Yeast cell for preparing tequila

WO2025248494A8PCT designated stage Publication Date: 2026-06-18MAURI TECH

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MAURI TECH
Filing Date
2025-05-30
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Existing yeast strains used in tequila production are inhibited by agave juice inhibitors, leading to prolonged fermentation times and reduced ethanol yield due to natural variations in agave juice composition, particularly from plants with high saponin and sapogenin content.

Method used

A yeast cell with enhanced tolerance to agave inhibitors, specifically saponins and sapogenins, capable of converting fermentable sugars into ethanol efficiently, even in high-inhibitor environments, utilizing a unique nucleic acid sequence (SEQ ID NO:1) and improved membrane composition.

🎯Benefits of technology

The yeast cell achieves faster fermentation rates and higher ethanol yields, converting up to 99% of fermentable sugars into ethanol within 24 hours, even in harsh agave juice conditions, outperforming commercial strains.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to a yeast cell according to the invention having an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium, based on total volume of the aqueous fermentation medium, said ability being determinable by a method comprising the steps of: a) providing an aqueous fermentation medium consisting essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant having Fusarium wilt, a plurality of yeast cells in a concentration of 5 -106 cells / ml and water, said aqueous fermentation medium comprising 6.6 w / v% total fermentable sugars, based on the volume of the aqueous fermentation medium; b) leaving the aqueous fermentation medium at a temperature of 35 °C and at a pH of 4 for a period of 24 h to obtain an aqueous fermentation medium comprising a concentration of at most 2 w / v% of fermentable sugars, based on the total volume of aqueous fermentation medium.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]P131594PC00 Title: Yeast cell for preparing tequila FIELD The invention relates to a yeast cell and to a method of preparing an alcoholic mixture, preferably tequila. BACKGROUND Mezcal and tequila are fermented alcoholic beverages that are prepared from the fermentation of feedstocks comprising agave juice by yeast cells, typically yeast cells of the yeast Saccharomyces cerevisiae. In the preparation of alcoholic beverages from agave juice, a problem frequently observed is that the yeast cells are inhibited by agave juice inhibitors that are naturally present in agave juice. These toxicity effects hamper the conversion of fermentable sugars present in agave juice to ethanol, which extends the fermentation time required to allow conversion of fermentable sugars to alcohol. Furthermore, because agave juice is obtained from a natural resource (agave), it’s composition is susceptible to natural variations. Therefore, the content of agave inhibitors which are present in agave juice may vary, depending on the age, health and size of the agave plant the juice is obtained from. It was found that certain feedstocks comprising agave juice have such high contents of agave inhibitors, that the fermentation process gets stuck or is slowed down to an unacceptable conversion rate. Typically, in such cases the fermentation is prematurely stopped, before all fermentable sugars have been converted into alcohol. This is of course undesirable, because fermentable sugars are wasted and the yield of ethanol, and ultimately the yield of alcoholic beverage obtained from the fermentation, is low. The inventors’ have found a new yeast strain that exhibits higher tolerance of agave inhibitors, in particular agave saponins, than commercially available yeast strains. This tolerance is significantly higher than other commercially available yeast strains in Tequila production. Advantageously, it was found that the yeast cell according to the invention exhibits an improved average fermentation speed, is more robust and has an improved yield, compared to regular yeasts in the art that are used for fermentation of agave juice. Further, the yeast cell according to the invention was found to be capable of converting a wide range of agave feedstocks, including those that have a high content of agave juice inhibitors. Accordingly, the invention relates to a yeast cell that has an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium, more preferably at most 1.5 w / v%, even more preferably at most 1 w / v%, even more preferably at most 0.5 w / v%, even more preferably at most 0.4 w / v%, even more preferably at most 0.3 w / v%, even more preferably at most 0.2 w / v%, most preferably at most 0.1 w / v% of fermentable sugars, most preferably essentially free of fermentable sugars, based on total volume of the aqueous fermentation medium, said ability being determinable by a method comprising the steps of: a) providing an aqueous fermentation medium consisting essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant having Fusarium wilt, a plurality of yeast cells in a concentration of 5·106cells / ml and water, said aqueous fermentation medium comprising 6.6 w / v% total fermentable sugars, based on the volume of the aqueous fermentation medium; b) leaving the aqueous fermentation medium at a temperature of about 35 °C and at a pH of about 4 for a period of about 24 h to obtain an aqueous fermentation medium comprising a concentration of at most 2 w / v% of fermentable sugars, based on the total volume of aqueous fermentation medium. The invention further relates to a yeast cell, preferably according to any one of the preceding claims, comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof. The invention further relates to a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof. FIGURE LEGENDS Figure 1: Sequence alignment between nucleotide sequence of SEQ ID NO:1 and a comparable sequence of a commercial strain (DistilaMax TQ). Figure 2: PCR comparison of V22 / 019248 vs commercial strains used in the Tequila market. V22 / 019248 was shown to be significantly genetically different to the commercial strains in the Tequila market. Figure 3: The effect of the saponin α-Tomatine on the growth of yeast strains isolated from commercial yeast products used in the Tequila market. Figure 4: Fermentation of regular (“Bueno”) agave juice by yeast cells as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 vs the main strains in the Tequila market. (A) ethanol content at 14 h, 19 h and 24 h fermentation time; (B) glucose and fructose content at 14 h, 19 h and 24 h fermentation time. Diamonds: V22 / 019248; horizontal stripes: Distilamax LS; dots: Distilamax TQ; vertical stripes: Distilamax SR; squares: Distilamax RM; waves: SafSpirit C70; interrupted horizonal stripes: Safspirit FD- 3; solid black: SafTeq Blue; Solid white: SafTeq Silver. Figure 5: Fermentation of regular (“Bueno”) agave juice supplemented with 3000 ppm Agave tequilana leaf extract of yeast cells as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 vs the main strains in the Tequila market. (A) ethanol content at 18 h and 24 h fermentation time; (B) glucose and fructose content at 18 h and 24 h fermentation time. Diamonds: V22 / 019248; horizontal stripes: Distilamax LS; dots: Distilamax TQ; vertical stripes: Distilamax SR; squares: Distilamax RM; waves: SafSpirit C70; interrupted horizonal stripes: Safspirit FD-3; solid black: SafTeq Blue; Solid white: SafTeq Silver. Figure 6. Fermentation of regular (“Bueno”) agave juice supplemented with 4000 ppm Agave tequilana leaf extract of yeast cells as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 vs commercial strains in the Tequila market. (A) ethanol content at 18 h and 24 h fermentation time; (B) glucose and fructose content at 18 h and 24 h fermentation time. Diamonds: V22 / 019248; horizontal stripes: Distilamax LS; dots: Distilamax TQ; vertical stripes: Distilamax SR; squares: Distilamax RM; waves: SafSpirit C70; interrupted horizonal stripes: Safspirit FD-3; solid black: SafTeq Blue; Solid white: SafTeq Silver. Figure 7. Strain screening fermentation performance experiment. Strains 1-12 were tested in comparison to a yeast according to the invention. Strain 1 is Saf Teq Silver (solid white). Strain 11 is Saf Teq Blue (solid black). V22 / 019248 is shown in diamonds. The experiment was performed on harsh (“Fito”) agave juice. (A) ethanol content at 17 h and 24 h fermentation time; (B) glucose and fructose content at 18 h and 24 h fermentation time. SUMMARY OF THE INVENTION The invention relates to a yeast cell having an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, preferably at most 1.5 w / v%, more preferably at most 1 w / v%, even more preferably at most 0.5 w / v%, even more preferably at most 0.3 w / v% of fermentable sugars, even more preferably at most 0.1 w / v% of fermentable sugars, most preferably essentially free of fermentable sugars based on the volume of the aqueous fermentation medium, based on total volume of the aqueous fermentation medium, said ability being determinable by a method comprising the steps of: a) providing an aqueous fermentation medium consisting essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant having Fusarium wilt, a plurality of yeast cells in a concentration of 5·106cells / ml and water, said aqueous fermentation medium comprising 6.6 w / v% total fermentable sugars, based on the volume of the aqueous fermentation medium; b) leaving the aqueous fermentation medium at a temperature of about 35 °C and at a pH of about 4 for a period of about 24 h to obtain an aqueous fermentation medium comprising a concentration of at most 2 w / v% of fermentable sugars, based on the total volume of aqueous fermentation medium. The invention further relates to a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof, preferably wherein said yeast cell comprises a nucleic acid molecule with a nucleotide sequence comprising at least one nucleotide corresponding to a nucleotide selected from A70, T316, A417, A546, A548 and T559, more preferably wherein said yeast cell comprises a nucleic acid molecule comprising at least two, preferably at least three, more preferably at least four, more preferably at least five, most preferably all six nucleotides corresponding to one or more nucleotide(s) selected from A70, T316, A417, A546, A548 and T559. Further preferred is a yeast cell according to the invention comprising a nucleic acid molecule comprising one or more nucleotides corresponding to one or more nucleotide(s) selected from A75, T276, C315, A327, C390, A401, C408, A437, A454 and T483 and / or comprising a nucleic acid molecule comprising at least 90%, preferably at least 95%, more preferably at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO:1, wherein said sequence identity is determined over the full length of SEQ ID NO:1. The invention further relates to a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof. The invention further relates to a yeast preparation, comprising a plurality of yeast cells according to the invention, wherein said yeast preparation is a dry preparation, a liquid preparation, a cream preparation, a compressed preparation or a crumble preparation. The invention further relates to a method for producing an alcoholic mixture, comprising a) contacting a feedstock comprising one or more fermentable sugars and a plurality of yeast cells or a yeast preparation according to the invention to form an aqueous fermentation medium; b) culturing said aqueous fermentation medium under conditions allowing the yeast cells to convert said one or more fermentable sugars into ethanol to obtain an alcoholic mixture, preferably an alcoholic beverage, more preferably an alcoholic beverage selected from tequila, mezcal and pulque, even more preferably tequila; and optionally; c) isolating said alcoholic mixture from said fermentation medium, preferably wherein said isolating comprises a step of distillation. The invention further preferably relates to a method according to the invention, wherein said fermentation medium comprises between about 1 w / v% and about 20 w / v% of fermentable sugars, preferably between about 5 w / v% and about 10 w / v% of fermentable sugars, more preferably wherein said fermented sugars comprise, consist of or consists essentially of fructose and glucose and / or wherein said aqueous fermentation medium formed in step a) consists essentially of agave juice, a plurality of yeast cells and water, more preferably wherein said aqueous fermentation medium formed in step a) consists essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant that has Fusarium wilt. The invention further relates to an alcoholic mixture obtainable by a method according to the invention, wherein said alcoholic mixture comprises at least 3.5 vol.% of ethanol, preferably wherein said alcoholic mixture is an alcoholic beverage, more preferably tequila. The invention further relates to a use of a plurality of yeast cells according to the invention or a yeast preparation according to the invention in producing an alcoholic mixture, preferably an alcoholic beverage, more preferably tequila. DETAILED DESCRIPTION OF THE INVNETION Definitions The term “or” as used herein is defined as “and / or” unless specified otherwise. The term “a” or “ an” as used herein is defined as “at least one” unless specified otherwise. When referring to a noun in the singular, the plural is meant to be included, unless it follows from the context that it should refer to the singular only. The term “substantial(ly)” or “essential(ly)” is generally used herein to indicate that it has the general character or function of that which is specified. When referring to a quantifiable feature, these terms are in particular used to indicate that it is for at least 75 %, more in particular at least 90 %, even more in particular at least 95 % of the indicated feature. When referring to “essentially free”, this generally means that a component is absent (not detectable), or – if present – in such low amount that it does not cause any significant effect. In particular, a composition is considered essentially free of a component, if the concentration is less than 0.1 mmol / l, more in particular less than 0.01 mmol / l in a liquid composition, and / or less than 0.1 wt.% of the dry weight of the composition, more in particular less than 0.01 wt.