Use of genes NAT1 and bhlh110 in improving high-temperature resistance of rice

By using gene editing technology to mutate the rice NAT1 gene, the inhibition of bHLH110 was released, wax synthesis was promoted, and the problem of insufficient high temperature resistance of rice was solved, achieving significant improvement in high temperature resistance and agronomic traits.

WO2025190166A1PCT designated stage Publication Date: 2025-09-18ZHEJIANG UNIV

Patent Information

Application Number
PCT/CN2025/081235
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-13
Filing Date
2025-03-07
Publication Date
2025-09-18

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve rice's resistance to high temperatures, resulting in a significant decline in grain production due to climate change.

Method used

By using gene editing technology to mutate the NAT1 gene in rice, the inhibitory effect on bHLH110 is released, the expression of wax synthesis genes CER1 and CER1L is promoted, the wax thickness is increased, and thus the high temperature resistance of rice is enhanced.

Benefits of technology

It significantly improved the high temperature resistance of rice, including the survival rate of seedlings and the improvement of agronomic traits in the reproductive period, especially significantly improved the fruit set rate and yield under high temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025081235_18092025_PF_FP_ABST
    Figure CN2025081235_18092025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed in the present invention is a use of genes NAT1 and bHLH110 in improving high-temperature resistance of rice, for use in using gene editing technology to obtain a rice material having enhanced high-temperature resistance. The base sequence of a rice gene NAT1 is as shown in SEQ ID NO. 1, and the base sequence of a gene bHLH110 is as shown in SEQ ID NO. 4. A base of a rice gene NAT1 of rice is replaced, deleted or inserted through gene editing technology to release inhibition on the rice gene bHLH110, and the expression of wax synthesis genes CER1 and CER1L is promoted by the rice gene bHLH110 to enhance the high-temperature resistance of a plant, thereby preparing a rice material having enhanced high-temperature resistance. According to the present invention, a NAT1 mutant rice material Nipponbare obtained by using CRISPR-Cas9 gene editing technology has remarkably enhanced high-temperature resistance, including an improved survival rate in a seedling stage and improved agronomic traits in a reproductive stage.
Need to check novelty before this filing date? Find Prior Art

Description

Application of genes NAT1 and bHLH110 in improving high temperature resistance in rice Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the application of rice genes NAT1 and bHLH110 in improving the high temperature resistance of rice. Background Art

[0002] In recent years, with the rapid development of industrialization, greenhouse gas emissions have increased, leading to rising temperatures and posing significant challenges to plant growth and agricultural production. For example, in July 2022, a heatwave swept across China, scorching many provinces with temperatures exceeding 40°C for several days. It is estimated that for every 1°C increase in global average temperature, the yield of major crops such as rice, wheat, and corn will decrease by 3-8% (Zhao et al., 2017. Temperature increase reduces global yields of major crops in four independent estimates. Proc. Natl. Acad. Sci. USA, 114:9326-9331). The Food and Agriculture Organization of the United Nations has stated that due to climate change, global food production has declined by 30% since 2007, and the situation is worsening. Rice is a major staple crop in my country and is cultivated on a large scale, making it crucial to national development. Crops face numerous adversities during their growth, including abiotic and biotic stresses. Plants cannot circumvent these stresses through movement or other means; they can only respond effectively by regulating their physiological and biochemical metabolism. Studying the molecular mechanism of rice's response to high temperature stress and creating high-temperature-resistant breeding materials are not only basic scientific issues in the interaction between plants and the environment, but also a major national strategic need for my country to achieve the revitalization of its seed industry.

