Combination of a GSK-3 inhibitor and a LSD-1 inhibitor for use in the treatment of cancer

A synergistic combination of LSD1 and GSK-3 inhibitors induces AML cell differentiation and suppresses proliferation, addressing the limitations of current AML treatments by activating the type I interferon pathway and inhibiting the Wnt pathway, effectively reducing tumor burden.

WO2026022243A1PCT designated stage Publication Date: 2026-01-29THE TRUSTEES OF THE UNIV OF PENNSYLVANIA +2
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/071222
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-23
Filing Date
2025-07-23
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Current treatments for acute myeloid leukemia (AML) have limited efficacy and are associated with toxicities, and existing LSD1 inhibitors do not achieve the therapeutic success of all-trans retinoic acid (ATRA) in acute promyelocytic leukemia (APL), necessitating the development of novel therapeutic strategies.

Method used

A synergistic combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor is administered to induce differentiation of AML cells, activating the type I interferon pathway and suppressing the Wnt pathway, thereby promoting therapeutic differentiation and reducing tumor burden.

Benefits of technology

The combination of LSD1 and GSK-3 inhibitors effectively induces differentiation and suppresses proliferation in AML cell lines and primary human AML cells, demonstrating a synergistic effect with low doses, and shows promise in reducing tumor burden in xenograft models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025071222_29012026_PF_FP_ABST
    Figure EP2025071222_29012026_PF_FP_ABST
Patent Text Reader

Abstract

This disclosure provides methods of preventing or treating cancer in an individual, comprising administering a therapeutic amount of an histone demethylase (LSD1) inhibitor and a therapeutic amount of a glycogen synthase kinase-3 (GSK-3) inhibitor to the individual, and compositions and kits usefule in performing such methods. Also provided are methods of determining the suitability of a cancer patient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, and methods of monitoring the efficacy of such treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Docket No.: FR 084276.00393 / LUD 6243.0ACUTE MYELOID LEUKEMIA (AML) COMBINATION THERAPY BACKGROUND OF THE DISCLOSURE

[0001] Acute myeloid leukemia (AML) is a devastating disease with approximately 44,000new cases diagnosed each year in the US and EU, with a 5-year survival rate varying considerably with age of the patient and genetic characteristics of the disease. The standard of care includes intensive combination chemotherapy, which can be consolidated with allogeneic stem and immune cell transplant, and for patients ineligible for this option, hypomethylating agents combined with the BCL2 inhibitor, venetoclax (see Döhner, H. et al. Blood 140:1345-1377 (2022)). Targeted inhibitors are used for specific genetic subgroups. Nevertheless, themedian survival is still only 8.5 months (see Yi, M. et al. J Hematol Oncol. 13, 72 (2020);Stahl, M. et al. Blood Adv. 2, 923-932 (2018); and Döhner, H., Weisdorf, D. J. & Bloomfield,C. D. N Engl J Med. 373, 1136-52 (2015)). Accordingly, there is an outstanding need for novel AML treatments.

[0002] While genetically heterogenous, AMLs are universally characterized by a prominentdifferentiation block that disables normal myeloid maturation programs and enables aberrant self-renewal and proliferation of a proportion of leukemic cells (see Döhner, H. et al. Blood 140:1345-1377 (2022), also Döhner, H., Weisdorf, D. J. & Bloomfield, C. D. N Engl J Med. 373, 1136-52 (2015)). Although differentiation arrest is a manifestation of the clinical phenotype, it also represents an AML vulnerability that can be leveraged for therapeutic purposes. Unlike most chemotherapy, which eliminates blasts via cytotoxicity, differentiation therapy aims to depress terminal myeloid maturation programs that reduce the competitive clonal advantage of leukemic cells (see, De Thé, H. Nat Rev Cancer. 18, 117-127(2018)). The exemplar AML differentiation therapy is the combination of all trans-retinoic acid (ATRA) with arsenic trioxide (ATO), which is used to treat acute promyelocytic leukemias (APLs) and has a 95% cure rate (De Thé, H. Nat Rev Cancer. 18, 117-127(2018)). However, extending the tremendous potential of differentiation therapy and its success to non-APL AML remains a major goal in the field.

[0003] Inhibition of chromatin regulators represents an emerging, promising approach toinducing maturation of AML cells. Inhibitors of MENIN and DOT1L can induce varying degrees of differentiation in MLL-rearranged (MLL-r) AML, and IDH1 / 2 inhibitors induce 1 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0differentiation and are highly effective towards IDH1 / 2 mutant AML (see Wang, F. et al.Science 340, 622–626 (2013), Issa, G. C. et al. Nature 615, 920-924 (2023), and Dafflon, C. Leukemia 31, 1269-1277 (2017)). Additionally, histone demethylases are potential targets for AML therapy due to their role in AML development and progression (see Højfeldt, J. W., Agger, K. & Helin K. Nat Rev Drug Discov. 12, 917-930 (2013)). In particular, the histoneH3K4me1 / 2 demethylase LSD1 (Shi, Y. et al. Cell 119, 941-53 (2004)) whose expression iselevated in AML, is crucial for leukemic stem cells (LSCs) (see, Harris, W. J. et al. CancerCell 21, 473-487(2012)) maintenance and proliferation, and inhibition of LSD1 has been shownto induce AML differentiation (see Harris, W. J. et al. Cancer Cell 21, 473-487(2012) andHosseini, A. & Minucci, S. A. Epigenomics 9, 1123-1142 (2017)). Consequently, inhibitors of LSD1 are being actively investigated in clinical trials, for example NCT02177812, for hematologic malignancies, including AML (see, Hosseini, A. & Minucci, S. A. Epigenomics 9, 1123-1142 (2017)). However, therapeutic efficacy with LSD1 inhibitors alone is limited due to associated toxicities (see, Fang, Y. Liao, G. Yu, B. J Hematol Oncol. 12, 129 (2019)). Overall, no inhibitors have approached the efficacy of ATRA differentiation therapy of APL.

[0004] THP-1 is a human leukemia monocytic cell line, which has been extensively used tostudy monocyte / macrophage functions, mechanisms, signaling pathways, and nutrient and drug transport. Kasumi-1 is a myeloblast cell that was isolated from the peripheral blood of an acute myeloblastic leukemia Asian male patient. Although published research shows that THP-1 and Kasumi-1 cell lines exhibit sensitivity to LSD1 inhibitors, other cell types display resistance. SUMMARY OF THE DISCLOSURE

[0005] In one embodiment, the present disclosure provides a method of preventing or treatingcancer in an individual, comprising administering a therapeutic amount of an histonedemethylase (LSD1) inhibitor and a therapeutic amount of a glycogen synthase kinase-3 (GSK-3) inhibitor to the individual.

[0006] In another embodiment, the present disclosure provides a product comprising a histonedemethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for combined separate, simultaneous or concurrent use for the prevention or treatment of cancer in an individual. 2 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0007] In another embodiment, the present disclosure provides a product comprising asynergistic combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for the prevention or treatment of cancer in an individual.

[0008] In another embodiment, the present disclosure provides a histone demethylase (LSD1)inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for combined use in the prevention or treatment of cancer.

[0009] In another embodiment, the present disclosure provides a composition comprising ahistone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor.

[0010] In another embodiment, the present disclosure provides a kit comprising a firstcontainer comprising a histone demethylase (LSD1) inhibitor, and a second container comprising a glycogen synthase kinase-3 (GSK-3) inhibitor.

[0011] On another embodiment, the present disclosure provides method of determining thesuitability of a cancer patient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor comprising determining the level of expression of at least one type I interferon (IFN) signaling pathway gene and / or at least one interferon stimulated gene (ISG) in a cancer cell sample of the patient, and determining the level of expression of the at least one type I interferon (IFN) signaling pathway gene and / or at least one interferon stimulated gene (ISG) in a non-cancer cell sample of the patient, wherein an increased level of expression of the at least one type I interferon (IFN) signaling pathway gene and / or at least one ISG in the cancer cell sample indicates that the patient will be responsive to the treatment.

[0012] In another embodiment, the present disclosure provides a method of determining thesuitability of a cancer patient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor comprising determiningthe presence or absence of a mutation in DNMT3A and / or NPM1 in a cancer cell sample fromthe patient, wherein the presence of a mutation in DNMT3A and / or NPM1 indicates a patientthat will be responsive to the treatment, and wherein the absence of a mutation in DNMT3Aand / or NPM1 indicates a patient that is expected to be non-responsive to the treatment.

[0013] In another embodiment, the present disclosure provides a method of monitoring theefficacy of treatment of cancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, comprising determining 3 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0the level of expression of: (i) at least one type I interferon (IFN) signaling pathway gene in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patientduring or after treatment, wherein an upregulation of a type I IFN signaling pathway gene, asrepresented by increased level of expression of said at least one gene, during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment; and / or (ii) at least one interferon stimulated gene (ISG) in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of an ISG, as represented by increased level of expression of said at least one gene, during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment.

[0014] In another embodiment, the present disclosure provides a method of monitoring theefficacy of treatment of cancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, comprising determining the level of expression of β-catenin in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of β- catenin, as represented by increased level of expression of β-catenin, during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment.

[0015] In another embodiment the present disclosure provides a method of monitoring theefficacy of treatment of cancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, comprising observing for granulocytes in a cancer cell sample of the patient during or after treatment, wherein morphologically and histologically mature granulocytes observed in samples during or after treatment indicates that the patient is responsive to treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] To easily identify the discussion of any particular element or act, the most significantdigit or digits in a reference number refer to the figure number in which that element is first introduced.

[0017] FIG. 1A is a diagram of a model cell system for high-throughput screeningidentifies LY2090314 as an enhancer of LSD1i-mediated differentiation. ER-HoxA9 is thecellular model for a phenotypic screen of AML differentiation. Upon differentiation, ER-HoxA9 cells upregulate GFP fluorescence.4 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0018] FIG. 1B shows a work flow chart of screening using the model cell system of FIG. 1A.The small molecule library was pin-transferred into 96-well plates containing ER-HoxA9 cellsin media with 50nM GSK-LSD1. Plates were incubated for 5 days and differentiation was evaluated by GFP expression and cell-surface marker CD11b.

[0019] FIG. 1C shows the results of screening of a library of compounds for a wide range ofbiological targets. The GSK-3 inhibitor, LY2090314, showed the strongest synergy with 50nM GSK-LSD1 to induce differentiation in ER-HoxA9 cells over 5 days of in vitro culture. NB: only compound LY2090314 in Fig.1c is a GSK inhibitor.

[0020] FIG. 1D shows how a combination of GSK-LSD1 and LY2090314 inhibitsproliferation and impairs clonogenic activity of AML cell lines by inducing differentiation. FIG. 1D is a time course measurement of ER-HoxA9 differentiation status cells treated with vehicle, GSK-LSD1(50nM), LY2090314 (100nM) and combination of both inhibitors for 5days. Data are presented as mean of triplicates ± SD. illustrates an aspect of the subject matterin accordance with one embodiment.

[0021] FIG. 2A shows the time course measurement of ER-HoxA9 cells proliferation as inFIG. 1D.

[0022] FIG. 2B shows how LSD1 and GSK3β inhibition synergistically inhibit AML cellsproliferation by inducing AML cells differentiation. FIG. 2B is a quantification of colonies formed by ER-HoxA9 cells treated with indicated inhibitors.

[0023] FIG. 2C is a micrograph of ER-HoxA9 colonies treated with indicated inhibitors.

[0024] FIG. 3A shows the survival of human AML cell lines treated with differentconcentrations of LY2090314 (black) and combination of LY2090314 with 50nM GSK-LSD1(red) for 5 days. Luminescence signal was normalized, and dose–response curves and EC50values were calculated using a nonlinear regression curve fit.

[0025] FIG. 3B shows the quantification of colonies formed by indicated human cell linestreated with DMSO, GSK-LSD1(50nM), LY2090314 (100nM) and combination of bothinhibitors. Data are presented as mean of triplicates ± SD.

[0026] FIG. 3C is an analysis of the clonogenic activity of THP-1 cells by serial replatingassay. Data are presented as mean of triplicates ± SD.

[0027] FIG. 3D is an analysis of CD11b mRNA relative levels in U937 cells treated with theindicated inhibitors for 5 days. Values were normalized against GAPDH. 5 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0028] FIG. 3E is an analysis of CD11b cell-surface protein relative levels in U937 cellstreated with the indicated inhibitors for 5 days.

[0029] FIG. 3F is an analysis of CD11b mRNA relative levels in human AML cells treatedwith the indicated inhibitors for 5 days. Values were normalized against GAPDH.

[0030] FIG. 3G shows representative images of Kasumi-1, THP-1 and U937 cells treated withindicated inhibitors for 5 days and stained with Wright-Giemsa.

[0031] FIG. 4 shows murine AML cells treated with 50nM GSK-LSD1 and differentconcentrations of LY2090314 for 5 days and cell growth determined by Cell Titer Glo assay.

[0032] FIG. 5A is an analysis of THP-1 cell viability after treatment with TAK-418, LY2090314 or combination of both inhibitors for 5 days by Cell Titer Glo assay.

[0033] FIG. 5B analysis of CD11b mRNA relative levels in THP-1 cells treated with TAK-418 or LY2090314 and combination of both inhibitors for 5 days. Values were normalizedagainst GAPDH.

[0034] FIG. 5C is an analysis of THP-1 cell viability after treatment with IMG-7289, LY2090314 or combination of both inhibitors for 5 days by Cell Titer Glo assay.

[0035] FIG. 5D is an analysis of CD11b mRNA relative levels in THP-1 cells treated withIMG-7289, LY2090314 or combination of both inhibitors for 5 days. Values were normalizedagainst GAPDH.

[0036] FIG. 5E is an analysis of cells viability in THP-1 cells treated with the indicatedinhibitors for 5 days by Cell Titer Glo assay.

[0037] FIG. 5F is an analysis of CD11b mRNA relative levels in THP-1 cells treated with theindicated inhibitors for 5 days. Values were normalized against GAPDH.

[0038] FIG. 5G is a quantification of colonies formed by THP-1 cells treated with DMSO,IMG-7289 (50nM), 9-ING-41 (100nM) and combination of both inhibitors. Data are presented as mean of triplicates ± SD.

[0039] FIG. 6A shows tumor burden over time in treated mice with indicated inhibitors in asyngeneic model of HoxA9-Meis1-driven acute myeloid leukemia. Error bars represent mean ±SEM.