% of the dry weight, either in a liquid composition or in a dry product. In the context of this application, the term “about” means generally a deviation of 15% or less from the given value, in particular a deviation of 10% or less, more in particular a deviation of 5% or less. In the context of this application, when using the term “parts per million (ppm)”, ppm by weight is indicated, unless otherwise specified. The term “agave juice” or “mosto” is generally known in the art to refer to a fluid comprising fermentable sugars, obtained from a bulb of an agave plant, also known in the art as the “piña”. The bulb of the agave plant comprises substantial amounts of inulin, a polysaccharide that is build-up from a repetitive fructose moiety and chain-terminating glucose moieties. Agave juice is obtainable by processing the bulb, thereby substantially degrading inulin into the fermentable sugars fructose and glucose. The amount of fermentable sugars present in the agave juice depends substantially on the age of the agave plant the juice is obtained from, where mature agave plants (typically at least 7 years, preferably at least 8 years, such as at least 9 years, in particular at least 10 years of age) typically contain a higher content of inulin compared to younger plants (typically less than 7 years, such as less than 6 years, typically between 5 and 6 years). Said processing is typically achieved by baking the bulb at a temperature of between 120 °C and 125 °C, preceded or followed by shredding the (baked) bulb to extract an agave juice comprising fermentable sugars therefrom. Said agave juice may optionally be subjected to one or more processing steps, such as the use of diffusers whereby the raw agave pina is initially shredded then the bagasse is rinsed with hot water at approximately 70 °C, the liquid is retained and a strong acid, such as sulfuric acid is added. The obtained liquid is then autoclaved at approximately 120 °C for approximately an hour. The liquid comprising fermentable sugars isthen cooled and ready to be fermented. Apart from fermentable sugars, agave juicetypically comprises one or more further components, such as vitamins, fat, dietary fiber and agave juice inhibitors. Typically, agave juice comprises one or more agave juice inhibitors. With the term “agave juice inhibitor” or “agave inhibitor” as used herein, is meant a component that is capable of inhibiting a yeast-catalyzed fermentation of fermentable sugars present in agave juice into ethanol. Known agave inhibitors include furfural, also referred to in the art as furan-2-carbaldehyde, 5- hydromethyl-furfural (HMF), also referred to in the art as 5-(hydroxymethyl)-2- furaldehyde and agave saponins or the sapogenin thereof. The content of agavejuice inhibitors typically depends on the agave plant the juice is obtained from andthe processing conditions by which the juice was obtained. Some Agave pinas were found to contain a higher content of agave juice inhibitors than others. Pinas from younger plants, i.e. less than 5 years old generally contain more saponins and / or sapogenins than older mature plants, typically plants that are seven years old or more. Saponins and / or sapogenins can also be elevated in response to attack by pathogens as these are part of the plants natural defense against these attacks. Fitosanitaria or “Fito” agave pinas are typically agave pines that have been harvested early from young plants that are diseased. The early harvest is necessary for the farmer to recover some kind of economic value from the diseased agave. Fito agave pinas normally sell well below the market price for mature and healthy agave pinas but may be used by a Tequila distillery to save on feedstock costs. The term “saponin” as used herein refers to the class of chemical components comprising one or more sugar moieties attached, to a triterpene, a steroid or an alkaloid aglycone also referred to as sapogenin. Herein, said aglycone is attached to the reducing end of (one of) the sugar moieties. As used herein, a “triterpene aglycone” refers to a molecule having a molecular formula C30H48. Triterpenes are composed of six isoprene units; which isoprene unit has the molecular formula C5H8 and is represented by formula I. Formula (I) In a triterpene aglycone, the isoprene units are linked “head-to-tail” to form linear chains or they may be arranged to form rings. As used herein, “a steroid aglycone” refers to a molecule having 27 carbon atoms and are typically classified in three main subclasses: spirostan, furostan and cholestane aglycons. Spirostan-type sapogenins are composed of four six-membered and two five-membered rings, wherein the terminal ring is a pyranose, which is coupled to a furanose ring, to form a spiro-carbon center. Examples of spirostan- type sapogenins include hecogenin and tigogenin. Furostan sapogenins represent a class of steroidal sapogenins composed of three six-membered rings and two five-membered and lack the terminal pyranose moiety forming the spiro-centre. Further, cholestan sapogenins represent a class of steroidal sapogenins composed of two six-membered rings and one five-membered, lacking the terminal pyranose moiety coupled to a furanose moiety. As used herein, an “alkaloid aglycone” refers to a spirostan-type aglycone, wherein the pyranose ring is replaced by a piperidine ring. Typically, a saponin comprises 1-3 sugar moieties. If three sugar moieties are present, it may be a linear sugar, wherein each sugar is attached to the reducing end of another sugar, or a branched sugar, wherein one of the sugar moieties is not attached to the reducing end of another sugar. Said sugar moiety may be a pentose or a hexose sugar. Examples of sugars present in saponins include rhamnose, arabinose, xylose, glucose, galactose and ribose. In the art, two main types of agave juice have been recognized, i.e. “low- inhibitory agave juice” and “high-inhibitory agave juice”, the latter also sometimes referred to as “Fito agave juice”. As used herein the term “high-inhibitory agave juice” also referred to as “Fito juice” or “harsh agave juice” refers to an agave juice wherein the fermentable sugars cannot be at least substantially converted within 24 hours using standard fermentation conditions (i.e. at 35 °C, a pH of about 4 and a plurality of yeast cells at the start of the fermentation of 5·106cells / ml) by the commercially available strain SafTeqTMSilver. A high-inhibitory agave juice typically contains fermentable sugars (fructose and glucose) and at least 1400 ppm of saponins and / or sapogenins and optionally one or more of at least 8.2 ppm of furfural and at least 1186 ppm of HMF. Such contents of saponins and / or sapogenins and optionally furfural and HMF substantially inhibit the conversion of fermentable sugars into ethanol by a yeast cell. As used herein the term “low-inhibitory agave juice” also referred to as “Bueno juice” refers to an agave juice wherein the fermentable sugars can be at least substantially converted within 24 hours using standard fermentation conditions (i.e. at 35 °C, a pH of about 4 and a plurality of yeast cells at the start of the fermentation of 5·106cells / ml) by the commercially available strain SafTeqTMSilver. A low-inhibitory agave juice typically comprises fermentable sugars (fructose and glucose) and less than 8.1 ppm of furfural, less than 1185 ppm of HMF and less than 1399 ppm of saponins and / or sapogenins. The term “fermentable sugars” as used herein, refers to sugar molecules (typically small saccharides comprising one, two or three monosaccharide units) that can be converted into ethanol by yeast cells, in particular by yeast cells from the genus Saccharomyces, more in particular S. cerevisiae. Examples of fermentable sugars include glucose, fructose, maltose, sucrose and maltotriose. The term “added sugars” as used herein refers to fermentable sugars in a feedstock that are not provided by agave juice. These are typically fermentable sugars that are not substantially naturally present in agave pinas. The term “mezcal” as used herein, refers to a distilled alcoholic beverage, having an ethanol content of between about 35 vol.% and 55 vol.%, prepared from the juice of any type of maguey plant, including plants from the genus Agave and the genus Furcraea. “Tequila” is generally known in the art to refer to a type of mezcal, having an ethanol content of between about 35 vol.% and about 55 vol.%, prepared from fermented agave juice obtained from the Agave tequilana (or blue agave) plant. Tequila is produced in the Mexican state of Jalisco, or in one of the municipalities Guanajuato, Michoacán, Nayarit or Tamaulipas. As is known, there are several types of tequila. T100 tequila is a type of tequila that is prepared from a feedstock comprising agave juice, to which no sugars have been added. This is typically considered “premium quality” tequila. Further, T51 tequila is a type of tequila that is prepared from a feedstock comprising agave juice, of which 51% of fermentable sugars is obtained from agave juice, and 49% of fermentable sugars are added sugars. The term “yeast” is generally known in the art to refer to a eukaryotic, single-celled microorganism, which is part of the fungus kingdom. In the context of the present invention, when referring to ‘a yeast cell’, a living yeast cell is meant, unless otherwise specified. As used herein, a yeast cell is typically isolated from its natural environment. The term “functional derivative” as used herein refers to an analogue of the nucleotide sequence as shown in SEQ ID NO:1, which may be present in an analogue strain of the yeast according to the invention, which analogue strain has an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium. Said ability is determinable with a method as defined in claim 1. Said functional derivative generally comprises a nucleic acid molecule having a nucleic acid sequence with at least 70% sequence identity to SEQ ID NO:1, preferably at least 75%, more preferably at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO:1. As used herein, percent sequence identity is determined over the full length of SEQ ID NO:1. A sequence alignment of a sequence of SEQ ID NO:1 with a sequence of interest may be prepared using “Emboss needle” (Rice P., et al. 2000. Trends in Genetics. 16(6):276-277). Said functional derivative may be from a strain found in nature (a natural strain), yet isolated from its natural environment. In an embodiment, the functional derivative is not from a strain found in nature (a non- natural strain). Advantageously, the functional derivative is a nucleotide sequence in or from a progeny strain of a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1, which progeny strain typically is the product of a mating between said yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 and another parent strain or the progeny strain is a descendent of that mating product. As used herein, with the phrase “corresponding to a nucleotide” is meant a nucleotide that corresponds to the referenced nucleotide in the alignment between a nucleotide sequence of interest and a reference nucleotide sequence (usually the nucleotide sequence of SEQ ID NO:1). A nucleotide corresponding to a reference nucleotide is usually a nucleotide comprising the same nucleobase (i.e. A, T, C, G) as in the reference nucleotide sequence. The skilled person will realize that the nucleotide corresponding to e.g. any one of nucleotides A70, T316, A417, A546, A548 or T559 or any other nucleotide, may have a different nucleotide number in a nucleic acid sequence of interest, for example due to the presence of one or more deletion(s) or insertion(s) in the nucleotide sequence of interest compared to the reference nucleotide sequence. A skilled person is capable of making an alignment between a nucleotide sequence of interest and a reference nucleotide sequence, wherein the alignment provides for the highest percentage of sequence identity between the two sequences over their full length, and to number the nucleotides in the sequence of interest in accordance with the nucleotide numbering of the reference nucleotide sequence. In determining the nucleotide that corresponds to a reference nucleotide (such as anyone of nucleotides A70, T316, A417, A546, A548 or T559), the skilled person may use an alignment tool, such as “Emboss needle” to prepare a best fit between the a nucleotide sequence of interest and a reference nucleotide sequence, preferably the nucleotide sequence of SEQ ID NO:1. When preparing a best fit, the alignment tool indicates the presence of a “gap” and indicates a gap penalty thereto, wherein a nucleotide sequence of interest contains a deletion compared to the reference nucleotide sequence. For example, in Figure 1 an alignment between a nucleotide molecule having a sequence of SEQ ID NO:1 and a nucleotide molecule of commercial strain DistilaMax TQ (Y2109) is prepared. It follows from the alignment that the nucleotide aligned with respectively nucleotides A70, T316, A417, A546, A548 and T559 in DistilaMax TQ are G69, G314, G415, G544, G546 and G557 and accordingly does not correspond to the reference sequence. Yeast cell Yeasts are frequently utilized as fermenting microorganisms in the preparation of many food and beverage products to convert fermentable sugars into ethanol and carbon dioxide. Many alcoholic beverages are also prepared by fermentation of a feedstock comprising fermentable sugars into alcohol. For example, beer is prepared from wort, a liquid extract derived from cereal grains, such as barley or wheat, whereas wine is prepared from fermentable sugars present in grapes. Mezcal and tequila are other fermented alcoholic beverages that are prepared from the fermentation of feedstocks comprising agave juice. Well known yeast strains that are used in the preparation of tequila and mezcal are the commercially available SafTeqTMBlue and SafTeqTMSilver by Fermentis, all yeast strains of the species Saccharomyces cerevisiae. These yeast strains suffer from toxicity caused by agave juice inhibitors, in particular saponins and / or sapogenins, which slows down the fermentation rate of regular fermentations and are even unsuitable to convert agave juice with relatively high content of agave juice inhibitors. As mentioned herein above, a yeast cell according to the invention exhibits markedly higher tolerance of agave inhibitors, in particular saponins and / or sapogenins, compared to yeast cells described in the prior art. Without wishing to be bound by any theory, it is believed that a yeast cell according to the invention comprises a different composition of components in the cell membrane and / or cell wall, which makes the yeast cell less susceptible to cell membrane or cell wall disruption caused by agave inhibitors. Accordingly, a yeast cell according to the invention has an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium, more preferably at most 1.5 w / v%, even more preferably at most 1 w / v%, even more preferably at most 0.5 w / v%, even more preferably at most 0.3 w / v%, even more preferably at most 0.2 w / v%, most preferably at most 0.1 w / v% of fermentable sugars, most preferably essentially free of fermentable sugars, based on total volume of the aqueous fermentation medium, said ability being determinable by a method comprising the steps of: a) providing an aqueous fermentation medium consisting essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant having Fusarium wilt, a plurality of yeast cells in a concentration of 5·106cells / ml and water, said aqueous fermentation medium comprising 6.6 w / v% total fermentable sugars, based on the volume of the aqueous fermentation medium; b) leaving the aqueous fermentation medium at a temperature of about 35 °C and at a pH of about 4 for a period of about 24 h to obtain an aqueous fermentation medium comprising a concentration of at most 2 w / v% of fermentable sugars, based on the total volume of aqueous fermentation medium. Said aqueous fermentation medium contains agave juice obtainable from an agave pina obtained from an A. tequilana plant that has Fusarium wilt. Fusarium wilt is a vascular wilt fungal disease caused by Fusarium oxysporum spp or Fusarium solani spp. It causes necrosis in roots, crown and lower part of the stem, and root rot. Fusarium wilt occurs in levels 1-4 ranging in severity, as defined by Avila-Miranda et al.2010. Journal of the Professional Association for Cactus Development, 12: 166–180. Herein, level 0 refers to asymptomatic plants with turgent and extended blue–greenish leaves with similar foliar volume than plants in the plantation; level 1, small greenish plants with lower leaves curled upwards in the margins; level 2, yellowish plants with the most of the leaves curled upwards in the margins, and dry areas in lower