[0003] This study identified a negative regulator of thermotolerance (NAT1), whose mutants exhibit heat resistance. Molecularly, NAT1 mutants exhibit increased wax content, enhancing heat resistance, a process mediated by the gene bHLH110. Summary of the Invention

[0004] The present invention provides an application of genes NAT1 and bHLH110 in improving the high temperature resistance of rice. A rice material with improved high temperature resistance is obtained by gene editing technology, and does not contain genetically modified components. The NAT1 gene involved in the present invention is a zinc finger transcription factor gene on rice chromosome 7, numbered Os07g0590100 (RAP number) or LOC_Os07g40080 (MSU number). The NAT1 DNA is 894bp long, with 1 exon, and the sequence is shown in SEQ ID NO.1. The coding region CDS is 606bp long, and the sequence is shown in SEQ ID NO.2; it encodes 202 amino acids, and the specific sequence is shown in SEQ ID NO.3. The NAT1 protein contains two zinc finger domains and an EAR domain (ERF-associated amphiphilic repression).

[0005] The rice gene NAT1 is related to high temperature resistance. The base sequence of the gene NAT1 is shown in SEQ ID NO.1, the coding region sequence is shown in SEQ ID NO.2, and the protein sequence is shown in SEQ ID NO.3.

[0006] The NAT1 mutant rice material Nipponbare obtained by the present invention using CRISPR-Cas9 gene editing technology has significantly enhanced high temperature resistance, including improved seedling survival rate and agronomic traits in the reproductive period.

[0007] The high temperature resistance of the mutant nat1 relieves the inhibitory effect on the gene bHLH110.

[0008] The base sequence of gene bHLH110 is shown in SEQ ID NO.4, the coding region sequence is shown in SEQ ID NO.5, and the protein sequence is shown in SEQ ID NO.6.

[0009] The high temperature resistance of the bhlh110 mutant was significantly weakened, while the high temperature resistance of the bHLH110OE overexpressing plants was significantly enhanced.

[0010] bHLH110 promotes the expression of wax synthesis genes CER1 and CER1L, increases wax thickness, and thus positively regulates high temperature resistance.

[0011] The base sequence of gene CER1 is shown in SEQ ID NO.7, the coding region sequence is shown in SEQ ID NO.8, and the protein sequence is shown in SEQ ID NO.9.

[0012] The base sequence of gene CER1L is shown in SEQ ID NO.10, the coding region sequence is shown in SEQ ID NO.11, and the protein sequence is shown in SEQ ID NO.12.

[0013] The present invention provides an application of using the NAT1 gene to change the high temperature resistance of rice, designs sgRNA targeting the NAT1 gene, and adopts CRISPR-Cas9 gene editing technology to obtain mutant plants.

[0014] The NAT1 gene editing target is GCAAGGCGTTCGCGTCGTACC. The present invention provides the design and synthesis of the required primers, obtains the complete sgRNA by PCR amplification, and constructs the transgenic vector using the TKC vector as the backbone. The primers are designed as follows:

[0015] OsU6P-F: GTCGTTTCCCGCCTTCAGTTTATGTACAGCATTACGTAGGNAT1-U6R:

[0016] GGTACGACGCGAACGCCTTGCAACCTGAGCCTCAGCGCAGCNAT1-U6F:

[0017] GCAAGGCGTTCGCGTCGTACCGTTTTAGAGCTAGAAATAGCAAGTTAOsU6T-R:

[0018] CTGTCAAACACTGATAGTTTAAACGATGTGTGCTTACTGTTTAG

[0019] The experimental steps are as follows: The first round of PCR was performed in two tubes, both using a vector containing the U6 promoter and terminator as a template. PCR1: OsU6P-F + NAT1-U6R; PCR2: NAT1-U6F + OsU6T-R. The products of PCR1 and PCR2 were gel-recovered. Subsequently, 0.5 μL of each was used as template for amplification using primers OsU6P-F + OsU6T-R. The two PCR fragments were ligated together. The recovered PCR products were ligated to the TKC vector that had been completely digested with Pme I. Finally, positive transformants were transformed into E. coli and sent for sequencing.

[0020] The present invention provides a CRISPR-Cas9 vector containing the above design.

[0021] The present invention provides Escherichia coli and Agrobacterium containing the above CRISPR-Cas9 vector.

