Novel lactococcus lactis subsp. cremoris hem 20103 strain useful for promoting intestinal absorption of calcium and use thereof

Abstract

The present disclosure relates to a novel (Lactococcus lactis subsp. cremoris HEM 20103 strain useful for promoting intestinal absorption of calcium, and uses thereof. The novel Lactococcus lactis HEM 20103 strain of the present invention was confirmed to exhibit acid resistance, bile resistance, and intestinal cell adhesion ability and to have an excellent effect of promoting intestinal absorption of calcium. In addition, by increasing bone mineral content, the strain was confirmed to increase calcium metabolism, bone density, bone volume per unit volume, and cortical bone thickness and to significantly improve trabecular bone thickness, trabecular number per unit area, and trabecular spacing in osteoporosis model mice. Therefore, the strain of the present invention is expected to be widely used as a health functional food composition, a feed composition, a feed additive, and the like for promoting intestinal absorption of calcium and to have an excellent effect of preventing or treating intestinal absorption-related diseases of calcium such as osteoporosis or osteopenia.

Description

A novel strain of Lactococcus lactis HEM 20103 (LACTOCOCCUS LACTIS SUBSP. CREMORIS HEM 20103) useful for promoting intestinal absorption of calcium and its use

[0001] The present invention relates to a novel Lactococcus lactis HEM 20103 (Lactococcus lactissubsp.cremorisHEM 20103) strain useful for promoting intestinal absorption of calcium, and uses thereof. This application claims the benefit of priority from Korean Patent Application No. 10-2024-0065143, filed May 20, 2024, and Korean Patent Application No. 10-2025-0031323, filed March 11, 2025, the entire contents of which are incorporated herein by reference.

[0002] Calcium is the most abundant mineral in the human body and is not only a major component of bones and teeth, but is also essential for various physiological functions, including nerve transmission, muscle contraction, blood clotting, and cell signaling. However, calcium deficiency can lead to serious health problems, such as bone diseases such as osteoporosis and osteopenia, as well as hypertension, diabetes, cardiovascular disease, and neuropathy. Calcium intake is primarily through the diet, and more than 90% of ingested calcium is absorbed in the small intestine. This calcium absorption occurs through various pathways, including active transcellular diffusion (facilitated transcellular diffusion) through the calcium channel (TRPV6) in enterocytes and passive intracellular diffusion (passive intercellular diffusion) mediated by claudins between enterocytes. Furthermore, calcium absorption is intricately regulated by hormones such as the active form of vitamin D (1,25-(OH)2D3) and fibroblast growth factor 23 (FGF23).

[0003] Impairments in calcium absorption and metabolism can lead to a variety of diseases. Calcium malabsorption can lead to bone diseases such as osteoporosis, osteopenia, rickets, and osteomalacia, as well as various health problems such as hypertension and neuropathy. Furthermore, endocrine disorders such as vitamin D deficiency or hypoparathyroidism, and metabolic diseases such as chronic renal failure can negatively impact the regulatory mechanisms of calcium metabolism, further exacerbating these problems.

[0004] Meanwhile, probiotics are known to offer various health benefits, including improving intestinal microbial balance, boosting immunity, and providing digestive enzymes. In particular, probiotic bacteria are effective in promoting nutrient absorption and suppressing the growth of pathogenic microorganisms. In some regions, including Europe, where the use of antibiotics and growth promoters is restricted, probiotics are gaining attention as an alternative for animal nutrition and disease prevention.

[0005] However, attempts to utilize probiotics as an effective treatment for diseases associated with calcium absorption disorders have been limited to date, and the development of therapeutics utilizing probiotic strains has not been actively pursued. Therefore, the inventors of the present invention have confirmed that the strain of the present invention promotes intestinal calcium absorption and significantly improves bone mineral and bone density, thereby completing the present invention.

[0006] The purpose of the present invention is to provide a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain having an effect of promoting intestinal absorption of calcium.

[0007] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating diseases related to intestinal absorption of calcium, comprising a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof.

[0008] Another object of the present invention is to provide a health functional food composition for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

[0009] Another object of the present invention is to provide a feed composition for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

[0010] Another object of the present invention is to provide a feed additive for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

[0011] Another object of the present invention is to provide a method for promoting calcium absorption in the intestines of an animal, comprising a step of administering a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof to an animal other than a human.

[0012] Another object of the present invention is to provide a method for promoting intestinal absorption of calcium, comprising a step of administering a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture thereof to an individual in need thereof.

[0013] Another object of the present invention is to provide a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for promoting intestinal absorption of calcium.

[0014] Another object of the present invention is to provide a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for producing a drug that promotes intestinal absorption of calcium.

[0015] Another object of the present invention is to provide a method for preventing or treating a disease related to intestinal absorption of calcium, comprising a step of administering a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture thereof to a subject in need thereof.

[0016] Another object of the present invention is to provide a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for the prevention or treatment of diseases related to intestinal absorption of calcium.

[0017] Another object of the present invention is to provide a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for producing a preventive or therapeutic agent for diseases related to intestinal absorption of calcium.

[0018] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by a person having ordinary skill in the technical field to which the present invention belongs from the description below.

[0019] The terminology used herein is for the purpose of description only and should not be construed as limiting. The singular expression includes the plural expression unless the context clearly indicates otherwise. In this specification, the terms "comprises" or "has" and the like are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood to not preclude the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0020] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0021] Hereinafter, the present invention will be described in more detail.

[0022] The present invention provides a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain having an effect of promoting intestinal absorption of calcium.