leaves; level 3, stunted plants with dry areas in the tip of leaves at different height level; level 4, plants with very few green areas and close to death. As used herein, a plant having Fusarium wilt is defined as a plant having at least level 3 of Fusarium wilt, as detectable by eye. Preferably, said aqueous fermentation medium consists essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant that is 7 years old or less, preferably 6 years old or less, more preferably 5 years old or less, 4 years old or less, 3 years old or less, 2 years old or less. Preferably, said agave plant is 1-7 years old, more preferably 2-6 years old, in particular 3-5 years old. Preferably, said agave juice is obtainable from an agave pina using a method comprising the steps of:- heating an agave pina obtained from an A. tequilana plant having Fusariumwilt to a temperature of between about 120 °C and about 125 °C;- shredding the baked agave pinas to obtain agave bagasse;- contacting the agave bagasse with water having a temperature of about 70 °Cto obtain an aqueous agave extract;- subjecting the aqueous agave extract to sulfuric acid to obtain an acidifiedagave extract; and- autoclaving the acidified agave extract at a temperature of 120 °C for 1 hourto obtain said agave juice. Said agave juice may optionally be diluted with water to obtain an aqueous fermentation medium, comprising 6.6 w / v% total fermentable sugars, based on the volume of the aqueous fermentation medium. Preferably said total fermentable sugars consists of fructose and glucose, more preferably 0.761 w / v% glucose and 5.886 w / v% of fructose. An aqueous fermentation medium as defined in step a) contains a relatively high content of agave inhibitors, in particular a relatively high content of saponins and / or sapogenins, more in particular a relatively high content of hecogenin, tigogenin and / or diosgenin. Preferably, an aqueous fermentation as defined in step a) contains a content of 1400 ppm saponins and / or sapogenins or more, more preferably 1600 ppm or more, more preferably 1800 ppm or more, such as 2000 ppm or more. Further, an aqueous fermentation medium as defined herein contains 1186 ppm or more of HMF, more preferably 1200 ppm or more of HMF, more preferably 1250 ppm or more of HMF, even more preferably 1300 ppm or more of HMF. An aqueous fermentation medium as defined herein further preferably contains 8.2 ppm of HMF or more, more preferably 9 ppm of furfural or more, 10 ppm of furfural or more, 12 ppm of furfural or more, in particular 13 ppm of furfural or more. Preferably said aqueous fermentation medium as defined in step a) comprises, consist of or consists substantially of 6.647 w / v% total fermentable sugars, which fermentable sugars consists of 5.886 w / v% fructose, 0.761 w / v% glucose, 0.000 w / v% maltotriose and 0.000 w / v% of maltose; 0.000 w / v% ethanol, 0.000 w / v% glycerol, 0.298 w / v% lactic acid, 0.052 w / v% acetic acid, 0.117 w / v% dextrin, 8.2 ppm of furfural, 1186 ppm of 5-hydroxymethylfurfural, 1400 ppm of saponins and / or sapogenins, a plurality of yeast cells according to the invention in a concentration of 5· 106cells / mL and water, based on the total volume of the fermentation medium. The fermentable sugars present in said aqueous fermentation medium as defined in step a) are derived from the agave juice present therein. The fermentable sugars present in the aqueous fermentation medium defined in step a) are in particular glucose and fructose. The content of fermentable sugars, in particular glucose and fructose, in the aqueous fermentation medium can be determined by HPLC, e.g. using the conditions as described in Example 3. In step b), the fermentation medium is preferably left for 24 h or less, more preferably 23 h or less, 22 h or less, 21 h or less, 20 h or less, 19 h or less, 18 h or less, 17 h or less. Preferably, the aqueous fermentation medium is left for about 17 h to about 27 h, more preferably 18 h to about 24 h. Preferably, a yeast cell according to the invention is at least 5% faster in converting fermentable sugars into alcohol until a concentration of 2 w / v% or less than a yeast cell of SafTeq Silver or SafTeq Blue when used in converting fermentable sugars in an aqueous fermentation medium as defined herein above. More preferably, said yeast cell is at least 10% faster, even more preferably at least 15% faster, even more preferably at least 20% faster, in particular at least 25% faster than a yeast cell of SafTeqTMSilver and SafTeqTMBlue are Tequila strains, commercially available from Fermentis on the effective filing date. Preferably, a yeast cell according to the invention produces a yield of ethanol that is at least 0.5% higher than the yield of ethanol of the yeast SafTeqTMSilver orSafTeqTM Blue when used in converting fermentable sugars in an aqueousfermentation medium as defined herein above. More preferably, the yield of ethanol is at least 1% higher, at least 1.5% higher, at least 2% higher, at least 2.5% higher, at least 3% higher, at least 3.3% higher than the yield of ethanol obtained by the yeast SafTeq Silver or SafTeq Blue. A yeast cell according to the invention further preferably has an activity, which activity is defined by an average conversion rate of fermentable sugars into ethanol, of at least 0.22 Bx / h preferably at least Bx / h, at least 0.24 Bx / h, most preferably at least 0.25 Bx / h. Said activity is significantly higher than the activity of yeast cells that are described in the art as shown in Example 7. Preferably, the average conversion rate of a yeast cell according to the invention is between about 0.22 Bx / h and about 1 Bx / h, preferably between about 0.23 Bx / h and about 0.8 Bx / h, more preferably between about 0.24 Bx / h and about 0.7 Bx / h, even more preferably between about 0.25 Bx / h and about 0.5 Bx / h. Herein, an average conversion rate is measured over the total duration of the fermentation until the concentration of fermentable sugars is 2 w / v% or less, based on the total volume of the aqueous fermentation medium. Herein, the average conversion rate can be determined by determining the Brix% of an aqueous fermentation medium provided in step a) using a refractometer and determining the Brix% of the aqueous fermentation medium defined in step b), and dividing the difference in Brix% by the total hours the aqueous fermentation medium is left in step b). Furthermore, said increased tolerance towards toxic effects caused by agave juice inhibitors, may enable a yeast cell according to the invention to convert a higher fraction of fermentable sugars and / or produce a higher yield of ethanol compared to known strains, in particular when a high-inhibitory aqueous fermentation medium is used, such as an aqueous fermentation medium obtainable from agave pinas obtained from A. tequilana plants having Fusarium wilt. Accordingly, the invention preferably relates to a yeast cell that allows the production of ethanol in a yield of at least 89%, preferably at least 90%, at least 91%, at least 92%, at least 93%, more preferably at least 94%, at least 95%, at least 96%, at least 97%, even more preferably at least 98%, at least 99%, most preferably 100%. Said yield can be determined by dividing the concentration of fermentable sugars in an aqueous fermentation medium at the end of the fermentation, preferably after 24 h or sooner, such as at 17 h, by the concentration of fermentable sugars in the aqueous fermentation medium at the start of the fermentation, usually at 0 h, wherein said aqueous fermentation medium is as defined herein. Preferably, the total amount of components other than fermentable sugars (fructose, glucose), ethanol, glycerol, lactic acid, acetic acid, dextrin, furfural, 5- hydroxymethylfurfural, saponins, sapogenins, yeast cells and water, in said aqueous fermentation medium is at most 10 w / v%, more preferably at most 5 w / v%, at most 4 w / v%, at most 3 w / v% at most 2 w / v%, at most 1 w / v%, even more preferably at most 0.5 w / v%, at most 0.4 w / v%, at most 0.3 w / v%, at most 0.2 w / v%, most preferably at most 0.1 w / v%, based on the total volume of the fermentation medium. Most preferably, said aqueous fermentation medium is essentially free of additional components other than fructose, glucose, lactic acid, acetic acid, dextrin, furfural, HMF, saponins and / or sapogenins and water. Accordingly, at the start of the fermentation (t=0), said fermentation medium preferably comprises, based on the total dry weight of the fermentation medium at least 90 wt.% of a combination of glucose, fructose, lactic acid, acetic acid, dextrin, furfural, HMF and saponins and / or sapogenins. More preferably, said aqueous fermentation medium comprises, based on the total dry weight of the fermentation medium at least 91 wt.%, at least 92 wt.%, at least 93 wt.%, at least 94 wt.%, at least 95 wt.%, at least 96 wt.%, at least 97 wt.%, at least 98 wt.%, at least 99 wt.%, at least 99.5 wt.%, at least 99.6 wt.%, at least 99.7 wt.% at least 99.8 wt.%, at least 99.9 wt.%, most preferably wherein 100 wt.% of said fermentation medium is a combination of fructose, glucose, lactic acid, acetic acid, dextrin, furfural, HMF and saponins and / or sapogenins. As the skilled person will understand, during fermentation, glucose and fructose are converted into ethanol and consequently the content of glucose and fructose in the fermentation medium decreases over time, whereas the content of ethanol present in the aqueous fermentation medium increases over time. Said aqueous fermentation medium is kept at a temperature of 35 °C and a pH of 4. Such fermentation conditions are suitable for converting fermentable sugars such as glucose and fructose into ethanol at a conversion rate as defined herein above. As the skilled person would understand, a yeast cell according to the invention is also capable of converting fermentable sugars into ethanol in a fermentation medium that comprises lower or higher contents of furfural, HMF, saponins and / or sapogenins and / or different contents and / or compositions of fermentable sugars and / or at different fermentation conditions. Although varying the fermentation conditions and / or the composition of the fermentation medium may affect the rate of converting fermentable sugars into ethanol, a skilled person will understand that these variations do not affect the ability of converting fermentable sugars into alcohol to a concentration of 2 w / v% or less as determinable with a method as defined herein above. As the skilled person will understand, said ability is an inherent property of a yeast cell according to the invention. The inventors analyzed the yeast cell according to the invention and other commercially available yeast strains described for Tequila production and realized that the yeast cell according to the invention is genetically distinguished from commercially available yeast strains. In particular, the inventors realized that the yeast cell according to the invention comprises a nucleic acid molecule that is markedly different from comparable nucleic acid molecules in the commercial yeast strains. Accordingly, the invention further relates to a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof. The inventors realized that the nucleic acid molecule is present in an internal transcribed spacer region of DNA of the yeast cell according to the invention. It is believed that a nucleic acid molecule as defined herein advantageously improves the resistance of said yeast cell, in particular provides said yeast cell with an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, preferably at most 1.5 w / v%, more preferably at most 1 w / v%, even more preferably at most 0.5 w / v%, even more preferably at most 0.3 w / v% of fermentable sugars, even more preferably at most 0.1 w / v% of fermentable sugars, most preferably essentially free of fermentable sugars based on the volume of the aqueous fermentation medium, said ability being determinable by a method as defined in claim 1. Without wishing to be bound by any theory, it is believed that a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof confers better resistance against agaveinhibitors, in particular saponins, by affecting one or more of ribosome biogenesisand gene regulation, which in turn may influence one or more of stress responses, membrane composition, or detoxification capacity. In more detail, the inventors envisage that a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof advantageously modulates the rate of ribosome assembly and / or composition of the ribosomes, thereby providing ribosomes that are more adapted to stress conditions or have altered translation dynamics. Without wishing to be bound by any theory it is believed that altered secondary structures of the ITS region potentially impairs recognition sites for processing enzymes and small nucleolar ribonucleoproteins and may impair processing fidelity, which may lead to changes in the composition of the ribosomes. Ribosomes with altered composition and / or which are more adapted to stress conditions and / or which have altered translation dynamics, may advantageously translate mRNAs that beneficially improve resistance against agave inhibitors, e.g. by enhancing membrane integrity thereby preventing its disruption. For example, said ribosomes may alter membrane composition of cells thereby reducing binding of agave inhibitors such as saponins, and preventing disruption of the membrane. Alternatively or additionally said ribosomes may promote translation of efflux pumps or transporters to remove agave inhibitors, thereby reducing inhibition caused by these inhibitors. Alternatively or additionally, said ribosomes may promote upregulation of chaperones and / or antioxidants involved in protecting the cell membrane and / or cell wall, thereby preventing inhibitor (saponin)-induced membrane disruption. Alternatively or additionally, said stress-adapted ribosomes may advantageously reduce metabolic strain, e.g. by promote translation of proteins that are critical for survival, e.g. protective chaperones or the like, whilst reducing unnecessary protein synthesis. Said functional derivative is preferably an equivalent strain that comprises a nucleic acid molecule with a nucleic acid sequence comprising at least 70%, preferably at least 75%, at least 80%, at least 85%, more preferably at least 90%, more preferably at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, even more preferably at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:1. Without wishing to be bound by any theory, the inventors envisage that a number of nucleotides appear relevant in increasing tolerance against known agave inhibitors including, HMF, 5-methyl HMF, saponins and / or sapogenins. Accordingly, the invention preferably relates to a yeast cell comprising a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof, wherein said yeast cell and / or said functional derivative comprises a nucleic acid molecule with a nucleotide sequence comprising at least one nucleotide, preferably at least two nucleotides, more preferably at least three nucleotides, even more preferably at least four nucleotides, even more preferably at least five nucleotides, most preferably six nucleotides corresponding to one or more nucleotide(s) selected from the group consisting of A70, T316, A417, A546, A548 and T559, preferably in SEQ ID NO:1. Preferably, a yeast cell according to the invention or functional derivative thereof at least comprises one or more of combinations of nucleotides, corresponding to the following combinations of nucleotides, preferably