any Cas endonuclease (or an expressible nucleotide sequence encoding same) which recognises a suitable PAM sequence matching a desired site in the DMD gene. Thus, the Cas endonuclease may be selected from, for example, SpCas9 (which recognises the PAM sequence, NGG), Cas9-NG which recognises an NG PAM (Nishimasu H et al., Science 361:1259-1262, 2018), Cas9-VQR which recognises an NGA PAM sequence (Kleinstiver BP et al., Nature 523(7561):481-485, 2015), and SaCas9 which recognises an NNGRRT or NNGRRN PAM sequence (Maeder M et al., Nat Med 25:229-233, 2019). Where "off-target" cutting / activity by the CRISPR-Cas complexes is a concern, then it may be preferred that a "high fidelity" Cas endonuclease be selected such as eSpCas9(1.1), HypaCas9 (Ikeda A et al., Commun Biol 2:371, 2019) and SpCas9-HF1 (Kleinstiver BP et al., Nature 529(7587):490-495, 2016).

[0054] The first nucleotide sequence may encode or comprise a first gRNA comprising a targeting nucleotide sequence (otherwise known as the gRNA spacer sequence, which is typically of ~20 nucleotides in length and defines the genomic sequence to be targeted) targeted to a first site positioned within a target exon, or within a splice acceptor region, splice donor region or an intron core of the target exon. For example, the first gRNA may be targeted to a first site in exon-51 including a PTC, exon-53 including a PTC, or exon-45 including a PTC. In another example, the first gRNA may be targeted to a first site in a splice donor region, splice acceptor region or intron core of an intron of target exon-51, exon-53, or exon-45 of the DMD gene. Preferably, the first gRNA is targeted to the splice acceptor region associated with exon-51 (eg the splice acceptor immediately upstream (ie 5') to exon-51), or exon-53 of the DMD gene.

[0055] The second nucleotide sequence may encode or comprise a second gRNA comprising a targeting nucleotide sequence (otherwise known as the gRNA spacer sequence, which is typically of ~20 nucleotides in length and defines the genomic sequence to be targeted) targeted to a second site positioned within a target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon), splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core of an intron associated with the target exon. For example, the second gRNA may be targeted to a second site in the target exon selected from, for example, exon-51, exon- 53, or exon-45, or may be targeted to a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region or intron core of an intron associated with exon-51, exon-53 or exon-45 of the DMD gene. Preferably, thesecond gRNA is targeted to the splice acceptor region or splice donor region associated with exon-51 (eg the splice acceptor immediately upstream (ie 5') to exon-51 or the splice donor immediately downstream (3') of exon-51), or exon-53 of the DMD gene.

[0056] Where the mutation involves exon-50 deletion and the target exon is exon-51, the first gRNA may in some embodiments be targeted to a first site within exon-51 (preferably upstream of a PTC in exon-51) and the second gRNA may be targeted to a second site within the splice acceptor or the splice donor of the adjacent intron upstream of exon-51 (Dual cut Splice-Exon).

[0057] Where the mutation involves exon-52 deletion and the target exon is exon-53, the first gRNA may in some embodiments be targeted to a first site within exon-53 (preferably upstream of a PTC in exon-53) and the second gRNA is preferably targeted to a second site within the splice acceptor or the splice donor of the adjacent intron upstream of exon-53 (Dual cut Splice-Exon).

[0058] Where mutation is exon-44 deletion and the target exon is exon-45, the first gRNA may in some embodiments be targeted to a first site within exon-45 (preferably upstream of a PTC in exon- 45) and the second gRNA is preferably targeted to a second site within the splice acceptor or the splice donor of the adjacent intron upstream of exon-45 (Dual cut Splice-Exon).

[0059] It is considered that an agent adapted for treating Duchenne muscular dystrophy (DMD) and intended to achieve, for example, exon skipping of exon-51 and / or generation of a reframing indel mutation to reframe exon-51, will be beneficial for treating a subject afflicted with, or predisposed to DMD, and having, for example, an exon-50 deletion, an exon-45-50 deletion or an exon-48-50 deletion, and / or other related mutation(s), and / or an exon-52 deletion and / or related mutation(s).

[0060] As will be known to those skilled in the art, the first and second gRNAs will further comprise a scaffold sequence necessary for binding to the Cas endonuclease (and thereby formation of the respective CRISPR-Cas complex) also known as the trans-activating RNA (tracrRNA). A gRNA comprising both a targeting nucleotide sequence and a scaffold sequence is known as a single guide RNA (sgRNA) molecule. Suitable scaffold sequences for use for use with Cas endonucleases such as SpCas9, Cas9-NG, Cas9-VQR, SaCas9, HypaCas9 and SpCas9-HF1 are well known to those skilled in the art. For example, well known scaffold sequences for use with SpCas9-NG and Cas9-VQR include those that have been described in Nishimasu H et al., Science 361:1259-1262, 2018; the disclosure(s) of which are incorporated herein by reference. Suitable scaffold sequences for use with SaCas9 are also well-known to those skilled in the art. However, a preferred scaffold for use with SaCas9 comprises the nucleotide sequence shown below:5’-GTTTCAGTACTCTGGAAACAGAATCTACTGAAACAAGGCAAAATGCCGTGTTTATCTCGTCAAC TTGTTGGCGAGA-3’ (SEQ ID NO:01); and a preferred scaffold for use with SpCas9 comprises the nucleotide sequence is: 5’-GTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGC ACCGAGTCGGTGC-3’ (SEQ ID NO:02).

[0061] The agent may comprise one or two (or more) polynucleotide molecules such as expression vectors / constructs and / or viral vectors suitable for delivery to the subject, such that the first and second nucleotide sequences (and, if present, the one or more nucleotide sequence(s) encoding the Cas endonuclease(s)) may be provided on the same or different polynucleotide molecules (eg all of the nucleotide sequences may be provided on one vector / construct, or two of the nucleotides sequences may be provided on one vector / construct and another / other nucleotide sequence(s) provided on another vector / construct, or all nucleotide sequences may be provided on different vectors / constructs).

[0062] In some embodiments, the agent for treating DMD comprises one or two vectors / constructs (eg two viral vectors) suitable for delivery to the subject (eg particularly to a cell of the subject which expresses dystrophin such as myotubes and myoblasts). In one particular embodiment, the first and second nucleotide sequences are provided on a first vector ("vector 1") each operably linked to a suitable promoter sequence (eg a strong constitutive promoter sequence such as a polymerase III promoter such as the well-known human U6 promoter sequence, H1 promoter sequence, 7SK promoter sequence or SV40 promoter sequence) for the production of the first and second gRNAs, and a nucleotide sequence encoding a suitable Cas endonuclease is provided on a second vector ("vector 2") operably linked to a suitable promoter sequence (eg a strong constitutive promoter sequence such as a polymerase II promoter such as the well-known cytomegalovirus (CMV) promoter sequence or a muscle-specific promoter sequence such as that designated Ck8e (muscle creatine kinase 8 promoter) described in Amoasii et al., 2017 supra), or any one of the MHCK7, CbH, CAG and U1A promoter sequences) to drive expression of the Cas endonuclease. The promoter sequences for the production of the first and second gRNA may be the same; for example, in one particular embodiment, the first and second nucleotides sequences may both be operably linked to a human U6 promoter sequence such that vector 1 comprises two "U6-gRNA cassettes".

[0063] The agent may be prepared for delivery to the subject in the form of a viral delivery vector or virus-like particles (VLPs) including engineered virus-like particles (eVLPs). Examples of suitable viral delivery vectors include the "typical" adeno-associated virus (AAV) vector (as described in, for example, Naso MF et al., BioDrugs 31(4):317-334, 2017; and Xu CL et al., Viruses 11(1):28, 2019),as well as other vectors based upon full length adenovirus (AdV), lentivirus (LV) vectors (e.g. non- integrating lentiviral vectors), and baculovirus (BV) vectors (Aulicinio F et al., Nucleic Acids Res 50(13);7783-7799, 2022) which may, for example, be used with magnetic nanoparticles for complement shielding. Examples of suitable VLPs include those based upon retroviral capsids (e.g. VLPs based upon the gag polyprotein of Friend murine leukaemia virus (FMLV) which have been shown to be capable of delivering encapsulated macromolecules to the eye; Banksota S et al., Cell 185:250-265, 2022). However, the agent may also be prepared for delivery to the subject in other forms well-known to those skilled in the art, such as non-viral vector systems including liposomes, lipid nanoparticles (LNPs), delivery forms incorporating a cell-penetrating peptide (CPP), nanoparticles composed of polymeric or other organic materials, and nanoparticles composed of gold (auNPs), silica and / or other inert inorganic materials. The use of nanoparticle delivery forms may, for example, offer advantages in terms of reduced immunogenicity, flexibility in design, and ease of large-scale production for therapeutic use. Suitable delivery vectors such as these and the viral vectors mentioned above have been reviewed in, for example, Lino CA et al., Drug Deliv 25(1):1234-1257, 2018; and Behr M et al., Acta Pharm Sin B 11(8):2150-2171, 2021; the disclosure(s) of which are incorporated herein by reference.

[0064] In some preferred embodiments, the agent is prepared for delivery to the subject in the form of an AAV delivery vector(s). AAVs have been routinely used for the in vivo delivery of various polynucleotide molecules for therapeutic purposes. In one particular embodiment, the second and third nucleotide sequences are provided on a first AAV vector ("vector 1") operably linked to a suitable promoter sequence (e.g. a strong constitutive promoter sequence such as a polymerase III promoter such as the well-known human U6 promoter sequence, H1 promoter sequence, 7SK promoter sequence or SV40 promoter sequence) for the production of the gRNA, and a nucleotide sequence encoding a suitable Cas endonuclease is provided on a second AAV vector ("vector 2") operably linked to a suitable promoter sequence (e.g. a strong constitutive promoter sequence such as a polymerase II promoter such as the well-known cytomegalovirus (CMV) promoter sequence or a muscle-specific promoter sequence such as that designated Ck8e (muscle creatine kinase 8 promoter) described in Amoasii et al., 2017 supra), or any one of the MHCK7, CbH, CAG and U1A promoter sequences) to drive expression of the Cas endonuclease.

[0065] In some other preferred embodiments, the agent is prepared for delivery to the subject in the form of an LV delivery vector(s). Recent work has indicated that a delivery vector based upon a self- inactivating non-integrating lentivirus can be successfully used for delivery of CRISPR-Cas systems (Ling S et al., Nature Biomed Eng 5:144-156, 2021) with very high efficiency. In this example, the LV delivery vector co-delivered to the target cell, mRNA encoding for the Cas endonuclease and an expression cassette (incorporated into the lentiviral genome) for production of the gRNA (bytranscription) by the target cell. Such vectors characteristically produce a "burst" of Cas endonuclease expression (due to the rapid degradation of the mRNA in the cell) which may prevent or reduce the potential for off-target mutations. Where it is desired to express the Cas endonuclease and gRNAs from respective expression cassettes within the target cell, LV delivery vectors may be advantageous in that their larger packaging capacity (i.e. as compared to AAVs; ~8.0kb vs. ~4.7kb) enables the generation and delivery of a single LV vector comprising both the first and second nucleotide sequences (encoding the gRNAs) and a nucleotide sequence encoding a suitable Cas endonuclease.

[0066] The agent may be administered (in vivo) to the subject by any of the suitable routes of administration including systemic or local routes of administration such as, for example, intravenous (iv), intramuscular (im) or intraperitoneal (ip) injection.

[0067] The agent may also be delivered ex vivo to a target cell (eg a muscle cell (myocyte), which may be provided by isolated tissue or organ) of the subject, and thereafter, the cell may be suitably administered or transplanted to the subject (eg by intramuscular (im) injection).

[0068] In a second aspect, the first disclosure provides a pharmaceutical composition comprising an agent according to the first aspect in combination with a pharmaceutically acceptable carrier, diluent and / or excipient.

[0069] Examples of suitable carriers and diluents are well-known to those skilled in the art, and are described in, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA 1995. Examples of suitable excipients may be found in the Handbook of Pharmaceutical Excipients, 2ndEdition, (1994), Edited by A Wade and PJ Weller. Examples of suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.

[0070] The pharmaceutical composition may further comprise any suitable binders, lubricants, suspending agents, coating agents and solubilising agents. Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Preservatives, stabilising agents, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Anti-oxidants and suspending agents may be also used.

[0071] The pharmaceutical composition will be administered to a subject afflicted with a genetic disease, or predisposed to a genetic disease, in a therapeutically effective amount, that is an amount sufficient to effect beneficial or desired clinical results. A therapeutically effective amount can be administered in one or more administrations. Typically, a therapeutically effective amount will be sufficient for treating the DMD or otherwise to palliate, ameliorate, stabilise, reverse, slow or delay the progression of the disease. Further, and notwithstanding the above, it will be understood by those skilled in the art that the therapeutically effective amount may vary and depend upon a variety of factors including the activity of the gene editing system, the metabolic stability and length of action of the particular gene editing system, the age, body weight, sex and / or health of the subject, the route and time of administration, and the severity of the genetic disease to be treated.

[0072] The pharmaceutical compositions may be intended for single daily administration, multiple daily administration, controlled or sustained release, or at regular intervals (eg every month, every 2 months or every three months) or irregular intervals (eg the period of the interval may, however, vary from time to time across the duration of the subject's treatment) as needed to achieve the most effective results. The pharmaceutical composition may be administered by, for example, intraperitoneal injection (with or without in vivo electroporation by application of suitable square pulses / waves from a standard porator apparatus such as those available from BTX®, Holliston, MA, United States of America).

[0073] In a third aspect, the first disclosure provides a method for treating a subject afflicted with, or predisposed to, a genetic disease, wherein the method comprises administering the agent of the first aspect or a pharmaceutical composition of the second aspect to the said subject.

[0074] Where the method is applied for treating DMD, then preferably, the method is commenced upon diagnosis, disease onset and / or the appearance of DMD symptoms, typically during childhood, and may be continued for the remainder of the subject's life. In some embodiments, the method is commenced during infancy or early childhood (eg before about 8 years of age) such as, for example, before disease onset and / or the appearance of DMD symptoms, the child subject having been genotyped for the presence of a DMD causative mutation in the DMD gene. Such early commencement of the method may prevent or delay disease onset or the appearance of symptoms.

[0075] In a fourth aspect, the first disclosure provides the use of the agent of the first aspect for treating or preventing a genetic disease.

[0076] In a fifth aspect, the first disclosure provides the use of the agent of the first aspect in the manufacture of a medicament (eg a pharmaceutical composition) for treating or preventing a genetic disease.

[0077] In this specification, a number of terms are used which are well-known to those skilled in the art. Nevertheless, for the purposes of clarity, a number of these terms are hereinafter defined.

[0078] As used herein, the term "treating" includes prophylaxis as well as the alleviation of established symptoms of a disease or condition. As such, the act of "treating" a genetic disease therefore includes: (1) preventing or delaying the appearance of clinical symptoms of the disease or condition developing in a subject afflicted with or predisposed to the disease or condition; (2) inhibiting the disease or condition (ie arresting, reducing or delaying the development of the disease or condition or a relapse thereof (in case of a maintenance treatment) or at least one clinical or subclinical symptom thereof; and (3) relieving or attenuating the disease or condition (ie causing regression of the disease or condition or at least one of its clinical or subclinical symptoms).

[0079] The term "intron" (abbreviation for "intragenic region") is used herein as is understood by those skilled in the art and therefore refers to a nucleotide sequence within a gene that is removed from pre mRNA by RNA splicing by spliceosomes (ie the term intron refers to non-coding regions of an RNA transcript, or the DNA encoding it, that are removed from the pre mRNA by splicing before translation). An intron includes a splice donor site (at the 5' end of the intron), a branch site (near to the 3' end of the intron) and a splice acceptor site (at the 3' end of the intron) which are required for splicing. The splice donor site and splice acceptor sites of an intron are collectively referred to as the "intronic splice sites" or, more simply, the "splice sites". The splice donor site comprises an almost invariant GU dinucleotide sequence (in the pre mRNA) at the 5' end of the intron, within a larger, less highly conserved sequence. The splice acceptor site is located at the 3' terminus of the intron and comprises an almost invariant AG dinucleotide sequence. The consensus sequence (using the IUPAC nucleotide notation) for an intron (and the sites cut in the process of RNA splicing) is: 5' G-G-[cut]-G-U-R-A-G-U … intron core sequence … Y-U-R-A-C … intron core sequence … Y-rich-N-C-A-G-[cut]-G 3' donor site branch sequence acceptor site (approximately 20-50 nucleotides upstream of the acceptor site);where N refers to any nucleotide, Y refers to the pyrimidine nucleotides (ie C and T) and R refers to the purine nucleotides (ie A and G).

[0080] As used herein, the term "splice donor region" refers to a region of the targeted gene which comprises the splice donor site (splice donor) as described in the preceding paragraph and up to 7 nucleotides (or up to 6 nucleotides, or up to 5 nucleotides, or up to 4 nucleotides, or up to 3 nucleotides, or up to 2 nucleotides, or up to 1 nucleotide) of the immediately adjacent upstream sequence such that the splice donor region may therefore include nucleotides of the exon such as thosethat may be present in, for example, an adjacent exonic enhancer element (ESE). In any case, it is considered that an agent of the present disclosure which cut the genomic DNA at a site (ie the first site or second site) within 6 nucleotides (or up to 5 nucleotides, or up to 4 nucleotides, or up to 3 nucleotides, or up to 2 nucleotides, or up to 1 nucleotide) of the splice donor site and / or the cut position of the splice donor site can interfere with splicing and suitable for achieving exon skipping and / or generation of a reframing indel mutation. Similarly, the term "donor acceptor region" refers to a region of the targeted gene which comprises the splice acceptor site (splice acceptor) as described in the preceding paragraph and up to 7 nucleotides (or up to 6 nucleotides, or up to 5 nucleotides, or up to 4 nucleotides, or up to 3 nucleotides, or up to 2 nucleotides, or up to 1 nucleotide) of the immediately adjacent downstream sequence such that the splice acceptor region may therefore include nucleotides of the exon such as those that may be present in, for example, an adjacent exonic enhancer element (ESE). It is considered that an agent of the present disclosure which cut the genomic DNA at a site (ie the first site or second site) within 6 nucleotides (or up to 5 nucleotides, or up to 4 nucleotides, or up to 3 nucleotides, or up to 2 nucleotides, or up to 1 nucleotide) of the splice acceptor site and / or the cut position of the splice acceptor site can interfere with splicing and suitable for achieving exon skipping and / or generation of a reframing indel mutation.

[0081] As used herein, the term "intron core" refers to the region (nucleotide sequence) of an intron between the splice donor site and the splice acceptor site, including the branch sequence.

[0082] The term "target exon" as used herein will be understood by those skilled in the art and refers to an exon which, upon skipping, can result in the reframing of a frameshift-causing mutation in a gene (one or two alleles) causative of said genetic disease. A frameshift-causing mutation adversely affects the translation of the exon such that a non-functional or poorly functional protein is expressed as may be the result of the frameshift creating a premature termination codon (PTC) such that a truncated non-functional or poorly functional protein is expressed, or which otherwise leads to the expression of, for example, an inactive or incorrectly folded domain which, in turn, causes the expression of a non-functional or poorly functional protein. Thus, where the agent creates a genomic sequence deletion (ie. the first outcome) or the generation of a reframing or splice-sire disrupting indel mutation (ie, the second outcome), consequent skipping of the target exon and / or reframing then allows for the expression of a functional or partially functional protein. And in the context of DMD, where the agent creates a genomic sequence deletion (ie. the first outcome) or the generation of a reframing or splice-sire disrupting indel mutation (ie, the second outcome), consequent skipping of the target exon and / or reframing then allows for the expression of a functional or partially functional dystrophin. In specific examples, the target exon which can reframe a DMD exon-52 deletion is exon- 51 or exon-53, whereas skipping of this exon would lead to reframing of DMD exon-52 deletion; the target exon which can reframe a DMD exon-50 deletion is exon-51; the target exon which can reframe a DMD exon-44 deletion is exon-45 or exon-43; and the target exon which can reframe a small indelmutation (eg 1 bp insertion) in exon-49 of DMD is exon-49 itself since skipping of this exon can reframe the mutation.