[0023] In the present invention, the strain may be derived from edible cream and may include a gene base sequence of 16s rRNA represented by SEQ ID NO: 1, but is not limited thereto. In addition, the strain may exhibit one or more characteristics selected from the group consisting of acid resistance, bile resistance, and intestinal cell adhesion ability, but is not limited thereto. In addition, the strain may increase the expression of calcium absorption-related genes NCX1, PMCA1, CLDN4, and CLDN12, but is not limited thereto. In addition, in the present invention, the edible cream may be produced through fermentation, but is not limited thereto.

[0024] In the present invention, the promotion of intestinal absorption of calcium may refer to an increase in the amount of calcium in the body by promoting intestinal absorption of calcium through various absorption pathways, such as passive intracellular diffusion or facilitated intracellular diffusion through calcium channels, but is not limited thereto. In addition, the intestinal absorption of calcium may be promoted by stimulating vitamin D receptor signaling or claudin expression, but is not limited thereto.

[0025] The present invention provides a pharmaceutical composition for preventing or treating diseases related to intestinal absorption of calcium, comprising a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof.

[0026] In the present invention, the disease related to intestinal absorption of calcium may be osteoporosis, osteopenia, rickets, osteomalacia, hypoparathyroidism, hyperadrenocorticism, type 2 diabetes, dyslipidemia, hypertension, heart disease related to blood calcium, obesity and metabolic syndrome, cancer, blood cancer, solid cancer, colon cancer, prostate cancer, ovarian cancer, breast cancer, disease related to intestinal metabolism, chronic inflammatory bowel disease, or disease related to cell signaling mechanism involving calcium, and may preferably be osteoporosis or osteopenia, but is not limited thereto.

[0027] In the present invention, the strain can increase bone density or bone mineral content, and suppress a decrease in bone density or bone mineral content, but is not limited thereto. In addition, the strain can increase bone volume and cortical bone thickness per unit volume, suppress bone loss, and increase bone formation, but is not limited thereto. The strain can promote intestinal calcium absorption by stimulating vitamin D receptor signaling or claudin expression, and can prevent or treat diseases related to intestinal calcium absorption, but is not limited thereto.

[0028] The pharmaceutical composition according to the present invention may further comprise suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions. The excipients may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, moisturizers, film-coating materials, and controlled-release additives.

[0029] The pharmaceutical composition according to the present invention can be formulated and used in the form of internal preparations and injections such as powders, granules, sustained-release granules, enteric-coated granules, liquids, eye drops, ellipses, emulsions, suspensions, alcohols, troches, air fresheners, limonades, tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, and external preparations such as ointments, lotions, pastes, sprays, inhalants, patches, aerosols, creams, gels, patches, ointments, liniments, or cataplasmas, respectively, according to a conventional method.

[0030] Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

[0031] When formulating, it is usually prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0032] The additives of the tablets, powders, granules, capsules, pills, and troches according to the present invention include excipients such as corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, D-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, calcium hydrogen phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methylcellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin, hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, refined shellac, starch starch, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl alcohol, polyvinyl pyrrolidone, and binders such as hydroxypropyl methylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, Disintegrants such as carboxymethylcellulose calcium, calcium citrate, sodium lauryl sulfate, anhydrous silicic acid, 1-hydroxypropyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, baking soda, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, amylopectin, pectin, sodium polyphosphate, ethylcellulose, sucrose, magnesium aluminum silicate, di-sorbitol solution, and light anhydrous silicic acid;Lubricants such as calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodium dentata, kaolin, petrolatum, sodium stearate, cocoa butter, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, polyethylene glycol 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, anhydrous silicic acid, higher fatty acids, higher alcohols, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid can be used.

[0033] As additives of the liquid formulation according to the present invention, water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, lanolin esters, acetic acid, hydrochloric acid, ammonia water, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethylcellulose, sodium carboxymethylcellulose, etc. can be used.

[0034] The syrup according to the present invention may include a solution of white sugar, other sugars, or sweeteners, and may also include a fragrance, a coloring agent, a preservative, a stabilizer, a suspending agent, an emulsifier, a viscosity increasing agent, and the like, as needed.

[0035] Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

[0036] The suspension according to the present invention may include suspending agents such as acacia, tragacanth, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, and HPMC 2910, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

[0037] The injection according to the present invention includes a solvent such as distilled water for injection, 0.9% sodium chloride injection, Ringer's injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated Ringer's injection, ethanol, propylene glycol, non-volatile oils - sesame oil, cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; a solubilizing agent such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tween, nitrile acid amide, hexamine, and dimethylacetamide; a buffer such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; It may include isotonic agents such as sodium chloride; stabilizers such as sodium bisulfite (NaHSO3), carbon dioxide gas, sodium metabisulfite (Na2S2O5), sodium sulfite (Na2SO3), nitrogen gas (N2), and ethylenediaminetetraacetic acid; oxidizing agents such as sodium bisulfite 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetic acid disodium, and acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; and suspending agents such as sodium cis-methylenediamine, sodium alginate, Tween 80, and aluminum monostearate.

[0038] The suppository according to the present invention comprises cocoa butter, lanolin, withepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cocoa butter + cholesterol, lecithin, ranet wax, glycerol monostearate, Tween or Span, Imhausen, monolene (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego-G, Cebes Pharma 16, hexalide base 95, Cotomar, Hydroxocote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Mechanisms such as Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), Suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecovi (W, R, S, M, Fs), Tezester triglyceride basis (TG-95, MA, 57) can be used.