[0040] FIG. 6B is a survival curve of treated mice with indicated inhibitors in a syngeneicmodel of HoxA9-Meis1-driven acute myeloid leukemia. 6 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0041] FIG. 7A shows a PCA of RNA-seq of ER-HoxA9 cells treated with vehicle, GSK-LSD1, LY2090314 and combination of both inhibitors.

[0042] FIG. 7B shows how combo treatment triggers transcriptional changes associated withmyeloid differentiation and interferon response in AML cells. FIG. 7B is GSEA of 47-geneleukemia stem cell (LSC) signature in ER-HoxA9 cells treated with drug combo vs. vehicle.

[0043] FIG. 7C shows GSEA of myeloid maturation signatures in drug-treated ER-HoxA9cells.

[0044] FIG. 7D shows GSEA of additional myeloid maturation signatures in ER-HoxA9 cellstreated with combo vs. vehicle.

[0045] FIG. 7E shows expression of genes relating to myeloid differentiation in drug-treatedER-HoxA9 cells.

[0046] FIG. 7F shows a PCA of RNA-seq of THP-1 cells treated with vehicle, GSK-LSD1, LY2090314 and combination of both inhibitors.

[0047] FIG. 7G shows a GSEA of myeloid maturation signatures in drug-treated THP-1 cells.

[0048] FIG. 7H shows a GSEA of additional myeloid maturation signatures in THP-1 cellstreated with combo vs. vehicle.

[0049] FIG. 7I shows a GSEA of Somervaille leukemia stem cell (LSC) signatures in THP-1cells treated with combo vs. vehicle.

[0050] FIG. 7J shows a GSEA of Wnt and β-catenin signaling genes in ER-HoxA9 cellstreated with drug combo vs. vehicle.

[0051] FIG. 7K shows a GSEA of Wnt and β-catenin signaling genes in THP-1 cells treatedwith drug combo vs. vehicle.

[0052] FIG. 7L is a chart showing expression of TCF7 (TCF1) in drug-treated ER-HoxA9cells.

[0053] FIG. 8A is a heatmap of expression of genes synergistically upregulated ordownregulated upon combo treatment.

[0054] FIG. 8B shows expression of genes relating to the type-I interferon response in drug-treated ER-HoxA9 cells.

[0055] FIG. 8C shows EnrichR database pathways enriched in upregulated combo synergysignature genes. 7 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0056] FIG. 8D is a heatmap of expression of genes synergistically upregulated ordownregulated upon combo treatment (left), and type I interferon signature genes (right).

[0057] FIG. 8E is a chart showing expression of genes relating to the type I interferonresponse in drug-treated THP-1 cells.

[0058] FIG. 8F is a diagam showing EnrichR database pathways enriched in upregulatedcombo synergy signature genes.

[0059] FIG. 8G shows combo treatment activates type I interferon signaling in AML cells.FIG. 8G is a dot blot for dsRNA using total RNA from THP-1 cells treated with indicatedinhibitors. Total RNA extract treated with mock, RNase T1, RNase III, or RNase A (350 mM NaCl) was dotted on Hybond N+ membranes, visualized by methylene blue staining and immunoblotted with J2 antibody.

[0060] FIG. 9A shows PCA of ATAC-seq in drug-treated ER-HoxA9 cells.

[0061] FIG. 9B shows ATAC-seq signal at promoters of type I interferon response genes incombo and vehicle-treated ER-HoxA9 cells.

[0062] FIG. 9C is tracks showing ATAC-seq signal at the MX1 promoter in drug-treated cells.

[0063] FIG. 10A shows PCA of IRF7 and β-catenin CUT&RUN in THP-1 cells treated withvehicle, GSK-LSD1, LY2090314 and combination of both inhibitors.

[0064] FIG. 10B are heat maps showing global signal intensity of IRF7, and β-cateninCUT&RUN in THP-1 cells treated with vehicle, GSK-LSD1, LY2090314 or combination ofboth inhibitors.

[0065] FIG. 10C shows Venn diagrams showing overlap between IRF7 and β-catenin bindingin LY2090314 and combo-treated THP-1 cells (top). Genomic distributions of singly and co-bound peaks shown for combo-treated cells (below).

[0066] FIG. 10D shows CUT&RUN signal of IRF7 and β-catenin at promoters of interferon-αresponse genes (left two panels) and myeloid differentiation signature genes (right two panels) after drug treatments.

[0067] FIG. 10E shows enrichment of top motifs relating to myeloid differentiation ingenomic regions co-bound by IRF7 and β-catenin. 8 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0068] FIG. 10F shows tracks of IRF7 and β-catenin CUT&RUN at the STAT1, STAT2, andIFIH1 (MDA5) loci in drug-treated THP-1 cells. Gene expression of each gene after drugtreatments is shown to the right of the corresponding CUT&RUN track.

[0069] FIG. 11A is an analysis of ISG15 and MX1 mRNA relative levels in THP-1, U937 andMOLM-13 cells treated with indicated inhibitors. Values were normalized against GAPDH.

[0070] FIG. 11B is a Western blot analysis of p-STAT1(T701) and total STAT1 from THP-1cells treated with indicated inhibitors in the presence or absence of ruxolitinib. Tubulin wasused as a loading control.

[0071] FIG. 11C is an analysis of IRF7, ISG15, MX1 and DDX58 mRNA relative levels inTHP-1 cells treated with indicated inhibitors in the presence or absence of ruxolitinib. Valueswere normalized against GAPDH.

[0072] FIG. 11D is an analysis of cell viability in THP-1 cells treated with the indicatedinhibitors in the presence or absence of ruxolitinib by Cell Titer Glo assay.

[0073] FIG. 11E is an analysis of CD11b mRNA relative levels in THP-1 cells treated withthe indicated inhibitors in the presence or absence of ruxolitinib.

[0074] FIG. 11F is a Western blot analysis of STAT1 protein level in THP-1 cells. Twoindependent clones were used for STAT1-KO. Tubulin was used as a loading control.

[0075] FIG. 11G is an analysis of IRF7, ISG15, MX1 and DDX58 mRNA relative levels inSTAT1-KO THP-1 cells treated with indicated inhibitors. Values were normalized againstGAPDH.

[0076] FIG. 11H is an analysis of cells viability in STAT1-KO THP-1 cells treated withindicated inhibitors by Cell Titer Glo assay.

[0077] FIG. 11I is an analysis of CD11b mRNA relative levels in STAT1-KO THP-1 cellstreated with indicated inhibitors.

[0078] FIG. 11J is an analysis of β-catenin and IRF7 interactions by co-immunoprecipitation. Vinculin was used as a loading control.

[0079] FIG. 11K shows how IRF7 and β-catenin co-localize at cell cycle and MYC-relatedgenes in combo-treated THP-1 cells. FIG.11K shows CUT&RUN tracks of IRF7 and β-cateninat the MYC locus in drug-treated THP-1 cells.9 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0080] FIG. 11L shows the enrichment of E2F motifs in genomic regions co-bound by IRF7and β-catenin in combo-treated THP-1 cells.

[0081] FIG. 12A shows fold change induction of CD11b-positive cells in primary AMLsamples cultured with varying concentrations of GSK-LSD1 relative to the vehicle. Each dotrepresents one primary sample.

[0082] FIG. 12B shows fold change induction of CD11b-positive cells in primary AMLsamples cultured with varying concentrations of LY2090314 relative to the vehicle. Each dotrepresents one primary sample.

[0083] FIG. 12C shows fold change induction of CD11b-positive cells in primary AMLsamples cultured with varying concentrations of GSK-LSD1 and LY2090314 relative to thevehicle. Each dot represents one primary sample.

[0084] FIG. 13A shows quantification of colonies formed by seven different DNMT3A-mutantprimary AML samples treated with DMSO, GSK-LSD1 (50nM), LY2090314 (100nM) andcombination of both inhibitors. Data are presented as mean of triplicates ± SD.

[0085] FIG. 13B shows the effect of the combo treatment in different AML primary samples.Quantification of colonies formed by a NPM1-mutant primary AML sample treated withDMSO, GSK-LSD1 (50nM), LY2090314 (100nM) and combination of both inhibitors. Dataare presented as mean of triplicates ± SD.

[0086] FIG. 13C shows the quantification of colonies formed by two different DMT3A-WTprimary AML samples treated with DMSO, GSK-LSD1 (50nM), LY2090314 (100nM) orcombination of both inhibitors. Data are presented as mean of triplicates ± SD.

[0087] FIG. 13D shows quantification of colonies formed by two different TP53-mutantprimary AML samples treated with DMSO, GSK-LSD1 (50nM), LY2090314 (100nM) andcombination of both inhibitors. Data are presented as mean of triplicates ± SD.

[0088] FIG. 13E shows Wright-Giemsa-stained cytospins for four different DNMT3A-mutantprimary AML samples treated with DMSO, GSK-LSD1 (50nM), LY2090314 (100nM) andcombination of both Inhibitors.

[0089] FIG. 13F shows quantification of colonies formed by a DNMT3A-mutant primary AMLsamples treated with DMSO, IMG-7289 (50nM), LY2090314 (100nM) and combination ofboth Inhibitors. Data are presented as mean of triplicates ± SD.10 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0090] FIG. 13G shows quantification of colonies formed by a DNMT3A-mutant primaryAML samples treated with DMSO, IMG-7289 (50nM), 9-ING-41 (100nM) and combination ofboth Inhibitors. Data are presented as mean of triplicates ± SD.

[0091] FIG. 13H shows Wright-Giemsa-stained cytospins for a DNMT3A-mutant primaryAML samples treated with DMSO, IMG-7289 (50nM), 9-ING-41 (100nM) and combination of both Inhibitors.

[0092] FIG. 13I shows the fold change induction of β-catenin-positive cells in primary AMLsamples treated with Vehicle, GSK-LSD1 (50nM), LY2090314(100nM) or combination of both inhibitors. Statistical analyses Mann Whitney U tests were used * = P < 0.05.

[0093] FIG. 13J is an analysis of IRF7, ISG15, DDX58 and MX1 mRNA relative levels in aDNMT3A-mutant primary AML samples treated with DMSO, GSK-LSD1 (50nM), LY2090314(100nM) or combination of both inhibitors. Values were normalized against GAPDH.

[0094] FIG. 13K shows an analysis of ERVs mRNA relative levels in a DNMT3A-WT vsDNMT3A-mutant primary AML samples.

[0095] FIG. 13L shows an analysis of IRF7, ISG15, DDX58 and MX1 mRNA relative levels ina DNMT3A-WT vs DNMT3A-mutant primary AML samples. Values were normalized againstGAPDH.

[0096] FIG. 13M shows quantification of colonies formed by normal hematopoietic progenitorcells (CD34+ cord blood cells) treated with indicated inhibitors. Data are presented as mean oftriplicates ± SD.

[0097] FIG. 14A shows correlations between OHSU patient combo synergy enrichmentscores, type I interferon response genes enrichment scores, Wnt pathways genes enrichment scores, and leukemia stem cell (LSC) signature gene enrichment scores in OSHU patient cohort.

[0098] FIG. 14B is a bar graph showing the number of DNMT3A-WT and DNMT3A-mutantOHSU patients with high (upper quartile) combo synergy scores and low (quartiles 1-3) combo synergy scores.

[0099] FIG. 15 shows Kaplan-Meier plot showing overall survival of OHSU patients stratifiedby above and below median combo synergy signature scores. 11 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0100] FIG. 16 is an analysis of the TCF / LEF reporter activity in HCT-116 cells followingtreatment with indicated inhibitors, with and without the presence of WNT3a. DETAILED DESCRIPTION

[0101] In accordance with the present disclosure it has been surprisingly found that acombination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor results in a combination of actives which has beneficial effect, preferably synergistic effect, in the prevention or treatment of various cancers.

[0102] More particularly, it has been found that simultaneous inhibition of the histonedemethylase LSD1 and the Wnt pathway GSK3β kinase robustly promotes therapeutic differentiation of established AML cell lines and primary human AML cells, as well as reducing tumor burden in a xenograft mouse model. Mechanistically, this combination promotes differentiation by activating genes in the type I interferon pathway (IFN-I) via inducing expression of IRF7 (LSD1i) and β-catenin (GSK3i) and their selective co-occupancyat targets such as STAT1, which is necessary for combination-induced differentiation.

[0103] Combination treatment was also found to suppress the canonical, pro-oncogenic Wntpathway and cell cycle genes. Analysis of AML patient datasets reveals a correlation between the combination-induced transcription signature and better prognosis, highlighting clinical potential of this strategy. It has been found that the combination strategy re-wires transcriptional programs to suppress stemness and to promote differentiation, and this is predicted to be of therapeutic benefit in AML and in Wnt-driven cancers more generally.

[0104] Advantageously, combination treatment in accordance with the present disclosureeffectively suppresses cell proliferation across all tested AML cell lines, not just THP-1 and Kasumi-1. As well as the unexpectedly greater range of responsive cell lines found when using the combination of inhibitors, there is also a dosage related effect. Very low doses of the two inhibitors have been used, which when used alone would have had modest effects even on sensitive cells, but in combination the two inhibitors have unexpectedly greater effects compared to each inhibitor used alone.

[0105] Accordingly, the present disclosure provides a method of preventing or treating cancerin an individual, comprising administering a therapeutic amount of an histone demethylase (LSD1) inhibitor and a therapeutic amount of a glycogen synthase kinase-3 (GSK-3) inhibitor 12 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0to the individual. The combined effect of the LSD1 and GSK-3 inhibitors is preferably synergistic.

[0106] An additive effect occurs when the combined effect of two active components equalsthe sum of each of the two active components alone. Synergy or a synergistic effect means that the combined effect of two active components exceeds the sum of the effects of the two individual components. was removed as a term.

[0107] "GSK-3" refers to Glycogen Synthase Kinase 3, which is a serine / threonine proteinkinase enzyme found in many organisms, including humans. It plays crucial roles in various cellular processes, including glycogen metabolism, cell signaling, gene expression, cell division, and neuronal function. There are two isoforms of GSK-3: GSK-3α and GSK-3β, which are encoded by separate genes but share significant structural and functional similarities. GSK-3 is constitutively active under basal conditions and is regulated primarily through inhibitory phosphorylation and interactions with various signaling pathways. GSK-3 is involved in numerous signaling pathways, including the Wnt signaling pathway, which regulates cell proliferation, differentiation, and cell fate determination during embryonic development and tissue homeostasis. GSK-3 also plays roles in insulin signaling, where it regulates glycogen synthesis and glucose metabolism, as well as in other pathways implicated in cancer, neurodegenerative diseases, and mood disorders.