[0022] The present invention provides a method for transforming a designed CRISPR-Cas9 vector into a rice variety Nipponbare using Agrobacterium to screen and obtain genetically modified rice plants. The specific method is as follows: (1) Constructing an engineered bacterium: The constructed CRISPR-Cas9 vector is transformed into the Agrobacterium strain EHA105 by the freeze-thaw method, and the positive Agrobacterium is obtained by screening with kanamycin and rifampicin. (2) Transforming rice callus with the CRISPR-Cas9 vector and obtaining transgenic positive seedlings: Infecting rice callus with EHA105 containing the CRISPR-Cas9 vector and co-culturing in a 22°C culture room for 3 days. After washing the Agrobacterium with a carboxybenzyl solution, the rice callus is placed on a screening medium containing a suitable antibiotic for culture. After 3-4 weeks of culture, resistant calli can be obtained, and the resistant calli are differentiated into seedlings. (3) Identifying whether the target site is mutated. Primer sequences were: NAT1-KO Seq F: GACAGACGCAATCGCATGCAAACG, NAT1-KO Seq R: CAGCAGCAACGACGACGTCTCTGTG. PCR products were sequenced to confirm mutations, and two mutation types were selected for subsequent experiments. NAT1-KO-1 inserts an A into the target region, while NAT1-KO-2 inserts a T; both cause frameshift mutations.

[0023] A rice high temperature resistance gene, wherein base A is inserted into the rice gene NAT1 sequence, and its base sequence is shown in SEQ ID NO. 13. The amino acid sequence of the protein obtained by translating the rice gene NAT1 sequence after the base A is inserted into the rice gene NAT1 sequence is shown in SEQ ID NO. 15.

[0024] A rice high temperature resistance gene, wherein the base T is inserted into the rice gene NAT1 sequence, and the base sequence thereof is shown in SEQ ID NO. 14. The amino acid sequence of the protein obtained by translating the rice gene NAT1 sequence after the base T is inserted into the rice gene NAT1 sequence is shown in SEQ ID NO. 16.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] This study uses gene editing technology to mutate the NAT1 gene in rice to further explore whether the rice's heat resistance is enhanced. The gene and manipulation techniques provided by this study have a significant effect on improving rice's heat resistance and can produce rice materials that are free of transgenic vectors, thus possessing high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 NAT1 gene negatively regulates high temperature resistance

[0028] (af) During the seedling stage, after high temperature treatment, the survival rate of the nat1 mutant was higher than that of the wild type (ab; e), while plants overexpressing NAT1OE were sensitive to high temperature (cd; f). (gr) During the reproductive stage, under normal growth conditions, there were no differences in seed setting rate and yield between the nat1 mutant or NAT1OE-overexpressing plants and the wild type (gi; mo). However, after high temperature treatment, the nat1 mutant showed a higher seed setting rate and yield (ji), while the NAT1OE-overexpressing plants showed a significant decrease (pr).

[0029] Figure 2 High temperature resistance of the mutant nat1 is achieved through enhanced wax synthesis

[0030] (a) Protein NAT1 is localized to the nucleus. (bc) Protein NAT1 has an EAR domain, which indicates that it can inhibit gene expression. (de) Transcriptome data indicate that the high-temperature resistance of the nat1 mutant is associated with increased expression of wax synthesis genes. (fj) After high-temperature treatment, the expression of wax synthesis-related genes is downregulated in wild-type Nipponbare plants, while these genes show an upregulation trend in the nat1 mutant. Simultaneously, quantitative PCR was used to verify the expression levels of the key gene CER1 and its homologous gene CER1L. (k) Scanning electron microscopy showed that more wax accumulated on the leaves of the nat1 mutant, while plants overexpressing NAT1OE showed less. (l) GC-MS analysis of the wax component content showed that the nat1 mutant had a higher wax content.

[0031] Figure 3 Wax synthesis is crucial for plant resistance to high temperatures

[0032] (af) During the seedling stage, high temperature treatment resulted in significantly lower survival rates for the cer1 and cer1l mutants than for the wild type. (gr) During the reproductive stage, under normal growth conditions, the cer1 or cer1l mutants showed no difference from the wild type (gi; mo). However, high temperature treatment significantly reduced the seed setting rate and yield of the cer1 or cer1l mutants (ji).