[0039] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing the extract with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

[0040] Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0041] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on factors including the type and severity of the patient's disease, drug activity, drug sensitivity, administration time, administration route and excretion rate, treatment period, concurrently used drugs, and other factors well known in the medical field.

[0042] The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents. It can be administered sequentially or simultaneously with conventional therapeutic agents, or in single or multiple doses. Taking all of the above factors into account, it is important to administer an amount that achieves maximum efficacy with minimal side effects. This amount can be readily determined by those skilled in the art to which the present invention pertains.

[0043] The pharmaceutical composition of the present invention can be administered to a subject via various routes. All modes of administration are conceivable, including oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, intrathecal injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, otic administration, nasal administration, inhalation, oral or nasal spraying, dermal administration, and transdermal administration.

[0044] The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with various related factors such as the disease to be treated, route of administration, age, sex, weight of the patient, and severity of the disease.

[0045] In the present invention, “subject” means a subject requiring treatment for a disease, and more specifically, may mean a mammal such as a human or non-human primate, mouse, rat, dog, cat, horse, cow, or pig, but is not limited thereto.

[0046] It can be applied to any individual, including non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds and fish, and preferably selected from the group consisting of cows, pigs, chickens, ducks, geese, pheasants and goats, but is not limited thereto.

[0047] In the present invention, “administration” means providing a predetermined composition of the present invention to an individual by any appropriate method.

[0048] In the present invention, “prevention” means any action that suppresses or delays the onset of a target disease, “treatment” means any action that improves or beneficially changes a target disease and its metabolic abnormality symptoms by administering a pharmaceutical composition according to the present invention, and “improvement” means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administering a composition according to the present invention.

[0049] The present invention provides a health functional food composition for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

[0050] In the present invention, the term “cultivation” means all acts performed to grow microorganisms under appropriately artificially controlled environmental conditions.

[0051] In the present invention, the cells of Lactococcus lactis HEM 20103 include not only the live cells themselves obtained from the culture medium, but also any processed form known to those skilled in the art, including, but not limited to, cell lysates, dried products, frozen products, etc.

[0052] In the present invention, the term "culture solution" means a fermentation solution, and may include, but is not limited to, processed products derived from the culture solution itself, such as the culture solution itself cultured in a liquid medium, and the filtrate (centrifuged supernatant) obtained by filtering or centrifuging the culture solution to remove the strain.

[0053] In the present invention, "food" means a natural product or processed product containing one or more nutrients, preferably a product that has gone through a certain degree of processing to become directly edible, and in its usual sense, includes all health functional foods, beverages, food additives, and beverage additives.

[0054] In the present invention, the term "functional food" is the same as food for special health use (FoSHU), and refers to a food with high medical or healthcare effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition, and may be manufactured in the form of tablets, capsules, pills, granules, powders, liquids, flakes, pastes, syrups, gels, jellies, bars, or films. Here, "function" means regulating nutrients for the structure and functions of the human body or obtaining a useful effect for health purposes such as physiological actions.

[0055] When the Lactococcus lactis HEM 20103 of the present invention is used as a food additive, it can be added as is or used together with other foods or food ingredients, and can be used appropriately according to a conventional method. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the Lactococcus lactis HEM 20103 of the present invention can be added in an amount of 15 wt% or less, or 10 wt% or less, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount can be below the above range, and since there is no problem in terms of safety, the active ingredient can also be used in an amount above the above range.

[0056] There are no specific restrictions on the types of the above foods. Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and all health functional foods in the conventional sense are included.

[0057] In addition to the above, the composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients may be used independently or in combination. The proportion of these additives is not particularly critical, but is typically selected within the range of 0.01 to 0.20 parts by weight per 100 parts by weight of the composition of the present invention.

[0058] The present invention provides a feed composition for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

[0059] The present invention provides a feed additive for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

[0060] The term "feed" of the present invention means any natural or artificial diet, meal, etc., or a component of the meal, which an animal eats, and the feed composition including Lactococcus lactis HEM 20103 according to the present invention can be manufactured into various types of feed known in the art, and preferably includes concentrate feed, roughage, and / or special feed, but is not limited thereto.

[0061] In the present invention, the term "feed composition" includes "composition for feed addition" and "feed additive", and includes substances added to feed for the purpose of various effects such as alleviating disease symptoms in animals, promoting intestinal absorption of calcium, preventing and treating diseases related to intestinal absorption of calcium, increasing digestibility and availability of fiber in feed, improving milk quality, preventing reproductive disorders or improving conception rate, and preventing summer heat stress.

[0062] The feed composition of the present invention corresponds to a supplementary feed under the Feed Management Act, and may additionally include mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamins AD, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysine; protected fatty acids such as fatty acid calcium salts; live bacteria such as probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

[0063] Among the above feeds, the concentrated feeds include, but are not limited to, seed and fruit products including grains such as wheat, oats, and corn; bran including rice bran, wheat bran, and barley bran as by-products obtained by refining grains; sesame cakes which are by-products obtained by extracting soybeans, sesame seeds, linseed, and coconut oil; residual starch which is the main component of starch residue remaining after removing starch from sweet potatoes, potatoes, etc.; animal feed such as fish meal, fish waste, fish soluble which is concentrated fresh liquid obtained from fish, meat meal, blood meal, feather meal, skim milk powder, dried whey which is the residue when manufacturing cheese from milk or casein from skim milk; yeast, chlorella, and seaweed.