[0108] Glycogen Synthase Kinase 3 (GSK-3) inhibitors are a class of compounds that blockthe activity of the GSK-3 enzyme. GSK-3 is a serine / threonine kinase that plays a crucial rolein various cellular processes including glycogen metabolism, gene expression, cellproliferation, apoptosis, and neuronal function, as well as being implicated in several diseases including cancer, diabetes, neurodegenerative disorders (such as Alzheimer's disease), and psychiatric disorders (such as bipolar disorder and schizophrenia).

[0109] LSD1 refers to lysine-specific demethylase 1, which is an enzyme that plays a role inthe epigenetic regulation of gene expression. Specifically, LSD1 functions as a histone demethylase, meaning it removes methyl groups from histone proteins. This activity can lead to changes in chromatin structure and gene expression. LSD1 primarily targets histone H3 lysine 4 (H3K4) and histone H3 lysine 9 (H3K9) for demethylation. By removing methyl groups from these histone residues, LSD1 can either activate or repress gene transcription, depending on its interactions with other proteins and the specific context of the chromatin environment. 13 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0110] The term “inhibitor,” “inhibition,” “inhibit,” “inhibiting,” and the like, in reference toa protein-inhibitor interaction, means negatively affecting (e.g., decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor. Inhibition may refer to negatively affecting (e.g., decreasing) the concentration or level of the protein relative to the concentration or level of the protein in the absence of the inhibitor. Inhibition may refer reduction of a disease or symptoms of disease. Inhibition may refer to a reduction in the activity of a particular protein or nucleic acid target. Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein.

[0111] GSK-3 inhibitor refers to a compound that selectively inhibits GSK-3 and in particularthe serine / threonine kinase activity of the enzyme.

[0112] LSD1 inhibitor refers to a compound that selectively inhibits LSD1, in particular thehistone demethylase activity of the LSD1 enzyme.

[0113] As used herein, “selective” or “selectively” or the like of a compound refers to thecompound’s ability to discriminate between molecular targets. “Specific”, “specifically”, “specificity”, or the like of a compound refers to the compound’s ability to cause a particular action, such as inhibition, to a particular molecular target with minimal or no action to other proteins in the cell.

[0114] Although there is no particularly preferred sequence or timing of administration of theLSD1 inhibitor and the GSK-3 inhibitor, these may be administered substantially simultaneously.

[0115] Amongst the possible GSK-3 inhibitors for use in accordance with the disclosure, thepreferred GSK-3 inhibitor is a β-isoform-specific inhibitor of GSK-3.

[0116] As is apparent from the above, the LSD-1 inhibitor and the GSK-3 inhibitor may beselected entirely independently of each other. In preferred aspects, the LSD-1 inhibitor may be independently selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY-1001 (RG6016), SP2509, TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003.

[0117] Whether separately or additionally to the above, the GSK-3 inhibitor may be selectedfrom the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB- 14 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO-acetoxime (6- Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

[0118] Cancers suitable for treatment in accordance with the disclosure may be characterisedby a dysregulation of the Wnt pathway.

[0119] Dysregulation of a gene refers to an abnormal or aberrant expression or activity of thatgene. Genes are typically regulated tightly within cells, with their expression controlled by various molecular mechanisms to ensure proper functioning and maintain cellular homeostasis. Dysregulation of a gene can occur due to various factors, including mutations, epigenetic changes, alterations in signaling pathways, or environmental factors. There are two main types of gene dysregulation: (1) downregulation, and (2) overexpression. Downregulation occurs when a gene is expressed at lower levels than normal or completely silenced. Downregulation can result from mutations that disrupt the gene's transcriptional machinery, alterations in regulatory elements that control gene expression, or epigenetic modifications such as DNA methylation or histone deacetylation that repress gene transcription. Overexpression occurs when a gene is expressed at higher levels than normal. Overexpression can result from gene amplification (increased gene copy number), chromosomal rearrangements that place the gene under the control of a stronger promoter, mutations in regulatory elements that enhance gene expression, or dysregulation of signaling pathways that activate gene transcription.

[0120] The Wnt signaling pathway is a highly conserved signaling pathway that plays criticalroles in embryonic development, tissue homeostasis, and various diseases, including cancer. It regulates cell proliferation, differentiation, migration, and polarity during embryogenesis and continues to function in adult tissues for tissue maintenance and repair. The canonical Wnt signaling pathway is the most well-studied branch of Wnt signaling and includes:

[0121] (1) Wnt Ligands and Receptors: the pathway is initiated by the binding of Wnt ligandsto Frizzled (Fz) receptors on the cell surface. Wnt ligands are secreted glycoproteins, and Frizzled receptors are seven-pass transmembrane proteins.

[0122] (2) Formation of Wnt-Receptor Complex: upon Wnt binding to Frizzled receptors, thereceptors form a complex with co-receptors, such as LRP5 / 6 (Low-Density Lipoprotein Receptor-Related Protein 5 / 6), which are single-pass transmembrane proteins. 15 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0123] Activation of Disheveled (Dvl): formation of the Wnt-Frizzled-LRP complex leads tothe recruitment and activation of Disheveled (Dvl), a cytoplasmic protein. Dvl becomes phosphorylated and activated at the cell membrane.

[0124] Inhibition of β-catenin Destruction Complex: activated Dvl inhibits the β-catenindestruction complex, which is a multiprotein complex consisting of APC (Adenomatous Polyposis Coli), Axin, CK1 (Casein Kinase 1), and GSK3β (Glycogen Synthase Kinase 3β). In the absence of Wnt signaling, the destruction complex promotes the phosphorylation and degradation of cytoplasmic β-catenin.

[0125] Accumulation and Nuclear Translocation of β-catenin: inhibition of the destructioncomplex by activated Dvl prevents β-catenin phosphorylation and degradation. Consequently, β-catenin accumulates in the cytoplasm and translocates into the nucleus.

[0126] Gene Transcription Activation: in the nucleus, β-catenin interacts with TCF / LEF (T-Cell Factor / Lymphoid Enhancer Factor) transcription factors to activate the transcription of Wnt target genes. These target genes include c-Myc, Cyclin D1, Axin2, and others, which regulate cell proliferation, survival, and other cellular processes.

[0127] The canonical Wnt pathway is tightly regulated at multiple levels to ensure propercellular responses and developmental processes. Dysregulation of Wnt signaling is associated with various diseases, including cancer, developmental disorders, and degenerative diseases. For example, aberrant activation of Wnt signaling, often due to mutations in pathway components such as APC or β-catenin, is a hallmark of colorectal cancer and contributes to tumor initiation and progression.

[0128] Cancers also suitable for treatment in accordance with the disclosure may becharacterized as a cancer which comprises cells which express Interferon-Stimulating Genes (ISGs) at levels greater than non-cancer cells. A list of these ISGs is set forth in Tables 1 and 3 hereinafter. Particular cancer cells which express ISGs at levels greater than non-cancer cellsmay have a DNMT3A mutation.

[0129] Interferon-stimulated genes (ISGs) are genes that are induced by interferons, whichare a group of signaling proteins that play a key role in the immune response to viral infections and other pathogens. Interferons are produced and released by cells in response to the presence of pathogens, particularly viruses, and they trigger a cascade of signaling events that lead to the expression of various genes, including ISGs. ISGs encode proteins that have diverse functions 16 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0involved in the antiviral response. These functions can include inhibiting viral replication, modulating immune cell activity, and enhancing the overall immune response. Examples ofISGs include proteins involved in: (1) antiviral defense mechanisms, such as proteins thatinhibit viral replication or block viral entry into host cells; (2) immune regulation, including proteins that regulate the activation and function of immune cells such as T cells, B cells, and natural killer (NK) cells; and (3) cellular processes that contribute to the overall antiviral response, such as apoptosis (programmed cell death) and the production of inflammatory cytokines.

[0130] Exemplary ISGs for use in accordance with the disclosure are set forth in Tables 1 and3 hereinafter. Particular ISGs of the present disclosure include, for example, selected from oneor more of: OASL1, OASL2, OAS2, OAS1G, OAS1A, MX1, MX2, ISG15, IRF7 andDdx58; preferably wherein the ISG is OAS1A and / or MX1.

[0131] DNMT3A refers to a gene encoding DNA (cytosine-5)-methyltransferase 3A, anenzyme involved in DNA methylation, an essential epigenetic mechanism regulating gene expression. DNMT3A mutations have been implicated in various cancers, including acute myeloid leukemia (AML), myelodysplastic syndromes (MDS), and other hematologic malignancies. Mutations in DNMT3A can disrupt normal DNA methylation patterns, contributing to aberrant gene expression and tumorigenesis.

[0132] The OASL1 gene encodes the 2'-5'-oligoadenylate synthetase-like protein 1 (OASL1).This protein is a member of the 2'-5'-oligoadenylate synthetase (OAS) family, which plays a crucial role in the innate immune response against viral infections.

[0133] The OASL2 gene encodes the 2'-5'-oligoadenylate synthetase-like protein 2 (OASL2).Like OASL1, OASL2 is a member of the 2'-5'-oligoadenylate synthetase (OAS) family, which plays a role in the innate immune response against viral infections. However, OASL2 has distinct functions and characteristics compared to OASL1.

[0134] The OAS2 gene encodes the 2'-5'-oligoadenylate synthetase 2 protein (OAS2). Thisprotein is a member of the 2'-5'-oligoadenylate synthetase (OAS) family, which plays a critical role in the innate immune response against viral infections.

[0135] The OAS1G gene encodes an isoform of the OAS1 protein, which is a member of the2'-5'-oligoadenylate synthetase (OAS) family, which plays a crucial role in the innate immune response against viral infections. 17 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0136] The OAS1A gene encodes an isoform of the OAS1 protein, which is a member of the2'-5'-oligoadenylate synthetase (OAS) family, which plays a crucial role in the innate immune response against viral infections.

[0137] The MX1 gene encodes Myxovirus resistance protein 1 (MX1). MX1 is a member ofthe dynamin superfamily of large GTPases. MX1 is a key component of the innate immune system and plays a critical role in defending against viral infections, particularly those caused by RNA viruses.

[0138] The MX2 gene encodes the Myxovirus resistance protein 2 (MX2) which is a memberof the dynamin superfamily of large GTPases. Like MX1, MX2 is involved in the innate immune response against viral infections, particularly those caused by retroviruses such asHIV-1 (Human Immunodeficiency Virus-1).

[0139] The ISG15 gene encodes the Interferon-Stimulated Gene 15 protein (ISG15). ISG15 isa small ubiquitin-like protein (UBL) that is induced by type I interferons (IFNs) and plays a crucial role in the innate immune response to viral infections.

[0140] The IRF7 gene encodes the Interferon Regulatory Factor 7 protein (IRF7). IRF7 is atranscription factor that plays a crucial role in the regulation of the immune response, particularly in the induction of type I interferons (IFNs) and the activation of antiviral defenses.

[0141] The Ddx58 gene, also known as RIG-I (Retinoic Acid-Inducible Gene I) encodes aprotein that plays a crucial role in the innate immune system, particularly in the detection of viral RNA. It is a member of the RIG-I-like receptor (RLR) family and is involved in recognizing viral RNA in the cytoplasm of infected cells. Upon binding to viral RNA, Ddx58 triggers a signaling cascade that leads to the production of type I interferons and other cytokines, which help to mount an immune response against the invading virus.

[0142] The present methods may be used to prevent or treat a wide range of cancer types,including acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breastcancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lungcancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer.

[0143] The methods are particularly useful in the prevention or treatment of AML. AML is atype of cancer that affects the blood and bone marrow. It is characterized by the rapid growth of abnormal myeloid cells, which are immature white blood cells that are supposed to develop into various types of mature blood cells, including red blood cells, white blood cells, and 18 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0platelets. AML typically develops from mutations in the DNA of hematopoietic stem cells, which are cells in the bone marrow that give rise to all types of blood cells. These mutations disrupt the normal process of cell differentiation and proliferation, leading to the accumulation of immature blast cells in the bone marrow and bloodstream.

[0144] A preferred GSK-3 inhibitor in according with the disclosure is LY2090314.

[0145] A preferred LSD-1 Inhibitor in accordance with the disclosure is GSK-LSD1.

[0146] This disclosure also provides a product comprising a histone demethylase (LSD1)Inhibitor and a glycogen synthase kinase-3 (GSK-3) Inhibitor for combined separate, simultaneous or concurrent use for the prevention or treatment of cancer in an individual.

[0147] The combined, separate, or concurrent use of two active agents refers to differentstrategies for administering multiple therapeutic agents. In the approach of combined use of two or more active agents formulated together into a single medication or treatment regimen, this can be achieved by combining drugs into a single pill or injection, or by administering them simultaneously as part of a treatment protocol. The goal of combined therapy is to enhance efficacy, improve convenience, and potentially reduce side effects compared to using each agent separately.

[0148] In separate use, each active agent is administered individually, either sequentially or atdifferent times during the course of treatment. This approach may be preferred when the drugs have different dosing schedules, mechanisms of action, or side effect profiles, making it difficult or impractical to combine them into a single formulation. Separate use allows for greater flexibility in adjusting doses, optimizing treatment regimens, and managing potential drug interactions.

[0149] In concurrent use, two or more active agents are administered simultaneously, but asseparate medications or treatment modalities. This approach is commonly used in cancer therapy, where multiple drugs with different mechanisms of action are administered together to target different aspects of tumor growth and progression. Concurrent chemotherapy regimens, for example, often combine drugs with complementary or synergistic effects to improve treatment response and reduce the risk of drug resistance.

[0150] This disclosure further provides a product comprising a synergistic combination of ahistone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for the prevention or treatment of cancer in an individual. 19 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0151] In any of the products of the disclosure, the LSD-1 inhibitor and the GSK-3 inhibitormay be selected entirely independently of each other. In preferred products the LSD-1 inhibitor may be independently selected from the group consisting of GSK-LSD1, bomedemstat(IMG-7289), l)-), IOX3, OG-L002, ORY-1001 (RG6016), SP2509, TAK-418, LSD1-UM-109,pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003; and / or the GSK-3 inhibitor may be selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

[0152] In particularly preferred products, the GSK-3 inhibitor is LY2090314 and the LSD-1inhibitor is GSK-LSD1.

[0153] The cancers that products of this disclosure are used to prevent or treat may be cancerscharacterized by a dysregulation of the Wnt pathway; preferably the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

[0154] The disclosure further provides a histone demethylase (LSD1) inhibitor and a glycogensynthase kinase-3 (GSK-3) inhibitor for combined use in the prevention or treatment of cancer.