in SEQ ID NO:1: A70 and T316; A70 and A417; A70 and A546; A70 and A548; A70 and T559; T316 and A317; T316 and A546; T316 and A548; T316 and T559; A417 and A546; A417 and A548; A417 and T559; A546 and A548; A546 and T559; and A548 and T559. Preferably a yeast cell according to the invention or a functional derivative thereof at least comprises one or more of combinations of nucleotides, corresponding to the following combinations of nucleotides, preferably in SEQ ID NO:1: A70, T316 and A417; A70, T316 and A546; A70, T316 and A548; A70, T316 and T559; A70, A417 and A546; A70, A417 and A548; A70, A417 and T559; A70, A546 and A548; A70, A546 and T559; A70, A548 and T559; T316, A417 and A546; T316, A417 and A548; T316, A417 and T559; T316, A546 and A548; T316, A546 and T559; T316, A548 and T559; A417, A546 and A548; A417, A546 and T559, A417, A458 and T559; and A546, A548 and T559. Preferably, a yeast cell according to the invention at least comprises one or more of combinations of nucleotides, corresponding to the following combinations of nucleotides, preferably in SEQ ID NO:1: A70, T316, A417 and A546; A70, T316, A417 and A548; A70, T316, A417 and T559; A70, T316, A546 and A548; A70, T316, A546 and T559; A70, T316, A548 and T559; A70, A417, A546 and A548; A70, A417, A546 and T559; A70, A546, A548 and T559; T316, A417, A546 and A548; T316, A417, A546 and T559; T316, A417, A458 and T559; T316, A546, A548 and T559; and A417, A546, A548 and T559. Preferably, a yeast cell according to the invention at least comprises one or more of combinations of nucleotides, corresponding to the following combinations of nucleotides, preferably in SEQ ID NO:1: A70, T316, A417, A546 and A548; A70, T316, A417, A546, T559; A70, T316, A456, A548 and T559; A70, A417, A546, A548 and T559; T316, A417, A546, A548 and T559 and A70, T316, A417, A546, A548; and T559. A yeast cell according to the invention preferably comprises one or more, preferably two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, most preferably thirteen nucleotides corresponding to one or more nucleotide(s) selected from the group consisting of T22, T23, T24, A75, T276, C315, A327, C390, A401, C408, A437, A454 and T483, preferably in SEQ ID NO:1. Alternatively or additionally, a yeast cell according to the invention preferably comprises one or more, preferably two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, more preferably ten or more, eleven or more, most preferably twelve nucleotides corresponding to one or more nucleotide(s) selected from the group consisting of A4, G160, A310, G335, G398, G405, G410, G422, A425, G444, G475 and G509, preferably in SEQ ID NO:1. Alternatively or additionally, a yeast cell according to the invention preferably comprises one or more, preferably two or more, more preferably three or more, more preferably four or more, most preferably five nucleotides corresponding to one or more nucleotide(s) selected from the group consisting of C299, T502, A514, A551 and A570, preferably in SEQ ID NO:1. Alternatively or additionally, a yeast cell according to the invention preferably comprises one or more, preferably two or more, more preferably three or more, most preferably four nucleotides corresponding to one or more nucleotide(s) selected from the group consisting of G20, A40, A58 and A73, preferably in SEQ ID NO:1. Good results have in particular be achieved with a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof. V22 / 019248 has been deposited on October 12, 2022 with the National Measurement Institute (1 / 153 Bertie Street, Port Melbourne, Victoria, Australia 3207) under accession number V22 / 019248 on the same terms as laid down in the Budapest Treaty. The deposit was made by AB Mauri Technology & Development Pty. Ltd., 1 Richardson Place, North Ryde NSW, 2113, Australia. The depositor has authorised the applicant to refer to the deposited material in the application and has given his unreserved and irrevocable consent to the deposited material being made available to the public in accordance with Rule 31(1)(d) of the European Patent Convention (EPC). A statement of authorisation and consent is being filed with this application. Accordingly, the invention further relates to a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof. A “derivative strain”, as used herein, is a strain derived from a yeast cell disclosed herein (such as a yeast cell having an activity as defined herein or a yeast cell as deposited under accession number V22 / 019248), including through hybridization, mutagenesis, recombinant DNA technology, mating, cell fusion, or cytoduction between strains. A derivative strain can be a strain found in nature (a natural strain), yet isolated from its natural environment. Advantageously, the derivative strain is not found in nature (a non-natural strain). Advantageously, the derivative strain is a progeny strain of a parent strain (i.e. a strain from which it is a progeny), which progeny strain typically is the product of a mating between said parent strain and another parent strain or the progeny strain is a descendent of that mating product. In an embodiment, the derivative strain is a hybrid strain that is producible or has been produced by a method comprising using a strain (such as a yeast cell having an activity as defined herein or a yeast cell as deposited under accession number V22 / 019248) as a parent strain for hybridisation. In a preferred embodiment, the progeny strain can be obtained using a hybridization method comprising hybridization of a parent strain (such as a yeast cell having an activity as defined herein or a yeast cell as deposited under accession number V22 / 019248) and at least one step of screening or selection of the hybrid obtained, which selection is based on one or more defining characteristics of said parent strain. For instance, a defining characteristic can be based on taxonomic classification. Preferably, a defining characteristic is an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium. Said ability being determinable using the method defined in claim 1. In a particularly preferred embodiment, the derivative strain is obtained or obtainable by a method comprising, (a) providing: (i) a first strain (such as a yeast cell having an activity as defined herein or a yeast cell as deposited under accession number V22 / 019248); and (ii) a second strain, wherein the second strain is in the same clade as the first strain; (b) inducing mating (e.g. sporulation or conjugation) of the first and the second strain; (c) screening or selecting for a derivative strain. In a particularly preferred embodiment, the derivative strain of a spore- forming strain is obtained or obtainable by a method comprising, (a) providing: (i) a first strain such as a yeast cell having an activity as defined herein or a yeast cell as deposited under accession number V22 / 019248; and (ii) one or more additional strains that are in the same clade as the first strain; (b) inducing sporulation of the first strain and the one or more additional strains to produce spores; (c) mixing the spores of step (b) to allow for hybridization of the spores; and (d) screening or selecting for the derivative strain. In a further preferred embodiment, the derivative strain is an evolved strain, in particular a strain obtained or obtainable by an evolution induced by applying selection pressure to the parent strain or a derivative thereof. In a further preferred embodiment, the derivative strain is a mutant strain of the parent strain or a derivative thereof. A mutant can be obtained by contacting the derivative with a mutagen. Examples of mutagens are ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine·2 (ICR-170), and nitrogen mustard. In a further embodiment, the derivative strain is a genetically modified strain. In particular, the genetically modified strain has a modification made using gene editing (also called genome editing). The gene editing can in particular comprise a modification to suppress expression of a gene, enhance expression of a gene, introduce one or more genomic nucleic acids, delete one or more genomic nucleic acids, introduce a gene, or delete a gene. A yeast cell according to the invention is preferably a yeast cell selected from the group consisting of Saccharomyces, Pichia and Kluyveromyces. Preferably said yeast cell is a cell selected from the group consisting of Saccharomyces arboricolus, Saccharomyces bayanus, Saccharomyces bulderi, Saccharomyces cariocanus, Saccharomyces cariocus, Saccharomyces cerevisiae, Saccharomyces chevalieri, Saccharomyces dairenensis, Saccharomyces ellipsoideus, Saccharomyces eubayanus, Saccharomyces exiguous, Saccharomyces florentinus, Saccharomyces fragilis, Saccharomyces kudriavzevii, Saccharomyces ludwigii, Saccharomyces martiniae, Saccharomyces mikatae, Saccharomyces norbensis, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces sensu stricto, Saccharomyces spenderorum, Saccharomyces turicensis, Saccharomyces unisporus, Saccharomyces uvarum, Saccharomyces zonatus, Kluyveromyces eastuarii, Kluyveromyces dobzhanskii, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces nonfermentans, Kluyveromyces thermotolerans, Kluyveromyces wickerhamii, Pichia anomalia, Pichia farinose, Pichia heedii, Pichia guilliermondii, Pichia Kluyveri, Pichia membranifaciens, Pichia norvengensis, Pichia ohmeri, Pichia pastoris, Pichia methanolica and Pichia subpelliculosa and hybrids thereof. In a particularly preferred embodiment, said yeast cell is a Saccharomycescell, more preferably a Saccharomyces sensu stricto cell and / or a Saccharomycescerevisiae cell. Preferably, said yeast cell, more preferably said Saccharomyces cell, in particular said Saccharomyces sensu stricto cell is not genetically modified. This makes the yeast cell suitable for a method of producing a beverage, in particular Tequila or Mezcal, at industrial scale. At industrial scale it is usually not acceptable to use genetically modified yeast cells. A yeast cell according to the invention may be formulated in any suitable way. Accordingly, the invention further relates to a yeast preparation, comprising a yeast cell according to the invention, wherein the preparation is formulated as a dry preparation, a liquid preparation, a cream preparation, a crumble preparation or a compressed preparation. A dry preparation, liquid preparation, cream preparation, crumble preparation or a compressed yeast preparation may be obtained using any suitable method known in the art. The invention further relates to a method for selecting a yeast cell that has an ability of converting fermentable sugars in an aqueous fermentation medium comprising agave juice obtained from an agave pina of an A. tequilana plant having Fusarium wilt, said aqueous fermentation medium comprising at least 6.6 w / v% total fermentable sugars, thereby reducing the content of fermentable sugars in the aqueous fermentation medium to 2 w / v% or less, based on the volume of the aqueous fermentation medium, preferably at most 1.5 w / v%, more preferably at most 1 w / v%, even more preferably at most 0.5 w / v%, even more preferably at most 0.3 w / v% of fermentable sugars, even more preferably at most 0.1 w / v% of fermentable sugars, most preferably essentially free of fermentable sugars, comprising - providing a library comprising a plurality of candidate yeast cells in a concentration of at least about 5·106cells / ml, which candidate yeast cells are each in an aqueous fermentation medium comprising agave juice obtained from an agave pina of an A. tequilana plant having Fusarium wilt, said aqueous fermentation medium comprising at least 6.6 w / v% total fermentable sugars - leaving the aqueous fermentation medium at a temperature of at least about 35 °C and at a pH of about 4 for a period of about 24 h, preferably about 18 h; thereafter - determining the fermentable sugar content in the aqueous fermentation medium; - selecting one or more yeast cells in a fermentation medium wherein the content of fermentable sugars in the aqueous fermentation medium is 2 w / v% or less; and - isolating the selected yeast cells. The aqueous fermentation medium, agave juice, fermentable sugars, and yeast cells are as defined herein above. The invention further relates to a yeast cell obtainable by a method for selecting a yeast cell according to the invention. Method for preparing an alcoholic mixture The invention further relates to a method for producing an alcoholic mixture, comprising a) contacting a feedstock comprising one or more fermentable sugars and a plurality of yeast cells or a yeast preparation comprising a plurality of yeast cells according to the invention, to form an aqueous fermentation medium; b) culturing said aqueous fermentation medium under conditions allowing for conversion of said one or more fermentable sugars into ethanol to obtain an alcoholic mixture; and optionally c) isolating said alcoholic mixture from said aqueous fermentation mixture. In a method according to the invention, in principle any feedstock comprising one or more fermentable sugars may be used. Preferably, said fermentable sugars are selected from fructose, glucose, sucrose, maltotriose, dextrin and maltose. Preferably, said fermentation medium at least comprises fermentable sugars which are naturally present in agave juice, more preferably said fermentation medium comprises agave juice, even more preferably agave juice obtainable from an agave pina obtained from an A. tequilana plant. More preferably, said agave juice is obtainable from an agave pina obtained from an A. tequilana plant that has Fusarium wilt. Optionally, said fermentation medium comprises one or more added sugars. Optionally, said feedstock or said aqueous fermentation medium further comprises dextrin. Said added sugars are fermentable sugars, preferably fermentable sugars not naturally present in agave juice. Said added sugars may be provided in pure form, or in a mixture with other components, preferably in a juice or extract obtained from a natural product, such as corn syrup, cane sugar or molasses. Preferably, said fermentation medium comprises at most 20 w / v% of fermentable sugars, based on the total volume of the aqueous fermentation medium. More preferably, the fermentation medium comprises, based on the total volume of the fermentation medium, at most 15 w / v% of fermentable sugars, at most 12 w / v% at most 10 w / v%, at most 9 w / v%, at most 8 w / v%, at most 7 w / v%, at most 6 w / v%, at most 5 w / v% of fermentable sugars. Preferably, said fermentation medium comprises at least 1 w / v% of fermentable sugars, based on the total volume of the fermentation medium. More preferably, the fermentation medium comprises at least 1 w / v% of fermentable sugars, at least 2 w / v%, at least 3 w / v%, at least 4 w / v%, at least 5 w / v%, at least 6 w / v%, at least 7 w / v% of fermentable sugars, based on the total volume of the feedstock. Preferably, said fermentation medium comprises between about 1 w / v% and 20 w / v% of fermentable sugars, more preferably between 2 w / v% and 15 w / v%, between 3 w / v% and 10 w / v%, between 4 w / v% and 9 w / v%, between 5 w / v% and 8 w / v%, between 6 w / v% and 8 w / v%, most preferably around 7 w / v% of fermentable sugars, based on the total volume of the fermentation medium. Preferably, said fermentation medium is essentially free of added sugars, and thus comprises only fermentable sugars obtained from agave juice. With such a feedstock, a T100 tequila may be prepared, which is typically considered to have superior quality compared to tequila prepared from a feedstock comprising added sugars, such as a T51 tequila. Accordingly, the fermentation medium preferably comprises 100 wt.