[0064] Among the above feeds, forage includes, but is not limited to, raw grass feed such as wild grass, grass, and green grass; root vegetables such as forage turnips, forage beets, and a type of turnip called luterberger; silage, which is stored feed made by filling a silo with raw grass, green grass crops, and grain and fermenting it with lactic acid; hay made by cutting and drying wild grass and grass; straw from crops for breeding stock; and leaves of legumes. Special feeds include, but are not limited to, mineral feeds such as oyster shells and rock salt; urea feeds such as urea or its derivative diuretic isobutane; feed additives and dietary supplements, which are substances added in small amounts to compound feed to supplement ingredients that are likely to be lacking when only natural feed ingredients are mixed or to increase the storability of the feed.

[0065] The feed composition according to the present invention can be manufactured by adding Lactococcus lactis HEM 20103 in an appropriate effective concentration range according to various feed manufacturing methods known in the art.

[0066] The feed composition according to the present invention can be applied without limitation to any individual for the purpose of promoting intestinal absorption of calcium. For example, it can be applied to any individual, including non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds, and fish, and preferably, it can be selected from the group consisting of cows, pigs, chickens, ducks, geese, pheasants, and goats, but is not limited thereto.

[0067] The present invention provides a method for promoting calcium absorption in the intestines of an animal, comprising a step of administering a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof to an animal other than a human.

[0068] In the present invention, the administration may be a culture solution containing the Lactococcus lactis HEM 20103 strain, and the titer of the strain is 1X10 per 1 ml. 8Inside 1X10 10 CFU / ml, 1X10 8 9X10 9 CFU / ml, 1X10 8 8X10 9 CFU / ml, 1X10 8 8X10 9 CFU / ml, 1X10 8 7X10 inland 9 CFU / ml, 1X10 8 6X10 inland 9 CFU / ml, 1X10 8 5X10 9 CFU / ml, 1X10 8 4X10 inland 9 CFU / ml, 1X10 8 Inside 3X10 9 CFU / ml, 1X10 8 Inside 2X10 9 CFU / ml, 2X10 8 Inside 2X10 9 CFU / ml, 3X10 8 Inside 2X10 9 CFU / ml, 4X10 8 Inside 2X10 9 CFU / ml, 5X10 8 Inside 2X10 9 CFU / ml, 6X10 8 Inside 2X10 9 CFU / ml, 7X10 8 Inside 2X10 9 CFU / ml, 8X10 8 Inside 2X10 9 CFU / ml, 9X10 8 Inside 2X10 9 CFU / ml, or 10 9 It can be administered as CFU / ml, but is not limited thereto.

[0069] The present invention provides a method for promoting intestinal absorption of calcium, comprising a step of administering a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture thereof to an individual in need thereof.

[0070] In addition, the present invention provides a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for promoting intestinal absorption of calcium.

[0071] In addition, the present invention provides a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for producing a drug that promotes intestinal absorption of calcium.

[0072] In addition, the present invention provides a method for preventing or treating a disease related to intestinal absorption of calcium, comprising a step of administering a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture thereof to an individual in need thereof.

[0073] In addition, the present invention provides a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for the prevention or treatment of diseases related to intestinal absorption of calcium.

[0074] In addition, the present invention provides a use of a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture medium thereof for producing a preventive or therapeutic agent for diseases related to intestinal absorption of calcium.

[0075] The novel Lactococcus lactis HEM 20103 strain of the present invention was confirmed to exhibit acid resistance, bile resistance, and intestinal cell adhesion ability, and to have an excellent effect of promoting intestinal absorption of calcium. In addition, it was confirmed to improve calcium metabolism in osteoporotic mice, thereby increasing bone mineral, bone density, bone volume per unit volume, and sebaceous bone thickness, and to significantly improve the thickness of cancellous bone, the number per unit area, and the distance between cancellous bones. Therefore, the strain of the present invention is expected to be widely used as a health functional food composition, feed composition, feed additive, etc. for promoting intestinal absorption of calcium, and is expected to have an excellent effect in the prevention or treatment of diseases related to intestinal absorption of calcium, such as osteoporosis or osteopenia.

[0076] Figure 1 shows the sequencing results of a novel Lactococcus lactis HEM 20103 (Lactococcus lactissubsp.cremorisHEM 20103) strain.

[0077] Figure 2 shows the results of a hemolytic test of the novel Lactococcus lactis HEM 20103.

[0078] Figure 3 shows the results of a biogenic amine experiment on the novel Lactococcus lactis HEM 20103.

[0079] Figure 4 shows the results of an antibiotic resistance test of the novel Lactococcus lactis HEM 20103.

[0080] Figure 5 shows the results of confirming the change in cell proliferation rate of the intestinal epithelial cell line Caco-2 depending on the presence or absence of inoculation with the novel Lactococcus lactis HEM20103.

[0081] Figure 6 shows the results of confirming the acid resistance and bile resistance of the novel Lactococcus lactis HEM 20103 strain.

[0082] Figure 7 shows the results of confirming the calcium absorption promoting effect of the novel Lactococcus lactis HEM 20103 strain in a Caco-2 cell line.

[0083] Figure 8 shows the results of confirming the change in calcium absorption by dose-dependent inoculation of a novel Lactococcus lactis HEM 20103 strain in a Caco-2 cell line.

[0084] Figure 9 shows the results of confirming changes in the expression of calcium absorption-related genes NCX1, PMCA1, CLDN4, and CLDN12 following administration of the novel Lactococcus lactis HEM 20103 strain in a Caco-2 cell line.