[0083] As used herein, the phrase "manufacture of a medicament" includes the use of the agent directly as the medicament or in any stage of the manufacture of a medicament.

[0084] The agent of the present first disclosure is hereinafter further described with reference to the following non-limiting examples 1-9 and accompanying figures. EXAMPLES Example 1 CRISPR-based strategies for DMD therapy

[0085] Initially, three CRISPR-based strategies for the potential treatment of DMD therapy were identified usual "traditional" thinking. These are illustrated in Figures 1 and 2, and each aims to reframe the mutations via indel generation or targeted exon removal. That is, in the first approach (Single cut Splice Acceptor / Donor), CRISPR is used to produce a single cut near to a splice site adjacent to an affected exon, which is depicted in Figure 1 as exon C with a premature termination codon (PTC) (nb. the mutation which causes a frameshift and the generation of a PTC in exon C is the deletion of exon B (ie "delEx-B)). This can lead to the creation of indels at the splice site and disrupt the splicing which leads to exon skipping in the transcript (Long C et al., Sci Adv 4(1):p.eaap9004, 2018). In the second approach (Single cut Exon), CRISPR is used to produce a single cut in the exon before the PTC, which again can lead to the creation of indels which could reframe the DMD frameshift (ie depending on the size of the indels). Such indels can be referred to as "reframing indels" (Amoasii et al., 2017 supra). Finally, in the third approach (Dual cut Intron-Intron), CRISPR is used to produce dual cuts in the genome targeting the introns flanking a PTC-affected exon (exon C) to mediate large genomic intervening sequence deletions that remove the exon / s and thereby leads to exon skipping (Figure 2) (Nelson CE et al., Science 351(6271):407-411, 2016).

[0086] However, the present Applicant recognised that the efficiency of CRISPR-based strategies for DMD therapy might be improved if the cuts in the genome were targeted to more "sensitive" (critical) sites. That is, with the "traditional" CRISPR-based approach targeting two introns (ie in a Dual cut Intron-Intron approach), where local indels in the intron core sequences will not reframe the frameshifted codon, targeting a splice acceptor and splice donor (Splice-Splice), splice donor / splice acceptor and exon site (Splice-Exon), splice donor / splice acceptor and intron core site (Splice-Intron) or an exon site and an intron core site (Exon-Intron), would not only create large intervening deletions that may skip a target exon but the other repair outcome, a local indel, may also give a reframing effect because they are located at critical locations that could contribute to reframing. That is, a localindel in the splice sites could disrupt the splicing that results in exon skipping, while a local indel in the exon before a PTC codon could create a reframing indel. Accordingly, new alternative approaches to CRISPR-based strategies for DMD therapy were conceived ("ReMax") involving the generation of dual cuts, one of which is targeted to a splice site of the DMD gene (ie a splice site of the precursor mRNA (pre mRNA) transcribed from the DMD gene) or, otherwise, a sensitive site within a target exon such as the reframing boundary sequences preceding a PTC; Amoasii L et al., Sci Transl Med 9(418): doi:10.1126 / scitranslmed.aan8081, 2017). Examples of the ReMax approaches are illustrated in Figure 2. In particular, Figure 2 illustrates the following four approaches: 1. A CRISPR-based approach to produce dual cuts targeting both a splice acceptor site and a splice donor site (Dual cut Splice-Splice); 2. A CRISPR-based approach to produce dual cuts targeting a splice site and an exon (Dual cut Splice-Exon); 3. CRISPR-based approaches to produce dual cuts targeting splice site and intron (Dual cut Splice-Intron; both Acceptor and Donor splice site versions); and 4. A CRISPR-based approach wherein dual cuts targeting an exon and an intron site are generated (Dual cut Exon-Intron).

[0087] ReMax for exon-53 skipping The double cut ReMax approaches shown in Figure 2 were tested using the C2C12 mouse myoblast cell line (ECACC 91031101; Porton Down, Wiltshire, United Kingdom) targeting exon-53 of the DMD gene and compared against a traditional CRISPR-based dual cut Intron-Intron approach (Figure 2) as well as a single cut strategy targeting the splice site for exon-53.

[0088] The ReMax approaches utilised a CRISPR-Cas system comprising the SpCas9 endonuclease due to the availability of SpCas9 PAM (NGG) sequences in the splice sites of the mouse DMD exon- 53. Guide RNA molecules (gRNAs) were as shown in Table 1 below:

[0089] Table 1 g mmmmm-GGGCATAAGGATCTGTGTT (SEQ ID NO:07)

[0090] For a fair comparison, all of the gRNAs were tested (and selected) to initially ensure that they induced a similarly high cutting efficiency (see below). However, subsequently, an improved gRNA scaffold was used (denoted the "3TC scaffold") which included an alteration to a string of thymine (T)nucleotides in the gRNA scaffold which were predicted to improve the amount of gRNA transcription and was found to exhibit a higher editing efficiency (Gao Z et al., Mol Ther Nucleic Acids 14:32-40, 2019).

[0091] CRISPR expression constructs (for single gRNAs) were prepared by standard methodologies. For double gRNAs, CRISPR expression constructs were prepared in a manner substantially as described in Adikusuma et al., 2017a supra). Generally, a plasmid for expressing SpCas9 and including a puromycin resistance gene (PuroR) was constructed using standard methodologies known to those skilled in the art. The inclusion of PuroR facilitates enrichment for transfected cells following in vitro transfection. Expression of the endonuclease and PuroR is driven by the well-known CBh promoter (Gray SJ et al., Hum Gene Ther 9:1143-1153, 2011), such that puromycin resistance only occurs in tandem with SpCas9 expression. The plasmid also encodes gRNA sites adjacent to the scaffold sequence, where the oligonucleotide sequence for custom gRNA molecules can be inserted for expression by a dual U6 RNA polymerase III promoter. Subsequently, custom oligonucleotide sequences corresponding to a particular gRNAs were inserted into the gRNA sites of the plasmid to generate the CRISPR expression constructs, according to standard methodologies known to those skilled in the art.

[0092] The CRISPR constructs encoding the single gRNAs were used to singly transfect the C2C12 cells (ie only one CRISPR construct was used for each transfection to assess single cut efficiency) by standard techniques followed by puromycin selection (Ran FA et al., Nat Protoc 8(11):2281-2308, 2013) and the cells cultured until approximately 90% confluent, and then harvested. DNA extraction was performed according to standard methodologies known to those skilled in the art. Then, by conducting NGS analysis, it was determined that all of the individual gRNAs had >95% cutting efficiency, indicating similar cutting efficiency in all of the gRNAs that were used.

[0093] Using the dual-gRNA expressing CRISPR constructs (ie to simultaneously express two gRNAs for testing the ReMax approaches), C2C12 myoblast cells were transfected (by standard techniques), cultured until approximately 90% confluent, and then differentiated into myotubes to express dystrophin by changing the media to a standard differentiation media. To quantify Dmd exon- 53 skipping in the myotubes, RT-PCR was performed on DMD cDNA according to standard methodologies. The results, shown in Figure 3, indicated that all of the ReMax approaches produced exon-53 skipping, and remarkably, the ReMax Splice-Splice and ReMax Splice-Exon approaches achieved nearly complete exon-53 skipping (95% and 94%, respectively). However, all of the ReMax approaches achieved a high level of exon-53 skipping of at least 60% (ie the Dual cut Splice Acceptor- Intron showed the lowest level of 60% exon-53 skipping). In contrast, of the single cut approaches, the best approach (ie the Single cut Exon) produced a 78% exon-53 skipping efficiency. Interestingly, thesingle cut approaches targeting splice sites produced a comparatively low efficiency rate of 27% (Single cut Splice Acceptor) and 25% (Single cut Splice Donor).

[0094] Significantly, for the ReMax Exon-Intron approach, where an exon-53 skipping efficiency of 75% was observed (which was very similar to the efficiency achieved with the traditional Intron- Intron approach), it was found that in the instances where exon-53 was not skipped ("unskipped"), the unskipped band included a high proportion (49%) of 3n-2 indels within the RT-PCR products resulting from local indels induced by the exonic gRNA. These 3n-2 indels could reframe DMD mutations associated with exon-52 deletion (ie 3n-1 frameshift mutation(s)), such that the effect of these reframing events in addition to incidences where exon-53 is skipped is to "boost" the overall successful reframing efficiency. Example 2 Candidate ReMax DMD therapy to skip and / or reframe exon-53

[0095] It is considered that skipping or reframing the DMD exon-53 could benefit ~10% of DMD patients (Bladen et al., 2015 supra). Setting out to use a ReMax approach (using a CRISPR-SpCas9 and CRISPR-SaCas9 systems), specifically a Dual cut Splice Donor-Exon approach, gRNAs were initially screened to identify candidates that could efficiently skip or reframe exon-53 of the human DMD gene. In particular, exonic gRNAs were screened for those that could result in abundant 3n-2 indels to efficiently reframe DMD mutations associated with exon-52 deletion. Briefly, CRISPR constructs encoding single gRNA candidates (prepared in the same manner as described in Example 1) were singly transfected into HEK293T cells (ie only one CRISPR construct was used for each transfection to assess single cut efficiency) by standard techniques followed by puromycin selection (Ran et al., 2013 supra), and the cells cultured until approximately 90% confluent. Then, by conducting NGS analysis, the cutting efficiency for the individual gRNAs was determined (Figure 4). The level of generation of 3n-2 indels was also determined by NGS. One example of a suitable candidate gRNA identified by the screening, designated gRNA-h53D, targets a site within exon-53 and shows a cutting (editing) efficiency of >98%. This gRNA also generates a high proportion of 3n-2 indels (51%) in transfected HEK293T cells. Another example, designated h53H, targets the Splice donor associated with exon-53, was also found to induce a high cutting efficiency (93%) (see Figure 4) using SpCas9. Using the SaCas9 system, the exonic gRNAs designated h53 Sa-E and h53 Sa-F showed high cutting efficiencies (Figure 4). The nucleotide sequences for these gRNAs (and other tested gRNAs) are shown in the Table 2 below (nb. the 5' nucleotides given in lower case (ie. as g) denotes a mismatch guanine nucleotide added to efficiently start transcription by RNA Polymerase III (from the U6 promoter)).

[0096] Using a dual-gRNA expressing CRISPR construct (prepared in the same manner as described in Example 1) to transfect HEK293T by standard techniques, to simultaneously express the h53D andh53H gRNAs (ie "h53D+H"), a Dual cut Splice Donor-Exon ReMax approach was tested and assessed for exon-53 skipping or reframing capacity. It was found that this dual cut approach could efficiently create large genomic intervening sequence deletions. That is, deletions were found in 90% alleles by standard qPCR techniques targeting the genomic DNA between the two cut sites (see Figure 5A and 5B). Assuming that of the remaining 10% of the alelles (ie non-large deleted alleles), 51% include reframing 3n-2 indels generated by the h53D gRNA, then the total level of efficiency of h53D+H in reframing a DMD gene with DMD-causative mutation in exon-53 (ie exon-53 deletion) of dual cut h53D+h53H could reach ~95%. Similar results were achieved with the h53G and h53H gRNAs (ie h53G+h53H) (Figure 5A and 5B).

[0097] Table 2 g hhhhhhhhhhhhhhh53 Sa-gCCTTCAGAACCGGAGGCAACAG (SEQ ID NO:22)xon

[0098] The results of this example have therefore identified a potential CRISPR-based gene editing therapy for DMD mutations associated with exon-53.Example 3 Restoring dystrophin expression with candidate ReMax DMD therapy in patient cells with an exon-52 deletion

[0099] Primary myoblast cells from a DMD patient characterised by an exon-52 deletion in the DMD gene were transfected with CRISPR SpCas9 constructs prepared in a similar manner described above in Example 1 (but here the constructs included sequences for the GFP reporter instead of puromycin), for expression of a range of gRNAs targeted to exon-53 (namely, h53B, h53C, h53D and h53H described in Example 2, and h53 Li3 and h53 Ri3 as detailed below in Table 3) in both CRISPR single cut and dual cut (ReMax) approaches. Transfected cells were selected by FACS. h53 Li3 and h53 Ri3 were selected from a panel of different gRNAs targeting the intron left ("L") of exon-53 (ie upstream) or the intron right ("R") of exon-53 (ie downstream), and which are shown in Table 3 (along with other potential gRNAs); wherein all proved to achieve a high level (> 85%) of cutting (data not shown). The ReMax experiments were Dual cut Exon-Intron (h53 Li3+h53C), Dual cut Splice-Intron (h53 Li3+h53H), Dual cut Splice-Exon (h53B+h53H which is also denoted as h53B-H, h53C+h53H, and h53D+h53H). The experiments were conducted to determine whether dystrophin expression could be restored in the patient cells using Western blots and a commercially sourced anti-dystrophin antibody. Results are shown in Figures 6 and 7. As expected, the patient cells ("∆Ex52") showed no detectable expression of dystrophin but did show strong levels of a control Protein, vinculin (detected using a labelled, commercially sourced anti-vinculin antibody). In comparison with wild-type (WT) cells, cells treated with CRISPR single cut approaches showed a low level of dystrophin expression (albeit dystrophin expression had been restored to some extent), whereas cells treated in accordance with ReMax, showed a strong level of dystrophin expression, which appeared (on a qualitative Level) comparable to the WT expression. A comparative Dual cut Intron-Intron approached showed a somewhat lesser degree of dystrophin expression restoration.

[0100] Table 3 g hhhhhh53 Sa-Ri1GAGTGGGTATCAGGATTGGGG (SEQ ID NO:28)h53 Sa-Ri1 (23)GTGAGTGGGTATCAGGATTGGGG (SEQ ID NO:29)hhhhhhhhhExample 4 Candidate ReMax DMD therapy to skip and / or reframe exon-51

[0101] It is considered that skipping or reframing exon-51 could benefit about 14% of all DMD patients (Bladen et al., 2015 supra). Potential guide RNAs (gRNAs) targeting splice sites and the reframable exon sequences of exon-51, deemed suitable for SpCas9, SaCas9, Cas9-NG, or Cas9-VQR, were identified as listed in Table 4.

[0102] HEK293T cells underwent transfection with CRISPR constructs, including SpCas9, SaCas9, Cas9-NG, and Cas9-VQR, expressing respective gRNAs, prepared as described in Example 1. For SpCas9 and SaCas9, a 3TC scaffold was utilised, while Cas9-NG and Cas9-VQR used the original gRNA scaffold. Editing efficiencies were assessed using Sanger and / or NGS analysis. Despite moderate editing observed in some gRNAs, the majority demonstrated notable editing efficiencies (Figure 8). Specifically, high editing efficiencies (>89%) were observed for gRNAs: Cas9-VQR gRNAs h51 VQR-2 (g20), h51 VQR-2 (21), h51 VQR-3, h51 VQR-s1 (19), h51 VQR-s1 (g20), h51 VQR-s1 (21); Cas9-NG gRNA h51 NG-4; SaCas9 gRNAs h51 Sa-A, h51 Sa-B; and SpCas9 gRNAs h51 Sp-A g20, h51 Sp-B g20, h51 Sp-B g19 (Figure 8). Indel analysis indicated that gRNAs targeting the reframable exon generated a high proportion of 3n-2 reframing indels. For example, Cas9 VQR gRNA h51 VQR-3, SaCas9 gRNAs h51 Sa-A, h51 Sa-B, SpCas9 gRNAs h51 Sp-A g20, h51 Sp-B g19 generated 50%, 26%, 32%, 35%, and 43% 3n-2 reframing indels, respectively.

[0103] Table 4 g ' ' hhhhhhhhhhhhhhhhhhhhhhhh51 NG-2ACCAGAGTAACAGTCTGAGTA (SEQ ID NO:62)Splice acceptorh51 NG-4GTGTCACCAGAGTAACAGTC (SEQ ID NO:63)Exonhhhhh

[0104] The results of this example have therefore identified a potential CRISPR-based gene editing therapy for DMD mutations associated with exon-51. Example 5 Analysis of patient cells (with an exon-48 to exon-50 deletion) following treatment with candidate ReMax DMD therapies

[0105] In this experiment, a broad range of gRNA combinations (targeted to exon-51) were tested in a ReMax Exon-Intron approach using eSpCas9(1.1) and myoblasts from a patient with an exon-48 to exon-50 deletion mutation in the DMD gene in the same manner as has been described above. Evidence of the dual cutting activities was assessed using standard PCR analysis of the genomic DNA of the treated cells. The wild-type (WT) amplicon was expected to be 2.9 kb. The gRNAs tested were: h51 Sp-A 20, h51 Sp-B 19g, h51 LiA, h51 LiB, h51 RiA, and h51 RiC. "L" denotes a gRNA targeting the "left" intron, and "R" denotes a gRNA targeting the "right" intron. Sequences are shown in Table 5 (unless shown above).

[0106] Table 5 g hhh

[0107] The combinations of the gRNAs tested are indicated in Figure 9A, where it can be seen that all ReMax treatments were successful; generating clearly smaller amplicons (arising from a successful deletion between the dual cuts) or some smaller sized amplicons along with a stronger band (similar in size to the WT) that likely incorporate 3n-2 indel mutations. Experiments were performed in triplicate. Subsequently, NGS analysis of isolated amplicons was conducted to assess cutting (editing efficiencies and the frequency of 3n-2 indel reframing. The results are shown in Figure 9B. Single cutexperiments using the gRNAs h51 Sp-A 20 and h51 Sp-B 19g were conducted for comparison. The results indicated that the ReMax experiments with the h51 Sp-A 20 gRNA achieved higher levels of editing efficiency, and greater frequency of 3n-2 indel generation relative to the single cut comparison experiments. In related experiments, RNA transcripts of the DMD gene of treated patient differentiated cells were used to generate cDNA which was then size-assessed (see Figure 9C). The results clearly indicate that the cDNA of cells treated with the ReMax dual cut approach produced smaller cDNAs reflecting exon skipping. NGS analysis of the cDNAs revealed a frequency of 3n-2 reframing indel generation of up to about 60% for the ReMax treatments conducted with the h51 Sp-A 20 gRNA. In comparison, lower level frequencies (eg 20-40%) were observed with the gRNA combinations including h51 Sp-B 19g. Further, myoblasts from a DMD patient with an exon-48-50 deletion were treated with a ReMax Exon-Intron approach with the following gRNA combinations: h51 Sp-A+Li and h51 Sp-A+RiC, and assessed for the restoration of dystrophin protein expression. Comparative treatments were conducted with a Dual cut Intron-Intron approach (ie LiA+RiC) as well as single cut, h51 Sp-A and h51 Sp-B, approaches. The results are shown in Figure 9D.

[0108] Further experiments were conducted with the exon-targeted h51 Sa-A and h51 Sa-B gRNAs (see Example 5) and gRNAs denoted as h51 LaB, LaC, RaA, RaB and RaC targeted to the introns left ("L") or right ("R") of exon 51 (sequences provided below in Table 6).

[0109] Table 6 g hhhhh

[0110] Using patient differentiated myoblasts (from a patient with an exon-48-50 deletion mutation) and SaCas9, cells treated with ReMax Exon-Intron approaches (ie with the gRNA combination of h51Sa-A+LaB and h51 Sa-A+RaC), single cut approaches using h51 Sa-A and h51 Sa- B separately, as well as a dual cut Intron-Intron approach (ie h51 LaB+RaC), the restoration of dystrophin protein expression was assessed by Western blot using a commercially sourced anti- dystrophin antibody. Quantified results are shown in Figure 9E. The single cut h51 Sa-A and the ReMax h51 Sa-A+RaC restored the dystrophin expression to levels comparable to wild-type (WT).