% of fermentable sugars obtained from agave juice, based on the total weight of fermentable sugars present in the feedstock. Preferably, such a fermentation medium comprises between about 50 wt.% and about 95 wt.% of fructose, based on the total weight of fermentable sugars. More preferably, said fermentation medium comprises between about 60 wt.% and about 93 wt.% of fructose, such as between 75 wt.% and 92 wt.% of fructose, between 85 wt.% and 92 wt.% of fructose. Preferably, such a fermentation medium comprises between about 5 wt.% and about 30 wt.% of glucose, based on the total weight of fermentable sugars. More preferably, said fermentation medium comprises between about 6 wt.% and about 25 wt.% of glucose, such as between 7 wt.% and 20 wt.% of glucose, between 8 wt.% and 15 wt.%, between 9 wt.% and 12 wt.% of glucose. Typically, the fermentation medium as defined herein has a w / w ratio of fructose to glucose of between about 3:1 and about 95:5, preferably between about 5:1 and about 95:5, more preferably between about 85:15 and 88:12. In a further embodiment, the fermentation medium as defined herein comprises added sugars. Preferably in such an embodiment, the fermentation medium comprises at most 49 wt.% of added sugars, based on the total weight of fermentable sugars, more preferably at most 45 wt.%, at most 40 wt.%, at most 35 wt.%, at most 30 wt.%, at most 25 wt.%, at most 20 wt.%, at most 15 wt.%, at most 10 wt.%, at most 5 wt.% of added sugars, based on the total weight of fermentable sugars. Preferably herein, the fermentation medium comprises at least 5 wt.% of added sugars, based on the total weight of fermentable sugars, more preferably at least 10 wt.%, at least 15 wt.%, at least 20 wt.%, at least 25 wt.%, at least 30 wt.%, at least 35 wt.%, at least 40 wt.%, at least 45 wt.%, most preferably around 49 wt.% of added sugars, compared to the total weight of fermentable sugars. Preferably in such embodiment, the fermentation medium comprises between about 5 wt.% to about 49 wt.% of added sugars, between about 10 wt.% and about 45 wt.% of added sugars, between about 15 wt.% and about 40 wt.% of added sugars, between 20 wt.% and about 35 wt.% of added sugars, between about 25 wt.% and 30 wt.% of added sugars. Most preferably, the fermentation medium comprises about 49 wt.% of added sugar, preferably dextrin, and about 51 wt.% of fermentable sugars obtained from agave juice. With such a fermentation medium, a T51 or “mixto” tequila may be prepared. An advantage of such a tequila is that the production process is typically less costly, because a cheaper source of fermentable sugars may be used than fermentable sugars from agave juice. Preferably, said aqueous fermentation medium comprises, based on the total volume of the aqueous fermentation medium, between about 50 w / v% and about 99 w / v% of water, more preferably between about 60 w / v% and about 98 w / v%, between about 70 w / v% and about 95 w / v%, between about 80 w / v% and about 90 w / v%, between about 82 w / v% and about 87 w / v% of water. Preferably, the fermentation medium comprises agave juice, more preferably, the fermentation medium comprises agave juice obtained from one or more agave plants selected from Agave abisaii, Agave acicularis, Agave acklinicola, Agave aktites, Agave albescens, Agave alboaustralis, Agave albomarginata, Agavealbopilosa, Agave americana, Agave andreae, Agave angustiarum, Agaveangustifolia, Agave anomala, Agave antillarum, Agave apedicellata, Agave applanata, Agave arcedianoensis, Agave × arizonica, Agave arubensis, Agave asperrima, Agave atrovirens, Agave attenuata, Agave aurea, Agave avellanidens,Agave azurea, Agave bahamana, Agave americana var. franzosinii, Agave bicolor,Agave boldinghiana, Agave bovicornuta, Agave braceana, Agave bracteosa, Agave brevipetala, Agave brevispina, Agave brittoniana, Agave brunnea, Agave bulbulifera, Agave bulliana, Agave cacozela, Agave cajalbanensis, Agave cantala, Agave aurea var. capensis, Agave caribaeicola, Agave caymanensis, Agave cerulata, Agave chamelensis, Agave chazaroi, Agave chiapensis, Agave chrysantha, Agave chrysoglossa, Agave cocui, Agave coetocapnia, Agave collina, Agave colorata, Agave confertiflora, Agave congesta, Agave convallis, Agave cremnophila, Agave cundinamarcensis, Agave cupreata, Agave dasylirioides, Agave datylio, Agave debilis, Agave decipiens, Agave delamateri, Agave demeesteriana, Agave deserti, Agave difformis, Agave doctorensis, Agave dolichantha, Agave durangensis, Agave dussiana, Agave eggersiana, Agave mitis, Agave ellemeetiana, Agave ensifera, Agave evadens, Agave felgeri, Agave filifera, Agave flexispina, Agave fortiflora, Agave fourcroydes, Agave funkiana, Agave fusca, Agave galvaniae, Agave garciae- mendozae, Agave geminiflora, Agave gentryi, Agave ghiesbreghtii, Agave gigantensis, Agave gilbertii, A. havardiana × A. lechuguilla, Agave gomezpompae, Agave gracielae, Agave gracilipes, Agave gracillima, Agave graminifolia, Agave grisea, Agave guadalajarana, Agave guerrerensis, Agave guiengola, Agave guttata,Agave gypsophila, Agave harrisii, Agave hauniensis, Agave havardiana, Agavehiemiflora, Agave hookeri, Agave horrida, Agave howardii, Agave hurteri, Agave impressa, Agave inaequidens, Agave inaguensis, Agave indagatorum, Agave intermixta, Agave involuta, Agave isthmensis, Agave jaiboli, Agave jaliscana, Agave jarucoensis, Agave jimenoi, Agave justosierrana, Agave karatto, Agave karwinskii, Agave kavandivi, Agave kerchovei, Agave kewensis, Agave kristenii, Agave lagunae, Agave lechuguilla, Agave × leopoldii, Agave littoralis, Agave longibracteata, Agave longiflora, Agave longipes, Agave macroacantha, Agave maculata, Agave madrensis, Agave manantlanicola, Agave mapisaga, Agave margaritae, Agave maria-patriciae, Agave marmorata, Agave maximiliana, Agave mckelveyana, Agave melanacantha, Agave michoacana, Agave microceps, Agave millspaughii, Agaveminor, Agave missionum, Agave mitis, Agave montana, Agave montium-sancticaroli, Agave moranii, Agave multicolor, Agave multifilifera, Agave murpheyi, Agave nanchititlensis, Agave nashii, Agave nayaritensis, Agave weberi, Agave neocernua, Agave neonelsonii, Agave neopringlei, Agave nickelsiae, Agave nizandensis, Agave nuusaviorum, Agave oaxacana, Agave obscura, Agave ocahui, Agave offoyana, Agave ornithobroma, Agave oroensis, Agave ortgiesiana, Agave oteroi, Agave ovatifolia, Agave pablocarrilloi, Agave pachycentra, Agave palmeri, Agave palustris, Agave panamana, Agave paniculata, Agave papyrocarpa, Agave parrasana, Agave parryi, Agave parva, Agave parvidentata, Agave parviflora, Agave pax, Agave peacockii, Agave pelona, Agave pendula, Agave petiolata, Agave petrophila, Agave petskinil, Agave phillipsiana, Agave pintilla, Agave planifolia, Agave platyphylla, Agave polianthes, Agave polianthiflora, Agave polyacantha, Agave potatorum, Agave potosina, Agave potreriana, Agave pratensis, Agave pringlei, Agave producta, Agave promontorii, Agave pubescens, A. asperrima × A. nickelsiae – Coahuila, Agave quilae, Agave revoluta, Agave rhodacantha, Agave rosei, Agave rovelliana, Agave rutteniae, Agave rzedowskiana, Agave salmiana, Agave scabra, Agave scaposa, Agave schidigera, Agave schneideriana, Agave schottii, Agave sebastiana, Agave seemanniana, Agave shaferi, Agave shawii, Agave shrevei, Agave sileri, Agave singuliflora, Agave sisalana, Agave sobolifera, Agave sobria, Agave spicata, Agave stictata, Agave striata, Agave stricta, Agave stringens, Agave subsimplex, Agave tecta, Agave temacapulinensis, Agave tenuifolia, Agave tequilana, Agave thomasiae, Agave titanota, Agave toumeyana, Agave triangularis, Agave tubulata, Agave turneri, Agave umbrophila, Agave underwoodii, Agave undulata, Agave univittata, Agave utahensis, Agave valenciana, Agave variegata, Agave vazquezgarciae, Agave vera-cruz, Agave verdensis, Agave verhoekiae, Agave vicina, Agave victoriae-reginae, Agave vilmoriniana, Agave virginica, Agave vivipara, Agave vizcainoensis, Agave wallisii, Agave warelliana, Agave weberi, Agave wercklei, Agave wildingii, Agave wocomahi, Agave xylonacantha, Agave yavapaiensis, Agave zapopanensis and Agave zebra. Preferably, said fermentation medium comprises agave juice obtained from an agave plant native to Mexico. In a particularly preferred embodiment, said fermentation medium comprises juice obtained from A. tequilana, A. angustifolia, A. Americana, A. karwinskii, A. rhodacantha, A. macroacantha, A. cantala, A. potatorum, more preferably A. tequilana. As described herein, a yeast cell according to the invention is particularly suitable for converting fermentable sugars present in an aqueous fermentation medium that contains a relatively high content of agave inhibitors, in particular saponins and / or sapogenins. Accordingly, said fermentation medium preferably consists of or consists essentially of agave juice obtained from an agave pina obtained from an A. tequilana plant that has Fusarium wilt, a plurality of yeast cells and water. Preferably, said A. tequilana plant having Fusarium wilt has at least Fusarium wilt level 1, more preferably at least level 2, even more preferably at least level 3, in particular level 4 of Fusarium wilt as defined by Avila-Miranda et al. 2010. Journal of the Professional Association for Cactus Development, 12: 166–180. Preferably, said Fusarium wilt is caused by Fusarium oxysporum spp and / or Fusarium solani spp. Fusarium wilt may be detected using a method described by Ramirez-Ramirez et al. Plant Protect Sci. 2017, 53, 3, 144-152. Alternatively or additionally Fusarium wilt may be detected using a commercially available for detecting Fusarium oxysporum in plants. An example of such commercially available kit is the real time PCR detection kit Fusarium oxysporum of Biopremier. The skilled person is capable of detecting Fusarium wilt on agave plants, such as A. tequilana plants based on common general knowledge and the information provided herein. Alternatively or additionally, fermentation medium preferably consists of or consists essentially of agave juice obtainable from an agave pina obtained from an agave plant (preferably A. tequilana) that is 7 years old or less, preferably 6 years old or less, more preferably 5 years old or less, 4 years old or less, 3 years old or less, 2 years old or less. Preferably, said agave plant is 1-7 years old, more preferably 2-6 years old, in particular 3-5 years old. Such a fermentation medium typically contains a relatively high content of agave inhibitors. Accordingly, the fermentation medium further typically comprises furfural, HMF, saponins and / or sapogenins. Preferably, the fermentation medium comprises at least 2.3 ppm furfural, more preferably at least 5.0 ppm furfural, most preferably at least 8.2 ppm furfural. Preferably, the fermentation medium comprises between about 1 ppm and about 15 ppm of furfural, more preferably between 2.3 and 14 ppm of furfural, in particular between 8.2 and 13 ppm of furfural. Preferably, the fermentation medium comprises at least about 599 ppm of HMF, more preferably at least about 750 ppm of HMF, at least about 900 ppm of HMF, most preferably at least about 1186 ppm of HMF. Preferably, the fermentation medium comprises between about 599 ppm and about 1500 ppm of HMF, more preferably between about 750 ppm and about 1400 ppm of HMF, most preferably between about 1186 ppm and about 1300 ppm of HMF. Preferably, the fermentation medium comprises at least about 200 ppm of saponins and / or sapogenins, more preferably at least about 400 ppm of saponins and / or sapogenins, at least about 600 ppm of saponins and / or sapogenins, at least about 800 ppm of saponins and / or sapogenins, at least about 1000 ppm of saponins and / or sapogenins, at least about 1200 ppm of saponin and / or sapogenins, most preferably at least about 1400 ppm of saponins and / or sapogenins. Preferably, the fermentation medium comprises between about 200 ppm and about 2000 ppm of saponins and / or sapogenins, more preferably between about 1000 ppm and about 1800 ppm of saponins and / or sapogenins, most preferably between about 1400 and about 1600 ppm of saponins and / or sapogenins. Preferably said saponins and / or sapogenins comprise at least one steroidal saponin and / or sapogenins, more preferably a spirostan-type saponin and / or sapogenins. Most, preferably, said saponins and / or sapogenins comprise one or more saponins and / or sapogenins selected from the group consisting of hecogenin, also referred to as (25r)-3b-hydroxy-5a-spirostan-12-one or (1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-16-hydroxy-5',7,9,13- tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one, diosgenin, also referred to as (2S,2′R,4aR,4bS,5′R,6aS,6bR,7S,9aS,10aS,10bS)- 4′,4a,6a,7-Tetramethyl-1,2,3,4,4a,4b,5,6,6a,6b,7,9a,10,10a,10b,11- hexadecahydrospiro[naphtho[2′,1′:4,5]indeno[2,1-b]furan-8,2′-oxan]-2-ol and tigogenin, also referred to as (25R)-5α-Spirostan-3β-ol, or (1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-5',7,9,13-tetramethylspiro[5- oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol. The fermentation medium may further comprise one or more additional components, such as vitamins, including vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B9, vitamin C, dietary fiber, fats, protein, vanilin and vanilic acid. In the method according to the invention, said fermentation medium and said yeast cell or said yeast preparation according to the invention, may be contacted using any suitable method known in the art. For example, said feedstock may be transferred into a suitable container and said yeast cell or said yeast preparation may be added thereto to obtain a fermentation mixture. Alternatively, said feedstock may be added to a yeast cell or yeast preparation according to the invention to obtain a fermentation mixture. Said yeast cell or said yeast preparation according to the invention is as defined herein above. Said yeast cells are added in an amount to provide a plurality of yeast cells that is suitable to convert fermentable sugars into alcohol in a reasonable amount of time, such as at most 36 h, in particular at most 24 h, most preferably at most 17 h. Preferably, said yeast cells are added in an amount to provide a plurality of yeast cells in a concentration in a fermentation mixture of between about 1·104cells / ml and about 1·109cells / ml, preferably between about 1·105cells / ml and about 1·108cells / ml, more preferably between about 1·106cells / ml and about 1·107cells / ml, such as around 5·106cells / ml. The method according to the invention is suitable of converting any fermentation medium comprising fermentable sugars to alcohol to produce an alcoholic mixture, but is in particular suitable of converting a fermentation medium comprising agave juice, and in particular high-inhibitory agave juice into alcohol. Accordingly, said fermentation medium preferably comprises fermentable sugars, more preferably fructose and / or glucose, 8.2 ppm of furfural, 1186 ppm of 5- hydroxymethylfurfural, 1400 ppm of saponins and / or sapogenins and a plurality of yeast cells according to the invention in a concentration of between about 1·104cells / ml and about 1·109cells / ml. More preferably, said fermentation mixture comprises 6.6 w / v% of total fermentable sugars, of which 5.886 w / v% fructose and 0.761 w / v% glucose, 8.2 ppm of furfural, 1186 ppm of 5-hydroxymethylfurfural and 1400 ppm of saponins and / or sapogenins and a plurality of yeast cells according to the invention in a concentration of about 5·106cells / ml. These fermentation media are suitable for the preparation of alcoholic beverages, preferably distilled alcohol beverages, most preferably tequila, mezcal and pulque using a method according to the invention. Said fermentation medium is subsequently cultured under conditions allowing for conversion of fermentable sugars into ethanol to obtain an alcoholic mixture. Preferably, said fermentation medium comprises at most 15 vol.