[0085] Figure 10 shows the results of confirming changes in bone mineral concentration (BMC) and bone mineral density (BMD) of the femur and tibia following administration of a novel Lactococcus lactis HEM 20103 strain to mice.

[0086] Figure 11 shows the results of confirming changes in bone density and bone mineral according to administration of a novel Lactococcus lactis HEM 20103 strain to osteoporotic mice (CTRL: normal control group, DEX: osteoporosis disease control group administered dexamethasone, HEM20103: osteoporosis-induced experimental group administered Lactococcus lactis).

[0087] Figure 12 shows the results of confirming the changes in bone volume per unit volume (BV / TV, bone volume / total volume), cortical bone thickness (Cortical wall thickness), cancellous bone thickness (Tb thickness), cancellous bone number per unit area (Tb number), and cancellous bone spacing (Tb spacing) in the femur according to administration of the novel Lactococcus lactis HEM 20103 strain to osteoporotic mice (CTRL: normal control group, DEX: osteoporosis disease control group administered dexamethasone, HEM20103: osteoporosis-induced experimental group administered Lactococcus lactis, BV / TV: bone volume / total volume, Tb.: trabecular bone).

[0088] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following examples.

[0089] [Example]

[0090] Example 1. Method for isolating and identifying strains

[0091] 15 g of edible cream and 135 ml of phosphate-buffered saline (PBS) were ground in a stomacher at 230 rpm for 1 minute and 30 seconds. The mixture was then diluted decimal and spread on MRS agar medium (Difco, USA) and cultured at 37°C for 48 hours. The milky white colonies on the MRS agar were passaged at least three times with platinum plates to isolate the pure strain. The purified strain was suspended in a 20% (v / v) glycerol stock, stored at -80°C, and used in the experiment.

[0092] In addition, the purified strains were secured and a polymerase chain reaction (PCR) specific for the entire 16s rRNA gene sequence was performed. The 16s rRNA gene sequence was obtained through base sequence analysis of the amplified product (PCR product). The entire 16s rRNA gene sequence was analyzed for similarity with base sequences registered in public databases (e.g., Ezbiocloud, NCBI blastn, etc.), and was identified through this. The 16S rRNA gene sequence (SEQ ID NO: 1) of the novel Lactococcus lactis HEM 20103 (Lactococcus lactissubsp. cremorisHEM 20103) is shown below. In addition, the sequencing results are shown in Fig. 1.

[0093]

[0094] Example 2. Safety evaluation of HEM 20103 strain

[0095] 2.1 Confirmation of the results of hemolytic, biogenic amine, and antibiotic resistance tests

[0096] To confirm the hemolytic activity of the isolated strain, a hemolytic test was performed. The isolated strain was cultured for 24 hours on Blood agar medium containing 5% sheep blood in Tryptic soy broth (Difco, USA). After streaking with platinum, the culture was incubated for 24 hours at each culture temperature. Lactobacillus plantarum 299v, a standard probiotic strain, was used as a negative control, and KCTC 1012 Bacillus cereus (ATCC 27348), which exhibits hemolytic activity, was used as a positive control. The results are shown in Fig. 2.

[0097] In addition, the cultured strains were cultured in a special medium (1 L: Tryptone 5 g, Yeast extract 5 g, Meat extract 5 g, Sodium chloride 2.5 g, Glucose 0.5 g, Tween 80 1 g, MgSO4 0.2 g, MnSO4 0.05 g, FeSO4 0.04 g, Ammonium citrate 2 g, Thiamine 0.01 g, K2PO4 2 g, CaCO3 0.1 g, Pyridoxal-5-phosphate 0.05 g, Amino acid (Ornithine, Lysine, Tyrosine, Histidine) 10 g, Bromocresol purple 0.06 g, Agar 20 g, pH 5.3) containing precursors of histamine, cadaverine, tyramine, and putrescine. The cultures were cultured for 4 days. After culture, the positive and negative results were confirmed through the color change of the medium. Lactobacillus plantarum 299v, a standard probiotic strain, was used as a negative control, and KCTC 1012 Escherichia coli (ATCC 25922), which shows biogenic amine formation, was used as a positive control. The results are shown in Figure 3.

[0098] In addition, to evaluate the antibiotic susceptibility of lactic acid bacteria, E-test strips (Liofilchem, Italy) for ampicillin, vancomycin, gentamicin, kanamycin, streptomycin, erythromycin, clindamycin, tetracycline, and chloramphenicol were purchased and the experiment was conducted according to the manufacturer's protocol. 1 X 10 8 2 X 108 The strains were diluted to a concentration of 1 CFU / mL and smeared on MRS agar (Difco, USA) using a cotton swab. E-test strips were placed on the medium and incubated at 37°C for 24 to 48 hours. The minimum inhibitory concentration (MIC) value was determined by examining the inhibition zone formed after incubation. The results are shown in Figure 4.

[0099] As shown in Figures 2 to 4, the HEM 20103 strain showed a negative reaction that did not show hemolysis, did not show biogenic amine formation, and in the antibiotic susceptibility test, the MIC value was suitable for the EFSA standard, confirming that it is a safe strain.