[0111] Similar experiments were also conducted using the SpCas9-VQR endonuclease. The gRNAs were as shown in Table 4. All of these gRNAs are targeted to h51 splice or exonic sites. The h51 VQR-2 (g20) (targeting splice acceptor), VQR-3 (targeting exon) and VQR-s1 (19) (targeting splice donor) gRNAs were selected on the basis of high editing efficiency in single cut experiments (data not shown). Using DMD patient differentiated myoblasts (from a patient with an exon-48-50 deletion mutation) and SpCas9-VQR, cells treated with Dual cut Splice-Exon or Splice-Splice approaches (ie with the combinations of the VQR-2 (g20) or VQR-3 with VQR-s1 (19)) resulted in significantly smaller RNA (ie as determined from generated cDNA) indicating exon-skipping. The unskipped RNA from the treatment of VQR-3 + VQR-s1 contained 53.5% reframed transcripts resulting from VQR-3 gRNA cutting. Also, ReMax with h51 VQR-3+s1 (19) showed a strong level of dystrophin expression restoration compared to individual VQR-3 or VQR-s1. Quantified results are shown in Figure 9F.

[0112] In further experiments, an AAV construct was designed to express SaCas9 and dual-gRNA. The AAV vectors produced the following gRNAs: h51 Sa-A+F (where "F" denotes a filler sequence replacing one of the gRNAs with sham sequences), h51 Sa-A+A (where both of the gRNA expression cassettes express gRNA Sa-A), h51 Sa-A+LaB, h51 Sa-A+RaC and h51 Sa-LaB+RaC. The evaluation was conducted using a humanised Duchenne muscular dystrophy (DMD) transgenic mouse model. This model carries a human DMD (hDMD) transgene with an exon-50 deletion, and a non-functional endogenous mouse Dmd gene (ie the endogenous gene was rendered non-functional by an exon-51 deletion). The AAVs were administered intraperitoneally at a dose of 1.5 × 10¹⁴ vector genomes per kilogram (vg / kg) to neonatal mice at postnatal day 4 (P4), and analysis was performed approximately one month post-injection. Restoration of the human dystrophin transgene in quadriceps muscle samples was assessed by dystrophin immunofluorescence (data not shown). All treatment groups demonstrated successful dystrophin restoration, with robust restoration observed specifically in samples treated with the ReMax h51 Sa-A+LaB gRNA combination (a Dual cut Exon-Intron approach). Western blot analysis of protein extracted from quadriceps confirmed that treatment with ReMax h51 Sa-A+LaB resulted in the highest level of dystrophin restoration (see Figure 13A), achieving approximately 17% restoration. Muscle strength assessments were conducted prior to tissue harvesting using a grip strength test. This test involved four sets of exercises. The results are shown in Figure 13B. Muscle strength rescue was observed only in mice treated with ReMax h51 Sa-A+LaB, with improvements seen in the first three sets of exercises but not the fourth, indicating increased muscle strength but persistent fatigue following treatment. It is anticipated that further optimisation of AAV quality or dosage may enhance the therapeutic efficacy of the ReMax h51 Sa-A+LaB treatment.Example 6 Candidate ReMax DMD therapy to skip and / or reframe exon-45

[0113] It is considered that skipping or reframing the DMD exon-45 could benefit ~9% of DMD patients (Bladen et al., 2015 supra). Potential guide RNAs (gRNAs) for ReMax targeting exon-45 using SpCas9 and SaCas9 were identified as listed in Table 7.

[0114] Experiments were conducted using a DMD myoblast cell model bearing an exon-44 deletion to assess the editing efficiency of individual SpCas9 gRNAs, including h45 Sp-A, h45 Sp-E, and h45 Sp-F. The methodology used was substantially as described above in Example 3. The editing efficiency observed for h45 Sp-A was 90%, for h45 Sp-E was 96%, and for h45 Sp-F was 70%. Then, a dual-gRNA expressing SpCas9 CRISPR construct (prepared in the same manner as described in Example 1) was used to transfect HEK293T by standard techniques and simultaneously express the h45 Sp-A and h45 Sp-E gRNAs (ie "h45 Sp-A+E), to test and assess a Dual cut Splice-Splice ReMax approach for exon-45 skipping. It was found that this dual cut approach could efficiently create large intervening deletions. That is, deletions were found in 90% alleles by standard qPCR techniques targeting the genomic DNA between the two cut sites. A combination of the h45 Sp-A and h45 Sp-F gRNAs (ie "h45 Sp-A+F") also achieved similar results.

[0115] In further experiments, the DMD myoblast cell model bearing an exon-44 deletion was also utilised for the evaluation of therapeutic gene editing. In this case, the cells were treated using the ReMax approach with SpCas9 and various gRNA configurations, including the dual-gRNA combinations of h45 Sp-A+E and h45 Sp-A+F, as well as individual gRNAs h45 Sp-A, h45 Sp-E, and h45 Sp-F. Analysis of DNA editing was performed on genomic DNA. Intervening deletions in the genomic DNA were observed in samples treated with the dual-cut ReMax approaches, and cDNA analysis was conducted to assess exon-45 skipping as a therapeutic outcome. It was found that robust therapeutic exon-45 skipping was present in cells treated with the dual-gRNA ReMax approaches. Western blot analysis was also used to evaluate dystrophin restoration, and robust dystrophin restoration was also observed in the samples treated with the dual-gRNA ReMax approach, confirming the therapeutic potential of the method (see Figure 11A and 11B).

[0116] In still further experiments, HEK293T cells were transfected with an SaCas9 CRISPR construct for expressing h45 Sa-A1 (or variants thereof such as h45 Sa-A1 g21) or h45 Sa-R1 or h45 Sa-R2 (or variants thereof such as h45 Sa-R1 g21 and h45 Sa-R1 g22) or h45 Sa-I1 or h45 Sa-I2 or h45 Sa-I3 substantially as described above in Example 1. Editing efficiencies were assessed using NGS analysis. All of the gRNAs tested showed editing efficiencies of 95% or more, with the exon targeting guides exhibiting reframing efficiencies of 39%-43% ((3n-2) indels). The same gRNAs were then tested in the DMD myoblast cell model bearing an exon-44 deletion in a manner substantially as described in Example 3. All of the gRNAs displayed efficient editing activities (as measured by NGSanalysis); particularly, the editing efficiencies were high, ranging from 75% to 97%, with exon- targeting guides exhibiting reframing (3n-2 indels) efficiencies of 32% to 45%.

[0117] The DMD myoblast model bearing an exon-44 deletion was then used to evaluate editing with SaCas9 and various gRNA combinations or individual gRNAs. The gRNA combinations tested included h45 Sa-A1+I1, h45 Sa-A1+I2, h45 Sa-R1+I1, h45 Sa-R1+I2, h45 Sa-A1, h45 Sa-R1, and h45 Sa-I1+I2. Analysis of DNA editing revealed the presence of genomic DNA intervening deletions in samples treated with the dual-cut approaches. cDNA analysis was performed to assess exon-45 skipping as a therapeutic outcome. Robust therapeutic exon-45 skipping was observed in cells treated with the dual-cut approaches (see Figure 12). NGS was conducted on the unskipped cDNA from samples treated with ReMax h45 Sa-A1+I1 and h45 Sa-A1+I2. In these samples, the unskipped cDNA contained 62% and 75% therapeutic reframing edits ((3n-2) indels), respectively, as a result of editing by guide Sa-A1. Further, Western blot analysis demonstrated dystrophin restoration levels ranging from 27% to 44%, with the highest restoration observed in samples treated with h45 Sa-A1+I1, highlighting the effectiveness of the ReMax treatment strategy.

[0118] Table 7 g hhhhhhhhhhhh45 Sa-I3AATCACCCATGATTGCTTAAAG (SEQ ID NO:88)IntronExample 7 Minimising the potential "off-target" activity of gRNA candidates

[0119] One of the key safety concerns of CRISPR-based therapy is the generation of mutations at the unintended sites (off-target), typically at sites in the genome having a nucleotide sequence with a close match to that of the gRNA (eg 1 or 2 nucleotide mismatches) (Fu Y et al., Nat Biotechnol 31(9):822-826, 2013). Using the CRISPR / Cas9 target online predictor (CC-Top) tool (Stemmer M et al., PloS One 10($)::e0124633, 2015), in silico off-target analysis was conducted on the candidate gRNAs of Examples 1-3 to generate a list of "possible" off-target sites with sequences having <3 nucleotide mismatches. These possible off-target sites will be assessed in future experiments (eg by performing targeted deep sequencing (NGS) of the off-target sites following transfection of cells with CRISPR constructs encoding for the candidate gRNAs) to identify whether any off-target activities have occurred at these sites, however based upon the in silico analysis, it is anticipated that the off- target activities of the candidate gRNAs will be minimal.

[0120] The off-target effects of Cas9 DNA cutting can be minimised or mitigated using Cas endonuclease variants with high fidelity features, such as HypaCas9, eSpCas9(1.1), and SpCas9-HF1, although they may exhibit lower on-target editing efficiency at times. HEK293T cells were transfected with SpCas9 or HypaCas9, eSpCas9(1.1), and SpCas9-HF1 constructs expressing gRNA h51 Sp-B g19 (Table 4). The h51 Sp-B gRNA is known to generate off-target effects in the intron region of the STRIP1 locus due to minimal sequence differences (only 1 mismatch). Assessment using NGS analysis revealed that the use of SpCas9 with gRNA h51 Sp-B g19 generated around 85% editing at the off-target site, while HypaCas9, eSpCas9(1.1), and SpCas9-HF1 showed reductions at this off- target with 6.5%, 2.3% and 3.2% off-target editing, respectively. It is considered that the use of the 3TC scaffold helps maintain high on-target editing efficiencies. Example 8 Evaluation of the effect of scaffold sequences on cutting efficiency

[0121] Experimentation was undertaken to assess whether improvements in CRISPR-effected cutting of a target genomic DNA could be achieved using alternative scaffold sequences. Specifically, experiments were conducted to assess any differences in cutting efficiencies between a scaffold sequence designated "4T" (or "original scaffold") and a variant of that sequence designated the "3TC" scaffold. The sequences of these scaffolds are shown in Figure 13A. The highlighted nucleotides indicate nucleotide differences between the two sequences.

[0122] Using standard methodologies known to those skilled in the art, human HEK293T cells were transfected with a "low" or "higher" dose of a plasmid with a CRISPR construct encoding SpCas9 anda suitable gRNA (with either the original or 3TC Sp scaffold sequences) targeted to the following genes: hEMX1, hRUNX1 and hVEGFA. For the hEMX1 gene, the experiments investigated the relative cutting efficiency of two different targeting sequences ("A" and "B"). Production of the gRNA in the transfected cells was quantified and the results are shown in Figure 13B; in all cases, it was found that the 3TC scaffold resulted in a higher expression level of gRNA transcripts. Further, quantification of the level of modified alleles of the target genes (ie. modified by CRISPR cutting), clearly demonstrated that "low" dose (ie 5-10ng) transfection with plasmids coding for gRNAs with 3TC scaffold achieved a substantially improved cutting (editing) efficiency. With the comparative "high" dose (ie 1-3 μg) experiments, the cutting efficiencies observed were substantially the same for the gRNAs with the 4T and 3TC scaffolds.

[0123] In similar experiments, HEK293T cells were transfected with SpCas9 or HypaCas9, eSpCas9(1.1), and SpCas9-HF1 constructs expressing gRNA h51 Sp-B g19 (Table 4) using either the 4T or 3TC scaffold. NGS analysis revealed that with the 4T scaffold, the editing efficiencies of gRNA h51 Sp-B g19 for SpCas9, SpCas9-HF1, eSpCas9(1.1), or HypaCas9 were 88%, 70%, 79%, or 82%, respectively. Employing the 3TC scaffold, the editing efficiencies improved to 96%, 93%, 93%, or 93%, respectively, underscoring the advantage of the 3TC scaffold for high-fidelity Cas9 variants.

[0124] In similar experiments involving the transfection of HEK293T cells with a plasmid with a CRISPR construct encoding SaCas9 and a suitable gRNA (with either the original or a 3TC Sa scaffold sequence as shown in Figure 13C) targeted to exon-53 of the DMD gene, it was also observed that significantly higher levels of gRNA expression could be achieved with the 3TC scaffold as compared to the "original" scaffold (see Figure 13E). NGS of the genomic DNA treated also revealed that greatly improved cutting efficiency (Figure 13F) and enhanced 3n-2 reframing indels could be achieved using gRNAs including the 3TC scaffold. Two gRNA targeting sequences were assessed in these experiments; namely h53 Sa-E (gCTTGTACTTCATCCCACTGATT; (SEQ ID NO:21))and h53 Sa-F (gCCTTCAGAACCGGAGGCAACAG; (SEQ ID NO:22)) targeting the exon.

[0125] Also, in experiments involving the transfection of HEK293T cells with a plasmid with a CRISPR construct encoding SaCas9 and a suitable gRNA (with either the original or a 3TC Sa scaffold sequence as shown in Figure 7C) targeted to exon-51 of the DMD gene. Two gRNA targeting sequences were assessed in these experiments; namely h51 Sa-A (TTGTGTCACCAGAGTAACAGT; (SEQ ID NO:50)) and h51 Sa-B (gTAGTAACCACAGGTTGTGTCAC; (SEQ ID NO:51)). As revealed by NGS of the genomic DNA, it was also found that improved cutting efficiency and enhanced 3n-2 reframing indels could be achieved using gRNAs including the 3TC scaffold (especially with gRNAs with the targeting sequence of h51 Sa-B.Example 9 Combinations of gRNA targeting sequences for use in candidate DMD therapy

[0126] Using the ReMax approach to a DMD therapy, various combinations of gRNAs may be applied.

[0127] For example, targeting exon-51 may utilise combinations of gRNAs with the targeting nucleotide sequences of the following: Dual cut Splice-Splice: One of the splice acceptor-targeting gRNAs such as h51 Sa-Splice, h51 VQR- 2 with one of the splice donor-targeting gRNAs such as h51 SD, h51 VQR-s1, h51 VQR-s2 and h51 NG donor A (or variants thereof, such as h51 VQR-s1 (19), h51 VQR-5 (g20) and h51 VQR-s1 (21)). Dual cut Splice-Exon: One of the splice-targeting gRNAs such as h51 Sa-Splice, h51 SD, h51 VQR- s1, h51 VQR-s2, h51 NG donor A, h51 VQR-2 (or variants thereof, such as h51 VQR-s1 (19), h51 VQR-5 (g20), h51 VQR-s1 (21), h51 VQR-2 (g20) and h51 VQR-2 (21)), with one of the exon- targeting gRNAs such as h51 Sp-A, h51 Sp-B, h51 Sa-A, h51 Sa-B, h51 VQR-1, h51 VQR-3, h51 VQR-4, h51 VQR-5, h51 NG-2, h51 NG-4, h51 NG-10, h51 NG-11 (or variants thereof, such as h51 Sp-A g20, h51 Sp-B g19, h51 Sp-B g20, h51 Sp-B 22, h51 Sp-B 23, h51 Sp-B gg20, h51 Sp-B ggg20, h51 Sp-B gcg19, and h51 Sp-B agg20). Dual cut Splice-Intron: One of the splice-targeting gRNAs such as h51 Sa-Splice, h51 SD, h51 VQR- s1, h51 VQR-s2, h51 NG donor A and h51 VQR-2 (or variants thereof, such as h51 VQR-s1 (19), h51 VQR-5 (g20), h51 VQR-s1 (21), h51 VQR-2 (g20) and h51 VQR-2 (21)) with one of the intronic gRNAs such as h51 LiA, h51 LiB, h51 RiA h51 RiB, h51 RiC, h51 LaA, h51 LaB, h51 LaC, h51 RaA, h51 RaB and h51 RaC. Dual cut Exon-Intron: One of the exon-targeting gRNAs such as h51 Sp-A, h51 Sp-B, h51 Sa-A, h51 Sa-B, h51 VQR-1, h51 VQR-3, h51 VQR-4, h51 VQR-5, h51 NG-2, h51 NG-4, h51 NG-10 and h51 NG-11 (or variants thereof, such as h51 Sp-A g20, h51 Sp-B g19, h51 Sp-B g20, h51 Sp-B 22, h51 Sp-B 23, h51 Sp-B gg20, h51 Sp-B ggg20, h51 Sp-B gcg19 and h51 Sp-B agg20) with one of the intronic gRNAs such as h51 LiA, h51 LiB, h51 RiA, h51 RiB, h51 RiC, h51 LaA, h51 LaB, h51 LaC, h51 RaA, h51 RaB and h51 RaC.

[0128] For targeting exon-53, ReMax may utilise combinations of gRNAs with the targeting nucleotide sequences of the following: Dual cut Splice-Splice: One of the splice acceptor-targeting gRNAs such as h53A, h53 Sa-A, h53 Sa- B, with one of the splice donor-targeting gRNAs such as h53H or h53I. Dual cut Splice-Exon: One of the splice-targeting gRNAs such as h53A, h53 Sa-A, h53 Sa-B, h53H or h53I with one of the exon-targeting gRNAs such as h53B, h53C, h53D, h53E, h53F, h53G, h53 Sa- C, h53 Sa-D, h53 Sa-E, or h53 Sa-F.Dual cut Splice-Intron: One of the splice-targeting gRNAs such as h53A, h53 Sa-A, h53 Sa-B, h53H and h53I with one of the intron-targeting gRNAs such as h53 Li1, h53 Li2, h53 Li3, h53 Ri1, h53 Ri3, h53 Sa-Ri1, h53 Sa-Ri2, h53 Sa-Ri3, h53 Sa-Li1, h53 Sa-Li2, h53 Sa-Li3 (or variants thereof, such as h53 Sa-Ri1 (23), h53 Sa-Ri2 (22), h53 Sa-Li1 (g21), h53 Sa-Li2 (g21), h53 Sa-Li3 (22)). Dual cut Exon-Intron: One of exon-targeting gRNAs such as h53B, h53C, h53D, h53E, h53F, h53G, h53 Sa-C, h53 Sa-D, h53 Sa-E, or h53 Sa-F, with one of the intron-targeting gRNAs such as h53 Li1, h53 Li2, h53 Li3, h53 Ri1, h53 Ri3, h53 Sa-Ri1, h53 Sa-Ri2, h53 Sa-Ri3, h53 Sa-Li1, h53 Sa-Li2, or h53 Sa-Li3 (or variants thereof, such as h53 Sa-Ri1 (23), h53 Sa-Ri2 (22), h53 Sa-Li1 (g21), h53 Sa- Li2 (g21) and h53 Sa-Li3 (22)).