[0033] Figure 4bHLH110 mediates NAT1's reverse regulation of wax synthesis

[0034] (a) ChIP-qPCR results indicate that NAT1 can bind to the bHLH110 promoter sequence and regulate its expression. (b) Quantitative qPCR results show that bHLH110 expression is increased in the nat1 mutant, while bHLH110 expression is decreased in NAT1OE overexpressing plants. (cd) bHLH110 promoter truncation experiments indicate that NAT1 exerts its regulatory function by binding to the high AGAAAAA sequence. (e) EMAS experiments demonstrate that NAT1 binds to the AGAAAAA cis-acting element. (fh) Promoter truncation experiments indicate that bHLH110 can bind to the CATATG element in the CER1 and CER1L promoters. (i) EMAS experiments demonstrate that bHLH110 binds to the CATATG cis-acting element. (j) Subcellular localization experiments demonstrate that bHLH110 is localized to the nucleus. (kl) Quantitative qPCR results indicate that the expression of the CER1 and CER1L genes is decreased in the bhlh110 mutant, while their expression levels are significantly increased in the overexpressing plants.

[0035] Figure 5bHLH110 positively regulates wax synthesis and improves high temperature resistance

[0036] (af) During the seedling stage, the survival rate of the bhlh110 mutant was lower than that of the wild type after high temperature treatment (ab; e), while plants overexpressing bHLH110OE showed enhanced heat resistance (cd; f). (gr) During the reproductive stage, under normal strip growth conditions, the bhlh110 mutant or bHLH110OE-overexpressing plants were indistinguishable from the wild type (gi; mo). However, under high temperature treatment, the seed set rate and yield of the bhlh110 mutant were significantly reduced (ji), while plants overexpressing bHLH110OE showed higher seed set rate and yield (pr). (st) Wax component content analysis by scanning electron microscopy and GC-MS revealed reduced wax content in leaves of the bhlh110 mutant, while plants overexpressing bHLH110OE accumulated more wax. DETAILED DESCRIPTION

[0037] The following examples are used to illustrate the present invention but are not intended to limit the scope of the invention. The experimental methods in the following examples where specific conditions are not specified are all performed according to conventional procedures. The molecular biology and biochemical methods involved in the examples are all known techniques, primarily with reference to Current Protocols in Molecular Biology, compiled by Ausubel, and Molecular Cloning: A Laboratory Manual, 4th ED., compiled by Green MR and Sambrook J. The experimental materials used in the examples are all commercially available products unless otherwise specified.

[0038] 1. NAT1 negatively regulates plant high temperature resistance

[0039] During the seedling stage, under normal conditions (30°C), there was no growth difference between the nat1 mutant and the wild-type plant Nipponbare. After 2 days of high temperature (45°C) treatment, the nat1 mutant showed higher heat resistance (Figure 1a-f). During the reproductive stage, under normal growth conditions (30°C), there was no difference between the nat1 mutant and the wild-type plants in terms of fruit set rate and yield; however, after 3 days of high temperature (38°C) treatment, the agronomic traits of the nat1 mutant were significantly higher than those of the wild type (Figure 1g-i). At the same time, NAT1 overexpressing plants were also subjected to high temperature treatment. In contrast to the mutant, NAT1OE plants had significantly lower heat resistance than the wild type, both in the seedling stage and the reproductive stage (Figure 1m-r). These results indicate that NAT1 is a negative regulatory gene for heat resistance.