[0100] 2.2 Confirmation of cytotoxicity test results for HEM 20103 strain

[0101] To evaluate the toxicity of Lactococcus lactis HEM 20103 strain to the gastrointestinal barrier when administered to the gastrointestinal tract, a cytotoxicity test was performed using the human intestinal epithelial cell line Caco-2. Specifically, for the cytotoxicity test, the Caco-2 cell line was cultured in a 5% CO2 incubator at 37°C using a minimum essential media (MEM) medium containing 15% fetal bovine serum, 1% non-essential amino acids cocktail, and 1% antibiotics. Afterwards, 2X10 4 Cells were inoculated at 10 cells / well and cultured until confluence, washed twice with PBS, and then 180 μL of MEM medium was added to prepare. In addition, Lactococcus lactis HEM 20103 strain was inoculated at 1% in MRS medium, cultured under anaerobic conditions at 30°C for 16 hours, washed twice with PBS, and then 2X10 7Each well of a Caco-2 96-well plate was inoculated with 20 μL to obtain 1 CFU / well. After 24 hours of incubation, 10% CCK-8 solution was added to the supernatant, followed by an additional 30-minute incubation. The absorbance of the supernatant was measured at 450 nm to determine the cell proliferation rate. The results are shown in Figure 5.

[0102] As shown in Fig. 5, the experimental group treated with the Lactococcus lactis HEM 20103 strain of the present invention did not show a significant decrease in cell proliferation rate compared to the control group not treated with the Lactococcus lactis HEM 20103 strain. This means that when administered to the gastrointestinal tract, the Lactococcus lactis HEM 20103 strain does not cause damage to intestinal epithelial cells.

[0103] Example 3. Confirmation of the characteristics of the HEM 20103 strain.

[0104] 3.1. Confirmation of acid resistance and bile tolerance (SSDP) of HEM 20103 strain

[0105] The above-mentioned mock-up solution was prepared by adjusting the pH of PBS (phosphate buffered saline) to 3.0 with 5 M HCl, sterilizing at 121°C for 15 minutes. Duodenum juice was prepared by dissolving NaHCO3 (6.4 g / L), KCl (0.239 g / L), and NaCl (1.28 g / L) in distilled water, sterilizing at 121°C for 15 minutes, and adjusting the pH to 6.5. Oxgall solution was prepared by dissolving oxgall (Difco, USA) (10 g / L) in distilled water, sterilizing at 121°C for 15 minutes.

[0106] Lactococcus lactis HEM 20103 and L. rhamnosus GG strain, a universal probiotic, were added at 1 x 10 8 5 X 10 8After adjusting to CFU / mL, 1 mL of the culture medium and 9 mL of the stomach simulant were suspended and cultured for 1 hour at 37°C under facultative anaerobic conditions. The initial bacterial count and the bacterial count present in the solution after 1 hour were measured, and then 4 mL of oxgall solution and 17 mL of duodenal juice were added and suspended. The solution was cultured for 2 hours at 37°C under facultative anaerobic conditions, and the bacterial count was measured. The measured bacterial count was confirmed, and the decreased bacterial count after exposure to the stomach simulant and the intestinal simulant were compared. The results are shown in Fig. 6.

[0107] As shown in Fig. 6, the survival rate of the strain was measured under stress conditions according to changes in gastrointestinal pH and salt. Compared to the control group, L. rhamnosus GG, the Lactococcus lactis HEM 20103 strain of the present invention showed a significantly superior survival rate. This indicates that the Lactococcus lactis HEM 20103 strain has excellent acid and bile tolerance.

[0108] 3.2. Confirmation of the intestinal cell adhesion ability of the HEM 20103 strain

[0109] In order to confirm the intestinal cell adhesion ability of Lactococcus lactis HEM 20103 strain when administered to the gastrointestinal tract, the cell adhesion ability of the strain was confirmed using the Caco-2 cell line, a human intestinal epithelial cell line. Specifically, the Caco-2 cell line was cultured in a 5% CO2 incubator at 37°C using a minimum essential media (MEM) medium containing 15% fetal bovine serum, 1% non-essential amino acids cocktail, and 1% antibiotics. Afterwards, 5X10 Caco-2 were seeded in a 12-well tissue culture plate. 5cells / well and cultured until confluence was reached. The plates were washed twice with PBS, and 900 μL of MEM was added to prepare them. Lactococcus lactis HEM 20103 strain was inoculated at 1% in MRS medium, and cultured for 16 hours under anaerobic conditions at 30°C, washed twice with PBS, and then 1X10 8 Each well was inoculated with 100 μL to obtain CFU / well and cultured for an additional 2 hours. Afterwards, the inoculum was removed and washed once with PBS, and 400 μL of TrypLE was treated to isolate intestinal epithelial cells. Then, 600 μL of MEM medium was added to prepare a total 1 mL turbidity. The turbidity was serially diluted 10-fold and plated on MRS agar medium to measure CFU, and the initial inoculation amount (1X10 8 The intestinal cell adhesion ability was evaluated by converting CFU to CFU / well. As a result, it was confirmed that Lactococcus lactis HEM 20103 of the present invention exhibited an adhesion ability of 2.64 ± 0.97%. This falls within the excellent intestinal cell adhesion ability range of 0.95 to 4.63% of probiotic strains, meaning that Lactococcus lactis HEM 20103 adheres well to the surface of intestinal cells in the gastrointestinal tract and causes direct interaction.

[0110] Example 4. Confirmation of the effect of HEM 20103 strain on promoting intestinal absorption of calcium.