[0129] For targeting exon-45, ReMax may utilise combinations of gRNAs with the targeting nucleotide sequences of the following: Dual cut Splice-Splice: One of the splice acceptor-targeting gRNAs such as h45 Sp-A or h45 Sa-A1 (or variants thereof such as h45 Sa-A1 g21), with one of splice donor-targeting gRNAs such as h45 Sp-E and h45 Sp-F. Dual cut Splice-Exon: One of the splice targeting gRNAs such as h45 Sp-A, h45 Sa-A1, h45 Sp-E, or h45 Sp-F (or variants thereof such as h45 Sa-A1 g21), with one of the exon targeting gRNAs such as h45 Sa-R1 or h45 Sa-R2 (or variants thereof such as h45 Sa-R1 g21 and h45 Sa-R1 g22). Dual cut Splice-Intron: One of the splice targeting gRNAs such as h45 Sp-A, h45 Sa-A1, h45 Sp-E, or h45 Sp-F (or variants thereof such as h45 Sa-A1 g21), with one of the intron targeting gRNAs such as h45 Sa-I1, h45 Sa-I2 or h45 Sa-I3. Dual cut Exon-Intron: One of the exon targeting gRNAs such as h45 Sa-R1 or h45 Sa-R2 (or variants thereof such as h45 Sa-R1 g21 and h45 Sa-R1 g22), with one of the intron targeting gRNAs such as h45 Sa-I1, h45 Sa-I2 or h45 Sa-I3. SECOND DISCLOSURE: GENE EDITING TO CORRECT OR KNOCK-OUT A MUTANT ALLELE FOR TREATING GENETIC DISEASES SUCH AS ADRP BACKGROUND

[0130] Dominant gain-of-function and dominant-negative mutations are commonly observed in many genetic disorders. Gain-of-function mutations result in a protein acquiring new or enhanced activity, often leading to pathological conditions. Dominant-negative mutations, on the other hand, occur when a mutant protein interferes with the function of the wild-type protein. Patients with these mutations are typically heterozygous, meaning that they possess one normal (wild-type) allele and one mutant allele. Despite the presence of the wild-type allele and its corresponding functional protein, the mutant protein exerts a harmful effect. In gain-of-function mutations, the mutant protein's abnormalactivity can lead to disease manifestations even when the wild-type protein is present. For instance, in autosomal dominant retinitis pigmentosa (adRP), mutations in the rhodopsin (RHO) gene, such as the P23H mutation, produce misfolded proteins that aggregate and cause photoreceptor cell death. The mutant protein can also sequester the wild-type protein, reducing its levels and leading to the disease phenotypes.

[0131] Retinitis pigmentosa (RP) is a leading cause of inherited blindness characterised by rod photoreceptor cell death that leads to a reduced ability of the eye to adapt to dim light or the dark ("night blindness"), peripheral vision loss and, eventually (over a period of decades), to loss of central vision. It has been estimated that between about 1.77 and 2.35 million people are affected worldwide (https: / / rarediseases.org / rare-diseases / retinitis-pigmentosa / ), and about 25% to 30% of cases are inherited in an autosomal dominant fashion.

[0132] The two most common sites for mutations causing autosomal dominant retinitis pigmentosa (adRP) are the genes for rhodopsin (RHO) and nuclear receptor subfamily two group E member 3 (NR2E3). RHO is the most abundant protein in retinal photoreceptor cells (comprising almost 50% of the total protein in the rod outer segments) and is involved in the photo-transduction cascade in rod photoreceptor cells, while NR2E3 is a photoreceptor-specific transcription factor that is key to the development and maintenance of rod photoreceptors. In complex with other factors, NR2E3 promotes the transcription of rod genes including RHO. There are over 150 known mutations in RHO which lead to adRP (www.ncbi.nlm.nih.gov / clinvar); the most common of which is a c.68C>A (p.Pro23His; P23H) mutation in RHO, where patients are heterozygous, retaining one wild-type, functional allele. Most RHO mutations causing adRP are gain-of-function mutations. The P23H mutation is a prime example, classified as a class II RHO mutant due to improper folding. These misfolded proteins are tagged with ubiquitin and directed to the ubiquitin-proteasome system (UPS) for degradation. However, the large protein load overwhelms the degradation machinery, leading to the accumulation of misfolded proteins and resulting in cell toxicity. Additionally, wild-type rhodopsin can become trapped with the mutant protein in the endoplasmic reticulum, leading to its increased degradation by the proteasome and failure to reach the outer disc membrane. Consequently, class II mutants exhibit a secondary dominant-negative effect.

[0133] The NR2E3 gene encodes a transcription factor that is essential for rod photoreceptor differentiation and suppressing cone-specific genes. It interacts with CRX, NR2D1, and NRL to promote rod-specific gene transcription. Eighty mutations in NR2E3 have been identified, mostly causing enhanced S cone syndrome. The G56R mutation in NR2E3 is uniquely linked to autosomal dominant retinitis pigmentosa (adRP) and is the second most common adRP mutation. This gain-of- function mutation disrupts DNA binding and proper dimerisation, impairing rhodopsin activation while excessively suppressing cone opsins.

[0134] Unfortunately, adRP is currently incurable and nor is there any available treatments to prevent or significantly retard the progression of the disease, with perhaps only Vitamin A palmitate supplementation providing any evidence of being able to slow the decline of photoreceptor function (in children) (Berson, EL et al., JAMA Ophthalmol136(5):490-495, 2018). Other than that, the only other options at present are essentially limited to the use, in the later stages of the disease, of acetazolamide to reduce swelling in the retina (macular oedema) caused by the disease to improve vision (Fishman GA et al., Arch Ophthalmol 107(10):1445-1452, 1989), or to undergo a retinal implant (again during the later stages of the disease) to provide some partial sight. Accordingly, new and innovative therapeutic approaches are desperately needed to treat this devastating disease.

[0135] One potential approach to the development of new adRP therapies involves the use of genome editing technology, including Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) methodologies which are recognised as offering enormous potential for single dose treatment of genetic diseases. Indeed, clinical trials using CRISPR methodologies have recently commenced for a range of different diseases including sickle cell disease and hereditary transthyretin amyloidosis (hATTR): https: / / www.nejm.org / doi / full / 10.1056 / NEJMoa2107454. In addition, and of particular interest in the context of the second disclosure, in 2020, a clinical trial of a CRISPR-based therapy commenced with patients suffering from a recessive retinopathy, namely Leber congenital amaurosis (LCA), which causes severe vision loss or blindness in newborns (ClinicalTrials.gov Identifier: NCT03872479; and Maeder M et al., Nat Med 25:229-233, 2019). For dominant gain-of- function or dominant-negative mutations, CRISPR nuclease technology offers a precise therapeutic strategy through allele-specific targeting. This approach enables the selective knock-out of the mutant allele while preserving the wild-type (WT) allele. This enables the removal of the toxic effects associated with the mutant protein while ensuring that the WT protein continues to be produced from the remaining functional allele.

[0136] However, a major limitation of the use of CRISPR methodologies in the context of a possible therapy for diseases caused by dominant gain-of-function or dominant negative mutations such as adRP, is the need to specifically target the disease-causing allele only, which is particularly challenging for single nucleotide changes (i.e. point mutations) in coding sequences. In addition, in cases where gene-editing is contemplated for a disease caused by a dominant gain-of-function or dominant negative mutation, it may generally be preferred to aim to correct the mutant allele by exploiting homology directed repair (HDR) rather than simply delete (i.e. "knock-out") the mutant allele. However, since the HDR process takes place during the S / G2 phase of dividing cells (Jasin M et al., Cold Spring Harb Perspect Biol 5:a012740, 2013), this can be difficult in post-mitotic cells such as retinal photoreceptor cells (Cai Y et al., Sci Adv 5:eaav3335, 2019).

[0137] Thus, the Applicant looked to determine whether a CRISPR-based methodology could be developed that could provide a potentially viable therapy for genetic diseases such as adRP, and which enables specific gene-editing without being reliant on the HDR repair process. SUMMARY

[0138] The first disclosure relates to a novel strategy for CRISPR-based gene-editing termed "Prime Chop or Change" (PCOC), which enables the insertion of specific (correct) gene edits (without a requirement for HDR) or inactivation of mutant alleles by the generation of inactivating mutations, to thereby facilitate phenotypic rescue for the treatment of diseases caused by dominant gain-of-function or dominant negative mutation such as adRP.

[0139] The present disclosure provides, in a first aspect, an agent for treating or preventing a genetic disease, preferably a disease caused by dominant gain-of-function or dominant negative mutation, in a subject, wherein said agent comprises: a prime editing (PE) endonuclease comprising a CRISPR-associated (Cas) endonuclease-reverse transcriptase fusion protein (PE nuclease) and a prime editing guide (peg)RNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease (e.g. to edit the site to correspond to that of the wild type), or a polynucleotide molecule comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease and a pegRNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, or one or more polynucleotide sequence(s) comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease and a second nucleotide sequence(s) encoding or comprising a pegRNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, such that, following delivery of the agent to a suitable cell of said subject, the editing complex induces either desired editing or inactivation of the mutant gene (knock-out) in said cell.

[0140] The agent may be used for treating adRP or, for example, other diseases caused by dominant gain-of-function or dominant-negative mutations such as Huntington's Disease, amyotrophic lateral sclerosis (ALS) caused by a SOD1 G93A mutation, SCN8A encephalopathy and others.

[0141] In a second aspect, the second disclosure provides a pharmaceutical composition comprising an agent according to the first aspect in combination with a pharmaceutically acceptable carrier, diluent and / or excipient.

[0142] In a third aspect, the second disclosure provides a method for treating a subject afflicted with, or predisposed to, a genetic disease, wherein the method comprises administering the agent of the first aspect or a pharmaceutical composition of the second aspect to the said subject.

[0143] In a fourth aspect, the second disclosure provides the use of the agent of the first aspect for treating or preventing a genetic disease.

[0144] In a fifth aspect, the second disclosure provides the use of the agent of the first aspect in the manufacture of a medicament (e.g. a pharmaceutical composition) for treating or preventing a genetic disease. BRIEF DESCRIPTION OF FIGURES

[0145] Figure 14 provides: (A) a schematic diagram showing the insertion of specific gene edits (pink) into a target sequence of a mutated gene (allele) using the prime editing (PE)-nuclease system described in Adikusuma F et al., Nucleic Acids Res 49(18):10785-10795, 2021. The abbreviations used in the figure are as follows: PBS – primer binding site, RTT – reverse transcription-template, NHEJ – non-homologous end joining pathway, RT – reverse transcriptase, DSB – double-strand break. While the diagram particularly depicts editing to correct a mutated site within the genomic DNA, it is to be appreciated that the editing complex may facilitate the incorporation of indels (i.e. the "insertion or deletion" of nucleotides) via non-homologous-mediated end-joining repair mechanisms (NHEJ) after the double-stranded DNA break (cleavage) to inactivate the mutant allele (without needing to rely on a repair process such as HDR); and (B) provides a schematic diagram of a PE nuclease construct used in this examples hereinafter. The prime editor nuclease is composed of a Cas nuclease fused to a reverse transcriptase through linker sequences. To facilitate efficient localisation within the nucleus, the PE nuclease is equipped with four nuclear localisation signals (NLSs);

[0146] Figure 15 provides a schematic diagram showing a "first generation" knock-out (KO), CRISPR-based approach to treating adRP, and a novel "next generation" approach involving a Prime Chop or Change (PCOC) strategy according to the present second disclosure. The KO only approach results in a "partial" phenotypic rescue as a consequence of rendering the dominant mutant allele inactive (i.e. knocked-out) of the RHO gene, whereas the PCOC approach may result in the correction of the mutation of the dominant mutant allele for the full phenotypic rescue in some cells, or at least render the dominant mutant allele inactive in other cells (i.e. by generating inactivating mutationswithin the mutant allele, particularly indels ("insertion-deletion" of nucleotides) and / or partial template duplications (PTDs) to inactivate the mutant allele);

[0147] Figure 16 provides the results of conventional CRISPR nuclease allele-specific targeting RHO P23H using SpCas9-NG and gRNA RHO P23H NG4. HEK293TRHOP23H / +disease model cells were transfected with CRISPR expression constructs for expressing the SpCas9-NG nuclease and gRNA. Untransfected HEK293TRHOP23H / +cells were used as a control. The results shown are the average of at least n=3 replicate experiments;

[0148] Figure 17 provides: (A) the results of PCOC strategy study using SpCas9-NG-PE-nuc fusion protein. In this case, HEK293TRHOP23H / +disease model cells were transfected with CRISPR expression constructs for expressing the SpCas9-NG PE nuclease and pegRNAs. Untransfected HEK293TRHOP23H / +cells were used as a control. The results shown are the average of at least n=3 replicate experiments; and (B) provides result of targeting P23H using conventional PE nickase PE3 strategy. HEK293TRHOP23H / +disease model cells were transfected with CRISPR expression constructs for expressing the SpCas9-NG PE (nickase), a pegRNA and a second-nick gRNA. Untransfected HEK293TRHOP23H / +cells were used as a control. The results shown are the average of at least n=3 replicate experiments;

[0149] Figure 18 provides the results of a study of PCOC strategy targeting RHO P23H; this time intended to discover PCOC strategy using SaCas9 PE nuclease. The HEK293TRHOP23H / +disease model cells were transfected with CRISPR expression constructs coding for pegRNAs and a SaCas9-PE- nuclease fusion protein. Untransfected HEK293TRHOP23H / +cells were used as a control, along with a "Neo control" (sham control), namely HEK293TRHOP23H / +cells transfected with a control PEA1 plasmid with neomycin targeting gRNA (i.e. which does not target the RHO locus). The results shown are the average of n=3 replicate experiments;

[0150] Figure 19 provides the results of a further study involving a PCOC strategy of the present second disclosure; this time involving the use of the SpCas9-VQR PE nuclease or eSpCas9-VQR-PE nuclease (High Fidelity version of SpCas9 VQR) fusion protein. In addition to the particular PE nuclease, the CRISPR expression constructs also coded for pegRNA RHO P23H VQR20 RTT1 or pegRNA RHO P23H VQR21 RTT1. Untransfected HEK293TRHOP23H / +cells were used as a control, along with a "Neo control" (sham control), namely HEK293TRHOP23H / +cells transfected with a control PEA1-nuclease plasmid with neomycin targeting gRNA (i.e. which does not target the RHO locus). The results shown are the average of n=3 replicate experiments;

[0151] Figure 20 shows the results of the use of a CRISPR nuclease allele-specific targeting strategy on adRP disease model HEK293T cells including a RHO-T17M allele. The cells were transfected witha CRISPR expression construct coding for a gRNA RHO T17M Sp-A, Sp-B or Sp-C and a Cas nuclease, namely SpCas9-nuclease (SpCas9-nuc) and eSpCas9-nuclease (eSpCas9-nuc). Untransfected HEK293TRHOT17M / +cells were used as a control;

[0152] Figure 21 shows the results of the use of the PCOC strategy of the second disclosure on HEK293TRHOT17M / +disease model cells. In this study, the cells were transfected with a CRISPR expression construct coding for SpCas9-PE nuclease or eSpCas9-PE nuclease fusion protein, along with a pegRNA. Untransfected HEK293TRHOT17M / +cells were used as a control. The results shown are the average of n=3 replicate experiments;

[0153] Figure 22 provides the results of a study using a PCOC strategy, again using the HEK293TRHOT17M / +disease model cells, but this time transfected with a CRISPR expression construct coding for SpCas9-NG-PE nuclease fusion protein, along with pegRNA. The study investigated the effect of using different RTT sequences. Untransfected HEK293TRHOT17M / +cells were used as a control. The results shown are the average of n=3 replicate experiments;

[0154] Figure 23 provides the results of a study investigating the PCOC strategy to target adRP disease model HEK293T cells including a NR2E3-G56R mutant allele (termed HEK293TNR2E3 + / G56R). The model cells were transfected with CRISPR expression constructs for expressing an SpCas9-NG PE nuclease and a pegRNA as shown in Table 16. Various RTTs were also assessed. Untransfected HEK293TNR2E3 G56R / +cells were used as a control. The results shown are the average of n=3 replicate experiments; and

[0155] Figure 24 provides the results of a study investigating the PCOC strategy to target adRP disease model HEK293T cells including a NR2E3-G56R mutant allele (HEK293TNR2E3 + / G56R). The model cells were transfected with PEA1 expression constructs for expressing a SpRY-Cas9 PE nuclease and a pegRNA as shown in Table 26. The results shown are the average of n=3 replicate experiments. DETAILED DESCRIPTION

[0156] Prime editing (PE) represents a revolutionary advancement in CRISPR technology, enabling precise genome modifications including point mutations, insertions and deletions (Anzalone A et al., Nature 576:149-157, 2019). This technique utilises a Cas9 nickase (H840A), a reverse transcriptase (RT) domain, and a prime editing guide RNA (pegRNA). The pegRNA consists of the guide RNA / spacer, along with its scaffold, the Prime Binding Site (PBS) serving as the upstream homology arm, and the Reverse Transcriptase Template (RTT) containing the downstream homology arm and the desired edit sequences. The RT domain facilitates the generation of desired edits by copying theRNA donor template. The typical prime editing process begins with the binding of PE components to the target DNA; thereafter inducing a single-strand break (nick) at the strand containing the NGG PAM sequence. Subsequently, the RNA prime binding sequences (PBS) in the pegRNA bind to the edited DNA strand, and the RT domain extends the RNA-bound DNA by copying the RNA template. This process generates a DNA template containing the desired edit and a short homology arm. The homology arm then anneals to complementary sequences downstream of the cut site, leading to the extension of the genomic sequences by copying the DNA template. Finally, the edited DNA is resolved and joined, resulting in precise genome modification. While prime editing relying solely on the pegRNA (termed "prime editor 2"; PE2) is typically inefficient, the use of a "second-nick gRNA" to achieve a second nick on the opposite strand, known as "prime editor 3" (PE3; Anzalone AV et al., Nature 576:149-157, 2019), can be employed to enhance efficiency. Prime editing does not generate a high frequency of indels. Consequently, the alleles that are not successfully prime edited should remain unmodified, preserving their original sequences.

[0157] In work leading to the second disclosure, the Applicant looked to improve prime editing rates achieved with their prime editing "all-in-one" ("PEA1") plasmids (Adikusuma et al., 2021 supra). This involved the development of a Prime Editing-nuclease CRISPR system (PE-nuclease), which generates double-stranded DNA breaks (in contrast to the single-stranded breaks generated with conventional prime editing), to potentially bypass any rate-limiting repair mechanisms. In K562 and HeLa cells, it was found that PE-nuclease induced prime editing. The Applicant also observed that the majority of alleles that did not undergo prime editing had indels. This is in contrast to conventional prime editing (nickase), where the alleles that are not successfully prime edited remain unmodified. The indels induced by PE-nuclease result from the incorporation of extra sequences derived from the reverse transcriptase template, termed partial template duplications (PTDs), as well as from modifications commonly seen in standard Cas9 nuclease activity. This highlights a unique aspect of PE-nuclease-mediated editing compared to conventional prime editing. It was later recognised by the Applicant that the ability of the PE-nuclease system to correct and / or inactivate alleles (i.e. by the generation of indels and / or PTDs) may be advantageous in certain therapeutic applications, particularly in the treatment of diseases caused by dominant gain-of-function or dominant-negative mutations such as autosomal dominant retinitis pigmentosa (adRP).

[0158] The most common mutation causing autosomal dominant retinitis pigmentosa (adRP) is a "gain-of-function" mutation in a single allele (Diakatou M et al., Int J Mol Sci 20:2542, 2019). In particular, the RHO disease-variant P23H causes progressive loss of vision via a toxic gain-of-function (GOF) mechanism (Athanasiou D et al., Prog Retin Eye Res 62:1-23, 2018), wherein the mutation causes misfolded RHO-P23H protein to accumulate in rod photoreceptor cells, overwhelming the proteasome and resulting in the gradual toxic accumulation of RHO-P23H, which causes retinal degeneration. The affected gene, RHO, is largely haplosufficient (i.e. one normal copy of the gene issufficient for normal vision (Diakatou et al., 2019 supra; and Haider NB et al., Nat Genet 24:127-131, 2000)), which means that, for example, a CRISPR-based methodology that specifically ablates (i.e. inactivates) the causative mutant allele so as to prevent expression of the mutant proteins (in other words, "knocks-out" the dominant mutant allele) can provide a potentially viable therapy for adRP (which may halt or even reverse the retinal degeneration in affected patients). In such an approach, the normal copy of the gene provides for "disease rescue" (i.e. phenotypic rescue via haplosufficiency) such that the treatment may be effective without needing to rely on a repair process such as HDR. However, since RHO is not completely haplosufficient, more desirably the CRISPR-based methodology would enable the insertion of specific gene edits so as to correct the mutant allele so that treated cells have a "full" phenotypic rescue (i.e. where the expression of each allele results in correct, "wild-type" proteins). This ought to increase the efficacy of treatment and may avoid some abnormalities in retinal morphology and photoreceptor function (nb. outer segment retinal morphology is abnormal in heterozygous RHO KO mice, and electroretinogram photo-response is significantly blunted (see Makino C et al., PLOS One 7:337832, 2012; and Lem J et al., Proc Natl Acad Sci U S A 96:736-741, 1999), while photoreceptor function has also been observed to be compromised in heterozygous null humans, which in rare cases can manifest clinically (Rosenfeld P et al., Nat Genet 1:209-213, 1992; and Rosenfeld P et al., Invest Ophthalmol Vis Sci 36:2186-2192, 1995)).