[0155] In any of these uses in accordance with the disclosure, the LSD-1 inhibitor may beindependently selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289),OG-L002, ORY-1001 (RG6016), SP2509, TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003; and / or the GSK-3 inhibitor may be independently selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

[0156] In preferred uses in accordance with the disclosure the GSK-3 inhibitor is LY2090314and the LSD-1 inhibitor is GSK-LSD1. 20 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0157] In accordance with the uses of the disclosure as defined herein, the cancer to beprevented or treated may be characterized by a dysregulation of the Wnt pathway; preferablywherein the cancer is selected from the group consisting of acute myeloid leukemia (AML),colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

[0158] The disclosure also provides a composition comprising a histone demethylase (LSD1)inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor; preferably wherein the composition is a synergistic composition.

[0159] In compositions of the disclosure, the LSD-1 inhibitor may be independently selectedfrom the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY-1001(RG6016), SP2509, TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552,INCB059872, and DDP-38003; and / or wherein the (b) the GSK-3 inhibitor may be independently selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

[0160] In a preferred composition of the present disclosure, the GSK-3 inhibitor isLY2090314 and the LSD-1 inhibitor is GSK-LSD1.

[0161] Compositions of this dosclusure as defined herein may be used to prevent or treat acancer which is characterized by a dysregulation of the Wnt pathway; preferably wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

[0162] The disclosure further provides a kit comprising a first container comprising a histonedemethylase (LSD1) inhibitor, and a second container comprising a glycogen synthase kinase-3 (GSK-3) inhibitor. 21 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0163] In such kits of the disclosure, these may comprise a set of instructions for the use ofthe histone demethylase (LSD1) inhibitor and the glycogen synthase kinase-3 (GSK-3) inhibitor in the prevention or treatment of cancer.

[0164] Similarly, as with the aforementioned aspects of the disclosure, a kit may comprise anLSD-1 inhibitor independently selected from the group consisting of GSK-LSD1, bomedemstat(IMG-7289), OG-L002, ORY-1001 (RG6016), SP2509, TAK-418, LSD1-UM-109,pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003; and / or the GSK-3 inhibitor is selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

[0165] A preferred kit of the comprises a GSK-3 inhibitor which is LY2090314 and an LSD-1inhibitor which is GSK-LSD1.

[0166] In application of the kits to the prevention or treatment of cancer, the cancer may becharacterized by a dysregulation of the Wnt pathway; preferably wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

[0167] The disclosure further includes a method of determining the suitability of a cancerpatient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor comprising determining the level of expression of at least one type I interferon (IFN) signaling pathway gene and / or at least one interferon stimulated gene (ISG) in a cancer cell sample of the patient, and determining the level of expression of the at least one type I interferon (IFN) signaling pathway gene and / or at least one interferon stimulated gene (ISG) in a non-cancer cell sample of the patient, wherein an increased level of expression of the at least one type I interferon (IFN) signaling pathway gene and / or at least one ISG in the cancer cell sample indicates that the patient will be responsive to the treatment. 22 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0168] The at least one type I interferon (IFN) signaling pathway gene and / or at least one ISGwith an increased level of expression in the cancer cell sample may be selected from the listed genes in Table 1 or Table 3; optionally wherein the gene or genes are mutated gene; preferably wherein the ISG is DNMT3A.

[0169] The disclosure also includes a method of determining the suitability of a cancerpatient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor comprising determining the presence or absenceof a mutation in DNMT3A and / or NPM1 in a cancer cell sample from the patient, wherein thepresence of a mutation in DNMT3A and / or NPM1 indicates a patient that will be responsive tothe treatment, and wherein the absence of a mutation in DNMT3A and / or NPM1 indicates apatient that is expected to be non-responsive to the treatment.

[0170] The NPM1 gene, also known as Nucleophosmin 1, encodes a nucleolar phosphoproteinthat plays important roles in various cellular processes, including ribosome biogenesis, mRNA processing, centrosome duplication, and regulation of the tumor suppressor protein p53. Mutations in the NPM1 gene are commonly associated with acute myeloid leukemia (AML), a type of cancer that affects the blood and bone marrow. The most common mutation involvingthe NPM1 gene in AML is a nucleotide insertion in exon 12, which leads to a frameshiftmutation and the production of a mutant protein. This mutation is found in approximately one-third of patients with AML, particularly those with normal cytogenetics. The NPM1 mutationis considered a driver mutation in AML and is associated with distinct clinical and molecular features, including a higher frequency in younger patients, a favorable response to chemotherapy, and a relatively good prognosis compared to other subtypes of AML. The mutant NPM1 protein has altered cellular localization and may disrupt normal cellular functions, contributing to leukemogenesis.

[0171] Detection of NPM1 mutations is important for diagnostic and prognostic purposes inpatients with AML. It is often used in combination with other molecular and cytogenetic markers to stratify patients into different risk groups and guide treatment decisions.Additionally, research into the molecular mechanisms underlying NPM1-mutated AML maylead to the development of targeted therapies aimed at specifically targeting cells with NPM1 mutations. 23 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0172] The disclosure further includes a method of monitoring the efficacy of treatment ofcancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, comprising determining the level of expression of: (i) at least one type I interferon (IFN) signaling pathway gene in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of a type I IFN signaling pathway gene, as represented by increased level of expression of said at least one gene, during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment; and / or (ii) at least one interferon stimulated gene (ISG) in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of an ISG, asrepresented by increased level of expression of said at least one gene, during or after treatmentcompared to prior to treatment, indicates that patient is responsive to treatment.

[0173] The increased level of expression referred to herein for the at least one IFN signallingpathway gene and / or at least one ISG may be measured and then this measurement compared to a control level of expression. Such a control level of expression may be calculated from a number of subjects without a particular disease. A control level also includes a known control level or value as measured using a non-cancer cell or control cell, or as may be known in the art.

[0174] The Type I interferon (IFN) signaling pathway is a crucial component of the innateimmune response against viral infections and other pathogens. Type I interferons, including interferon-alpha (IFN-α) and interferon-beta (IFN-β), are secreted by virus-infected cells and certain immune cells in response to viral nucleic acids or other microbial stimuli. These interferons bind to specific cell surface receptors, initiating a signaling cascade that leads to the induction of antiviral proteins and other immune responses.

[0175] Monitoring efficacy of treatment of cancer in a patient may involve variousapproaches and techniques aimed at assessing the response of tumours to treatment. Exemplary methods of monitoring are now described briefly and include imaging techniques. Imaging may be by computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), and ultrasound. Each of these imaging methods can provide detailedimages of tumors, allowing clinicians to monitor changes in tumor size, shape, and metabolicactivity over time. 24 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0176] Certain proteins or other molecules already known to be associated with the particularcancer can be measured in blood samples to track disease progression and response to treatment.

[0177] Tissue biopsies before, during, and after treatment can allow for histologicalexamination of tumor tissue to assess changes in cell morphology, proliferation rates, and genetic markers associated with response or resistance to therapy.

[0178] Liquid biopsies, for example, blood samples can be analyzed for circulating tumorcells (CTCs), cell-free DNA (cfDNA), or other biomarkers shed by tumors. These tests can provide real-time information on tumor dynamics and genetic alterations, allowing for early detection of treatment resistance or disease recurrence.

[0179] Functional assays, for example tests such as flow cytometry, immunohistochemistry,or gene expression profiling can evaluate specific cellular functions, protein expression patterns, or molecular signatures associated with treatment response or resistance.

[0180] Clinical parameters can be used for monitoring changes in symptoms, performancestatus, and quality of life can provide valuable insights into the overall response to therapy and help guide treatment decisions.

[0181] Response criteria may be used. For example, various standardized criteria, such asRECIST (Response Evaluation Criteria in Solid Tumors) or PERCIST (PET Response Criteria in Solid Tumors), provide guidelines for categorizing tumor responses based on imaging findings, including complete response, partial response, stable disease, or progressive disease.

[0182] When a cancer is non-responsive to treatment, it means that the tumor is not shrinkingor showing signs of improvement despite undergoing therapy. This lack of response could be due to various factors, summarised briefly as follows:

[0183] Intrinsic resistance which is observed when some cancers inherently havecharacteristics that make them resistant to certain types of treatment. For example, certain mutations or molecular pathways may render the cancer cells less susceptible to chemotherapy, radiation therapy, or targeted therapy.

[0184] Acquired resistance is when cancer cells can adapt and develop resistance to treatmentover time. This may occur due to genetic mutations, changes in signaling pathways, or the selection of subpopulations of cancer cells that are inherently resistant to therapy. 25 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0185] Tumor heterogeneity because tumors are composed of a diverse population of cancercells with different genetic and molecular characteristics. Some of these cells may be more resistant to treatment than others, leading to a heterogeneous response to therapy.

[0186] Microenvironmental factors in the tumor microenvironment play a role, includingfactors such as hypoxia, inflammation, and interactions with surrounding stromal cells, caninfluence the response to treatment. Tumors with a dense stroma or poor blood supply may beless accessible to chemotherapy or targeted agents.

[0187] There may be situations of suboptimal treatment. In some cases, the chosen treatmentregimen may not be the most effective option for a particular cancer type or stage. Factors such as drug dosage, scheduling, and combination therapies may need to be adjusted to improve treatment response.

[0188] Also there may be patient factors: individual patient characteristics may be involved,such as age, overall health, genetic predispositions, and immune function, which can influence treatment response. Patients with compromised immune systems or pre-existing medical conditions may be less responsive to therapy.

[0189] In the aforementioned method of monitoring, the at least one type I IFN signalingpathway gene may be independently selected from one or more genes listed in Table 1 or Table3; preferably independently selected from the group consisting of: STAT1, STAT2, OASL1,OASL2, OAS2, OAS1G, OAS1A, MX1, MX2, ISG15, IRF9, IFIH1 / MDA5, IRF7 and IRF5.

[0190] The STAT1 gene encodes the Signal Transducer and Activator of Transcription 1protein (STAT1). This protein is a member of the STAT family of transcription factors, which play crucial roles in mediating cellular responses to cytokines, growth factors, and other extracellular signals.

[0191] The STAT2 gene encodes the Signal Transducer and Activator of Transcription 2protein (STAT2). This protein is a member of the STAT family of transcription factors, which play crucial roles in mediating cellular responses to cytokines, growth factors, and other extracellular signals.

[0192] The IRF9 gene encodes the Interferon Regulatory Factor 9 protein (IRF9). IRF9 is amember of the interferon regulatory factor (IRF) family of transcription factors, which play critical roles in regulating the expression of interferon-stimulated genes (ISGs) and modulating the innate and adaptive immune responses. 26 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0193] The IFIH1 gene, also known as MDA5 (Melanoma Differentiation-Associated protein5), encodes a cytoplasmic sensor protein involved in the recognition of viral RNA and the initiation of antiviral immune responses. MDA5 is a member of the RIG-I-like receptor (RLR)family, which also includes RIG-I (Retinoic Acid-Inducible Gene I).

[0194] The IRF5 gene encodes the Interferon Regulatory Factor 5 protein (IRF5). IRF5 is atranscription factor that plays a critical role in the regulation of the immune response, particularly in the induction of pro-inflammatory cytokines and the activation of innate and adaptive immune pathways.

[0195] In other aspects of the method of monitoring, the at least one type I IFN signallingpathway gene may be independently selected from one or more genes listed in Table 1 or Table 3; preferably independently selected from the group consisting of: STAT1, OAS1A, MX1 andIRF5; preferably wherein the type I IFN signalling pathway gene is STAT1 and / or IRF7.

[0196] In other aspects of the method of monitoring, the at least one type I IFN signallingpathway gene maybe an ISG independently selected from one or more ISGs in Table 1 or Table 3; preferably independently selected from the group consisting of: OASL1, OASL2, OAS2,OAS1G, OAS1A, MX1, MX2, ISG15, IRF7 and Ddx58; preferably wherein the ISG is OAS1Aand / or MX1.

[0197] In any aspect of the method of monitoring defined herein, the method may furthercomprise determining the level of expression of β-catenin in a cancer cell sample of the patientprior to treatment, and in a cancer cell sample of the patient during or after treatment, whereinan upregulation of β-catenin, as represented by increased level of expression of β-catenin,during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment.

[0198] The disclosure also provides a method of monitoring the efficacy of treatment ofcancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and aglycogen synthase kinase-3 (GSK-3) inhibitor, comprising determining the level of expressionof β-catenin in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of β-catenin, as represented byincreased level of expression of β-catenin, during or after treatment compared to prior totreatment, indicates that patient is responsive non-responsive to treatment. 27 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0199] In any of the aformentioned methods, a cancer sample from a patient may be a tumorsample, such as a resected tumor sample, a tumor biopsy sample, a primary tumor sample, a resected primary tumor sample, a primary tumor biopsy sample, a metastatic tumor sample, a resected metastatic tumor sample, or a metastatic tumor biopsy sample. The sample may also be a blood sample, such as a peripheral blood sample.

[0200] "β-catenin" is a key protein involved in cell adhesion and the Wnt signaling pathway.β-catenin is a cytoplasmic protein that plays a crucial role in cell-cell adhesion. It is a component of adherens junctions, which are protein complexes that help cells stick together. In adherens junctions, β-catenin interacts with cadherin proteins on the cell surface and links them to the actin cytoskeleton inside the cell. This connection helps maintain tissue integrity and stability and is important for various cellular processes, including tissue development and wound healing. β-catenin is also a central component of the canonical Wnt signaling pathway. In the absence of Wnt signaling, cytoplasmic β-catenin is targeted for degradation by a protein complex known as the destruction complex, which includes adenomatous polyposis coli (APC), Axin, glycogen synthase kinase 3 beta (GSK3β), and casein kinase 1 (CK1). This results in low levels of β-catenin in the cytoplasm. When Wnt signaling is activated by Wnt ligands binding to Frizzled receptors and co-receptors such as LRP5 / 6, the destruction complex is inhibited. As a result, β-catenin accumulates in the cytoplasm and translocates into the nucleus. In the nucleus, β-catenin interacts with transcription factors of the TCF / LEF family to activate the transcription of Wnt target genes involved in cell proliferation, survival, and other cellular processes. Dysregulation of β-catenin is associated with various cancers, particularly colorectal cancer. Mutations in genes encoding components of the destruction complex or β- catenin itself can lead to aberrant activation of the Wnt pathway and contribute to tumor initiation and progression. In some cancers, such as hepatocellular carcinoma, β-catenin mutations are common and drive tumor growth independently of Wnt signaling.