[0111] In order to confirm the effect of promoting calcium absorption in the intestine when Lactococcus lactis HEM 20103 strain is administered to the gastrointestinal tract, changes in calcium absorption were measured using the human intestinal epithelial cell line Caco-2. Specifically, the Caco-2 cell line was cultured in a 5% CO2 incubator at 37°C using a minimum essential media (MEM) medium containing 15% fetal bovine serum, 1% non-essential amino acids cocktail, and 1% antibiotics. Afterwards, 5 × 10 cells were seeded in a 0.4 μm pore transwell support. 4 After inoculating with cell / insert and culturing for 12 days until confluence, and washing twice with PBS, 1 mL of MEM or EBSS medium was added to the basolateral side and 455 μL of MEM was added to the transwell support to prepare an intestinal epithelial monolayer. Lactococcus lactis HEM 20103 strain was inoculated at 1% in MRS medium, cultured under anaerobic conditions at 30°C for 16 hours, washed twice with PBS, and then inoculated with 3 × 10 5 Inside 3X10 8 Each well was inoculated with 30 μL to obtain CFU / support, and 15 μL to obtain 7.5 mM CaCl2, and cultured for 24 hours. After 24 hours of culture, 100 μL of the culture medium from the basolateral chamber was collected and diluted 20-fold, and the calcium concentration was measured using a colorimetric assay kit. The results were expressed as relative changes compared to the control group. The results are shown in Fig. 7.

[0112] As shown in Fig. 7, it was confirmed that Lactococcus lactis HEM 20103 of the present invention exhibited a significant calcium absorption promotion function compared to the CaCl2 only treatment group.

[0113] In addition, Ca by inoculation of Lactococcus lactis HEM 20103 strain at different doses (1, 10, 100, 1000) 2+ Changes in absorption were observed. Each dose represents the bacterial ratio per Caco-2 cell, and the results are shown in Figure 8.

[0114] As shown in Fig. 8, it was confirmed that the experimental group treated with Lactococcus lactis HEM 20103 strain exhibited significantly sufficient calcium absorption promotion functionality at various doses compared to the control group not treated with Lactococcus lactis HEM 20103 strain.

[0115] Example 5. Confirmation of changes in gene expression related to intestinal calcium absorption by HEM 20103 strain.

[0116] To confirm the changes in gene expression involved in the promotion of calcium absorption in the intestine by gastrointestinal administration of Lactococcus lactis HEM 20103 strain, quantitative PCR was performed using Caco-2 cell line, a human intestinal epithelial cell line. Specifically, Caco-2 cell line was cultured in minimum essential media (MEM) medium containing 15% fetal bovine serum, 1% non-essential amino acids cocktail, and 1% antibiotics at 37℃ in a 5% CO2 incubator. Then, 2X10 5The intestinal epithelial monolayer was prepared by inoculating the cells / cells and culturing them for 8 days until confluence, washing them twice with PBS, and adding 1 mL of MEM medium. The Lactococcus lactis HEM 20103 strain was inoculated at 1% in MRS medium, cultured under anaerobic conditions at 30°C for 16 hours, washed twice with PBS, and then inoculated with 1X10 8 Each well was inoculated with 100 μL to obtain 10 CFU / well and cultured for an additional 2 hours. Afterwards, the bacterial solution was removed and washed twice with PBS, and Trizol ® After dissolving in (RNA extraction buffer, Thermo Fisher Scientific), RNA was extracted according to the manufacturer's manual. The extracted RNA was quantified using nano drop (BMG LabTech) and cDNA was synthesized using RTase (Promea) and Oligo_dT (20). The synthesized cDNA, each gene-specific primer, and SYBR Green premix (GoTaq ® , Promega) was used to perform real-time PCR, and the relative gene expression level was calculated as ΔΔCt. The primer sequences and Tm used in the experiment are shown in Table 1 below. The results are shown in Figure 9.

[0117] GeneSEQ SEQ ID NO:Tm (℃)PMCA1ForwardGGAGCTCAGGTCCACAGATG260ReverseTGCAGGGTTTCCACTTAAACCT3NCX1ForwardCCTGTTTGGCCAACCTGTCT460ReverseCTCTTTGCTGGTCAGTGGCT5Claudin 4ForwardCCACTCGGACAACTTCCCAA660ReverseACTTCCGTCCCTCCCCAATA7Claudin 12ForwardAAAACGAGGCACAGGGAAGT860ReverseAGGCGATTCCACACAGGAAG9ppiaForwardTGCTGACTGTGGACAACTCG1060ReverseTGCAGCGAGAGCACAAAGAT11

[0118] As shown in Fig. 9, it was confirmed that Lactococcus lactis HEM 20103 of the present invention significantly increases the expression of calcium absorption-related genes NCX1, PMCA1, CLDN4, and CLDN12 in intestinal cells.

[0119] Example 6. Confirmation of the effect of HEM 20103 strain on improving calcium metabolism and bone density in osteoporotic mice.

[0120] Glucocorticoids, which are anti-inflammatory drugs, have side effects such as osteoporosis and increased fracture risk due to decreased Wnt signaling in osteoblasts and increased RANKL signaling in osteoclasts when administered long-term. In order to confirm the bone metabolism health promotion effect of the Lactococcus lactis HEM 20103 strain by promoting calcium absorption when administered into the gastrointestinal tract, the bone density reduction inhibition effect of pre-administration of the strain was confirmed in osteoporotic mice induced by subcutaneous administration of the glucocorticoid dexamethasone. Specifically, after acclimating 8-week-old C57BL / 6J male mice to the breeding facility for 2 weeks, they were given 1X10 Lactococcus lactis HEM 20103 strain while providing a normal diet (Harlan 2018S) and water ad libitum. 9Oral administration was performed for 3 weeks at CFU / mouse / day. At this time, individuals that were not administered the strain served as a control group. Afterwards, dual-energy X-ray absorptiometry (DEXA) was performed using InAlyzer (Medikors) to measure changes in bone mineral concentration (BMC) and bone mineral density (BMD) of the femur and tibia. The results are shown in Fig. 10.