[0159] The second disclosure of the present specification relates to a novel strategy for the treatment of genetic diseases such as diseases caused by dominant gain-of-function or dominant-negative mutations such as adRP involving CRISPR-based gene-editing termed "Prime Chop or Change" (PCOC), which enables correct gene-editing of mutant alleles or the inactivation of mutant alleles (i.e. by the generation of indels and / or PTDs), thereby facilitating phenotypic rescue of affected cells by alternative mechanisms. In other words, the PCOC strategy takes advantage of the gene editing outcomes generated by PE-nuclease to induce either correct editing (change) or generate indels / PTDs which knock-out the gene (chop). Either outcome provides a therapeutic benefit, as at a "minimum", the mutant allele is inactivated (ablated), and at the "maximum", wild-type (WT) sequences are restored. Figure 15 provides a schematic comparison of the outcomes of the PCOC strategy (i.e. in the context of treating adRP) versus that achieved with a "first generation" knock-out (KO), CRISPR- based approach. The PCOC strategy utilises a CRISPR-associated (Cas) prime editing (PE) enzyme similar to those previously described (e.g. Anzalone et al., 2019 supra), but wherein the enzyme includes a Cas nuclease (e.g. a Cas9 endonuclease) rather than a nickase fused to a reverse transcriptase (RT) protein or domain.

[0160] Thus, the second disclosure provides, in a first aspect, an agent for treating or preventing a genetic disease, preferably a disease caused by dominant gain-of-function or dominant negative mutation(s), in a subject, wherein said agent comprises:a prime editing (PE) endonuclease comprising a CRISPR-associated (Cas) endonuclease-reverse transcriptase fusion protein (PE nuclease) and a prime editing guide (peg)RNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease (e.g. to edit the site to correspond to that of the wild type), or a polynucleotide molecule comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease and a pegRNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, or one or more polynucleotide sequence(s) comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease and a second nucleotide sequence(s) encoding or comprising a pegRNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, such that, following delivery of the agent to a suitable cell of said subject, the editing complex induces either desired editing or inactivation of the mutant gene (knock-out) in said cell.

[0161] Accordingly, the agent of the second disclosure is capable of "correcting" the mutant allele of the cell to which the agent has been delivered (recipient cell) by specifically editing the mutant target site to correspond to that of the wild type, and / or inactivating the mutant allele of the recipient cell by the generation of indels and / or PTDs; thereby facilitating phenotypic rescue of cells affected by, for example, a disease caused by dominant gain-of-function or dominant negative mutation(s). By "correcting" the mutant allele, it is to be understood that this includes editing so as to replace the mutant nucleotide(s) of the mutated site with the particular nucleotide(s) found at the corresponding site of the wild-type allele or with nucleotide(s), which due to codon redundancy (i.e. the redundancy in the genetic code), ensure that the protein translated from the edited allele comprises the amino acid sequence of the wild-type protein.

[0162] The agent may be used for treating adRP or, for example, other diseases caused by dominant gain-of-function or dominant-negative mutations such as Huntington's Disease, ALS caused by a SOD1 G93A mutation, SCN8A encephalopathy and others. For the treatment of adRP, the editing complex formed from the said PE nuclease and pegRNA is targeted to a mutant RHO or NR2E3 gene allele, such as RHO-P23H, RHO-T17M and NR2E3-G56R allele. For the treatment of ALS caused by a SOD1 G93A mutation, the editing complex formed from the said PE nuclease and pegRNA is targeted to the mutant SOD1-G93A mutation gene allele.

[0163] As mentioned above, the PE nuclease comprises a CRISPR-associated (Cas) endonuclease- reverse transcriptase fusion protein.

[0164] The Cas endonuclease portion of the fusion protein may be selected from, for example, any Cas endonuclease which recognises a suitable PAM sequence matching a desired target mutated site. Thus, the Cas endonuclease may be selected from, for example, SpCas9 (which recognises the PAM sequence, NGG), SpCas9-NG which recognises an NG PAM (Nishimasu H et al., Science 361:1259- 1262, 2018), SpCas9-VQR which recognises an NGA PAM sequence (Kleinstiver BP et al., Nature 523(7561):481-485, 2015), SaCas9 which recognises an NNGRRT or NNGRRN PAM sequence (Maeder M et al., Nat Med 25:229-233, 2019), and SaCas9-KKH which recognises an NNNRRT PAM sequence. Where "off-target" activity by the editing complex is a concern, then it may be preferred that a "high fidelity" Cas endonuclease be selected such as, for example, eSpCas9(1.1), HypaCas9 (Ikeda A et al., Commun Biol 2:371, 2019) and SpCas9-HF1 (Kleinstiver BP et al., Nature 529(7587):490-495, 2016). Otherwise, the Cas endonuclease portion of the fusion protein may be a Cas endonuclease which does not require a PAM sequence or is regarded as "near-PAMless" (e.g. SpRY-Cas9).

[0165] The reverse transcriptase (RT) portion of the fusion protein may be selected from Moloney murine leukemia virus (M-MLV) RT, Schizosaccharomyces pombe Tf1 retrotransposon RT, porcine endogenous retrovirus (PERV) RT, koala retrovirus (KoRV) RT, avian reticuloendotheliosis virus (AVIRE) RT, woolly monkey sarcoma virus (WMSV) RT, or their engineered versions. The RT portion of the fusion protein will typically be fused to the C-terminal of the Cas endonuclease; however the alternative, wherein the RT portion is fused to the N-terminal of the Cas endonuclease, is also envisaged. As used herein, the term "Cas endonuclease" is to be understood as including functional fragments of Cas endonuclease enzymes which retain the ability to make specific cuts in genomic DNA as targeted by a pegRNA. Similarly, the term "reverse transcriptase" is to be understood as including functional fragments of reverse transcriptase enzymes which retain an activity of an RNA-dependent DNA polymerase, particularly to reverse transcribe a single-stranded RNA sequence into a single-stranded DNA, from which a double-stranded DNA may be synthesised. The PE nuclease, and polynucleotide molecules for expression of same, may be prepared in accordance with standard methodologies well known to those skilled in the art. In some embodiments, the PE nuclease may be operably expressed with one or more other useful elements or domains, such as one or more nuclear localisation signal (NLS) (eg one or more of any of the NLS domains or "tags" comprising one or more short sequences of lysine and / or arginine well known to those skilled in the art). In particular embodiments, the PE nuclease may comprise 2, 3 or 4 NLS domains, which may enhance the editing efficiency of the agent. In further particular embodiments, the PE nuclease may comprise 2, 3 or 4 copies, in an adjacent repeat arrangement, of an NLS sequence selected from the group consisting of: SV40 NLS, nucleoplasmin NLS and c-Myc NLS.

[0166] The pegRNA may comprise the typical sequence components of pegRNA molecules as are well known to those skilled in the art. In particular, the pegRNA may comprise a single guide (sg)RNA comprising both a targeting nucleotide sequence (otherwise known as the gRNA spacer sequence, which is typically of ~20 nucleotides in length and defines the genomic sequence to be targeted) and a scaffold sequence for binding to the Cas endonuclease portion of the PE nuclease (also known as the trans-activating RNA (tracrRNA) and which is typically between 50 and 150 nucleotides in length), a reverse transcriptase template (RTT) sequence (comprising an appropriate RNA sequence to effect the desired edit to the target mutated site, which may be of 25 to 75 nucleotides in length but are typically about 25 to 30 nucleotides in length) and a primer binding sequence (PBS). In other words, the pegRNA may comprise an sgRNA ("gRNA") with a 3' extension sequence including a reverse transcriptase primer binding site and the desired gene edit. Suitable scaffold sequences, RTTs and PBSs are well known to those skilled in the art (e.g. as detailed by Anzalone et al., 2019 supra). For example, well known scaffold sequences for use with SpCas9-NG and SpCas9-VQR include those that have been described in Nishimasu H et al., Science 361:1259-1262, 2018; the disclosure(s) of which is incorporated herein by reference. In addition, suitable scaffold sequences for use with SaCas9 are also well known to those skilled in the art. However, a preferred scaffold for use with SaCas9 comprises the nucleotide sequence shown below: 5’-GTTTCAGTACTCTGGAAACAGAATCTACTGAAACAAGGCAAAATGCCGTGTTTATCTCGTCAAC TTGTTGGCGAGA-3' (SEQ ID NO: 01); a preferred scaffold for use with SpCas9 or SpCas9-VQR comprises the nucleotide sequence: 5’-GTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGC ACCGAGTCGGTGC-3' (SEQ ID NO: 02); and a preferred scaffold for use with SpCas9-NG comprises the nucleotide sequence: 5’-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG CACCGAGTCGGTGC-3' (SEQ ID NO: 89).

[0167] It is well known to those skilled in the art that, for example, a 5' extension / reduction of the spacer, 3' extension / reduction of the PBS, a 5' extension / reduction of the RTT, the type of intended edits within the RTT, and modification(s) in the scaffold sequences, may or may not affect the efficiency of the agent to effect the desired editing and / or indel or PTD generation (Adikusuma et al., 2021 supra).

[0168] In some embodiments, the targeting nucleotide sequence of the pegRNA is targeted so that the PE nuclease cuts the genomic DNA at, or just upstream, of a short protospacer adjacent motif (PAM) recognised by Cas endonuclease portion of the PE nuclease, and which is upstream ordownstream of the mutated site to be edited. Preferably, the PE nuclease cuts at a site that is about 1 to 25, more preferably about 1 to 10, or even more preferably about 1 to 5, nucleotides upstream of the mutated site to be edited, or 1 to 10, or even more preferably about 1 to 5, nucleotides downstream the mutated site to be edited.

[0169] In some embodiments, the pegRNA may comprise one or more structural modification(s) at the 3' end of the molecule to inhibit 3' degradation which, in turn, can lead to reduced editing efficiency. One suitable example of such pegRNA showing enhanced stability through 3' structural modification is referred to hereinafter as "engineered pegRNA" or "epegRNA" and includes an evopreQ1 or mpknot sequence motif (see Nelson J et al., Nat Biotech 40:402-410, 2021).

[0170] In some embodiments, where the pegRNA is produced synthetically, the pegRNA may include one or more chemical modification to increase the stability of the pegRNA and / or editing complex (eg the incorporation of one or more nucleotide with a 2'O-methyl (2'OMe) or 2'-O- methoxyethyl (MOE) ribose modification, one or more 5'-methylcytosine (MeC) nucleotide, and / or one or more phosphorothioate (PS) backbone linkage).

[0171] In some embodiments, the agent may comprise: a prime editing (PE) endonuclease comprising a CRISPR-associated (Cas) endonuclease-reverse transcriptase fusion protein (PE nuclease), a prime editing guide (peg)RNA and a second-nick guide RNA (gRNA), wherein said pegRNA and gRNA forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, or a polynucleotide molecule comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease, a pegRNA and a second-nick guide RNA (gRNA), wherein said pegRNA and gRNA forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, or one or more polynucleotide sequence(s) comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease, a second nucleotide sequence(s) encoding or comprising a pegRNA and a third nucleotide sequence(s) encoding or comprising a second-nick guide RNA (gRNA), wherein said pegRNA and gRNA forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, such that, following delivery of the agent to a suitable cell of said subject, the editing complex induces either desired editing or inactivation of the mutant gene (knock-out) in said cell.

[0172] As will be well known to those skilled in the art, the second-nick gRNA may be suitably targeted such that the editing complex induces a second single-strand break (nick) at a distance in the range of, for example, 30-150 nucleotides / bp (but more preferably, 40-100 nucleotides / bp) from the first nick (ie the pegRNA-induced nick). Preferably, the site of the second nick will be positioned 3′ of the first nick and, preferably, in the non-edited strand (ie the strand without the first nick), which may then enable strand excision and enhance the prime editing process.

[0173] The agent may be provided in the form of at least one ribonucleoprotein complex (RNP), that is the agent may comprise a formed editing complex comprising the PE nuclease and the pegRNA (i.e. the formed editing complex may be regarded as constituting an RNP), or the agent may comprise a polynucleotide molecule such as an expression vector / construct and / or viral vectors suitable for delivery to the subject, wherein the polynucleotide molecule comprises a first nucleotide sequence coding for the PE nuclease (and operably linked promoter and / or regulatory sequences) to enable expression or production of the PE nuclease and pegRNA (and, in some embodiments, second-nick gRNA), such that, following delivery of the agent to a suitable cell of said subject, the PE nuclease is expressed or produced and thereafter forms an editing complex with the pegRNA (and, in some embodiments, second-nick gRNA). Those skilled in the art will readily appreciate that an equivalent outcome may also be achieved by providing the first nucleotide sequence (i.e. coding for the PE nuclease) as mRNA for translation of the PE nucleases, and accordingly, such embodiments are also to be regarded as encompassed within the scope of the present second disclosure.

[0174] Alternatively, the agent may comprise one or two (or more) polynucleotide molecules such as expression vectors / constructs and / or viral vectors (e.g. baculovirus delivery vectors) suitable for delivery to the subject, such that a first nucleotide sequence coding for the PE nuclease (and operably linked promoter and / or regulatory sequences) to enable expression or production of the PE nuclease and a second nucleotide sequence encoding the pegRNA (and operably linked promoter and / or regulatory sequences), may be provided on the same or different polynucleotide molecules (e.g. the first and second nucleotide sequences may be provided on one vector / construct, or the first nucleotide sequences may be provided on one vector / construct and the second nucleotide sequence provided on another vector / construct). In some embodiments, the expression vectors / constructs and / or viral vectors may comprise a third nucleotide sequence(s) encoding a second-nick guide RNA (gRNA) (and operably linked promoter and / or regulatory sequences).

[0175] In some preferred embodiments, the agent is provided as an "all in one" expression vector / construct; that is, a single polynucleotide molecule comprising the first nucleotide sequence coding for the expression or production of the PE nuclease, and the second nucleotide sequence encoding pegRNA (and, in some embodiments, a third nucleotide sequence(s) encoding a second-nick guide RNA (gRNA)). In such embodiments, the first and second (and, in some embodiments, third)nucleotide sequences are provided on an expression vector, each operably linked to a suitable promoter sequence (e.g. a polymerase II promoter sequence such as CMV, CBh, EF1a, RHO or Ck8e, or a polymerase III promoter such as the well-known human U6 promoter sequence, H1 promoter sequence, 7SK promoter sequence or SV40 promoter sequence) for the production of the PE nuclease and pegRNA. The promoter sequences for the production of the PE nuclease and pegRNA (and, in some embodiments, second-nick gRNA) may be the same or different; for example, in one particular embodiment, the first and second nucleotide sequences may both be operably linked to a human U6 promoter sequence such that the expression vector comprises two "hU6 cassettes". In another particular embodiment, the first nucleotide sequence is operably linked to the CBh promoter sequence, and the second nucleotide sequence is operably linked to the hU6 promoter sequence.

[0176] One example of a suitable expression vector is the all in one expression vector known as the PEA1 plasmid and described by Adikusuma et al, 2021 supra, wherein the PE nuclease is expressed from a nucleotide sequence coding for the expression or production of the PE nuclease (i.e. a "first nucleotide sequence") operably linked to the CBh promoter sequence, and the nucleotide sequence encoding pegRNA (i.e. the second nucleotide sequence) is operably linked to the hU6 promoter sequence.

[0177] The agent may be prepared for delivery to the subject in the form of a viral delivery vector or virus-like particles (VLPs) including engineered virus-like particles (eVLPs). Examples of suitable viral delivery vectors include the "typical" adeno-associated virus (AAV) vector (as described in, for example, Naso MF et al., BioDrugs 31(4):317-334, 2017; and Xu CL et al., Viruses 11(1):28, 2019), as well as other vectors based upon full length adenovirus (AdV), lentivirus (LV) vectors (e.g. non- integrating lentiviral vectors), and baculovirus (BV) vectors (Aulicinio F et al., Nucleic Acids Res 50(13);7783-7799, 2022) which may, for example, be used with magnetic nanoparticles for complement shielding. Examples of suitable VLPs include those based upon retroviral capsids (e.g. VLPs based upon the gag polyprotein of Friend murine leukaemia virus (FMLV) which have been shown to be capable of delivering encapsulated macromolecules to the eye; Banksota S et al., Cell 185:250-265, 2022). However, the agent may also be prepared for delivery to the subject in other forms well-known to those skilled in the art, such as non-viral vector systems including liposomes, lipid nanoparticles (LNPs), delivery forms incorporating a cell-penetrating peptide (CPP), nanoparticles composed of polymeric or other organic materials, and nanoparticles composed of gold (auNPs), silica and / or other inert inorganic materials. The use of nanoparticle delivery forms may, for example, offer advantages in terms of reduced immunogenicity, flexibility in design, and ease of large-scale production for therapeutic use. Suitable delivery vectors such as these and the viral vectors mentioned above have been reviewed in, for example, Lino CA et al., Drug Deliv 25(1):1234-1257,2018; and Behr M et al., Acta Pharm Sin B 11(8):2150-2171, 2021; the disclosure(s) of which are incorporated herein by reference.

[0178] In some preferred embodiments, the agent is prepared for delivery to the subject in the form of an AAV delivery vector(s). AAVs have been routinely used for the in vivo delivery of various polynucleotide molecules for therapeutic purposes. In one particular embodiment, the first and second nucleotide sequences are provided on a split-intein dual AAV delivery vector system (see, for example, Davis JR et al, Nat Biotechnol 42:253-264, 2024; the disclosure(s) of which is incorporated herein by reference) in an arrangement such that, for example, the first nucleotide sequence coding for the PE nuclease (or part of the PE nuclease) is operably linked to a suitable promoter sequence (e.g. a strong constitutive promoter sequence such as a polymerase II promoter such as the well-known cytomegalovirus (CMV) promoter sequence, or any one of the MHCK7, CbH, CAG and U1A promoter sequences), and the second nucleotide sequence is operably linked to a suitable promoter sequence (e.g. a strong constitutive promoter sequence such as a polymerase III promoter such as the well-known human U6 promoter sequence, H1 promoter sequence, 7SK promoter sequence or SV40 promoter sequence) for the production of the pegRNA.

[0179] In some other preferred embodiments, the agent is prepared for delivery to the subject in the form of an LV delivery vector(s). Recent work has indicated that a delivery vector based upon a self- inactivating non-integrating lentivirus can be successfully used for delivery of CRISPR-Cas systems (Ling S et al., Nature Biomed Eng 5:144-156, 2021) with very high efficiency. In this example, the LV delivery vector co-delivered to the target cell, mRNA encoding for the Cas endonuclease and an expression cassette (incorporated into the lentiviral genome) for production of gRNA (by transcription) by the target cell. Such vectors characteristically produce a "burst" of Cas endonuclease expression (due to the rapid degradation of the mRNA in the cell) which may prevent or reduce the potential for off-target mutations. In the context of the second disclosure, and in circumstances where it may be desired to express the PE nuclease and pegRNA from respective expression cassettes within the target cell, LV delivery vectors may be advantageous in that their larger packaging capacity (i.e. as compared to AAVs; ~8.0kb vs. ~4.7kb) enables the generation and delivery of a single LV vector.

[0180] The agent may be administered (in vivo) to the subject by any of the suitable routes of administration including systemic or local routes of administration by, for example, injection such as intravenous (iv), intramuscular (im), intravitreal, subretinal, or intraperitoneal (ip) injection.