[0201] The disclosure additionally provides a method of monitoring the efficacy of treatmentof cancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor anda glycogen synthase kinase-3 (GSK-3) inhibitor, comprising observing for granulocytes in acancer cell sample of the patient during or after treatment, wherein morphologically and histologically mature granulocytes observed in samples during or after treatment indicates that the patient is responsive to treatment. 28 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0202] In an aforementioned method of monitoring efficacy of treatment, additionally (a) thelevel of expression of CD11b and / or STAT1 may be determined in (i) a non-cancer cell samplefrom the patient; optionally prior to combination treatment, or (ii) a cancer cell sample from thepatient prior to combination treatment, and (b) the level of expression of CD11b and / or STAT1is determined in the cancer cell sample of the patient during or after treatment, wherein aninduction of expression of CD11b and / or STAT1 in the cancer cell sample, or an increase inexpression of CD11b and / or STAT1 in the cancer cell sample compared to the cell sample of (a)or (b) indicates that the patient is responsive to treatment.

[0203] In any of the aformentioned methods of determining the suitability of a cancer patientfor treatment, or methods of monitoring the efficacy of treatment, the cancer may be one is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; preferably wherein the cancer is AML.

[0204] A screen was carried out to identify small molecule inhibitors that synergize with theLSD1 inhibitor GSK-LSD1 to induce differentiation in AML cells. Multiple different librarieswere screened with high quality compounds with known biological targets that the ICCB-L atHMS maintains (https: / / iccb.med.harvard.edu / known-bioactives-collection). The LY2090314was identified in a MoA (mechanism of action library). A full explanation of the materials andmethods and results is provided below and having reference to the Drawings, as briefly described above.

[0205] When used herein, the term “biological sample” refers to any biological sample takenfrom a subject. Biological samples include blood, plasma, serum, tumors, tissue, cells, and thelike. The biological sample may be a blood sample, a peripheral blood sample, a tumor sample, a primary tumor sample, a metastatic tumor sample, a resected tumor sample, a tumor biopsy sample, a resected tumor sample from a primary tumor, a resected tumor sample from a metastisic tumor, a biopsy sample from a primary tumor, a biopsy sample from a metastatictumor. Such samples can be taken from a subject by methods known in the art, and can beanalyzed by methods known in the art.

[0206] In connection with any of the method of monitoring or determination of the disclosure,a “control” sample or value refers to a sample that serves as a reference, usually a known 29 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0reference, for comparison to a test sample. For example, a test sample can be taken from apatient suspected of having a given disease (cancer) and compared to samples from a knowncancer patient, or a known normal (non-disease) individual. A control can also represent anaverage value gathered from a population of similar individuals, e.g., cancer patients or healthyindividuals with a similar medical background, same age, weight, etc. A control value can alsobe obtained from the same individual, e.g., from an earlier-obtained sample, prior to disease, orprior to treatment. One of skill will recognize that controls can be designed for assessment of any number of parameters. A control may be a negative control. In the context of detecting a level of expression, a control may comprise the average amount of expression (e.g., protein or mRNA) in a population of subjects (e.g., with cancer) or in a healthy or generalpopulation. The control may comprise an average amount (e.g. amount of expression) in apopulation in which the number of subjects (n) is 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 25 of more, 50 or more, 100 or more, 1000 or more, 5000 or more, or10000 or more. Where there is a standard control, a person of skill in the art will understandwhich controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance ofdata. For example, if values for a given parameter are widely variant in controls, variation intest samples will not be considered as significant.

[0207] The term “mutant" or “mutation” when applied to a gene or expressed product of thatgene, refers to a gene or gene product having aberrant biological activity compared to a non- mutant. For example, a mutant protein may have increased or decreased biological activity or the mutant protein may have no detectable biological activity compared to the corresponding non-mutant protein. A mutant protein may have biological activity distinct from the non- mutant protein. Mutant proteins are encoded by DNA sequences (i.e. genes) including base pair insertions, deletions, or substitutions that are absent in the corresponding non-mutant protein and that result in the modulation (e.g., increased, decreased, loss of function, gain of function) of biological activity compared to the non-mutant protein.

[0208] The terms “treating”, or “treatment” used herein refer to any indicia of success in thetherapy or amelioration of a tumor or cancerous condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient’s physical 30 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0or mental well-being. The treatment of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric exams, and / or a psychiatric evaluation. The term "treating" and conjugations thereof, include prevention of an tumor or cancer pathology, condition, or disease.

[0209] As used herein “treating" a cancer tumor also means preventing an increase in size orvolume of the cancer tumor. The cancer tumor may be a solid tumor. In some aspects, treatinga cancer tumor includes decreasing the size of volume of a cancer tumor. In other aspects,treating a cancer tumor includes eliminating the cancer tumor altogether. A cancer tumor iseliminated when it is not detectable by an imaging test such as magnetic resonance imaging (MRI), a positron emission tomography (PET) scan, X-ray computed tomography (CT),ultrasound, or single-photon emission computed tomography (SPECT). In further aspects,treating a cancer tumor further comprises reducing or preventing metastasis of the cancer tumor.

[0210] An “effective amount” or “a therapeutic amount” is an amount sufficient to accomplisha stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, or reduce one or more symptoms of a disease or condition). An example of a “therapeutic amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease. A “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). In relation to prevention aspects of this disclosure, where cancer is to be prevented a prophylactically effective amount of the combinations of active agent inaccordance with the disclosure when administered to a subject, will have the intendedprophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of the cancer pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of the cancer pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins). 31 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0211] For any compound described herein, the therapeutically effective amount can beinitially determined from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.

[0212] As is known in the art, therapeutically effective amounts for use in humans can also bedetermined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.

[0213] Dosages may be varied depending upon the requirements of the patient and thecompound being employed. The dose administered to a patient, in the context ofthe compounds described herein should be sufficient to effect a beneficial therapeutic responsein the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.

[0214] Utilizing the teachings provided herein, an effective prophylactic or therapeutictreatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.

[0215] In relation to the products, compositions and kits of the disclosure, the active agentsmay be incorporated together in a “pharmaceutically acceptable excipient” or a “pharmaceutically acceptable carrier”. These terms refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the compounds described herein without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable 32 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0excipients include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethylcellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agentssuch as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencingosmotic pressure, buffers, coloring, and / or aromatic substances and the like that do not deleteriously react with the compounds described herein. Pharmaceutically acceptable excipients are described in the Handbook of Pharmaceutical Excipients, 8thEdition, published by the Pharmaceutical Press (2017), and the United States Food and Drug Administration Inactive Ingredient Database (July 2017), the disclosures of which are incorporated by reference herein in their entirety. One of skill in the art will recognize that other pharmaceutical excipients are useful in combination with the compounds described herein.

[0216] As used herein, the terms “product”, “composition” or "preparation" are intended toinclude the formulation of the active compound with encapsulating material as a carrierproviding a capsule in which the active component with or without other carriers, is surroundedby a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.

[0217] As used herein, the terms “administer”, “administration” or “administering” includesany of oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneousadministration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to asubject. Administration is by any route compatible with the selected compound preparation,including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal,rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular,intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.

[0218] Products or compositions of the disclosure as described herein may be deliveredtransdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, 33 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols. Oral preparations include tablets, pills, powder, dragees, capsules, liquids, lozenges, cachets, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water / propylene glycol solutions. The products or compositions described herein may additionally include components to provide sustained release and / or comfort. Such components include high molecular weight, anionic mucomimetic polymers, gelling polysaccharides and finely-divided drug carrier substrates. These components are discussed in greater detail in U.S. Pat. Nos. 4,911,920; 5,403,841; 5,212,162; and 4,861,760. The entire contents of these patents are incorporated herein by reference in their entirety for all purposes. The compositions disclosed herein can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug- containing microspheres, which slowly release subcutaneously (see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995; as biodegradable and injectable gel formulations (see, e.g., Gao Pharm. Res. 12:857-863, 1995); or, as microspheres for oral administration (see, e.g., Eyles, J. Pharm. Pharmacol. 49:669-674, 1997). The formulations of the compositions of the compounds described herein can be delivered by the use of liposomes which fuse with the cellular membrane or are endocytosed, i.e., by employing receptor ligands attached to the liposome, that bind to surface membrane protein receptors of the cell resulting in endocytosis. By using liposomes, particularly where the liposome surface carries receptor ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the compositions of the compounds described herein into the target cells in vivo. (See, e.g., Al- Muhammed, J. Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587, 1989). The compositions can also be delivered as nanoparticles.

[0219] Pharmaceutical products or compositions in accordance with the disclosure mayinclude compositions wherein the active ingredient (e.g. compounds described herein) is contained in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, interalia, on the condition being treated. When administered in methods to treat a disease, suchcompositions will contain an amount of active ingredient effective to achieve the desired result, 34 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0e.g., modulating the activity of a target molecule, and / or reducing, eliminating, or slowing the progression of disease symptoms.

[0220] The dosage and frequency (single or multiple doses) administered to a mammal orhuman can vary depending upon a variety of factors, for example, whether the mammal or human suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems. Other therapeutic regimens or agents can be used in conjunction with the methods and compounds described herein. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.

[0221] The compounds described herein can be used in combination with one another, withother active drugs known to be useful in treating a disease (e.g. anti-cancer agents) or with adjunctive agents that may not be effective alone, but may contribute to the efficacy of the active agent.

[0222] By "co-administer" it is meant that a composition described herein is administered atthe same time, just prior to, or just after the administration of one or more additional therapies, for example an anti-cancer agent as described herein. The compounds described herein can be administered alone or can be co-administered to the patient. Co-administration is meant to include simultaneous or sequential administration of the compound individually or in combination (more than one compound or agent). Thus, the preparations can also be combined, when desired, with other active substances (e.g. anti-cancer agents).

[0223] Co-administration includes administering one active agent (e.g. a compound describedherein) within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of a second active agent (e.g. anti- cancer agents). Co-administration includes administering one active agent within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of a second active agent. Co-administration includes administering two active agents simultaneously, approximately simultaneously (e.g., withinabout 1, 5, 10, 15, 20, or 30 minutes of each other), or sequentially in any order. Co-administration can be accomplished by co-formulation, i.e., preparing a single pharmaceutical composition including both active agents. The active agents can be formulated separately. Theactive and / or adjunctive agents may be linked or conjugated to one another. The compounds35 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0described herein may be combined with treatments for cancer such as chemotherapy or radiation therapy.

[0224] “Patient” and “subject” are herein used interchangeably and refer to a living organismsuffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. Where a human patient is concerned, this may be sub-categorised into ahuman adult or a human child.

[0225] “Disease” or “condition” refers to a state of being or health status of a patient orsubject capable of being treated with the compounds or methods provided herein. Disease as used herein refers to cancer.

[0226] As used herein, the term "cancer" refers to all types of cancer, neoplasm, malignant orbenign tumors found in mammals, including leukemia, carcinomas and sarcomas. Exemplary cancers include acute myeloid leukemia (“AML”), chronic myelogenous leukemia (“CML”), and cancer of the brain, breast, pancreas, colon, liver, kidney, lung, non-small cell lung, melanoma, ovary, sarcoma, and prostate. Additional examples include, cervix cancers, stomach cancers, head & neck cancers, uterus cancers, mesothelioma, metastatic bone cancer, Medulloblastoma, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, and neoplasms of the endocrine and exocrine pancreas.

[0227] In methods where the expression or level of expression of a gene is required in acancer cells or other sample, the following methods may be used.

[0228] Microarray Analysis allows the expression levels of thousands of genes to be measuredsimultaneously. It involves hybridizing cDNA or RNA samples from cancer cells to microarrays containing gene probes. The intensity of hybridization signals reflects the expression levels of genes in the sample. 36 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0229] RNA Sequencing (RNA-Seq) provides a comprehensive and quantitative analysis ofgene expression by sequencing cDNA molecules derived from RNA samples. It can identify known and novel transcripts and quantify gene expression levels with high sensitivity and accuracy.

[0230] Quantitative Real-Time PCR (qRT-PCR) is a sensitive technique used to measure theexpression levels of specific genes. It involves reverse transcription of RNA into cDNA followed by PCR amplification and quantification using fluorescent probes. This method allows for precise quantification of gene expression levels.

[0231] Northern blotting is a technique used to detect and quantify specific RNA molecules ina sample. It involves separating RNA molecules by gel electrophoresis, transferring them to a membrane, and hybridizing with labeled probes specific to the target RNA. The intensity of the hybridization signal indicates the abundance of the target RNA.

[0232] In Situ Hybridization (ISH) allows for the visualization and localization of specificRNA molecules within cells or tissue sections. It involves hybridizing labeled RNA probes complementary to the target RNA sequence and detecting the hybridization signal using microscopy. This method can provide spatial information about gene expression within the tissue.

[0233] Immunohistochemistry (IHC) is a technique used to detect and visualize proteinswithin tissue sections. It involves using antibodies specific to the protein of interest, which are labeled with a chromogenic or fluorescent marker. By detecting protein expression levels in cancer cells, researchers can infer changes in gene expression that may contribute to cancer progression.

[0234] These methods may be used in combination as desired to provide a morecomprehensive analysis of gene expression patterns in cancer cell and optionally any control or non-cancer samples.