% of alcohol, preferably ethanol, more preferably at most 10 vol.%, at most 10 vol.%, at most 8 vol.%, at most 6 vol.%, at most 4 vol.%, at most 2 vol.% of alcohol. At concentrations of alcohol, preferably ethanol, of above 15 vol.%, the activity of a yeast cell according to the invention may be reduced, compared to the activity of the yeast cell at lower concentrations of ethanol, preferably substantially in absence of ethanol. In principle, any conditions allowing conversion of fermentable sugars into ethanol are suitable in the method according to the present invention. The fermentation medium may be cultured in any suitable container. Since during the fermentation reaction typically gaseous carbon dioxide is formed, it is preferred that the container comprises a means for releasing superfluous carbon dioxide, to avoid the pressure inside the container to become too high, such as a water trap or a vent. Preferably, the fermentation medium is cultured in a fermentation vessel, more preferably a stainless steel fermentation vessel. Preferably, in a method according to the invention, the fermentation medium is cultured under agitation. Agitation may be achieved using any suitable method known in the art, such as stirring or shaking. Agitation may also be achieved in situ, e.g. as a result of the development of gas bubbles, such as CO2 bubbles, during the culturing. In an embodiment, the fermentation medium is agitated at a speed of between about 10 rpm and about 200 rounds per minute (rpm), preferably between about 50 and about 150 rpm, between about 70 and about 120 rpm. Preferably, the fermentation medium is cultured at a temperature of between about 25 °C and between about 40 °C, more preferably between about 27 °C and between about 37 °C, even more preferably between about 30 °C and about 35 °C, most preferably around 35 °C. It was found that under such conditions the conversion of fermentable sugars to ethanol using a yeast cell or yeast preparation according to the invention is optimal. The pH during culturing is preferably between about 3 and about 7, more preferably between 3.5 and 6, between 3.8 and 4.5, such as around 4. Typically, the pH during culturing of a fermentation medium is not controlled, e.g. by addition of acid or base. The pressure during culturing of a fermentation medium is preferably kept at atmospheric pressure, or about 1 bar. Optionally, the fermentation medium may be cultured at increased pressure, for example between 1 and 3 bar, such as between 1.5 and 2.5 bar, or around 2 bar. At increased pressure, compared to atmospheric pressure, higher temperatures during fermentation may be employed. Most preferably, the fermentation medium is cultured at a temperature of about 35 °C and / or a pH of about 4. The fermentation medium is preferably cultured until the concentration of fermentable sugars in the aqueous fermentation medium is about 2 w / v% or less, preferably about 1.5 w / v% or less, more preferably about 1.0 w / v% or less, even more preferably about 0.5 w / v% or less, even more preferably about 0.4 w / v% or less, even more preferably about 0.3 w / v% or less, even more preferably about 0.2 w / v% or less, in particular 0.1 w / v% or less, more in particular essentially free of fermentable sugars. The fermentation medium is preferably cultured until at least 70% of initial fermentable sugars have been converted into ethanol, preferably until at least 75% of fermentable sugars have been converted, more preferably at least 80% of fermentable sugars have been converted, at least 85% of fermentable sugars, at least 89%, at least 90%, at least 91%, at least 92%, most preferably at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, most preferably 100% of fermentable sugars is converted to ethanol. Preferably, the fermentation medium is cultured for at least 1 h, more preferably for at least 2 h, even more preferably at least 5 h, even more preferably at least 8 h, even more preferably at least 10 h, even more preferably at least 15 h, even more preferably at least 18 h, even more preferably at least 20 h, even more preferably at least 21 h, even more preferably at least 22 h, even more preferably at least 23 h, even more preferably at least 24 h. Preferably, the fermentation medium is cultured for at most 25 h, more preferably at most 24 h, even more preferably at most 23 h, even more preferably at most 22 h, even more preferably at most 21 h, even more preferably at most 20 h, even more preferably at most 18 h. Preferably, the fermentation medium is cultured for between 1 and 25 h, preferably between 15 and 24 h, more preferably between 16 and 20 h. Such a fermentation time is markedly shorter than a fermentation time described in the prior art. Preferably between about 1 vol.% and about 10 vol.% of ethanol is produced, more preferably between about 2 vol.% and about 8 vol.%, about 3 vol.% and about 7 vol.%, between about 4 vol.% and about 6 vol.% of ethanol, based on the total volume of the fermentation medium. Preferably, at most about 10 vol.% of ethanol is produced, more preferably at most 8 vol.%, even more preferably at most 6 vol.% of ethanol. At such concentrations of ethanol, a yeast cell according to the invention is typically not substantially inhibited. The content of fermentable sugars in the fermentation medium may be determined using any method known in the art, such as HPLC, e.g. using the conditions as described in Example 3. By monitoring the average rate of conversion of fermentable sugars over time,the conversion rate of fermentable sugars into ethanol may be determined.Preferably, with the method according to the invention, the average conversionrate of fermentable sugars into ethanol is at least 0.22 Bx / h, at least 0.23 Bx / h,at least 0.24 Bx / h, most preferably in an average fermentation rate of at least 0.25 Bx / h. Said average conversion rate of fermentable sugars into ethanol is determinable by measuring a first concentration of fermentable sugars in the fermentation medium before addition of the yeast cell according to the invention (in Bx%) and measuring a second concentration of fermentable sugars in the fermentation medium at a second time point (in %Bx) subtracting said second concentration from said first concentration of fermentable sugars, and divide the difference by the difference between the second and first time point to obtain the conversion rate of fermentable sugars into ethanol (in Bx% / h). There is preferably sufficient time between said first and second measurement. For example, said second measurement is preferably measured after at least 1 hour, at least 2 h, at least 5 h, at least 10 h, at least 15 h, at least 20 h of obtaining said first measurement. As the skilled person will understand, the longer the time between the two measurements, the more accurate the conversion rate of fermentable sugars into ethanol may be determined, because the average fermentation speed is less affected by local fluctuations in fermentation speed. Optionally, the alcoholic mixture is isolated from one or more other components present in the fermentation medium. Isolation may be achieved using any suitable method known in the art, for example by distillation, filtration, or decantation. Preferably, the alcoholic mixture is isolated comprising at least one distillation step. If a high percentage of ethanol is required, it may be advantageous to subject the alcoholic mixture to multiple rounds of distillation, for example 2-5 rounds of distillation. Preferably, the alcoholic mixture is subjected to two rounds of distillation. The isolated alcoholic mixture, preferably tequila, may optionally be subjected to one or more further steps, for example, filtration, ageing or blending. Ageing typically occurs in vessels, preferably wooden vessels, and may help to increase the depth of the flavor of the alcoholic mixture. Optionally, said alcoholic mixture may be blended with one or more further components, for example, water, in case the ethanol content is to be adjusted. In a particularly preferred embodiment, the invention relates to a method for preparing an alcoholic beverage, preferably tequila or mezcal, comprising a) providing an aqueous fermentation medium consisting essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant that has Fusarium wilt, a plurality of yeast cells in a concentration of between about 1·104cells / ml and about 1·109cells / ml and water, said aqueous fermentation medium comprising 5 w / v% or more of total fermentable sugars, based on the volume of the aqueous fermentation medium, preferably wherein said aqueous fermentation medium comprises 6.647 total fermentable sugars, of which 5.886 w / v% fructose and 0.761 w / v% glucose, 8.2 ppm of furfural, 1186 ppm of 5-hydroxymethylfurfural, 1400 ppm of saponins and / or sapogenins, and a plurality of yeast cells in a concentration of about 5·106cells / ml; b) leaving the aqueous fermentation medium at a temperature of between about 30 °C and about 40 °C, at a pH of about 3.5 to about 4.5 until the concentration of fermentable sugars in the aqueous fermentation medium, based on the total volume of fermentation medium, is 2 w / v% or less, preferably 1.5 w / v% or less, more preferably 0.5 w / v% or less, most preferably essentially free of fermentable sugars (preferably for a time period of 24 h or less); and - distilling said alcoholic mixture to obtain an alcoholic beverage, preferably mezcal or tequila. Preferably, said yeast cell is a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof and / or a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof. Preferably, said fermentation mixture is cultured for at least 1 h, more preferably for at least 2 h, at least 5 h, at least 8 h, at least 10 h, at least 15 h, at least 18 h, at least 20 h, at least 21 h, at least 22 h, at least 23 h, at least 24 h. Preferably, the fermentation mixture is cultured for a time of between about 14 h and about 24 h, preferably between about 15 h and about 22 h, more preferably between about 16 h and about 20 h, such as about 18 h. The invention further relates to a use of a yeast cell, preferably a yeast cell comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof, and / or a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof, in producing an alcoholic mixture, preferably an alcoholic beverage, more preferably tequila. Alcoholic mixture The invention further relates to an alcohol mixture, preferably obtainable by a method according to the invention. Said alcoholic mixture may be any mixture comprising ethanol and may have any purpose, for example, the alcoholic mixture may be a biofuel, a cleaning fluid, a solvent or an alcoholic beverage. Preferably, said alcoholic mixture is an alcoholic beverage, more preferably an alcoholic beverage selected from tequila, mezcal and pulque, more preferably tequila. Said alcoholic mixture, preferably an alcoholic beverage, comprises at least 3 vol% of ethanol, preferably at least 5 vol.% of ethanol, more preferably at least 10 vol.% of ethanol, at least 15 vol.% of ethanol, at least 20 vol.% of ethanol, at least 25 vol.% of ethanol, at least 30 vol.% of ethanol, at least 35 vol.% of ethanol, at least 40 vol.% of ethanol, at least 45 vol.% of ethanol, at least 50 vol.% of ethanol, at least 55 vol.% of ethanol, most preferably at least 60 vol.% of ethanol. In particular, said alcoholic mixture, preferably an alcoholic beverage, comprises between about 3 vol.% and about 100 vol.% of ethanol, between about 5 vol.% and about 95 vol.% of ethanol, between about 10 vol.% and about 90 vol.% of ethanol, between about 20 vol.% and about 70 vol.% of ethanol, between about 30 vol.% and about 50 vol.%, most preferably between about 35 vol.% and about 45 vol.% of ethanol, based on the total volume of the alcoholic beverage. Said alcoholic mixture further typically comprises water. Typically, the water content of an alcoholic mixture according to the invention, preferably an alcoholic beverage, comprises at least 5 vol.% of water, more preferably at least 10 vol.% of water, at least 15 vol.% of water, at least 20 vol.% of water, at least 25 vol.% of water, at least 30 vol.% of water, at least 35 vol.% of water, at least 40 vol.% of water, at least 45 vol.% water, at least 50 vol.% water, at least 55 vol.% of water, at least 60 vol.% of water, at least 65 vol.% of water, at least 70 vol.% of water, at least 75 vol.% of water, at least 80 vol.% of water, at least 85 vol.% of water 90 vol.% of water, at least 97 vol.%, based on the total volume of the alcoholic mixture. An alcoholic mixture, preferably an alcoholic beverage may further comprise one or more further components, for example flavor components and fragrance components, said one or more further components are preferably naturally present in the feedstock used in the method according to the invention. Preferably, said alcoholic mixture, more preferably alcoholic beverage, comprises one or more components typical for high-inhibitory agave juice. Preferably, said alcoholic mixture (at least prior to the optional step of distillation) comprises at least one or more of furfural, 5-hydroxymethyl furfural and saponins and / or sapogenins, in particular hecogenin. More preferably, said alcoholic mixture comprises at least 8.2 ppm of furfural, at least 1186 ppm of 5- hydroxymethylfurfural, or at least 1400 ppm of saponins and / or sapogenins. The inventor’s surprisingly realized that the alcoholic beverage, preferably obtainable by a method according to the invention, has a distinguishable flavor profile compared to an alcoholic beverage prepared with other yeasts described in the prior art. Said alcoholic beverage, preferably a tequila, comprises a flavor profile that has less strong orange notes and less strong flower notes compared to commercially available tequila. Preferably, said alcoholic beverage, more preferably a tequila comprises less strong orange notes and less strong flower notes compared to tequila prepared with a commercial Tequila strain, preferably prepared with SafTeqTMSilver or SafTeqTMBlue. Such a tequila is advantageous, in particular for consumers that do not appreciate the orange and flower notes of regular tequila, or when the tequila is paired with a food or beverage that does not pair well with strong orange and / or flower notes. For the purpose of clarity and a concise description, features are described herein as part of the same or separate embodiments, however, it will be appreciated that the scope of the invention may include embodiments having combinations of all or some of the features described. The invention is demonstrated by the following examples. Examples Example 1: PCR comparison of V22 / 019248 vs commercial strains used in the Tequila market. PCR was conducted according to the method of Ness, F., Lavellée, F., Dubourdieu, D., Aigle, M. and Dulau, L.1993 : Identification of Yeast Strains Using the Polymerase Chain Reaction. Journal of the Science of Food and Agriculture 62: 89- 94”. The PCR products were analyzed on an agarose gel. results are shown in Figure 2. V22 / 019248 was shown to be significantly genetically different to the tested commercial