[0181] The agent may also be delivered ex vivo to a target cell (which may be provided by an isolated tissue or organ) of the subject, and thereafter, the cell may be suitably administered or transplanted to the subject (eg by intramuscular (im) injection).

[0182] In some particular embodiments, the agent is for treating adRP. In such embodiments, the editing complex formed from the said PE nuclease and pegRNA is targeted to a mutant adRP gene allele, such as RHO-P23H, RHO-T17M and NR2E3-G56R. Also, in such embodiments, the agent is provided, preferably, in the form of a split-intein dual AAV delivery vector system providing the first and second nucleotide sequences, or in the form of LNPs encapsulating, for example, PE nuclease- encoding mRNA and pegRNA, or as an all in one expression vector comprising the first and second nucleotide sequences. Such AAVs and LNPs may be administered (in vivo) to the subject by sub- retinal injection (SRi), or intravitreal injection, so as to deliver the agent to a target cell, particularly a retinal photoreceptor cell. In some cases, the agent may be administered to the subject on a single occasion (i.e. a single dose). The pegRNA sequence may be selected from: For targeting RHO-P23H SEQ ID NOs: 113-117, 121, 122, 124 and 125 For targeting RHO-T17M SEQ ID NOs: 132-134 and 155-163 For targeting NR2E3-G56R SEQ ID NOs: 172-177 and 180-188

[0183] In a second aspect, the second disclosure provides a pharmaceutical composition comprising an agent according to the first aspect in combination with a pharmaceutically acceptable carrier, diluent and / or excipient.

[0184] Examples of suitable carriers and diluents are well-known to those skilled in the art, and are described in, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA 1995. Examples of suitable excipients may be found in the Handbook of Pharmaceutical Excipients, 2ndEdition, (1994), Edited by A Wade and PJ Weller. Examples of suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.

[0185] The pharmaceutical composition may further comprise any suitable binders, lubricants, suspending agents, coating agents and solubilising agents. Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Preservatives, stabilising agents, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Anti-oxidants and suspending agents may be also used.

[0186] The pharmaceutical composition will be administered to a subject afflicted with a genetic disease, or predisposed to a genetic disease, in a therapeutically effective amount, that is an amount sufficient to effect beneficial or desired clinical results. A therapeutically effective amount can be administered in one or more administrations. Typically, a therapeutically effective amount will be sufficient for treating the genetic disease or otherwise to palliate, ameliorate, stabilise, reverse, slow or delay the progression of the disease. Further, and notwithstanding the above, it will be understood by those skilled in the art that the therapeutically effective amount may vary and depend upon a variety of factors including the activity of the gene editing system, the metabolic stability and length of action of the particular gene editing system, the age, body weight, sex and / or health of the subject, the route and time of administration, and the severity of the genetic disease to be treated.

[0187] The pharmaceutical compositions may be intended for single daily administration, multiple daily administration, controlled or sustained release, or at regular intervals (eg every month, every 2 months or every three months) or irregular intervals (eg the period of the interval may, however, vary from time to time across the duration of the subject's treatment) as needed to achieve the most effective results. The pharmaceutical composition may be administered by, for example, intraperitoneal injection (with or without in vivo electroporation by application of suitable square pulses / waves from a standard porator apparatus such as those available from BTX®, Holliston, MA, United States of America).

[0188] In a third aspect, the second disclosure provides a method for treating a subject afflicted with, or predisposed to, a genetic disease, preferably a disease caused by dominant gain-of-function or dominant negative mutation(s), wherein the method comprises administering the agent of the first aspect or a pharmaceutical composition of the second aspect to the said subject.

[0189] In a fourth aspect, the second disclosure provides the use of the agent of the first aspect for treating or preventing a genetic disease, preferably a disease caused by dominant gain-of-function or dominant negative mutation(s).

[0190] In a fifth aspect, the second disclosure provides the use of the agent of the first aspect in the manufacture of a medicament (eg a pharmaceutical composition) for treating or preventing a genetic disease, preferably a disease caused by dominant gain-of-function or dominant negative mutation(s).

[0191] In this specification, a number of terms are used which are well-known to those skilled in the art. Nevertheless, for the purposes of clarity, a number of these terms are hereinafter defined.

[0192] As used herein, the term "treating" includes prophylaxis as well as the alleviation of established symptoms of a disease or condition. As such, the act of "treating" a genetic diseasetherefore includes: (1) preventing or delaying the appearance of clinical symptoms of the disease or condition developing in a subject afflicted with or predisposed to the disease or condition; (2) inhibiting the disease or condition (ie arresting, reducing or delaying the development of the disease or condition or a relapse thereof (in case of a maintenance treatment) or at least one clinical or subclinical symptom thereof; and (3) relieving or attenuating the disease or condition (ie causing regression of the disease or condition or at least one of its clinical or subclinical symptoms).

[0193] As used herein, the phrase "manufacture of a medicament" includes the use of the agent directly as the medicament or in any stage of the manufacture of a medicament.

[0194] The agent of the second disclosure is hereinafter further described with reference to the following non-limiting examples 10-17 and accompanying figures. EXAMPLES Example 10 CRISPR-based treatment of an adRP-causing RHO allele (RHO-P23H)

[0195] Proposed CRISPR-based agents that can specifically ablate the RHO-P23H allele (i.e. "First generation" knock-out only approaches) have limited therapeutic potential because rhodopsin is haploinsufficient. The Applicant identified a novel strategy for CRISPR-based gene-editing termed "Prime Chop or Change" (PCOC), and hypothesised that this would be a more effective therapeutic strategy for RHO-P23H, because the strategy enables the insertion of specific gene edits to correct the mutation (i.e. correcting the RHO-P23H allele to wild-type (WT)) or inactivate the mutation (i.e. by the generation of indels / PTDs) to counteract RHO haploinsufficiency as well as the toxic gain-of- function (GOF).

[0196] Identification of guide RNAs for knocking-out RHO-P23H To identify candidate guide RNA (gRNA) sequences for "KO-only" allele-specific targeting, the human RHO-P23H allele sequence was scanned for all possible CRISPR-Cas9 gRNA options. While it was found that there were no gRNA sequences targeting the P23H site available for the SpCas9 system, gRNAs for three other Cas9 endonucleases were identified. In particular, eight (8) gRNAs for SpCas9-NG were identified (designated RHO P23H NG1-8), two gRNAs for SpCas9-VQR (designated RHO P23H VQR20 and VQR21) and two gRNAs for SaCas9 (designated RHO P23H Sa22 and Sa23). The short protospacer adjacent motif (PAM) sequence for SpCas9-NG is an NG PAM, while SpCas9-VQR binds to an NGA PAM, and SaCas9 binds to an NNGRRT PAM sequence. Where gRNAs of canonical length did not begin with G, an additional G was appended to the 5' end of the gRNA to enhance transcription under the U6 RNA polymerase III promoter. In some instances, this G is naturally occurring in the target sequence (SEQ ID NOS: 92, 94, 95, 97, 99, 100 and 101);otherwise, the additional G creates a mismatch with the target DNA sequence (SEQ ID NOS: 90, 91 and 96). In some cases, where a gRNA starts with an A, an additional G is not required (SEQ ID NOS: 93 and 98). These RHO gRNAs are as shown in Table 8.

[0197] Table 8 gRNA / s acer 5'→3' nucleotide se uence RRRRRRRRRRRR(* An additional G nucleotide was added to the 5' end of the given sequence to enable enhance transcription from the U6 promoter)

[0198] Screening of candidate gRNAs for off-target activity Each of the ten candidate gRNA molecules were screened to ensure that their cleavage activity was limited to the RHO-P23H allele sequence, and there was no substantial cleavage observed in the wild- type (WT) allele. Briefly, HEK293T cells were transfected with CRISPR expression constructs and transfected cells were selected using puromycin. The target site was PCR-amplified and the indels quantified by next-generation sequencing (Illumina Mi-seq).

[0199] Construction of knock-out CRISPR expression constructs SpCas9-NG expression constructs Initially, a plasmid for expressing SpCas9-NG and including a puromycin resistance gene (PuroR) was constructed using standard methodologies known to those skilled in the art; hereinafter Cas9-NG-puro.The nucleotide sequence for SpCas9-NG was as published (Nishimasu et al., 2018 supra). The inclusion of PuroR facilitates enrichment for transfected cells following in vitro transfection. Expression of the Cas9-NG enzyme and PuroR is driven by the well-known CBh promoter (Gray SJ et al., Hum Gene Ther 9:1143-1153, 2011), such that puromycin resistance only occurs in tandem with SpCas9-NG expression. The plasmid also encodes a gRNA site upstream of the scaffold sequence, where the oligonucleotide sequence for a custom gRNA molecule can be inserted for expression of the gRNA by the U6 RNA polymerase III promoter. Subsequently, custom gRNA oligonucleotide versions of the sequences corresponding to the gRNAs in Table 8 (SEQ ID NOs: 90–97) were inserted into the gRNA site of SpCas9-NG-puro to generate eight RHO-P23H-targeting expression constructs, according to standard methodologies known to those skilled in the art. An example of the nucleotide sequence encoding for a gRNA (comprising the P23H RHO NG6 spacer sequence and the scaffold sequence) in a SpCas9-NG-puro expression plasmid is shown below: 5'–GTGTGGTACGCAGCCACTTCGgttttagagctagaaatagcaagttaaaataaggctagt ccgttatcaacttgaaaaagtggcaccgagtcggtgc–3' (SEQ ID NO: 102) (Note. The RHO NG6 spacer sequence is shown in uppercase, while the scaffold sequence is shown lowercase.) SpCas9-VQR expression construct A plasmid for expressing SpCas9-VQR and PuroR was obtained (px459-VQR, Addgene reference: 196971). The nucleotide sequence for SpCas9-VQR was as published (Kleinstiver B et al., Nature 523:481-485, 2015). As above, the inclusion of PuroR facilitates enrichment for successfully transfected cells following in vitro transfection, and expression of the SpCas9-VQR enzyme and PuroR is driven by the CBh promoter (Gray et al., 2011 supra). Again, the plasmid also encodes the gRNA site upstream of the scaffold sequence, and gRNA expression is driven by the U6 RNA polymerase III promoter. Subsequently, custom gRNA oligonucleotide versions of the sequence corresponding to the SpCas9-VQR gRNAs in Table 8 was inserted into the SpCas9-VQR-puro expression plasmid to generate a RHO-P23H-targeting expression constructs, according to standard methodologies known to those skilled in the art. SaCas9 expression construct Initially, an expression plasmid expressing SaCas9 and PuroR was created using standard methodologies known to those skilled in the art; this construct is hereinafter referred to as SaCas9- puro. Further, SaCas9-puro was modified to alter a string of thymine (T) nucleotides in the gRNA scaffold which were predicted to negatively affect the amount of gRNA transcription. In this construct, the expression of the SaCas9 enzyme and PuroR is driven by the CBh promoter (Gray et al., 2011 supra). SaCas9-puro also encodes a gRNA site upstream of the scaffold sequence, from which gRNA expression is driven by the U6 RNA polymerase III promoter. Subsequently, a custom gRNAoligonucleotide version of the sequence corresponding to the SaCas9 gRNA in Table 8 (SEQ ID NO: 98) was inserted into SaCas9-puro-V3 to generate a RHO-P23H-targeting expression construct. The nucleotide sequence encoding for the gRNA (comprising the RHO P23H Sa23 spacer sequence and the preferred scaffold sequence) in the SaCas9-puro expression plasmid is shown below: 5'-GACGGGTGTGGTACGCAGCCACTgtttcagtactctggaaacagaatctactgaaacaaggca aaatgccgtgtttatctcgtcaacttgttggcgaga-3' (SEQ ID NO: 103)(Note. The RHO Sa23 spacer sequence is shown in uppercase, while the scaffold sequence is shown lowercase.)

[0200] Transfection of cells with the CRISPR expression constructs HEK293T cells were transfected with one each of the CRISPR expression constructs according to standard methodologies known to those skilled in the art. The cells were enriched for successfully transfected cells by culturing in the presence of puromycin. The transfected cells were grown until approximately 90% confluent, and then harvested. DNA extraction was performed according to standard methodologies known to those skilled in the art.

[0201] Analysis of alleles in transfected cells The target site, namely nucleotides -12 to 388 of exon 1 the human RHO gene, was amplified using the following primers and standard methodologies known to those skilled in the art: Forward primer: 5'-GGTCAGAACCCAGAGTCATCCAGC-3' (SEQ ID NO: 104) Reverse primer: 5'-AGAGGTGTAGAGGGTGCTGGTGAAG-3' (SEQ ID NO: 105) The primer sequences were provided with standard overhangs (adaptor sequences) for next generation sequencing (NGS) techniques as is well known to those skilled in the art. The indels present in WT alleles were quantified by using standard NGS (Illumina MiSeq™ System; Illumina, Inc., San Diego, CA, United States of America). The results indicated that five of the candidate gRNAs (namely, RHO P23H NG3, RHO P23H NG4, RHO P23H NG6, RHO P23H NG8 and RHO P23H Sa23) exhibited virtually low activity at the WT allele (<10%).

[0202] Analysis of knock-out activity of gRNAs To assay for the specific targeting activity of the gRNAs at the RHO-P23H allele sequence, CRISPR "search-and-replace" prime editing methodologies (see, for example, Anzalone A et al., Nature 576:149-157, 2019) were used to produce adRP disease model HEK293T cells; that is, HEK293T including a RHO-P23H allele (nb. these cells have three (3) copies of RHO). The disease model cells are denoted herein as HEK293TRHOP23H / +cells. Then, in the same manner as that described above, the HEK293TRHOP23H / +cells were transfected with one each of a CRISPR expression construct for each ofthe gRNAs RHO P23H NG3, RHO P23H NG4, RHO P23H NG6, RHO P23H NG8 and RHO P23H Sa23, and encoding the appropriate Cas endonuclease (i.e. SpCas9-NG or SaCas9). PCR amplification of the target site and quantification of the indels present in the RHO-P23H and WT alleles were quantified using the Illumina MiSeq™ system. Strikingly, all five candidate gRNAs achieved almost complete disruption of RHO-P23H alleles: RHO P23H NG3 (only 2.2% of the RHO-P23H alleles remaining), RHO P23H NG6 (5.9% remaining), RHO P23H NG8 (9.5% remaining), RHO P23H NG4 (about 1% remaining; see Figure 16) and RHO P23H Sa23 (3.0%). In contrast, there was no reduction in the WT allele frequencies. In some instances, the observed increase in WT alleles might be misleading. This phenomenon is likely attributed to the presence of large deletions in the mutant allele, which impeded the amplification process during NGS. Consequently, it is considered that the amplification failure of mutant alleles containing these large deletions resulted in an over- representation of WT alleles in the NGS analyses. Example 11 PCOC treatment of RHO-P23H

[0203] Construction of PCOC CRISPR expression constructs "All in one" plasmid (PEA1) generation” A plasmid for accommodating expression cassettes for a Cas endonuclease-RT fusion protein (PE-nuc; i.e. a fusion of a Cas endonuclease and reverse transcriptase (RT) enzyme) and pegRNA (along with a selection marker if desired), so as to provide an all in one plasmid was prepared substantially as previously described (Adikusuma et al., 2021 supra). Briefly, PEA1-nuclease (Nuc)-Puro (SpCas9 PE nuclease) was generated by replacing the H840A sequence of PEA1-Puro (Nickase) (Adikusuma et al., 2021 supra) back to A840H. Additionally, more NLS signals were added to the construct (total= 4 NLSs). Then the construct was modified to introduce mutations in the SpCas9 coding sequences to generate SpCas9-NG PE nuclease or SpCas9-VQR PE nuclease. The particular PE-nuc enzymes used in this study were based upon the SpCas9, SpCas9-NG, SpCas9-VQR and SaCas9 endonucleases and the reverse transcriptase from Moloney murine leukaemia virus (M-MLV RT) described by Anzalone et al., 2019 supra. Sequences encoding a pegRNA may be readily cloned into the PEA1-Nuc-Puro at a gRNA site upstream of a scaffold sequence for expression of the pegRNA by a suitable promoter (e.g. U6 RNA polymerase III promoter). Resultant PEA1-nuclease (targeting) plasmids are sequenced using a suitable primer (e.g. 5’-GGTTTCGCCACCTCTGACTTG-3’; SEQ ID NO: 106) to verify the pegRNA-encoding sequences (guide, scaffold and donor template).

[0204] PCOC treatment of RHO P23H using SpCas9-NG PE nuclease This study sought to employ a PCOC strategy using SpCas9-NG PE nuclease targeting the RHO- P23H. The PE nuclease used was expressed from a SpCas9-NG-PE-nuclease (PCOC) all in oneplasmid. HEK293TRHOP23H / +adRP model cells were transfected (as described above) with the appropriate PEA1-nuclease plasmids. PegRNAs used in the study were based on the gRNAs listed in Table 8, and donor templates shown in Table 9 and included the scaffold sequence as shown in SEQ ID NO: 92. In some cases, the experiments used "engineered pegRNA" (epegRNA) comprising a 3' structural modification of 5'-CGCGGTTCTATCTAGTTACGCGTTAAACC AACTAGAA-3' (SEQ ID NO: 107) to enhance pegRNA stability. Genomic DNA extraction and downstream analysis using next-generation sequencing (NGS) was as described above. The pegRNA sequences are listed in Table 10.

[0205] Table 9 List of donor template sequences D ' ' RRRRR(lower case = point mutation + silent mutation)

[0206] Table 10 List of pegRNA sequences for SpCas9-NG targeting RHO P23H p R R R R R R R RGCAGtCcCTTCGAGTACCCACAG (SEQ ID NO: 116)RHO P23H NG8 GTACTGTGGGTACTCGAAGTgttttagagctagaaatagcaagttaaaata R

[0207] Analysis of the genomic sequences looked for the following allelic sequences: Alleles / Corrected alleles: WT: GTGGTACGCAGCCCCTTCGAGTACCC (SEQ ID NO: 118) P23H: GTGGTACGCAGCCaCTTCGAGTACCC (SEQ ID NO: 119) Corrected alleles: Are the silent mutation version of WT sequences and shown in the RTT sequence of the pegRNA.

[0208] The results are shown in Figure 17A. Using the PCOC strategy, it was possible to efficiently remove the P23H alleles and convert most of these mutants into sequences WT-equivalent sequences, thereby increasing the proportion of functional alleles. It was particularly found that the SpCas9-NG PE-nuclease with pegRNA RHO P23H NG4 RTT4.0-epeg yielded the most optimal results. The PCOC strategy in this case achieved approximately 79.3% removal of the P23H mutant allele, reducing it from 67.5% to 14%. Moreover, the frequency of correction of the mutation was approximately 25.3%, leading to an increase in the proportion of functional alleles from 32.5% to 53.4% (Figure 17A). This study also tested a PE3 strategy using conventional PE nickase, pegRNA - RHO P23H NG4 RTT4.0, and a second-nick gRNA with the nick positioned 3′ of the edit at 81 bp from the pegRNA-induced nick. The PE3 successfully corrected a proportion of mutant alleles to WT- equivalent sequences, but it was found that a large proportion of the mutant alleles were still present (Figure 17B). Example 12 PCOC treatment of RHO-P23H using SaCas9 PE nuclease

[0209] In a similar study to that described above in Example 11, gRNA and RTT optimisation was investigated for a PCOC strategy targeting the RHO-P23H and using the SaCas9-PE nuclease. HEK293TRHOP23H / +adRP model cells were transfected using protocols described previously, followed by (at 24 hours), a change in the media to selection media (normal media + 2 μg / mL Puromycin). Puromycin selection was then continued for 72 hours (media refreshed daily). PegRNAs used in the study were based on the gRNAs shown in Table 8 above (see RHO P23H Sa22 and RHO P23H Sa23). The donor template sequence was as is shown in Table 11, and the pegRNA sequence was as in shownin Table 12. Genomic DNA extraction and downstream analysis using next-generation sequencing (NGS) was as described above.