[0121] As shown in Fig. 10, the bone mineral content and bone density of the femur and tibia significantly increased after administration of Lactococcus lactis HEM 20103.

[0122] In addition, 8-week-old C57BL / 6J male mice were acclimated to the breeding facility for 2 weeks, and then were given 1X10 of Lactococcus lactis HEM 20103 strain while being fed a normal diet (Harlan 2018S) and water ad libitum. 9 CFU / mouse / day were administered orally for 3 weeks. After that, for modeling osteoporosis induced by glucocorticoid administration, dexamethasone (Sigma, D1159) was mixed in PBS and injected subcutaneously into each mouse at a concentration of 1 mpk once every two days for 3 weeks. To measure bone mineral density indices, after 3 weeks of strain administration and 3 weeks of dexamethasone administration, dual-energy X-ray absorptiometry (DEXA) was performed using InAlyzer (Medikors) to measure changes in bone mineral and bone density (CTRL: normal control group, DEX: osteoporosis disease control group by dexamethasone administration, HEM20103: osteoporosis-induced experimental group by Lactococcus lactis administration). The results are shown in Fig. 11.

[0123] As shown in Fig. 11, it was confirmed that the strain and dexamethasone administration groups suppressed the decrease in bone density and bone mineral even after osteoporosis was induced.

[0124] In addition, 8-week-old C57BL / 6J male mice were acclimated to the breeding facility for 2 weeks, and then were given 1X10 of Lactococcus lactis HEM 20103 strain while being fed a normal diet (Harlan 2018S) and water ad libitum. 9 Oral administration was performed at 1 CFU / mouse / day for 3 weeks. Afterwards, to model osteoporosis induced by glucocorticoid administration, dexamethasone (Sigma, D1159) was mixed in phosphate-buffered saline (PBS) and injected subcutaneously into each mouse at a concentration of 1 mpk every other day for 4 weeks. Micro CT scans were performed using INVEON (Siemens) to measure trabecular bone. Through this, bone volume per unit volume (BV / TV, Bone volume / total volume), cortical bone thickness (Cortical wall thickness), cancellous bone thickness (Tb thickness), cancellous bone number per unit area (Tb number), and cancellous bone spacing (Tb spacing) were measured (CTRL: normal control group, DEX: osteoporosis disease control group administered with dexamethasone, HEM20103: osteoporosis-induced experimental group administered with Lactococcus lactis, BV / TV: Bone volume / total volume, Tb.: trabecular bone). The results are shown in Fig. 12.

[0125] As shown in Fig. 12, the bone volume per unit volume and the thickness of the cortical bone increased, and it was confirmed that the thickness and number per unit area of ​​cancellous bone, which rapidly reflect bone loss and bone formation, and the distance between cancellous bones were also significantly improved by administration of the HEM 20103 strain.

[0126] Meanwhile, the HEM 20103 strain having the calcium absorption promoting effect was deposited with the Korean Culture Center of Microorganisms (KCCM) on April 30, 2024 under the accession number KCCM 13477P.

[0127] Therefore, the HEM 20103 strain of the present invention exhibited acid resistance, bile resistance, and intestinal cell adhesion ability, and had an excellent effect of promoting intestinal absorption of calcium. In addition, it improved calcium metabolism in osteoporotic mice, thereby increasing bone mineral, bone density, bone volume per unit volume, and sebaceous bone thickness, and significantly improved cancellous bone thickness, number per unit area, and intercancellous bone distance, confirming an excellent effect of promoting intestinal absorption of calcium.

[0128]

Claims

1. A novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) having the effect of promoting intestinal absorption of calcium.

2. In paragraph 1, The above strain is a novel Lactococcus lactis HEM 20103 strain derived from edible cream.

3. In paragraph 1, The above strain is a novel Lactococcus lactis HEM 20103 strain comprising a 16s rRNA gene base sequence represented by sequence number 1.

4. In paragraph 1, The above strain is a novel Lactococcus lactis HEM 20103 strain exhibiting one or more characteristics selected from the group consisting of the following characteristics: (a) Acid resistance; (b) biliary; and (c) Intestinal cell adhesion ability.

5. A pharmaceutical composition for preventing or treating diseases related to intestinal absorption of calcium, comprising a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof.

6. In paragraph 5, A pharmaceutical composition for preventing or treating a disease related to intestinal absorption of calcium, wherein the disease related to intestinal absorption of calcium is osteoporosis or osteopenia.

7. A health functional food composition for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

8. A feed composition for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

9. In paragraph 8, A feed composition for promoting intestinal absorption of calcium, wherein the animal to be fed the feed is selected from the group consisting of cows, pigs, chickens, ducks, geese, pheasants, and goats.

10. A feed additive for promoting intestinal absorption of calcium, comprising a novel Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) strain or a culture solution thereof.

11. A method for promoting calcium absorption in the intestines of an animal, comprising a step of administering a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof to an animal other than a human.

12. A method for promoting intestinal absorption of calcium, comprising a step of administering a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof to an individual in need thereof.

13. A method for preventing or treating a disease related to intestinal absorption of calcium, comprising a step of administering a novel strain of Lactococcus lactis HEM 20103 (Accession No.: KCCM 13477P) or a culture solution thereof to an individual in need thereof.

14. In paragraph 13, A method for preventing or treating a disease related to intestinal absorption of calcium, wherein the disease related to intestinal absorption of calcium is osteoporosis or osteopenia.

Images