strains in the Tequila market. Example 2: The effect of the saponin α-Tomatine on the growth of yeast strains isolated from the main yeast products used in the Tequila market. The strains were pre-grown in Yeast Extract Peptone Dextrose (YEPD) with the cell densities adjusted to 5.0E+06 cells / ml, 10µl of each strain was dropped onto the plate and depicted as “0” dilution. Subsequent serial dilutions 1:10 were prepared with 10ul of each dilution dropped onto the plate. Plates were made from YEPD+ 2% agar with different concentrations of α-Tomatine added. Plates were incubated at 30 °C for 72 hours. The results are shown in Figure 3. As can be derived from Figure 3, 50µM of α-Tomatine pre-dissolved in DMSO was found to completely inhibit the growth of all other yeast strains except V22 / 019248 at the “0” dilution. This indicates that yeast strain V22 / 019248 is more resistant against saponins and / or sapogenins than other yeast strains. Example 3: Fermentation of regular (“Bueno”) Agave juice using the yeast cell according to the invention in comparison to commercial strains. The experiment was performed in triplicate. A 5 mL sterile centrifuge tube was charged with, “bueno” agave juice (obtained from A. tequilana also derived from plants aged 7 years or greater and using a traditional oven process) was used (meaning that at least 95 w / v% of fermentable sugars present therein were converted by a reference strain SafTeq Silver within 19 h), 5.0E+06 cells of yeast cells according to the invention or a commercial reference strain and 0.7g / L of diammonium phosphate (DAP). The starting mixture was defined as follows: Initial pH: 3.820, Initial fermentable sugars: glucose 1.011%w / v, fructose 8.767: total 9.778%w / v, starting %Brix 11.9. The centrifuge tube was closed with a lid, which was pin pricked for ventilation, shaked at 160 rpm on an orbital shaker and kept at 35 °C. Samples were taken at 14, 19 and 24h. The %Brix was determined using a digital refractometer (Atago PR101α). pH was determined using a calibrated pH-meter (Crison). Contents of fructose, glucose, ethanol, glycerol, lactic acid and acetic acid were analysed by HPLC (Shimadzu: DGU-20A3R degasser, LC-20AD pump, SIL- 20ACHT autosampler, CTO-20A column oven, CBM-20A system controller, RID- 20A Refractive Index (RI) detector), using the following parameters: column temperature: 60 °C; mobile phase: 5 mM H2SO4; flow rate: 0.6 ml / min; injection volume: 10 µL. The ethanol (A) and fermentable sugar (B) contents are shown in Figure 4. As can be derived from Figure 4, the yeast cell according to the invention was able to convert fermentable sugars almost to completion at 14 h. This rate was much faster compared to commercial strains, which needed at least 19h or even longer (SafTeq Silver, Distilamax LS, Distilamax TQ, Distilamax SR, Distilamax RM and SafSpirit FD-3). Example 4: Fermentation of regular (“Bueno”) Agave juice supplemented with saponin rich A. tequilana leaf extract 3000ppm using the yeast cell according to the invention in comparison to commercial strains. The experiment was performed in triplicate using the method described in Example 3. Bueno juice (obtained from A. tequilana also derived from plants aged 5-6 years and using a diffuser process) was supplemented with 3000 ppm of A. tequilana agave leaf extract obtained using the method described in section 2.1.1. of Alcazar 2017 using leaves of 3 year old plants. LWT – Food Science and technology, 77, 430. The dried extract was rehydrated in absolute ethanol. The mixture was defined as follows: Initial pH: 4.074, Initial fermentable sugars: glucose 0.724 %w / v, fructose 6.414: total 7.138 %w / v, starting %Brix 9.2. Samples were taken at 18 and 24h. The %Brix was determined using a digital refractometer (Atago PR101α). pH was determined using a calibrated pH-meter (Crison). Contents of fructose, glucose and ethanol were analysed by HPLC as described in Example 3. The ethanol (A) and fermentable sugar (B) contents are shown in Figure 5. As can be derived from Figure 5, the yeast cell according to the invention was the only yeast cell able to convert fermentable sugars to completion within 18 h to produce an ethanol content of about 4 w / v% based on the total volume of the fermentation mixture. Example 5: Fermentation of regular (“Bueno”) Agave juice supplemented with saponin rich A. tequilana leaf extract 4000ppm using the yeast cell according to the invention in comparison to commercial strains. The experiment was performed in triplicate using the method described in Example 3. Bueno juice (obtained from A. tequilana also derived from plants aged 5-6 years and using a diffuser process) was supplemented with 4000 ppm of A. tequilana agave leaf extract obtained using the method described in section 2.1.1. of Alcazar 2017 using leaves of 3 year old plants. LWT – Food Science and technology, 77, 430. The dried extract was rehydrated in absolute ethanol. The mixture was defined as follows: Initial pH: 4.060, Initial fermentable sugars: glucose 0.724%w / v, fructose 6.414: total 7.138%w / v, starting %Brix 9.2 Samples were taken at 18 and 24h. The %Brix was determined using a digital refractometer (Atago PR101α). pH was determined using a calibrated pH-meter (Crison). Contents of fructose, glucose and ethanol were analysed by HPLC as described in Example 3. The ethanol (A) and fermentable sugar (B) contents are shown in Figure 6. As can be derived from Figure 6, the yeast cell according to the invention was the only yeast cell capable of converting fermentable sugars to less than 3.5 w / v% after 24 h to produce about 2 w / v% of ethanol, based on the total volume of the fermentation mixture. Example 6: Fermentation of Harsh (“Fito”) Agave juice using the yeast cell according to the invention in comparison to commercial strains. The experiment was performed in triplicate using the method described in Example 3. Instead of Bueno juice, “harsh agave juice” was used, obtained from diseased agave that was harvested early (around age 5) and classified by a distillery as “harsh” (meaning that at least 90 w / v% of fermentable sugars present therein where not converted to a concentration of 4 w / v% or less, based on the total volume of the fermentation mixture, by commercial strains such as SafTeq Silver after 24 h). The mixture was defined as follows: initial pH: 4.004, Initial fermentable sugars: glucose 0.761%w / v, fructose 5.886 w / v%, 0.000 w / v% maltose, 0.000 w / v% maltotriose: total fermentable sugars 6.647% w / v, 0.117 w / v% dextrin, 0.298 w / v% lactic acid, 0.000 w / v% glycerol, 0.052 w / v% acetic acid, 0.000 w / v% ethanol, starting %Brix 7.6. Samples were taken after 17 h and 24 h and analysed. The %Brix was determined using a digital refractometer (Atago PR101α). pH was determined using a calibrated pH-meter (Crison). Contents of fructose, glucose, ethanol, glycerol, lactic acid and acetic acid were analysed by HPLC as described in Example 3. The ethanol (A) and fermentable sugar (B) contents are shown in Figure 7. As can be derived from Figure 7, the yeast cell according to the invention was able to convert fermentable sugars of a ‘harsh’ agave juice to completion after 17 h, whereas comparable commercial strains did not completely convert fermentable sugars after 24 h (or even after 72 h), to produce an ethanol content of more than 3.5 w / v%, based on the total volume of the fermentation mixture. Example 7: Fermentation of various agave juices at industrial scale A trial was conducted in a large Tequila distillery in Jalisco state Mexico June 2021. The trial compared the performance of dried yeast of SafTeq Silver and a dried yeast preparation comprising a yeast as deposited under accession number V22 / 019248 over a number on months. A number of substrates were used during the trial: 100% Agave “ Bueno” Juice(Bueno) in which the fermentable sugars only came from the agave pina’s, The juice was defined as a juice that can be fermented under standard conditions in 24h or less using a commercially available yeast. 51% Mixto Agave “Bueno” Juice in which the fermentable sugars came both agave pina’s (51%) and dextrose syrup (49%). The juice was defined as a juice that can be fermented under standard conditions in 24h or less using a commercially available yeast. 100% Agave “ Fito” Juice in which the fermentable sugars only came from the agave pina’s. The juice was obtained from agave pina’s that suffered from Fusarium rot and had to be harvested early. Statistics were analysed using JMP 16. Comparison testing and analysis of variance was performed using one way anova, all pairs Tukey-Kramer at 95% confidence. The results are shown in Table 1 Substrate: 100% Agave Juice (Bueno) V22 / 019248 SafTeq Silver p-Value Sig Diff Number of fermentations (n) 98 211 Ave Fermentation Time (h) 20.18 ± 3.68* 24.51 ± 4.88 <0.0001 Y Ave Fermentation Speed (Bx / h) 0.281 ± 0.06 0.334 ± 0.06 <0.0001 Y Conversion Efficiency (%) 91.27 ± 5.11 90.01 ± 6.22 0.0801 N Substrate: 51% Mixto Agave Juice (Bueno) V22 / 019248 SafTeq Silver p-Value Sig Diff Number of fermentations (n) 69 109 Ave Fermentation Time (h) 23.36 ± 2.78 25.85 ± 3.64 <0.0001 Y Ave Fermentation Speed (Bx / h) 0.402 ± 0.05 0.357 ± 0.05 <0.0001 Y Conversion Efficiency (%) 91.71 ± 5.25 90.21 ± 5.12 0.0602 N Substrate: 100% Agave Juice (Fito) V22 / 019248 SafTeq Silver p-Value Sig Diff Number of fermentations (n) 16 43 Ave Fermentation Time (h) 23.50 ± 5.19 29.44 ± 4.96 0.0002 Y Ave Fermentation Speed (Bx / h) 0.252 ± 0.06 0.216 ± 0.06 0.0370 Y Conversion Efficiency (%) 92.66 ± 4.04 89.86 ± 6.48 0.0922 N Overall trial scores-All substrates V22 / 019248 SafTeq Silver p-Value Sig Diff Number of fermentations (n) 167 328 Ave Fermentation Time (h) 21.50 ± 3.68 25.07 ± 4.54 <0.0001 Y Ave Fermentation Speed (Bx / h) 0.361 ± 0.06 0.305 ± 0.06 <0.0001 Y Conversion Efficiency (%) 91.45 ± 5.15 90.03 ± 5.88 0.0083 Y *Average ± SD It can be derived from Table 1 that a yeast according to the invention is capable of converting all fermentable sugars within 24 h, irrespective of the feedstock (in particular the inhibitor content therein). By contrast, commercially available yeast strain SafTeq silver showed a slower conversion rate of all feedstocks, and in particular of Fito Juice. Sequences SEQ ID NO: 1 – nucleic acid molecule of yeast cell as deposited under accession number V22 / 019248 ATTAATAATTTTGAAATGGGATTTTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACT GGGCAAGAAAACAAAAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGC TAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTA TAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTT TTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTTAACAAACACAAACAATTTTATCT ATTCATTAAATTTTCTTCAAAAACAAAAATTTTCGTAACTGGAAATTTTAAAATATTAAA AACTTTCAACAACGGATCTCTTGGTTCTCCCATCGATGAAAAACGCACCGAAATGCAATA CGTAATGTGAATTGCAAAATTCCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCCT TGTTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGT AGTGAATAATACTCTTTGTAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTT TTT SEQ ID NO: 2 Distilamax LS GGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCT TCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCC TTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTA AAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCA TCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAA AAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGA TCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTG GGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGT ATTATAGCCTGTGGG SEQ ID NO: 3 Distilamax TQ AATTTAATAATTTTGAAATGGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTG GGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCT AGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTAT AGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTT TTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTAT TCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAA CTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACG TAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTG GTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAG TGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTT CCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAAGAACGGCCGTTT SEQ ID NO: 4 Distilamax SR TTAATAATTTTGAAATGGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGC AAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGG CTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGG ACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTC TTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCA TTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTT TCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAA TGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTA TTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGA GTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCC AAAAAAAGGTTTCTCTGCGTGCTTGAGGTATAATGCAATTACGGTCGTTTTAGGTTTTAC CAACTGCGGCTAATCTTTTTTATACGGAGCGTATTGAAACGTTATCGATAAAA--AAAGC GTCTAGGCAA SEQ ID NO: 5 Distilamax RM TTTATAATTTTGAAATGGATTTTTTTGTTTTGGCAGAGCATGAGAGCTTTTCTGGGCAAG AAGACGAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGT SEQ ID NO: 6 SafSpirit C-70 GGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAGCTCAAATTTGAAATCTGGTACCTT CGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCT TGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAA AGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCAT CTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAA AGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGAT CAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGG GCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTA TTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTACGTCAAGGATGC TGGCATAATGGTTATATGCCGCCCGTCTTGAAACACGGACC SEQ ID NO: 7 SafSpirit FD-3 AGGGGATGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACC TTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTC CTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGT AAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCC ATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGA AAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTG ATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACT GGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAG TATTATAGCCTGTGGGAA SEQ ID NO: 8 SafTeq Blue ATTTATAATTTTGAAATGGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGG CAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAG GCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAG GACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTT CTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTC ATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACT TTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTA ATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGT ATTCCAGGGGGCATGCCGGTTTGAGCGTCGTTTCCTTCTCAAACATTCTGTTTGGTAGTG AGTGATGCTCTTTGGAGTTAACTTGTAATTGCTG SEQ ID NO: 9 SafTeq Silver ATTTATAATTTTGAAATGGGATTTTTTTTTTGTTTTGGCAAGAGCATGAGGAGCTTTTAC TGGGCAAGAAGACAAAAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTG CTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAAAGATTTCTGTGCTTTTGTT ATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACT TTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTTAACAAACACAAACAATTTTATC TATTCATTAATTTTTCGTCAAAAACAAAAATTTTCTTAACTGGAAATTTTAAAATATTAA AAACTTTCAACAACGGATCTCTTGGTTCTCCCATCGATAAAAAACCCACCAAAATGCGAT Ĵ9 ACTTATTGTGAATTGCAAAATTCCTTGAATCATCAAATCTTTGAACGCACATTGCCCCCC TTGTTATTCCAGGGGGCATGCCTGTTTGACCGTCATTTCCTTCTCAAACATTCTGTTTGG TAGTGAGTGATACTCTTTGAAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTT TTTTTCCAAAAAAA