[0040] 2. NAT1 inhibits wax synthesis under high temperature conditions

[0041] NAT1 encodes a C2H2-type transcription factor localized in the nucleus (Figure 2a) and contains an EAR domain, suggesting its ability to repress gene expression (Figures 2b-c). To explore the molecular function of NAT1, transcriptome analysis was performed on wild-type plants and nat1 mutants under normal conditions and high temperature treatment. Genes specifically upregulated in the nat1 mutant compared to Nipponbare under high temperature were selected, and genes upregulated by Nipponbare under high temperature were subtracted, resulting in a total of 492 genes for analysis (Figure 2d). GO analysis revealed that the wax biosynthesis pathway was significantly upregulated in the nat1 mutant (Figure 2e). In wild-type plants, wax biosynthesis genes showed a decreased expression pattern under high temperature stress, whereas these genes were more highly expressed in the mutant (Figure 2h). Quantitative qPCR was performed to validate the expression of two key wax biosynthesis genes, CER1 and its homolog CER1L. Consistent with the transcriptome data, these genes were highly expressed in the nat1 mutant, while their expression was significantly reduced in the overexpression plants (Figures 2f-j). These results indicate that NAT1 inhibits the function of wax biosynthesis genes. Scanning electron microscopy of leaves from mutant and overexpressing plants revealed that after high-temperature treatment, the nat1 mutant exhibited increased wax accumulation (Figure 2k). Wax components were extracted from the leaf surfaces and analyzed by gas chromatography-mass spectrometry. The results also showed that the nat1 mutant had higher levels of wax components (Figure 2l).

[0042] 2. CER1 and CER1L are key genes for wax synthesis

[0043] Given that these results suggest that CER1 and CER1L are involved in wax synthesis, thereby exerting heat resistance, mutants cer1 and cer1l were created. During the seedling stage, under normal growth conditions (30°C), the mutants were indistinguishable from wild-type plants. However, after two days of high temperature treatment (45°C), the mutants' survival rate was significantly reduced (Figures 3a-f). During the reproductive stage, under normal growth conditions (30°C), the mutants were indistinguishable from Nipponbare in terms of seed set rate and yield; however, after three days of high temperature treatment (38°C), the mutants' agronomic traits were significantly reduced (Figures 3g-r). Analysis of wax accumulation and component content revealed that high temperature treatment significantly reduced wax synthesis in the cer1 and cer1 mutants (Figures 3s-u). These results indicate that both mutants play important roles in the wax synthesis pathway.

[0044] 3. NAT1 reduces the wax synthesis pathway by inhibiting the expression of the gene bHLH110

[0045] To further explore whether NAT1 reduces wax content by directly inhibiting the expression of wax synthesis genes, we performed chromatin immunoprecipitation (ChIP) and selected candidate genes from the transcriptome for ChIP-qPCR, including CER1, CER1L, and the wax synthesis gene regulator WR2. The results showed that NAT1 could not directly bind to the promoters of these three genes to exert its function. Instead, the bHLH110 gene was significantly enriched (Figure 4a). At the same time, in the nat1 mutant background, bHLH110 expression was significantly increased, while in the background of NAT1OE overexpressing plants, bHLH110 expression was significantly suppressed (Figure 4b), suggesting that NAT1 can regulate the expression of the gene bHLH110.

[0046] We linked bHLH110 promoters of varying lengths, along with a constitutive 35 promoter, to a luciferase reporter gene and co-expressed them with the NAT1 effector. We found that NAT1 strongly inhibited bHLH110 promoter activity, with this activity dependent on a region extending from -609 bp to -264 bp (pbHLH110-D) (Figure 4c). We further predicted potential NAT1 binding sites within this region and identified three similar A / T-rich cis-elements. We used these cis-element fragments to further characterize their ability to be bound by NAT1 using a luciferase reporter gene. The results showed that pbHLH110-D1 (74 bp, containing two copies of the A / T-rich element) was bound by NAT1 and inhibited its activity, while mutation of the cis-element abolished the inhibitory effect (Figure 4d). Furthermore, electrophoresis retardation assays (EMSAs) further confirmed that NAT1 specifically bound to the probes for these A / T-rich cis-elements (Figure 4e). Therefore, NAT1 directly binds to the bHLH110 promoter and represses its expression.