[0235] LSD1 inhibitors

[0236] GSK-LSD1 is (trans-racemic) dihydrochloride, rel-N-[(1R,2S)-2-Phenylcyclopropyl]-4-Piperidinamine hydrochloride (1:2). CAS Number 1431368-48-7: 37 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0237] Bomedemstat (IMG-7289) is N-[(2S)-5-[[(1R,2S)-2-(4-fluorophenyl)cyclopropyl]amino]-1-(4-methylpiperazin-1-yl)-1-oxopentan-2-yl]-4-(triazol-1-yl)benzamide). CAS No. 1990504-34-1:

[0238] OG-L002 is 4′-((1R,2S)-2-Aminocyclopropyl)-[1,1-biphenyl]-3-ol hydrochloride.CAS No. 1357299-45-6: 38 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0239] ORY-1001 (RG6016) also known as ladamemstat is rel-N1-[(1R,2S)-2-phenylcyclopropyl]-1,4-cyclohexanediamine, dihydrochloride. CAS No. 1431326-61-2:

[0240] SP2509 (also known as LSD1 Inhibitor VII) is 3-(4-morpholinylsulfonyl)-benzoic acid(2E)-2-[1-(5-chloro-2-hydroxyphenyl)ethylidene]hydrazide. CAS No. 1423715-09-6:39 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0241] TAK-418 is 5-((2R)-2-((cyclopropylmethyl)amino)cyclopropyl)-N-(tetrahydro-2H-pyran-4-yl)thiophene-3-carboxamide hydrochloride. CAS No. 1818252-53-7:

[0242] LSD1-UM-109 is 2-fluoro-4-[5-(1-methylindazol-5-yl)-1-[(4-methylpiperidin-4-yl)methyl]pyrrolo[2,3-c]pyridin-4-yl]benzonitrile. CAS No. 2252446-26-5: 40 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0243] Pulrodemstat (CC-90011) is 4-[2-(4-Amino-piperidin-1-yl)-5-(3-fluoro-4-methoxyphenyl)-1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl]-2-fluorobenzonitrile benzenesulfonic acid. CAS No. : 1821307-10-1:

[0244] GSK2879552 is 4-[[4-[[[(1R,2S)-2-phenylcyclopropyl]amino]methyl]-1-piperidinyl]methyl]-benzoic acid. CAS No. 1401966-69-5: 41 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0245] INCB059872 is presently without a systematic name. CAS No. 1802909-49-4:

[0246] DDP-38003 is N-[4-[(1S,2R)-2-aminocyclopropyl]phenyl]-4-(4-methylpiperazin-1-yl)benzamide;dihydrochloride. CAS No. 1831167-98-6. The structure below shows the dihydrochloride form, but DDP-38003 also includes the trihydrochloride form (N-[4-[(1S,2R)- 2-aminocyclopropyl]phenyl]-4-(4-methylpiperazin-1-yl)benzamide;trihydrochloride). 42 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0247] GSK-3 Inhibitors

[0248] LY2090314 is 3-[9-Fluoro-1,2,3,4-tetrahydro-2-(1-piperidinylcarbonyl)pyrrolo[3,2,1-jk][1,4]benzodiazepin-7-yl]-4-imidazo[1,2-a]pyridin-3-yl-1h-pyrrole-2,5-dione. CAS No. 603288-22-8:

[0249] Tideglusib (formerly known as 9-ING-41 or NP031112) is 4-Benzyl-2-(naphthalen-1-yl)-[1,2,4]thiadiazolidine-3,5-dione. CAS No. 865854-05-3: 43 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0250] Lithium includes lithium chloride (CAS No. 7447-41-8)

[0251] SB-216763 is 3-(2,4-Dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione. CAS No. 280744-09-4:

[0252] SB-415286 is 3-[(3-Chloro-4-hydroxyphenyl)-amino]-4-(2-nitrophenyl)-1H-pyrrol-2,5-dione. CAS No. 264218-23-7:44 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0253] AR-A014418 is N-(4-Methoxybenzyl)-N-(5-nitro-1,3-thiazol-2-yl)urea. CAS No.487021-52-3:

[0254] CHIR-99021 (CT99021) is 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile. CAS No. 252917-06-9:

[0255] AZD1080 is 2-Hydroxy-3-[5-(4-morpholinylmethyl)-2-pyridinyl]-1H-indole-5-carbonitrile. CAS No. 612487-72-6:45 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0256] BIO-acetoxime (6-Bromoindirubin-3'-oxime) is (3Z)-3-[(3E)-3-[(Acetyloxy)imino]-1,3-dihydro-2H-indol-2-ylidene]-6-bromo-1,3-dihydro-2H-Indol-2-one. CAS No. 667463-85- 6:

[0257] VP0.7 (GSK3-IN-3) is 3-Quinolinecarboxylic acid, 1-ethyl-1,2-dihydro-4-hydroxy-2-oxo-, 2-(1-oxododecyl)hydrazide. CAS No. 331963-27-0:46 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0258] 18BIOder is a neuroprotective GSK-3β inhibitor. CAS No. : 275374-93-1:

[0259] GSK-3 Inhibitor IX is BIO, (2ʹ Z,3ʹ E)-6-Bromoindirubin-3ʹ-oxime. CAS No. 667463-62-9:

[0260] TWS119 is 3[[6(3aminophenyl)7Hpyrrolo[2,3d]pyrimidin4yl]oxy]phenol and is a Wntpathway activator that inhibits GSK-3β. CAS No. 601514196:47 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0261] Cromolyn sodium salt (synonyms: Cromoglycate, Cromoglycic acid) . CAS No.15826-37-6:

[0262] 1-Azakenpaullone (synonyms: 1-Azakenpaullone, 1-AKP) is 9-Bromo-7,12-dihydro-pyrido[3′,2′:2,3]azepino[4,5-b]indol-6(5H)-one and is a kenpaullone analog that acts as a potent and ATP-competitive inhibitor of GSK-3β. Cas No. 676596-65-9: 48 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0263] IM-12 (also known as GSK-3β Inhibitor XIX) is 3-(4-fluorophenethylamino)-1-methyl-4-(2-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione. CAS No. 1129669-05-1:

[0264] AZD2858 is 4-amino-4'-(4-methylpiperazin-1-ylsulfonyl)-N-(pyridin-3-yl)biphenyl-3-carboxamide hydrocholride. CAS No. 486424-20-8:49 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0265] TDZD-8 is 4-Benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione. CAS No. 327036-89-5:

[0266] CHIR 98014 is N-6-[2-[[4-(2,4-Dichlorophenyl)-5-(1H-imidazol-1-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6-pyridinediamine. CAS No. 252935-94-7:

[0267] CP21R7 is 3-(3-aminophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione. CASNo. 125314-13-8: 50 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0268] Unless otherwise stated, compound and structures depicted herein are also meant toinclude compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of ahydrogen by a deuterium or tritium, or the replacement of a carbon by 13C- or 14C-enrichedcarbon are within the scope of the compounds described herein.

[0269] The compounds described herein may also contain unnatural proportions of atomicisotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I), or carbon-14 (14C). All isotopic variations of the compounds described herein, whether radioactive or not, are encompassed within the scope of the compounds described herein.

[0270] The disclosure includes the compounds defined herein to also include anypharmaceutically acceptable salts thereof. That is to say, for any active agent described herein is also included any salts of the active compounds that are prepared with relatively nontoxicacids or bases. Examples of pharmaceutically acceptable base addition salts include sodium,potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, oxalic, 51 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0methanesulfonic, and the like. (See, for example, Berge et al.., “Pharmaceutical Salts”, Journal of Pharmaceutical Science, 1977, 66, 1-19).

[0271] In addition to salt forms, the compounds described herein may be provided in aprodrug form. Prodrugs of the compounds described herein include those compounds that readily undergo chemical or enzymatic changes under physiological conditions to provide the compounds described herein. Additionally, prodrugs can be converted to the compoundsdescribed herein by chemical or biochemical methods in an ex vivo environment. For example,prodrugs can be slowly converted to the compounds described herein when placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent.

[0272] Where compounds described herein can exist in unsolvated forms, they may beprovided as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the compounds described herein. Some compounds may exist in multiple crystalline or amorphous forms.

[0273] In relation to any of the aspects of the disclosure employing the combination of activesingredients, i.e. any of the methods of treatment, any of the products, any of the compositions or kits of the disclosure, then the following individual combinations of LSD1 inhibitor and a therapeutic amount of a GSK-3 inhibitor are provided and described individually herein as follows:

[0274] A combination of LY2090314 and GSK-LSD1.

[0275] A combination of LY2090314 and bomedemstat (IMG-7289).

[0276] A combination of LY2090314 and OG-L002.

[0277] A combination of LY2090314 and ORY-1001 (RG6016).

[0278] A combination of LY2090314 and SP2509.

[0279] A combination of LY2090314 and TAK-418.

[0280] A combination of LY2090314 and LSD1-UM-109.

[0281] A combination of LY2090314 and pulrodemstat (CC-90011).

[0282] A combination of LY2090314 and GSK2879552.

[0283] A combination of LY2090314 and INCB059872.

[0284] A combination of LY2090314 and DDP-38003.

[0285] A combination of Tideglusib (9-ING-41 or NP031112) and GSK-LSD1.52 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0286] A combination of Tideglusib (9-ING-41 or NP031112) and bomedemstat (IMG-7289).

[0287] A combination of Tideglusib (9-ING-41 or NP031112) and OG-L002.

[0288] A combination of Tideglusib (9-ING-41 or NP031112) and ORY-1001 (RG6016).

[0289] A combination of Tideglusib (9-ING-41 or NP031112) and SP2509.

[0290] A combination of Tideglusib (9-ING-41 or NP031112) and TAK-418.

[0291] A combination of Tideglusib (9-ING-41 or NP031112) and LSD1-UM-109.

[0292] A combination of Tideglusib (9-ING-41 or NP031112) and pulrodemstat (CC-90011).

[0293] A combination of Tideglusib (9-ING-41 or NP031112) and GSK2879552.

[0294] A combination of Tideglusib (9-ING-41 or NP031112) and INCB059872.

[0295] A combination of Tideglusib (9-ING-41 or NP031112) and DDP-38003.

[0296] A combination of lithium and GSK-LSD1.

[0297] A combination of lithium and bomedemstat (IMG-7289).

[0298] A combination of lithium and OG-L002.

[0299] A combination of lithium and ORY-1001 (RG6016).

[0300] A combination of lithium and SP2509.

[0301] A combination of lithium and TAK-418.

[0302] A combination of lithium and LSD1-UM-109.

[0303] A combination of lithium and pulrodemstat (CC-90011).

[0304] A combination of lithium and GSK2879552.

[0305] A combination of lithium and INCB059872.

[0306] A combination of lithium and DDP-38003.

[0307] A combination of SB-216763 and GSK-LSD1.

[0308] A combination of SB-216763 and bomedemstat (IMG-7289).

[0309] A combination of SB-216763 and OG-L002.

[0310] A combination of SB-216763 and ORY-1001 (RG6016).

[0311] A combination of SB-216763 and SP2509.

[0312] A combination of SB-216763 and TAK-418.

[0313] A combination of SB-216763 and LSD1-UM-109.53 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0314] A combination of SB-216763 and pulrodemstat (CC-90011).

[0315] A combination of SB-216763 and GSK2879552.

[0316] A combination of SB-216763 and INCB059872.

[0317] A combination of SB-216763 and DDP-38003.

[0318] A combination of SB-415286 and GSK-LSD1.

[0319] A combination of SB-415286 and bomedemstat (IMG-7289).

[0320] A combination of SB-415286 and OG-L002.

[0321] A combination of SB-415286 and ORY-1001 (RG6016).

[0322] A combination of SB-415286 and SP2509.

[0323] A combination of SB-415286 and TAK-418.

[0324] A combination of SB-415286 and LSD1-UM-109.

[0325] A combination of SB-415286 and pulrodemstat (CC-90011).

[0326] A combination of SB-415286 and GSK2879552.

[0327] A combination of SB-415286 and INCB059872.

[0328] A combination of SB-415286 and DDP-38003.

[0329] A combination of AR-A014418 and GSK-LSD1.

[0330] A combination of AR-A014418 and bomedemstat (IMG-7289).

[0331] A combination of AR-A014418 and OG-L002.

[0332] A combination of AR-A014418 and ORY-1001 (RG6016).

[0333] A combination of AR-A014418 and SP2509.

[0334] A combination of AR-A014418 and TAK-418.

[0335] A combination of AR-A014418 and LSD1-UM-109.

[0336] A combination of AR-A014418 and pulrodemstat (CC-90011).

[0337] A combination of AR-A014418 and GSK2879552.

[0338] A combination of AR-A014418 and INCB059872.

[0339] A combination of AR-A014418 and DDP-38003.

[0340] A combination of CHIR-99021 (CT99021) and GSK-LSD1.

[0341] A combination of CHIR-99021 (CT99021) and bomedemstat (IMG-7289).54 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0342] A combination of CHIR-99021 (CT99021) and OG-L002.

[0343] A combination of CHIR-99021 (CT99021) and ORY-1001 (RG6016).

[0344] A combination of CHIR-99021 (CT99021) and SP2509.

[0345] A combination of CHIR-99021 (CT99021) and TAK-418.

[0346] A combination of CHIR-99021 (CT99021) and LSD1-UM-109.

[0347] A combination of CHIR-99021 (CT99021) and pulrodemstat (CC-90011).

[0348] A combination of CHIR-99021 (CT99021) and GSK2879552.

[0349] A combination of CHIR-99021 (CT99021) and INCB059872.

[0350] A combination of CHIR-99021 (CT99021)and DDP-38003.

[0351] A combination of AZD1080 and GSK-LSD1.

[0352] A combination of AZD1080 and bomedemstat (IMG-7289).

[0353] A combination of AZD1080 and OG-L002.

[0354] A combination of AZD1080 and ORY-1001 (RG6016).

[0355] A combination of AZD1080 and SP2509.

[0356] A combination of AZD1080 and TAK-418.

[0357] A combination of AZD1080 and LSD1-UM-109.

[0358] A combination of AZD1080 and pulrodemstat (CC-90011).

[0359] A combination of AZD1080 and GSK2879552.

[0360] A combination of AZD1080 and INCB059872.

[0361] A combination of AZD1080 and DDP-38003.

[0362] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and GSK-LSD1.

[0363] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and bomedemstat(IMG-7289).

[0364] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and OG-L002.

[0365] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and ORY-1001(RG6016).

[0366] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and SP2509.

[0367] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and TAK-418.55 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0368] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and LSD1-UM-109.

[0369] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and pulrodemstat (CC-90011).

[0370] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and GSK2879552.

[0371] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and INCB059872.

[0372] A combination of BIO-acetoxime (6-Bromoindirubin-3'-oxime) and DDP-38003.

[0373] A combination of VP0.7 and GSK-LSD1.

[0374] A combination of VP0.7 and bomedemstat (IMG-7289).

[0375] A combination of VP0.7 and OG-L002.

[0376] A combination of VP0.7 and ORY-1001 (RG6016).

[0377] A combination of VP0.7 and SP2509.

[0378] A combination of VP0.7 and TAK-418.

[0379] A combination of VP0.7 and LSD1-UM-109.

[0380] A combination of VP0.7 and pulrodemstat (CC-90011).

[0381] A combination of VP0.7 and GSK2879552.

[0382] A combination of VP0.7 and INCB059872.

[0383] A combination of VP0.7 and DDP-38003.

[0384] A combination of 18BIOder and GSK-LSD1.

[0385] A combination of 18BIOder and bomedemstat (IMG-7289).

[0386] A combination of 18BIOder and OG-L002.

[0387] A combination of 18BIOder and ORY-1001 (RG6016).

[0388] A combination of 18BIOder and SP2509.

[0389] A combination of 18BIOder and TAK-418.

[0390] A combination of 18BIOder and LSD1-UM-109.