Claims

Claims 1. A yeast cell having an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium, said ability being determinable by a method comprising the steps of: a) providing an aqueous fermentation medium consisting essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant having Fusarium wilt, a plurality of yeast cells in a concentration of 5·106cells / ml and water, said aqueous fermentation medium comprising 6.6 w / v% total fermentable sugars, based on the volume of the aqueous fermentation medium; b) leaving the aqueous fermentation medium at a temperature of about 35 °C and at a pH of about 4 for a period of about 24 h to obtain an aqueous fermentation medium comprising a concentration of at most 2 w / v% of fermentable sugars, based on the total volume of aqueous fermentation medium.

2. The yeast cell according to claim 1, having an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more into ethanol to a concentration of, based on the total volume of the aqueous fermentation medium, at most 1.5 w / v%, preferably at most 1 w / v%, more preferably at most 0.5 w / v%, even more preferably at most 0.3 w / v% of fermentable sugars, even more preferably at most 0.1 w / v% of fermentable sugars, most preferably essentially free of fermentable sugars.

3. A yeast cell, preferably according to any of the preceding claims, comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO:1 or a functional derivative thereof.

4. The yeast cell according to claim 3, comprising a nucleic acid molecule with a nucleotide sequence comprising at least one, preferably at least two, more preferably at least three, more preferably at least four, more preferably at least five, most preferably all six nucleotides corresponding to a nucleotide selected from A70, T316, A417, A546, A548 and T559 in SEQ ID NO:1.

5. The yeast cell according to any of claims 3-4, comprising a nucleic acid molecule comprising one or more nucleotides corresponding to one or more nucleotide(s) selected from A75, T276, C315, A327, C390, A401, C408, A437, A454 and T483 in SEQ ID NO:

1.

6. The yeast cell according to any of claims 3-5, wherein said functional derivative comprises a nucleic acid molecule comprising at least 90%, preferably at least 95%, more preferably at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO:1, wherein said sequence identity is determined over the full length of SEQ ID NO:

1.

7. The yeast cell according to any one of the preceding claims, as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 or a cell of a derivative strain thereof.

8. The yeast cell according to claim 7, wherein the derivative strain is a progeny strain, preferably which progeny strain is the product of a mating between said parent strain and another parent strain or the progeny strain is a descendent of that mating product.

9. The yeast cell according to any of claims 3 to 8, wherein the derivative strain and / or said functional derivative has an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration of at most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium, said ability being determinable by a method as defined in claim 1.

10. The yeast cell according to any of claims 7 to 9, wherein the derivative strain is obtainable by a method comprising hybridization of a yeast cell as deposited with the National Measurement Institute (Victoria, Australia) under accession number V22 / 019248 to obtain a hybrid strain and at least one step of screening or selection of said hybrid strain.

11. The yeast cell according to claims 9 to 10, wherein said derivative strain is obtainable by a method comprising obtainable by a method comprising, (a) providing: (i) a yeast cell that has an ability of converting fermentable sugars present in an aqueous fermentation medium comprising one or more fermentable sugars in a total concentration of 5 w / v% or more, into ethanol to a concentration ofat most 2 w / v% of fermentable sugars, based on the volume of the aqueous fermentation medium, said ability being determinable by a method as defined in claim 1; and (ii) a second strain, wherein the second strain is in the same clade as the first strain; (b) inducing mating, preferably sporulation or conjugation, of the first and the second strain; and (c) screening or selecting for a derivative strain.

12. The yeast cell according to any one of the preceding claims, which yeast cell is not genetically modified.

13. The yeast cell according to any one of the preceding claims, which yeast cell is a Saccharomyces cell, preferably a Saccharomyces sensu stricto cell.

14. A yeast preparation, comprising a plurality of yeast cells according to any one of the preceding claims, wherein said yeast preparation is a dry preparation, a liquid preparation, a cream preparation, a compressed preparation or a crumble preparation.

15. A method for producing an alcoholic mixture, comprising a) contacting a feedstock comprising one or more fermentable sugars and a plurality of yeast cells according to any one of claims 1-13 or a yeast preparation according to claim 14 to form an aqueous fermentation medium; b) culturing said aqueous fermentation medium under conditions allowing the yeast cells to convert said one or more fermentable sugars into ethanol to obtain an alcoholic mixture; and optionally; c) isolating said alcoholic mixture from said fermentation medium.

16. The method according to claim 15, wherein said alcoholic mixture is an alcoholic beverage, preferably an alcoholic beverage selected from tequila, mezcal and pulque, more preferably tequila.

17. The method according to claim 15 or 16, wherein said fermentation medium comprises between about 1 w / v% and about 20 w / v% of fermentable sugars, preferably between about 5 w / v% and about 10 w / v% of fermentable sugars, more preferably wherein said fermented sugars comprise, consist of or consists essentially of fructose and glucose.

18. The method according to claim 15 to 17, wherein said aqueous fermentation medium formed in step a) consists essentially of agave juice, aplurality of yeast cells and water, more preferably wherein said aqueous fermentation medium formed in step a) consists essentially of agave juice obtainable from an agave pina obtained from an A. tequilana plant that has Fusarium wilt.

19. The method according to any of claims 15 to 18, wherein said isolating comprises a step of distillation.

20. An alcoholic mixture obtainable by a method according to any of claims 15 to 19, wherein said alcoholic mixture comprises at least 3.5 vol.% of ethanol, preferably wherein said alcoholic mixture is an alcoholic beverage, more preferably tequila.

21. Use of a plurality of yeast cells according to any one of claims 1-13 or a yeast preparation according to claim 14 in producing an alcoholic mixture, preferably an alcoholic beverage, more preferably tequila.