[0047] 4. bHLH110 is involved in high temperature resistance in rice

[0048] To further investigate the role of bHLH110 in heat tolerance in rice, we constructed and obtained bhlh110 mutants and transgenic plants overexpressing bhlh110. During the seedling stage, 2 days of high temperature (45°C) treatment significantly reduced the survival rate of the mutants, while the overexpressing plants exhibited heat tolerance (Figures 5a-f). During the reproductive stage, under normal growth conditions (30°C), the mutants and overexpressing plants did not differ from the wild type in terms of seed set rate and yield. However, after 3 days of high temperature (38°C), the mutants' agronomic traits were significantly reduced, while the bHLH110OE overexpressing plants showed greater heat tolerance than the wild type (Figures 5g-r). Analysis of wax accumulation and component content revealed that after high temperature treatment, bHLH110 overexpressing plants had higher wax contents, positively regulating heat tolerance (Figures 5s-t).

[0049] 5. bHLH110 can directly regulate CER1 / CER1L expression

[0050] To test whether bHLH110 directly binds to the CER1 / CER1L promoter and regulates expression, truncated CER1 / CER1L promoters of varying lengths were linked to a luciferase reporter gene and transiently co-expressed with the effector bHLH110. We found that bHLH110 promoted promoter activity in two regions of CER1 (C: -1500 bp to -1000 bp and E: -500 bp to -1 bp) (Figure 4f), while bHLH110 promoted CER1L promoter activity only within the region -1000 bp to -500 bp (Figure 4g). bHLH family proteins can bind to E-box sequences (CANNTG) to function, and several different types of elements have been found in these regions: CAATTG, CATATTG, CAGGTG, and CAGTTG. We also used a dual-luciferase reporter system to further analyze the ability of different E-box forms to be regulated by bHLH110. The results showed that bHLH110 can strongly promote the promoter activity of CATATG (Figure 4h). EMSA experiments showed that bHLH110 directly binds to the CATATG element to initiate downstream gene expression (Figure 4i). Subcellular localization results showed that the protein bHLH110 is localized in the cell nucleus and functions (Figure 4j). In addition, as downstream genes of bHLH110, the expression levels of CER1 and CER1L are also regulated by bHLH110. In the mutant bhlh110 background, the expression levels of CER1 and CER1L are low, while in the bHLH110OE overexpressing plants, the expression of both is significantly upregulated (Figure 4k-i). Therefore, bHLH110 directly binds to the CER1 / CER1L promoter and promotes its expression.

Claims

1. Application of rice genes NAT1 and bHLH110 in improving high temperature resistance of rice, characterized in that: The base sequence of the rice gene NAT1 is shown in SEQ ID NO. 1, and the base sequence of the gene bHLH110 is shown in SEQ ID NO.

4.

2. The use according to claim 1, characterized in that Specifically include: Through gene editing technology, the bases of the rice gene NAT1 are replaced, deleted or inserted to release the inhibition of the rice gene bHLH110. The rice gene bHLH110 promotes the expression of wax synthesis genes CER1 and CER1L, thereby enhancing the plant's high temperature resistance and preparing rice materials with enhanced high temperature resistance.

3. The use according to claim 2, characterized in that The gene editing technology uses CRISPR-Cas9 gene editing technology.

4. The use according to claim 2, characterized in that The wax synthesis gene CER1 is shown in SEQ ID NO.

7.

5. The use according to claim 2, characterized in that The wax synthesis gene CER1L is shown as SEQ ID NO.

10.

6. A rice high temperature resistance gene, characterized in that Its base sequence is shown in SEQ ID NO.

13.

7. A protein encoded by a rice high temperature resistance gene, characterized in that Its amino acid sequence is shown in SEQ ID NO.

15.

8. A rice high temperature resistance gene, characterized in that: Its base sequence is shown in SEQ ID NO.

14.

9. A protein encoded by a rice high temperature resistance gene, characterized in that Its amino acid sequence is shown in SEQ ID NO.16.

Citation Information

Patent Citations

  • Application of DWA1 gene for controlling drought resistance of rice and leaf epidermis wax synthesis

    CN103421814A

  • Application of genes NAT1 and bHLH110 in improving high-temperature resistance of rice

    CN118048391A

  • Increased wax production in plants

    WO2006044839A2

Cited By

  • Application of genes NAT2 and NAT3 in improvement of heat resistance of rice

    CN120966880A

  • Application of genes NAT2 and NAT3 in improving heat tolerance of rice

    CN120966880B