[0391] A combination of 18BIOder and pulrodemstat (CC-90011).

[0392] A combination of 18BIOder and GSK2879552.

[0393] A combination of 18BIOder and INCB059872.

[0394] A combination of 18BIOder and DDP-38003.56 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0395] A combination of GSK-3 Inhibitor IX and GSK-LSD1.

[0396] A combination of GSK-3 Inhibitor IX and bomedemstat (IMG-7289).

[0397] A combination of GSK-3 Inhibitor IX and OG-L002.

[0398] A combination of GSK-3 Inhibitor IX and ORY-1001 (RG6016).

[0399] A combination of GSK-3 Inhibitor IX and SP2509.

[0400] A combination of GSK-3 Inhibitor IX and TAK-418.

[0401] A combination of GSK-3 Inhibitor IX and LSD1-UM-109.

[0402] A combination of GSK-3 Inhibitor IX and pulrodemstat (CC-90011).

[0403] A combination of GSK-3 Inhibitor IX and GSK2879552.

[0404] A combination of GSK-3 Inhibitor IX and INCB059872.

[0405] A combination of GSK-3 Inhibitor IX and DDP-38003.

[0406] A combination of TWS119 and GSK-LSD1.

[0407] A combination of TWS119 and bomedemstat (IMG-7289).

[0408] A combination of TWS119 and OG-L002.

[0409] A combination of TWS119 and ORY-1001 (RG6016).

[0410] A combination of TWS119 and SP2509.

[0411] A combination of TWS119 and TAK-418.

[0412] A combination of TWS119 and LSD1-UM-109.

[0413] A combination of TWS119 and pulrodemstat (CC-90011).

[0414] A combination of TWS119 and GSK2879552.

[0415] A combination of TWS119 and INCB059872.

[0416] A combination of TWS119 and DDP-38003.

[0417] A combination of Cromolyn sodium and GSK-LSD1.

[0418] A combination of Cromolyn sodium and bomedemstat (IMG-7289).

[0419] A combination of Cromolyn sodium and OG-L002.

[0420] A combination of Cromolyn sodium and ORY-1001 (RG6016).

[0421] A combination of Cromolyn sodium and SP2509.

[0422] A combination of Cromolyn sodium and TAK-418.57 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0423] A combination of Cromolyn sodium and LSD1-UM-109.

[0424] A combination of Cromolyn sodium and pulrodemstat (CC-90011).

[0425] A combination of Cromolyn sodium and GSK2879552.

[0426] A combination of Cromolyn sodium and INCB059872.

[0427] A combination of Cromolyn sodium and DDP-38003.

[0428] A combination of 1-Azakenpaullone and GSK-LSD1.

[0429] A combination of 1-Azakenpaullone and bomedemstat (IMG-7289).

[0430] A combination of 1-Azakenpaullone and OG-L002.

[0431] A combination of 1-Azakenpaullone and ORY-1001 (RG6016).

[0432] A combination of 1-Azakenpaullone and SP2509.

[0433] A combination of 1-Azakenpaullone and TAK-418.

[0434] A combination of 1-Azakenpaullone and LSD1-UM-109.

[0435] A combination of 1-Azakenpaullone and pulrodemstat (CC-90011).

[0436] A combination of 1-Azakenpaullone and GSK2879552.

[0437] A combination of 1-Azakenpaullone and INCB059872.

[0438] A combination of 1-Azakenpaullone and DDP-38003.

[0439] A combination of IM-12 and GSK-LSD1.

[0440] A combination of IM-12 and bomedemstat (IMG-7289)

[0441] A combination of IM-12 and OG-L002

[0442] A combination of IM-12 and ORY-1001 (RG6016)

[0443] A combination of IM-12 and SP2509

[0444] A combination of IM-12 and TAK-418

[0445] A combination of IM-12 and LSD1-UM-109

[0446] A combination of IM-12 and pulrodemstat (CC-90011)

[0447] A combination of IM-12 and GSK2879552.

[0448] A combination of IM-12 and INCB059872.

[0449] A combination of IM-12 and DDP-38003.

[0450] A combination of AZD2858 and GSK-LSD1.58 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0451] A combination of AZD2858 and bomedemstat (IMG-7289).

[0452] A combination of AZD2858 and OG-L002.

[0453] A combination of AZD2858 and ORY-1001 (RG6016).

[0454] A combination of AZD2858 and SP2509.

[0455] A combination of AZD2858 and TAK-418.

[0456] A combination of AZD2858 and LSD1-UM-109.

[0457] A combination of AZD2858 and pulrodemstat (CC-90011).

[0458] A combination of AZD2858 and GSK2879552.

[0459] A combination of AZD2858 and INCB059872.

[0460] A combination of AZD2858 and DDP-38003.

[0461] A combination of TDZD-8 and GSK-LSD1.

[0462] A combination of TDZD-8 and bomedemstat (IMG-7289).

[0463] A combination of TDZD-8 and OG-L002.

[0464] A combination of TDZD-8 and ORY-1001 (RG6016).

[0465] A combination of TDZD-8 and SP2509.

[0466] A combination of TDZD-8 and TAK-418.

[0467] A combination of TDZD-8 and LSD1-UM-109.

[0468] A combination of TDZD-8 and pulrodemstat (CC-90011).

[0469] A combination of TDZD-8 and GSK2879552.

[0470] A combination of TDZD-8 and INCB059872.

[0471] A combination of TDZD-8 and DDP-38003.

[0472] A combination of CHIR-98014 and GSK-LSD1.

[0473] A combination of CHIR-98014 and bomedemstat (IMG-7289).

[0474] A combination of CHIR-98014 and OG-L002.

[0475] A combination of CHIR-98014 and ORY-1001 (RG6016).

[0476] A combination of CHIR-98014 and SP2509.

[0477] A combination of CHIR-98014 and TAK-418.

[0478] A combination of CHIR-98014 and LSD1-UM-109.59 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0479] A combination of CHIR-98014 and pulrodemstat (CC-90011).

[0480] A combination of CHIR-98014 and GSK2879552.

[0481] A combination of CHIR-98014 and INCB059872.

[0482] A combination of CHIR-98014 and DDP-38003.

[0483] A combination of CP21R7 and GSK-LSD1.

[0484] A combination of CP21R7 and bomedemstat (IMG-7289).

[0485] A combination of CP21R7 and OG-L002.

[0486] A combination of CP21R7 and ORY-1001 (RG6016).

[0487] A combination of CP21R7 and SP2509.

[0488] A combination of CP21R7 and TAK-418.

[0489] A combination of CP21R7 and LSD1-UM-109.

[0490] A combination of CP21R7 and pulrodemstat (CC-90011).

[0491] A combination of CP21R7 and GSK2879552.

[0492] A combination of CP21R7 and INCB059872.

[0493] A combination of CP21R7 and DDP-38003.

[0494] The DNMT3A gene provides instructions for making an enzyme called DNAmethyltransferase 3 alpha. This enzyme is involved in DNA methylation, which is the addition of methyl groups, consisting of one carbon atom and three hydrogen atoms, to DNA molecules. In particular, the enzyme helps add methyl groups to DNA building blocks (nucleotides) called cytosines.

[0495] Nucleophosmin (NPM), also called nucleolar protein B23, numatrin, or NO38, is anabundant phosphoprotein that is ubiquitously expressed and highly conserved. Thenucleophosmin gene (NPM1) is located on chromosome 5q35 and contains 12 exons. Theencoded protein is localized primarily in the nucleolus, but shuttles rapidly between the nucleus and cytoplasm.

[0496] Each publication, patent application, patent, and other reference cited herein isincorporated by reference in its entirety to the extent that it is not inconsistent with the present disclosure. Publications disclosed herein are provided solely for their disclosure prior to the filing date of the present disclosure. Nothing herein is to be construed as an admission that the 60 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0497] It is understood that the examples and embodiments described herein are forillustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. EXAMPLES EXAMPLE 1

[0498] Materials and Methods

[0499] Small molecule inhibitor screen

[0500] ER-HoxA9 cells provide a model system for study of normal myeloid celldifferentiation. ER-HoxA9 cells were prepared in media with 50nM GSK-LSD1 (SelleckChemical) and seeded at a density of 50,000 cells / ml in 200µL volume per well of a flat-bottom 96-well plastic plate (Genesee Scientific) using a Combi Reagent Dispenser(ThermoFisher). Drugs in 100% DMSO (Sigma Aldrich) were pin-transferred (V&P Scientific)from 384-well stock plates into the 96-well plates containing our cells at approximately 300nL drug stock per well.

[0501] Cells treated with GSK-LSD1 alone served as negative control, while cells treated withGSK- LSD1 and 100nM cytarabine (Sigma Aldrich), a known synergistic combination, servedas a positive control. Plates were incubated for 5 days and analyzed on an iQue Screener Plus-VBR flow cytometer (Intellicyt) running the Forecyt acquisition and analysissoftware. Monocytic differentiation was assessed using an internal Lyz2-GFP marker (bluelaser channel 488nm excitation and 530nm emission). Viability was calculated by dividing thenumber of live cells by the number of total cells, and differentiation was calculated by dividing the number of Lyz2-GFP + cells by the number of live cells. 61 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0502] Cell culture

[0503] ER-HoxA9 cells were grown in RPMI-1640 medium supplemented with 10% of fetalbovine serum (FBS), 100 ng / ml stem cell factor (SCF) (Stemcell Technologies, 78064), 4mM glutamine, 1% penicillin / streptomycin, and 0.5mM beta-estradiol (Sigma Aldrich,E4389). HOXA9-MEIS1 cells were similarly passaged as ER-HoxA9 cells except withoutE2. RN2 cells were cultured in RPMI 1640 medium supplemented with 10% FBS, 20 mM L-glutamine, 10 mM sodium pyruvate, 10 mM HEPES (pH 7.3), 1% penicillin / streptomycin, and 50 μM β-mercaptoethanol.

[0504] THP-1 (ATCC TIB-202) is a monocyte isolated from peripheral blood from an acutemonocytic leukemia patient. U937 (ATCC CRL-1593.2) is a cell line exhibiting monocytemorphology that was derived in 1974 from malignant cells obtained from the pleural effusionof a 37-year-old, White, male patient with histiocytic lymphoma. THP-1 and U937 cells weregrown in RPMI-1640 medium supplemented with 10% of FBS, 4mM glutamine, 1% penicillin / streptomycin. MOLM13 and Kasumi-1 were grown in RPMI-1640 medium supplemented with 20% of FBS, 4mM glutamine, 1% penicillin / streptomycin.

[0505] OCI-AML2 cells (DSMZ ACC 99) are human AML cells. OCI-AML3 cells (DSMZACC 582) are human AML cells. OCI-AML2 and OCI-AML3 cells were grown in alpha-MEM(with ribo- and deoxyribonucleosides) with 20% FBS, 4mM glutamine, 1%penicillin / streptomycin. Cells were maintained at 37ºC and 5% CO2 with routine testing toconfirm lack of mycoplasma infection.

[0506] Human primary AML samples

[0507] Bone marrow (BM) or peripheral blood (PB) samples were collected after informedconsent from patients with AML using protocols approved by an Institutional Review Board at the Helsinki University Hospital (permit numbers 239 / 13 / 03 / 00 / 2010, 303 / 13 / 03 / 01 / 2011) incompliance with the Declaration of Helsinki. Mononuclear cells (MNCs) were isolated fromBM or PB samples by Ficoll-Paque PREMIUM (GE Healthcare) density gradient separation and viably frozen and stored in liquid nitrogen prior to further analyses.

[0508] Ex vivo drug sensitivity testing of primary AML cell62 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0509] GSK-LSD1 (CAS Number: 1431368-48-7) also known as GSK-LSD1 (trans-racemic)dihydrochloride, rel- N-[(1R,2S)-2-Phenylcyclopropyl]-4-Piperidinamine hydrochloride (1:2),is a lysine specific demethylase 1 (LSD1) inhibitor. GSK-LSD1 was obtained from MedchemExpress). LY2090314 (Cas Number: 603288-22-8) also known as 3-[9-Fluoro-1,2,3,4-tetrahydro-2-(1-piperidinylcarbonyl)pyrrolo[3,2,1-jk][1,4]benzodiazepin-7-yl]-4-imidazo[1,2- a]pyridin-3-yl-1h-pyrrole-2,5-dione, 3-[9-Fluoro-2-(piperidin-1-ylcarbonyl)-1,2,3,4- tetrahydro[1,4]diazepino[6,7,1-hi]indol-7-yl]-4-imidazo[1,2-a]pyridin-3-yl-1H-pyrrole-2,5-dione, is a potent inhibitor of glycogen synthase kinase-3 (GSK-3). LY2090314 was obtainedfrom Medchem Express. GSK-LSD1 and LY2090314 were dissolved in 100% DMSO anddispensed on Nunc™ 96-well polystyrene V-bottom plates (Thermo Fisher Scientific) using theEcho 550 Acoustic Dispenser (Labcyte Inc.) in seven different concentrations. GSK-LSD1 wasplated in a concentration range of 1nM to 250 nM and LY2090314 in a range of 50 nM to 500nM as single agents and in combination. 0.1% DMSO was used as negative control and 100µMbenzethonium chloride (Sigma-Aldrich) was used as a positive control for total cell death.