[0210] Table 11 Donor template SaCas9 PE nuclease for P23H Donor template 5'-3' sequences R

[0211] Table 12 pegRNA sequences for SaCas9 PE nuclease for P23H p ' ' R g R C R t R A

[0212] Analysis of the genomic sequences looked for the following allelic sequences: Alleles / Corrected alleles: WT: GTGGTACGCAGCCCCTTCGAGTACCC (SEQ ID NO: 118) P23H: GTGGTACGCAGCCaCTTCGAGTACCC (SEQ ID NO: 119) WT PEA1 corrected: GTGGTACGCAGCCCGTTCGAGTACCC(SEQ ID NO: 123) (Underline = correction + silent mutation position; italics = primer binding site; bold = repair template)

[0213] The results are shown in Figure 18. Using the PCOC strategy, it was possible to efficiently remove the P23H alleles and convert most of these mutants into sequences WT-equivalent sequences, thereby increasing the proportion of functional alleles. Moreover, it was found that the length of the gRNA (both 22-nt (i.e. gRNA RHO P23H Sa22) and 23-nt (i.e. RHO P23H Sa23) gRNAs were tested) upon which the pegRNA was based, had an impact on PCOC efficiency. In particular, it was found that the 22-nt gRNA length yielded a higher level of efficiency for the removal / correction of the P23H mutant allele. Among the tested combinations, the most optimal PCOC was the pegRNA with a 22-ntgRNA / spacer. This construct achieved approximately 84% removal of the P23H mutant allele, reducing it from 68.5% to 11%. At the same time, the conversion of the mutant allele to a WT- equivalent allele increased the proportion of functional alleles from 31.5% to 54.7%. Example 13 PCOC treatment of RHO-P23H using SpCas9-VQR PE nuclease

[0214] In this study, the PCOC strategy (again targeting RHO-P23H) was investigated using the following PE nucleases: SpCas9-VQR-PE-nuclease and eSpCas9-VQR-PE-nuclease (High Fidelity version of the SpCas9-VQR). SpCas9-VQR recognises an NGA PAM. The High Fidelity (eSp) version includes three amino acid changes that increase target specificity. It was anticipated that these PE nucleases, when used with VQR gRNA, would lead to non-specific targeting, potentially affecting both mutant P23H and WT alleles (see, for example, Li P et al., CRISPR J 1(1):55-64, 2018). HEK293TRHOP23H / +adRP model cells were transfected using lipofection as described above. PegRNAs used in the study were based on the gRNAs shown in the tables below. The donor template sequence was as is shown in Table 13, and the full pegRNA sequence was as is shown in Table 14. Genomic DNA extraction and downstream analysis using next-generation sequencing (NGS) was as described above.

[0215] Table 13 Donor template for SpCas9 VQR PE nuclease targeting RHO P23H D R

[0216] Table 14 pegRNA for SpCas9 VQR PE nuclease targeting RHO P23H p R a R C R a R T

[0217] Analysis of the genomic sequences looked for the following allelic sequences: Alleles / Corrected alleles: WT: GTGGTACGCAGCCCCTTCGAGTACCC (SEQ ID NO: 118)P23H: GTGGTACGCAGCCaCTTCGAGTACCC (SEQ ID NO: 119) WT PEA1 corrected: GTGGTACGCAGCCCGTTCGAGTACCC(SEQ ID NO: 123) (Underline = correction + silent mutation position; italics = primer binding site; bold = repair template)

[0218] With the PCOC strategy tested in this study, it was anticipated that the use of a pegRNA based upon the VQR gRNA would lead to non-specific targeting, and indeed, a reduction in WT alleles was observed indicating that these alleles were also being targeted (see Figure 19). However, owing to the unique capability of the PCOC strategy in generating the desired edit, the conversion of both WT alleles and P23H mutant alleles to WT-equivalent sequences (i.e. corrected alleles) was also seen. With RHO P23H VQR21 RTT1, this resulted in an increase in the proportion of functional alleles from 31% to 60% or 65% in the cells treated with SpCas9-VQR PE-nuclease and eSpCas9- VQR PE-nuclease, respectively (Figure 19). Remarkably, efficient reduction of the P23H mutant alleles was achieved, with the best performing construct (providing the SpCas9-VQR PE nuclease and pegRNA RHO P23H VQR21 RTT1, demonstrating a reduction of mutant alleles from 69% to 2% (Figure 19). These findings underscore an unexpected potential of a PCOC SpCas9-VQR PE nuclease approach for treating adRP caused by the RHO-P23H mutation. Example 14 CRISPR-based treatment of an adRP-causing RHO allele (RHO-T17M)

[0219] In this study, the PCOC strategy described above in Example 11 was adapted to target a different adRP-causing mutation, namely RHO-T17M. The experimental protocol was substantially as described in Example 11, however in this case, a new adRP model was established. In particular, using the same approach as that to generate the HEK293TRHOP23H / +cells, HEK293T were edited to establish heterozygosity for WT / T17M alleles in the RHO gene, resulting in HEK293TRHOT17M / +cells. These cells were then transfected with SpCas9 nuclease or eSpCas9 nuclease (nb. eSpCas9 is an engineered variant with enhanced fidelity) targeting the mutant, followed by puromycin selection facilitated by the presence of a puromycin resistance marker in the construct. Genomic DNA was subsequently harvested from the cells and subjected to next-generation sequencing (NGS). Three different gRNAs were tested, shown in Table 15 below.

[0220] Table 15 gRNA 5'→3' nucleotide sequence RRR (loe case = po ua o a o a uceo e as a e o e e o e g e seque ce o e a e e ance transcription from the U6 promoter)

[0221] The results are shown in Figure 20. It was found that for all of the gRNAs, an effective reduction in the disease mutant allele (RHO-T17M) was achieved. Interestingly, in some instances of treatment involving the eSpCas9 and gRNA versions of gRNA RHO T17M Sp-B or gRNA RHO T17M Sp-C, the observed increase in WT alleles might be misleading. This phenomenon is likely attributed to the presence of large deletions in the mutant allele, which impeded the amplification process during NGS. Consequently, it is considered that the amplification failure of mutant alleles containing these large deletions resulted in an over-representation of WT alleles in the NGS analyses. Example 15 PCOC treatment of RHO-T17M using SpCas9 / eSpCas9 PE nuclease and analysis of correction

[0222] In this study, the PCOC strategy was again adapted to target the RHO-T17M mutation. The experimental protocol was substantially as described in Example 11, but in this case, the HEK293TRHOT17M / +adRP model cells were used. These cells were then transfected with PEA1 plasmids encoding variants of the SpCas9-PE nuclease and eSpCas9 PE nuclease, which also included 4 nuclear localisation signals (NLS) to aid in nuclear transport. In particular, transfection was performed using Lipofectamine 2000, 5 μL with 3 μg plasmid (300K cells plated 24-hours prior in normal (DMEM 89%, FCS 10%, Glutamax 1%) media).24 hours after transfection, the media was changed to selection media (normal media + 2 μg / mL Puromycin), and then the Puromycin selection continued for 72 hours (media refreshed daily). Media was then changed to normal media; cells were grown to confluency before harvest, genomic DNA extraction, and downstream analysis using next- generation sequencing (NGS). PegRNAs used in the study were based on a single gRNA, namely the gRNA RHO T17M Sp-C, due to the position of the cut site that supports the prime editing repair. The donor template (reverse transcriptase template (RTT)+PBS) was selected from those shown in Table 16 below. The full pegRNA sequence is shown in Table 17.

[0223] Table 16 Donor template ( RRR(lower case = pont mutaton + s ent mutaton)

[0224] Table 17 p RRR

[0225] Analysis of the genomic sequences looked for the following allelic sequences: Alleles: WT: CCCTTCTCCAATGCGACGGGTGTGGTACGCAG (SEQ ID NO: 135) T17M: CCCTTCTCCAATGCGAtGGGTGTGGTACGCAG (SEQ ID NO: 140) Corrected alleles: RTT3': CCCTTCTCCAATGCGAccGGTGTGGTACGCAG (SEQ ID NO: 141)RTT5': CCCTTCTCCAATGCcAcGGGTGTGGTACGCAG (SEQ ID NO: 142) RTT35': CCCTTCTCCAATGCcAccGGTGTGGTACGCAG (SEQ ID NO: 143); where corrected allelic sequences, while different from the WT sequences, produce the same WT RHO protein (nb. four different DNA combinations, ACC or ACG or ACT or ACA, produce the same Threonine amino acid). These sequence differences made it possible to readily distinguish between the corrected and the original WT alleles.

[0226] The results are shown in Figure 21. Using the PCOC strategy, it was possible to efficiently remove the T17M alleles and convert a high proportion of these mutants into sequences equivalent to the wild-type (WT) (i.e. encoding the same WT RHO protein), thereby increasing the proportion of functional alleles, which in a clinical setting would most likely lead to enhanced therapeutic efficacy. For instance, in the case of SpCas9 PE-nuc + pegRNA RHO T17M Sp-C RTT3' a reduction in the mutant T17M allele from 52% to 3% was observed. Concurrently, the proportion of functional alleles increased from 47% to 73%, with corrected alleles accounting for 18%. It is considered that the observed increase in WT alleles (shown in black in Figure 21) is likely due to the presence of large deletions in the mutant allele as previously observed. Example 16 PCOC treatment of RHO-T17M using SpCas9-NG PE nuclease and analysis of correction

[0227] In this study, the PCOC strategy was again adapted to target the RHO-T17M mutation, but this time using the SpCas9-NG PE nuclease, wherein SpCas9-NG recognises an NG PAM. Similar to the other PE nuclease constructs, this SpCas9-NG PE nuclease has 4 NLSs. HEK293TRHOT17M / +adRP model cells were transfected (as described above) with the appropriate PEA1-nuclease plasmids. PegRNAs used in the study were based on the gRNAs shown in Table 18 below, the donor template sequence was as is shown in Table 19, and the full pegRNA sequence was as is shown in Table 20.

[0228] Table 18 g RRR bp) (lower case = point mutation)

[0229] Table 19 Donor template for PCOC T17M using SpCas9-NG PE nuclease Donor template sequences (5'-3') n RRRRC RRT RRG

[0230] Table 20 p R R R N R N R N R N epegACCACgCCggTCGCATTGGAGAAGcgcggttctatctagttacgcgttaaa R N R N e R ( R N e

[0231] Analysis of the genomic sequences looked for the following allelic sequences: Alleles / Corrected alleles: WT: CCCTTCTCCAATGCGACGGGTGTGGTACGCAG (SEQ ID NO: 135) T17M: CCCTTCTCCAATGCGAtGGGTGTGGTACGCAG (SEQ ID NO: 140) Corrected alleles: Are the silent mutation version of WT sequences as indicated in the donor template sequences.

[0232] The results are shown in Figure 22. Using the PCOC strategy, it was possible to efficiently remove the T17M alleles and convert some of these mutants into sequences equivalent to the wild- type (WT) (i.e. encoding the same WT RHO protein). Comparison of the various pegRNAs enabled a determination of the most efficient gRNA to target this locus using PCOC (i.e. by assessing overall editing efficiency). As such, the editing observed using a pegRNA with the combination of gRNA2 (19bp) and RTT2 produced the highest amount of total editing (PE +indels), with 69.9% removal of the mutant allele, where ~24.8% represented allelic corrections.Example 17 PCOC treatment for NR2E3 G56R adRP

[0233] In this study, the PCOC strategy was used to target a different adRP-causing allele, this time for the NR2E3 gene. The SpCas9-NG PE nuclease, which recognises an NG PAM and includes 4 NLS motifs, was used. adRP disease model HEK293T cells carrying the NR2E3-G56R mutant allele (termed HEK293TNR2E3 + / G56R), as prepared in a manner similar to that described for the HEK293TRHOP23H / +cells in Example 10, were transfected by lipofection (in the same manner to the lipofection transfections described in previous examples) with PEA1-nuclease plasmid encoding the SpCas9-NG PE nuclease and the pegRNA. The spacer for the pegRNA that was used was gRNA NR2E3 G56R NG4 and NR2E3 G56R NG5 as shown in Table 21 below. The donor templates (RTT+PBS) were as shown in Table 22. The full pegRNA sequences were as shown in Table 23. Genomic DNA extraction and downstream analysis using next-generation sequencing (NGS) was as described above.

[0234] Table 21 g N N(lower case = point mutation)

[0235] Table 22 R RRR RRR(lower case = point mutation + silent mutation)

[0236] Table 23 pegRNA name pegRNA sequences (5'-3') N a R A N a R A N a R A c N a R G N a R G N a R G c

[0237] Analysis of the genomic sequences looked for the following allelic sequences: Alleles / Corrected alleles: WT: GAGACAGCAGCAGCGGGAAGCACTATGGCA (SEQ ID NO: 178) G56R: GAGACAGCAGCAGCaGGAAGCACTATGGCA (SEQ ID NO: 179)

[0238] The results are shown in Figure 23. Using the PCOC strategy, it was possible to efficiently remove the G56R alleles and convert most of these mutants into sequences WT-equivalent sequences, thereby increasing the proportion of functional alleles. Among the various constructs tested, the combination of the SpCas9-NG PE nuclease with pegRNA NR2E3 G56R NG4 RTT4.2-epeg yieldedthe best results. This construct achieved approximately 92% removal of the G56R mutant allele, reducing it from 48% to 4%. Moreover, it corrected the mutation, leading to an increase in the proportion of functional alleles from 52% to 68%. Example 18 PCOC treatment for NR2E3 G56R adRP using SpRY PE nuclease

[0239] In this study, the PCOC strategy was again adapted to target the NR2E3-G56R mutation, but this time using the SpRY-Cas9 PE nuclease, wherein SpRY-Cas9 is a "near-PAMless" (NRN>NYN PAMs) SpCas9 variant (Walton RT et al., Science 368(6488):290-296, 2020). Similar to the other PE nuclease constructs, this SpRY-Cas9 PE nuclease has 4 NLSs. HEK293TNR2E3 + / G56RadRP model cells were transfected (as described above) with the appropriate PEA1-nuclease plasmids. PegRNAs used in the study were based on the gRNAs shown in Table 24 below; the donor template sequence was as is shown in Table 25; and the full pegRNA sequence was as is shown in Table 26.

[0240] Table 24 g NNN(lower case = point mutation)

[0241] Table 25 R R e R e R e(lower case = point mutation + silent mutation)

[0242] Table 26 pegRNA name pegRNA sequences (5'-3') N g S G e A N a S A e A N g S A e A

[0243] The results are shown in Figure 24. Using the PCOC strategy, it was possible to efficiently remove the G56R alleles and convert most of these mutants into WT-equivalent sequences, thereby increasing the proportion of functional alleles. Variable editing outcomes were observed with the PE- nuc-SpRY constructs. For instance, epegRNA4 and epegRNA5 showed minimal prime editing activity and left a high proportion of unmodified mutant alleles. In contrast, epegRNA2 reduced the mutant allele frequency to 1.13% and increased functional alleles to 63.74%, with 12% of these generated by prime editing. These results highlight the potential of SpRY-Cas9 to expand the targetability and enhance the efficacy of the PCOC strategy, providing new avenues for addressing challenging mutations such as NR2E3 G56R.

[0244] Guide RNA (gRNA) / pegRNA sequences as disclosed throughout the specification (including, for example, scaffold sequences and 5'→3' targeting nucleotide sequences) are provided in DNA format (i.e. T instead of U) for consistency with standard sequence listing conventions and ease of reference.

[0245] Throughout the specification and the claims that follow, unless the context requires otherwise, the words "comprise" and "include" and variations such as "comprising" and "including" will be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers.

[0246] The reference to any prior art in this specification is not, and should not be taken as, an acknowledgement of any form of suggestion that such prior art forms part of the common general knowledge.

[0247] It will be readily appreciated by those skilled in the art that the agent, pharmaceutical composition, method and uses of the present disclosures are not restricted in their use to the particular application described. Neither is the agent, pharmaceutical composition, method and uses restricted in their preferred embodiment(s) with regard to the particular elements and / or features described or depicted herein. Further, it will be readily appreciated that the agent, pharmaceutical composition, method and uses are not limited to the embodiment(s) disclosed, but are capable of numerous rearrangements, modifications and substitutions without departing from the scope of the present disclosures.

Claims

CLAIMS:

1. An agent for treating a genetic disease, in a subject, wherein said agent comprises: a first endonuclease or endonuclease complex, or one or more polynucleotide molecule comprising a nucleotide sequence(s) enabling the expression or production of said first endonuclease or endonuclease complex within a cell, wherein the first endonuclease or endonuclease complex is targeted to a gene at a suitable first site positioned within a target exon, or a splice acceptor region, splice donor region or intron core of an adjacent intron of said exon; and a second endonuclease or endonuclease complex, or one or more polynucleotide molecule comprising a nucleotide sequence(s) enabling the expression or production of said second endonuclease or endonuclease complex within a cell, wherein the second endonuclease or endonuclease complex is targeted to said gene at a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon) or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon; such that, following delivery of the agent to a suitable cell of said subject, one or both of the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA of said cell at the first and second sites thereby creating first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site- disrupting insertion-deletion ("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift-causing mutation associated with the said genetic disease.

2. The agent of claim 1, wherein the first and second endonucleases or endonuclease complexes make double-stranded cuts in the genomic DNA as follows: "Dual cut Splice-Splice" The first endonuclease or endonuclease complex cuts at a first site located within the splice acceptor region of the target exon (preferably within the splice acceptor of the adjacent intron upstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the splice donor region of said exon (preferably within the splice donor of the adjacent intron downstream of said exon); "Dual cut Splice-Exon" The first endonuclease or endonuclease complex cuts at a first site located within the target exon and the second endonuclease or endonuclease complex cuts at a second site within the splice donor region (preferably within the splice donor of the adjacent intron downstream of said exon), or the first endonuclease or endonuclease complex cuts at a first sitelocated within the splice acceptor region of the target exon (preferably within the splice acceptor of the adjacent intron upstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the said exon; "Dual cut Splice-Intron" The first endonuclease or endonuclease complex cuts at a first site located within the intron core of the adjacent intron upstream of the target exon and the second endonuclease or endonuclease complex cuts at a second site within the splice acceptor region of said exon (preferably within the splice acceptor of the adjacent intron upstream of said exon), or the first endonuclease or endonuclease complex cuts at a first site located within the splice acceptor region of the target exon (preferably within the splice acceptor of the adjacent intron upstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the intron core of the adjacent intron downstream of said exon, or the first endonuclease or endonuclease complex cuts at a first site located within the intron core of the adjacent intron upstream of the target exon and the second endonuclease or endonuclease complex cuts at a second site within the splice donor region of said exon (preferably within the splice donor of the adjacent intron downstream of said exon), or the first endonuclease or endonuclease complex cuts at a first site located within the splice donor region of the target exon (preferably within the splice donor of the adjacent intron downstream of said exon) and the second endonuclease or endonuclease complex cuts at a second site within the intron core of the adjacent intron downstream of said exon; or "Dual cut Exon-Intron" The first endonuclease or endonuclease complex cuts at a first site located within the intron core of the adjacent intron upstream of the target exon and the second endonuclease or endonuclease complex cuts at a second site within the said exon, or the first endonuclease or endonuclease complex cuts at a first site located within the target exon and the second endonuclease or endonuclease complex cuts at a second site within the intron core of the adjacent intron downstream of said exon.

3. The agent of claim 1 or 2, wherein the first or second endonuclease or endonuclease complex cuts at a site within the target exon and the frameshift-causing mutation associated with the said genetic disease is a frameshift-causing deletion or insertion which creates a premature termination codon (PTC) in said exon and the cut site is within a reframing boundary sequence of the target exon where an indel (if generated within that sequence) can potentially reframe the frameshifted codon.

4. The agent of claim 1, 2 or 3, wherein the first or second endonuclease or endonuclease complex cuts at a site within the intron core of an intron adjacent to the target exon, and the site of the cut is within about 20 to 20000 nucleotides, or within about 2000 nucleotides of the exon-intron junction or within about 1000 nucleotides of the exon-intron junction.

5. The agent of any one of claims 1 to 4, wherein the endonucleases or endonuclease complexes of said agent are selected from gene editing systems such as CRISPR complexes, transcription activator-like effector nucleases (TALEN) and zinc-finger nucleases (ZFN).

6. The agent of any one of claims 1 to 5, wherein the agent is adapted for treating a monogenic disease in a subject, and wherein said agent comprises: at least one polynucleotide molecule comprising: (i) a first nucleotide sequence encoding or comprising a first guide RNA (gRNA) targeted to a gene at a suitable first site positioned within an target exon, or a splice acceptor region, splice donor region or intron core of an adjacent intron of said exon, said first gRNA capable of forming a first CRISPR-Cas complex with a suitable CRISPR-associated (Cas) endonuclease, and wherein, where the first nucleotide sequence encodes the first gRNA, the first nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said first gRNA; and (ii) a second nucleotide sequence encoding or comprising a second guide RNA (gRNA) targeted to said gene at a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon) or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon, said second gRNA capable of forming a second CRISPR-Cas complex (an endonuclease complex) with a suitable Cas endonuclease, which may be the same or different to the said Cas endonuclease with which the first gRNA is capable of forming a CRISPR-Cas complex, and wherein, where the second nucleotide sequence encodes the second gRNA, the second nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said second gRNA; and one or more Cas endonuclease with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, or one or more nucleotide sequence encoding the Cas endonuclease(s) operably linked to a promoter and / or regulatory sequence(s) for expression of the Cas endonuclease(s), such that, upon delivery of the agent to a suitable cell of said subject, the first and second CRISPR-Cas complexes are formed from the Cas endonuclease(s) and the first and second gRNAs and one or both of the formed CRISPR-Cas complexes make double-stranded cuts in the genomic DNA at the first and second sites thereby creating a first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site-disrupting insertion-deletion ("indel") mutation, wherein either or both of the first and second outcomes reframe a frameshift- causing mutation associated with the said genetic disease.

7. The agent of claim 6, wherein the agent comprises at least one polynucleotide molecule comprising (i) and (ii), and (iii) one or more nucleotide sequence encoding the Cas endonuclease(s) with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, wherein said one or more nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for expression of said Cas endonuclease(s).

8. The agent of claim 7, wherein the one or more nucleotide sequence encoding the Cas endonuclease(s) are provided on an expression vector, where the nucleotide sequence(s) is / are operably linked to a strong constitutive promoter sequence.

9. The agent of claim 7, wherein the one or more nucleotide sequence encoding the Cas endonuclease(s) are provided as one or more mRNA for expression of the Cas endonuclease(s).

10. The agent of any one of claims 6 to 9, wherein the Cas endonuclease(s) that may comprise the agent (or nucleotide sequence(s) encoding such other Cas endonucleases) is / are selected from SpCas9, Cas9-NG, SpCas9-VQR, SaCas9, SaCas9-KKH, HypaCas9 and high-fidelity variants thereof.

11. The agent of any one of claims 6 to 10, wherein the agent is adapted for treating Duchenne muscular dystrophy (DMD) in a subject, wherein said agent comprises at least one polynucleotide molecule comprising: (i) a first nucleotide sequence encoding or comprising a first guide RNA (gRNA) targeted to a first site positioned within a target exon (of the DMD gene), or a splice acceptor region, splice donor region or intron core of an adjacent intron of the exon, said first gRNA capable of forming a first CRISPR-Cas complex with a suitable CRISPR-associated (Cas) endonuclease, and wherein, where the first nucleotide sequence encodes the first gRNA, the first nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said first gRNA; and (ii) a second nucleotide sequence encoding or comprising a second guide RNA (gRNA) targeted to a second site positioned within the target exon (other than when the first endonuclease or endonuclease complex is targeted to a first site within the exon), or a splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region) or intron core (other than when the first endonuclease or endonuclease complex is targeted to a first site in the intron core) of an adjacent intron of said exon, said second gRNA capable of forming a second CRISPR-Cas complex with a suitable Cas endonuclease, which may be the same or different to the said Cas endonuclease with which the first gRNA is capable of forming a CRISPR-Cas complex, and wherein, where said second nucleotide sequence encodes the second gRNA, the second nucleotide sequence is operably linked to a promoter and / or regulatory sequence(s) for transcription of said second gRNA; andone or more Cas endonuclease with which the first gRNA and second gRNA form, respectively, the first and second CRISPR-Cas complexes, or one or more nucleotide sequence encoding the Cas endonuclease(s) operably linked to a promoter and / or regulatory sequence(s) for expression of the Cas endonuclease(s), such that, upon delivery of the agent to a suitable cell of said subject, the first and second CRISPR-Cas complexes are formed from the Cas endonuclease(s) and the first and second gRNAs and one or both of the formed CRISPR-Cas complexes make double-stranded cuts in the genomic DNA at the first and second sites thereby creating first outcome of a genomic sequence deletion to achieve exon skipping and / or a second outcome of the generation of a reframing or splice site-disrupting insertion-deletion ("indel") mutation wherein either or both of the first and second outcomes reframe a frameshift- causing mutation associated with said DMD.

12. The agent of claim 11, wherein the first or second endonuclease or endonuclease complex cuts at a site within the target exon and the DMD frameshift-causing mutation associated with the said genetic disease is a frameshift-causing deletion or insertion which creates a premature termination codon (PTC) in said exon and the cut site is within a reframing boundary sequence of the target exon.

13. The agent of claim 11 or 12, wherein the first or second endonuclease or endonuclease complex cuts at a site within the intron core of an intron adjacent to the target exon, and the site of the cut is within about 20 to 20000 nucleotides, or within about 2000 nucleotides of the exon-intron junction or within about 1000 nucleotides of the exon-intron junction.

14. The agent of any one of claims 11 to 13, wherein the first nucleotide sequence encodes or comprises a first gRNA comprising a targeting nucleotide sequence targeted to a first site positioned within a target exon, or within a splice acceptor region, splice donor region or an intron core of the target exon, wherein said target exon is exon-51 including a premature termination codon (PTC), and the second nucleotide sequence encodes or comprises a second gRNA comprising a targeting nucleotide sequence targeted to a second site positioned within said exon-51 (other than when the first endonuclease or endonuclease complex is targeted to a first site within exon-51), splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region of exon-51), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region of exon-51) or intron core of an intron associated with exon-51.

15. The agent of claim 14, wherein the targeting nucleotide sequences of the first and second gRNAs comprise a combination of targeting nucleotides sequences as follows: Dual cut Splice-Splice: One of the splice acceptor-targeting gRNAs such as h51 Sa-Splice, h51 VQR-2 with one of the splice donor-targeting gRNAs such as h51 SD, h51 VQR-s1, h51 VQR-s2 and h51 NG donor A (or variants thereof, such as h51 VQR-s1 (19), h51 VQR-5 (g20) and h51 VQR-s1 (21)); Dual cut Splice-Exon: One of the splice-targeting gRNAs such as h51 Sa-Splice, h51 SD, h51 VQR- s1, h51 VQR-s2, h51 NG donor A, h51 VQR-2 (or variants thereof, such as h51 VQR-s1 (19), h51 VQR-5 (g20), h51 VQR-s1 (21), h51 VQR-2 (g20) and h51 VQR-2 (21)), with one of the exon- targeting gRNAs such as h51 Sp-A, h51 Sp-B, h51 Sa-A, h51 Sa-B, h51 VQR-1, h51 VQR-3, h51 VQR-4, h51 VQR-5, h51 NG-2, h51 NG-4, h51 NG-10, h51 NG-11 (or variants thereof, such as h51 Sp-A g20, h51 Sp-B g19, h51 Sp-B g20, h51 Sp-B 22, h51 Sp-B 23, h51 Sp-B gg20, h51 Sp-B ggg20, h51 Sp-B gcg19, and h51 Sp-B agg20); Dual cut Splice-Intron: One of the splice-targeting gRNAs such as h51 Sa-Splice, h51 SD, h51 VQR- s1, h51 VQR-s2, h51 NG donor A and h51 VQR-2 (or variants thereof, such as h51 VQR-s1 (19), h51 VQR-5 (g20), h51 VQR-s1 (21), h51 VQR-2 (g20) and h51 VQR-2 (21)) with one of the intronic gRNAs such as h51 LiA, h51 LiB, h51 RiA h51 RiB, h51 RiC, h51 LaA, h51 LaB, h51 LaC, h51 RaA, h51 RaB and h51 RaC; or Dual cut Exon-Intron: One of the exon-targeting gRNAs such as h51 Sp-A, h51 Sp-B, h51 Sa-A, h51 Sa-B, h51 VQR-1, h51 VQR-3, h51 VQR-4, h51 VQR-5, h51 NG-2, h51 NG-4, h51 NG-10 and h51 NG-11 (or variants thereof, such as h51 Sp-A g20, h51 Sp-B g19, h51 Sp-B g20, h51 Sp-B 22, h51 Sp-B 23, h51 Sp-B gg20, h51 Sp-B ggg20, h51 Sp-B gcg19 and h51 Sp-B agg20) with one of the intronic gRNAs such as h51 LiA, h51 LiB, h51 RiA, h51 RiB, h51 RiC, h51 LaA, h51 LaB, h51 LaC, h51 RaA, h51 RaB and h51 RaC.

16. The agent of any one of claims 11 to 13, wherein the first nucleotide sequence encodes or comprises a first gRNA comprising a targeting nucleotide sequence targeted to a first site positioned within a target exon, or within a splice acceptor region, splice donor region or an intron core of the target exon, wherein said target exon is exon-53 including a premature termination codon (PTC), and the second nucleotide sequence encodes or comprises a second gRNA comprising a targeting nucleotide sequence targeted to a second site positioned within said exon-53 (other than when the first endonuclease or endonuclease complex is targeted to a first site within exon-53), splice acceptor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice acceptor region of exon-53), splice donor region (other than when the first endonuclease or endonuclease complex is targeted to a first site in the splice donor region of exon-53) or intron core of an intron associated with exon-53.

17. The agent of any one of claims 11 to 13, wherein the targeting nucleotide sequences of the first and second gRNAs comprise a combination of targeting nucleotides sequences as follows:Dual cut Splice-Splice: One of the splice acceptor-targeting gRNAs such as h53A, h53 Sa-A, h53 Sa- B, with one of the splice donor-targeting gRNAs such as h53H or h53I; Dual cut Splice-Exon: One of the splice-targeting gRNAs such as h53A, h53 Sa-A, h53 Sa-B, h53H or h53I with one of the exon-targeting gRNAs such as h53B, h53C, h53D, h53E, h53F, h53G, h53 Sa- C, h53 Sa-D, h53 Sa-E, or h53 Sa-F; Dual cut Splice-Intron: One of the splice-targeting gRNAs such as h53A, h53 Sa-A, h53 Sa-B, h53H and h53I with one of the intron-targeting gRNAs such as h53 Li1, h53 Li2, h53 Li3, h53 Ri1, h53 Ri3, h53 Sa-Ri1, h53 Sa-Ri2, h53 Sa-Ri3, h53 Sa-Li1, h53 Sa-Li2, h53 Sa-Li3 (or variants thereof, such as h53 Sa-Ri1 (23), h53 Sa-Ri2 (22), h53 Sa-Li1 (g21), h53 Sa-Li2 (g21), h53 Sa-Li3 (22)); or Dual cut Exon-Intron: One of exon-targeting gRNAs such as h53B, h53C, h53D, h53E, h53F, h53G, h53 Sa-C, h53 Sa-D, h53 Sa-E, or h53 Sa-F, with one of the intron-targeting gRNAs such as h53 Li1, h53 Li2, h53 Li3, h53 Ri1, h53 Ri3, h53 Sa-Ri1, h53 Sa-Ri2, h53 Sa-Ri3, h53 Sa-Li1, h53 Sa-Li2, or h53 Sa-Li3 (or variants thereof, such as h53 Sa-Ri1 (23), h53 Sa-Ri2 (22), h53 Sa-Li1 (g21), h53 Sa- Li2 (g21) and h53 Sa-Li3 (22)).

18. The agent of any one of claims 11 to 13, wherein the targeting nucleotide sequences of the first and second gRNAs comprise a combination of targeting nucleotides sequences as follows: Dual cut Splice-Splice: One of the splice acceptor-targeting gRNAs such as h45 Sp-A or h45 Sa-A1 (or variants thereof such as h45 Sa-A1 g21), with one of splice donor-targeting gRNAs such as h45 Sp-E and h45 Sp-F; Dual cut Splice-Exon: One of the splice targeting gRNAs such as h45 Sp-A, h45 Sa-A1, h45 Sp-E, or h45 Sp-F (or variants thereof such as h45 Sa-A1 g21), with one of the exon targeting gRNAs such as h45 Sa-R1 or h45 Sa-R2 (or variants thereof such as h45 Sa-R1 g21 and h45 Sa-R1 g22); Dual cut Splice-Intron: One of the splice targeting gRNAs such as h45 Sp-A, h45 Sa-A1, h45 Sp-E, or h45 Sp-F (or variants thereof such as h45 Sa-A1 g21), with one of the intron targeting gRNAs such as h45 Sa-I1, h45 Sa-I2 or h45 Sa-I3; or Dual cut Exon-Intron: One of the exon targeting gRNAs such as h45 Sa-R1 or h45 Sa-R2 (or variants thereof such as h45 Sa-R1 g21 and h45 Sa-R1 g22), with one of the intron targeting gRNAs such as h45 Sa-I1, h45 Sa-I2 or h45 Sa-I3.

19. The agent of any one of claims 6 to 18, wherein the first gRNA and / or the second gRNA comprise a scaffold sequence selected from: GTTTCAGTACTCTGGAAACAGAATCTACTGAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGT TGGCGAGA (SEQ ID NO:01), for use with SaCas9; and GTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGC (SEQ ID NO:02), for use with SpCas9.

20. The agent of any one of claims 6 to 19, in the form of a viral delivery vector or virus-like particles (VLPs) including engineered virus-like particles (eVLPs).

21. The agent of claim 20, wherein the agent is prepared for delivery to the subject in the form of an AAV delivery vector(s) or an LV delivery vector(s).

22. The agent of any one of claims 6 to 21, wherein the agent is delivered by systemic injection.

23. The agent of any one of claims 6 to 22, wherein the agent is delivered ex vivo to a target cell of the subject, and thereafter, the cell is suitably administered or transplanted to the subject.

24. A pharmaceutical composition comprising an agent according to any one of claims 1 to 23 in combination with a pharmaceutically acceptable carrier, diluent and / or excipient.

25. A method for treating a subject afflicted with, or predisposed to, a genetic disease, wherein the method comprises administering the agent of any one of claims 1 to 23 or a pharmaceutical composition of claim 24 to the said subject.

26. The method of claim 25, wherein the method is applied for treating DMD, and the method is commenced upon diagnosis, disease onset and / or the appearance of DMD symptoms, and is continued for the remainder of the subject's life.

27. The use of the agent of any one of claims 1 to 23 for treating or preventing a genetic disease.

28. The use of the agent of any one of claims 1 to 23 in the manufacture of a medicament for treating or preventing a genetic disease.

29. An agent for treating or preventing a genetic disease in a subject, wherein said agent comprises: a prime editing (PE) endonuclease comprising a CRISPR-associated (Cas) endonuclease-reverse transcriptase fusion protein (PE nuclease) and a prime editing guide (peg)RNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, or a polynucleotide molecule comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease and a pegRNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, or one or more polynucleotide sequence(s) comprising a first nucleotide sequence(s) enabling the expression or production of said PE nuclease and a second nucleotide sequence(s) encoding or comprising a pegRNA which forms an editing complex with said PE nuclease targeted so as to edit a mutated site within a mutant gene causative of the said genetic disease, such that, following delivery of the agent to a suitable cell of said subject, the editing complex induces either desired editing or inactivation of the mutant gene (knock-out) in said cell.

30. The agent of claim 29, wherein the genetic disease is a disease caused by a dominant-gain-of- function or dominant negative mutation(s).

31. The agent of claim 29 or 30, wherein the genetic disease is selected from autosomal dominant retinitis pigmentosa (adRP), Huntington's Disease, amyotrophic lateral sclerosis (ALS) caused by a SOD1 G93A mutation, and SCN8A encephalopathy.

32. The agent of any one of claims 29 to 31, wherein the Cas endonuclease portion of the PE nuclease is selected from SpCas9, SpCas9-NG, SpCas9-VQR, SaCas9, SaCas9-KKH, SpRY-Cas9, SpG-Cas9, eSpCas9(1.1), HypaCas9 and SpCas9-HF1.

33. The agent of any one of claims 29 to 32, wherein the reverse transcriptase (RT) portion of the PE nuclease is selected from Moloney murine leukemia virus (M-MLV) RT, Schizosaccharomyces pombe Tf1 retrotransposon RT, porcine endogenous retrovirus (PERV) RT, koala retrovirus (KoRV)RT, avian reticuloendotheliosis virus (AVIRE) RT, woolly monkey sarcoma virus (WMSV) RT, or their engineered versions.

34. The agent of any one of claims 29 to 33, wherein the PE nuclease further comprises one or more nuclear localisation signal (NLS).

35. The agent of claim 34, wherein the PE nuclease comprises 2, 3 or 4 NLS domains.

36. The agent of any one of claims 29 to 35, wherein the pegRNA targets a site that is about 1 to 10 nucleotides upstream of the mutated site to be edited.

37. The agent of any one of claims 29 to 36, wherein the agent is provided as an "all in one" expression vector / construct comprising the first nucleotide sequence coding for the expression or production of the PE nuclease, and the second nucleotide sequence encoding pegRNA.

38. The agent of any one of claims 29 to 36, wherein the agent is provided as a split dual expression vector / construct comprising the first nucleotide sequence coding for the expression or production of the PE nuclease, and the second nucleotide sequence encoding pegRNA.

39. The agent of any one of claims 29 to 36, wherein the agent is provided as a split-intein dual adeno-associated virus (AAV) delivery vector comprising the first nucleotide sequence coding for the expression or production of the PE nuclease, and the second nucleotide sequence encoding pegRNA.

40. The agent of any one of claims 29 to 36, wherein the agent is provided as lipid nanoparticles (LNPs).

41. The agent of any one of claims 29 to 36, wherein the agent is provided as baculovirus delivery vector comprising the first nucleotide sequence coding for the expression or production of the PE nuclease, and the second nucleotide sequence encoding pegRNA.

42. The agent of any one of claims 29 to 41, wherein the agent is for treating adRP and comprises pegRNA targeted to a mutant adRP gene allele selected from RHO-P23H, RHO-T17M and NR2E3- G56R.

43. The agent of claim 42, wherein the pegRNA comprises a nucleotide sequence selected from: For targeting RHO-P23H SEQ ID NOs: 113-117, 121, 122, 124 and 125For targeting RHO-T17M SEQ ID NOs: 132-134 and 155-163 For targeting NR2E3-G56R SEQ ID NOs: 172-177 and 180-188 44. A pharmaceutical composition comprising the agent of any one of claims 29 to 43 in combination with a pharmaceutically acceptable carrier, diluent and / or excipient.

45. A method for treating a subject afflicted with, or predisposed to, a genetic disease, wherein the method comprises administering the agent of any one of claims 29 to 43 or the pharmaceutical composition of claim 44 to the said subject.

46. The use of the agent of any one of claims 29 to 43 for treating or preventing a genetic disease.

47. The use of the agent of any one of claims 29 to 43 in the manufacture of a medicament for treating or preventing a genetic disease.