[0510] Frozen MNCs were thawed and suspended in 12.5% conditioned medium composedof RPMI 1640 medium (Corning) supplemented with 12.5% HS-5 cell-derived conditionedmedium, 10% FBS 2mM L-glutamine and penicillin-streptomycin (100U / ml) (see, Karjalainen,R. et al. Blood 130:789-802 (2017)) then treated with DENARASE®(250U / µl, c-LEcta) todegrade DNA released from dead cells, and the cells left to recover for 4 h in 12.5%conditioned medium. (DENARASE® is a GMP endonuclease from Serratia marcescens usedfor enzymatic DNA removal in bioprocessing.) The cells were plated onto pre-drugged platesat a density of 50,000 cells / well and incubated with the drugs for 5 days (37 °C, 5%CO2). After incubation, the cells were centrifuged (500 x g, 5 minutes) and resuspended instaining buffer (RPMI 1640, 10% FBS 2mM L-glutamine and penicillin-streptomycin(100U / ml)). The cells were stained with antibodies against CD45-FITC (BD Pharmingen),CD34-APC (BD Pharmingen), CD15-PE-Cy7 (Biolegend), CD14-BV421 BD Biosciences), andCD11b-BV605 (BD Horizon) for 30 minutes at room temperature in the dark. Subsequently,the cells were centrifuged (500 x g, 5 minutes) and excess antibodies were removed. The cells were resuspended and stained with PE Annexin V and 7-amino actinomycin D in Annexin VBinding Buffer (BD Pharmingen) for 15 minutes at room temperature in the dark. The cellswere analyzed using the iQue Screener Plus-VBR flow cytometer and gating was done withForeCyt software (Intellicyt). Data was processed and analyzed using R software (v4.2).63 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0511] Phosphoflow analysis

[0512] After thawing and DENARASE® treatment as described previously, MNCs from AMLpatient samples were plated onto pre-drugged Nunc™ 96-well V-bottom plate at a density of200,000 cells / well and incubated with 50nM GSK-LSD1, 100 nM LY2090314 and thecombination of both drugs for 5 days (37°C, 5% CO2). After incubation with the drugs, thecells were washed with PBS, centrifuged (1000 x g, 4 minutes) and stained with ZombieYellow (BioLegend) viability marker for 30 minutes in the dark at room temperature. The cellswere washed with staining buffer (5% FBS in DPBs) and stained with surface markers for CD45-BV786 (BD Biosciences), CD38-BV421 (BD Biosciences), CD34-APC-Cy7(BioLegend) and CD11b-BV605 (BD Horizon) for 30 minutes at room temperature. The cellswere fixed in 1.5% paraformaldehyde solution in PBS pre-warmed to 37°C, for 15 minutes atroom temperature. Fixed cells were centrifuged (1000 x g for 4 minutes), washed with stainingbuffer, and centrifuged again with the same settings. The cells were resuspended in ice coldmethanol and incubated at 4°C for 30 minutes, after which the cells were washed twice withstaining buffer with centrifugation (1000g for 4 minutes). The cells were stained with β-catenin-AF488 (BD Pharmingen) for 1 hour at room temperature. After incubation, the cellswere washed with staining buffer, centrifuged (1000g x 4 minutes), then resuspended andanalyzed on an iQue PLUS flow cytometer and data analyzed using the Forecyt software. Datawas processed and analyzed using R software (v4.2).

[0513] In vivo study

[0514] HoxA9-Meis1 overexpressing leukemia cells previously developed by Sykes, D. B. etal. Cell 167, 171-186.e15 (2016) were virally transduced to express Luciferase and GFP for invivo tracking. Cell expressing GFP were twice sorted and used to establish syngeneic mousemodels of AML in 6 to 8 weeks old female C57BL / 6J mice purchased from JacksonLaboratory. Animals were maintained at Boston Children Hospital’s ARCH facility and treatedaccording to all protocols approved by IACUC under protocol number 16-09-3230R. The micereceived sublethal radiation of 350 cGy 16-20 hr prior to tail vein injection of 0.5x104leukemiacells in 100uL PBS to establish a measurable residual disease model of AML. Leukemiaengraftment was monitored using whole body IVISTM imaging through retro-orbital injection 64 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0of luciferin. Mice were randomized into four treatment groups after engraftment was observed7 days post injection. For in vivo treatments, either GSK-LSD1 (0.25 mg / kg in DMSO),LY2090314 (10 mg / kg in 5% DMSO+45% PEG 300+ddH2O) or a combination of both wasadministered via intraperitoneal injections every alternate day for a week. Tumor burden wasmonitored through IVISTM bioluminescence imaging every week and mice exhibiting signs of distress were euthanized (CO2 asphyxiation) according to protocol.

[0515] Dot blots

[0516] Purified total RNA from treated cells were subjected to digestion with mock, RNaseT1 (Thermo Fisher Scientific, AM2283) and RNase III (Thermo Fisher Scientific, AM2290) intheir respective buffers and according to the manufacturer’s instructions, or RNase A (ThermoFisher Scientific, EN0531) under high salt condition (350 mM NaCl). The digestion wasdeactivated by the addition of TRIzol and RNA samples extracted using the TRIzolmanufacturer’s protocol (Zymo Research, R2053). Equal volumes (3 µl) of purified RNA weredotted on Hybond N+ membrane (GE Healthcare, RPN119B), air dried for 10-15 minutes atroom temperature, then UV crosslinked in a UV stratalinker 2400 (Stratagene) two times. Themembrane was blocked for 1 hour in blocking buffer (5% milk diluted in 0.01% PBS-T) andprobed with J2 antibody (Jena Bioscience, RNT-SCI-10010500) rocking overnight at 4°C. Onthe next day, the membrane was washed 3x in PBS-T rocking for 10 minutes at room temperature per wash and probed with secondary goat-anti-mouse HRP antibody in 5% milk atroom temperature for 1 h. Membrane was washed 3x in PBS-T rocking for 10 minutes at roomtemperature per wash and ECL was applied for chemiluminescent development. To detect totalnucleic acid loading, the membrane was then incubated 0.5% methylene blue in 30% EtOH to visualize the presence of RNA.

[0517] CRISPR / Cas9 gene knockouts

[0518] CRISPR gene editing was performed using the Integrated DNA Technologies (IDT)Alt-R CRISPR-Cas9 System as per manufacturer’s protocol. Briefly Alt-R® CRISPR-Cas9crRNA was mixed with Alt-R® CRISPR-Cas9 tracrRNA and Alt-R® HiFi S.p. Cas9 NucleaseV3 to assemble the ribonucleoprotein (RNP) complex. Subsequently, this complex was65 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0electroporated into target cells using the Neon transfection system, employing a pulse voltageof 1400, a width of 10 ms, and three pulses. Alt-R® CRISPR-Cas9 Negative Control crRNA#2 was employed for the creation of non-targeted controls. Specific gene knockouts weregenerated using guide RNAs listed below that were selected using the IDT predesign and selection tool. crRNA Name SequenceHs.Cas9.STAT1#1 TGTGATAGGGTCATGTTCGT (SEQ IDNO:1) Hs.Cas9.STAT1#2 CCACTAGTTCATCATTAATC (SEQ IDNO:2)

[0519] Total RNA extraction and RT-PCR

[0520] Total RNA isolation and DNaseI treatment was performed using Direct-zol(TM) RNAMiniPrep kit (Zymo Research, R2053) as per manufacturer’s protocol. Reverse transcription of1μg of RNA / sample was performed using SuperScript IV Vilo (Thermo Fisher Scientific,11756050) as per manufacturer’s protocol and quantified by spectrophotometer (ND1000NanoDrop). From 5 to 10 ng of cDNA were used to perform quantitative polymerase chainreaction using SYBR™ Select Master Mix (Thermo Fisher Scientific, 4472908). All the qPCRamplifications were performed in the Step One Plus system (Applied Biosystems).

[0521] Gene expression values were calculated by the ΔCq method, using GAPDH as thehousekeeping gene, and resulting experimental target values were normalized to the globalmean of the control group. Normalized fold change was plotted using GraphPad Prism Version6.0 or 8.0 software. The sequences of the primers used in this study are listed below.Primer name Sequence (5’-3’)66 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0GAPDH GCCTCAAGATCATCAGCAATGC (SEQID NO:3) ITGAM(CD11b) AACCCCTGGTTCACCTCCT (SEQ IDNO:4) IRF7 GTGGACTGAGGGCTTGTAG (SEQ IDNO:5) ISG15 GCCTCAGCTCTGACACC (SEQ IDNO:6) MX1 GGCTGTTTACCAGACTCCGACA (SEQID NO:7) DDX58 CCAGCATTACTAGTCAGAAGGAA(SEQ ID NO:8) ERVL ATATCCTGCCTGGATGGGGT (SEQ IDNO:9) MER57B1 CCTCCTGAGCCAGAGTAGGT (SEQ IDNO:10) MER4D CCCTAAAGAGGCAGGACACC (SEQ IDNO:11) MLT1C49 TATTGCCGTACTGTGGGCTG (SEQ IDNO:12)

[0522] In vitro studies and viability assays67 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0523] Approximately 2500 cells were plated in triplicates in 96 well plates for 5 days. For invitro experiments cells were treated with 50nM GSK-LSD1 (Sigma Aldrich, SML1072), 50nMBomedemstat (IMG-7289) (Med Chem Express, HY-109169B) and 500 nM TAK-418 (Med Chem Express, HY-138830), 100 nM LY2090314 (Med Chem Express, HY-16294) and 100nM Elraglusib (9-ING-41) (Med Chem Express, HY-113914). Cell viability was determinedusing a Cell Titer-GloTM luminescent cell viability assay (Promega, G7572). Data werepresented as proliferation present by comparing the treated groups with the vehicle-treated cells.

[0524] Colony forming unit (CFU) assay

[0525] Leukemia Cell Lines: Approximately 1000 cells (for human leukemia cell lines) and500 cells (for murine leukemia cell lines) were initially plated in triplicates in the methylcellulose medium (MethoCultTM GF H4435; StemCell Technologies) pre-added withVehicle, GSK-LSD1, LY2090314 or combination of Inhibitors. For serial replating, cellsisolated from colonies in the previous plating were seeded again in the same semi-solidmedium. CFUs were scored every 7 to 10 / days’ post seeding.

[0526] Human CD34+ Umbilical Cord Blood Cells: Human CB CD34+ cells (Stem Cell, Catnumber:200-0000) were plated in methylcellulose (MethoCult H4534 Classic, Stemcelltechnologies). For each condition 5000 cells were plated in 35 mm dishes in presence ofinhibitors. After 14 days, hematopoietic colonies were scored.

[0527] Human Primary AML Samples: Patient samples were thawed and cultured inStemSpan™ SFEM II (Stem Cell Technology) supplemented with human recombinant (rh)Flt3 / Flk-2, rh IL-3, rh GM-CSF, rh IL-6, human stem cell factor and rh G-CSF (Stem CellTechnology) for 24 hours. The cells were then treated with DMSO or inhibitors inmethylcellulose medium (MethoCult H4535 or MethoCult™ H4534 Classic, StemCellTechnologies) plated at 25,000 cells / mL on 35 mm culture dish and cultured for 7 to 10 days to form colonies.

[0528] Wright-Giemsa staining68 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0529] The cells collected from culture plates were spun onto a cytological slide by using acytospin centrifuge (Cytospin™ 4 Cytocentrifuge). Then slides were stained using the May-Grünwald-Giemsa staining method. The fixed cells were stained for 8 minutes in May-Grünwald stain (Sigma Aldrich, MG500), then slides were sequentially washed 6 times indeionized water and then incubated for 30 min with Giemsa stain (Sigma Aldrich,1092041000)and diluted with 19 volumes of distilled water. After this step the cytological slides wererinsed again 3 times in distilled water and air-dried. For long time storage, a cover slip wasattached to the slides by Eukitt® mounting medium, which is an adhesive and specimenpreservative that can be used manually and in automated cover slipping equipment.

[0530] TCF / LEF Luciferase Reporter Assay

[0531] HCT116 cells were plated at 100,000 cells / well in 12 well plates and following a 24-hour incubation were infected with 30 µl TCF / LEF luciferase reporter lentivirus (BPSBiosciences). Following 48 hours, cells were re-plated and selected for 3 days usingpuromycin. Then cells treated with inhibitors in presence and absence of WNT3a (40ng / ml) for5 days. TCF / LEF activity was assessed using ONE-Step™ Luciferase reagent perrecommended protocol (BPS Biosciences).

[0532] RNA-seq protocol and analysis

[0533] For freshly cultured cells, total RNA isolation and DNaseI treatment was performedusing Direct-zol(TM) RNA MiniPrep kit (Zymo Research, R2053) as per manufacturer’sprotocol. Library preparation was conducted using the NEBNext UltraII RNA library kit(NEB#E7770S / L). Sequencing was conducted on an Illumina NextSeq 2000.

[0534] For ER-HoxA9 cell RNA-seq analysis: Fastq reads were aligned to the mouse genome(mm10) using STAR 2.7.0f. Read counts were mapped to genes usingfeatureCounts. Differential analysis of gene expression was performed using DESeq2. Onlygenes with > 10 total counts when summed across all samples were considered. For THP-1RNA-seq analysis: RNA-seq analysis was conducted using EdgeR-limma workflow. Readswere quantified using featureCounts, creating the raw gene count matrix. Data quality metricswere investigated, and the limma voom normalization was applied to obtain counts per million 69 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0(CPM) normalization and trimmed means of M (TMM) values and normalization to finalize thedifferential expression analysis. The normalization accounted for sequencing depth. The log-CPM values were calculated, and adjusted p-values less than 0.01 were consideredsignificant. Genes responding synergistically to combo treatment were defined as those withadjusted p-value <0.01 and fold change > 3 in combo vs. vehicle and were also not significant at adjusted p-value <0.01 and fold change > 1.5 in either GSK-LSD1 or LY2090314 vs.vehicle. In THP1 cells, genes responding synergistically to combo treatment were defined asthose with adjusted p-value < 0.01 and >3X change in combo vs. vehicle and not significant atp < 0.05 (non-adjusted) in either GSK-LSD1 or LY2090314 vs. vehicle in THP-1 cells. Heatmaps of synergy genes and other gene lists were generated using Heatmapper.ca using Pearsoncorrelation and average linkage settings. For pathway-level analysis, gene lists were eithersubmitted to EnrichR (see (a) Chen, E., Y. et al. BMC Bioinformatics 14:128 (2013), (b)Kuleshov, M., V. et al. Nucleic Acids Res. 44:W90-7 (2016), and (c) Xie, Z. et al. Curr Protoc.1: e90 (2021)) or GSEA (see (a) Subramanian, A. et al. Proc Natl Acad Sci U S A. 102:15545-50 (2005), or (b) Mootha, V., K. et al. Nat Genet. 34:267-73 (2003)) was used. For GSEA,cpm normalized data were used as inputs and GSEA MolSigDB gene set compendia or manually curated gene sets were used for enrichment using genes for permutations and defaultsettings otherwise. Manually curated gene sets not in the MSigDB database included the Sykesterminal differentiation gene sets (Sykes, D. B. et al. Cell 167, 171-186.e15 (2016)), theLSC47 leukemia stem cell signature (Huang, B., J. et al. Nat Commun. 13:5487 (2022)), andthe Somervaille leukemia stem cell signatures (Somervaille, T., C., P. et al. Cell Stem Cell4:129-40 (2009)).

[0535] ATAC-seq protocol and analysis

[0536] ATAC-seq was performed as described in Zee, B. M. et al. iScience 24, 102651(2021). Briefly, cells were treated with DNAse I (Life Tech, Cat. #EN0521) to removegenomic DNA contamination. Live cell samples were quantified and assessed for viability andafter cell lysis and cytosol removal, nuclei were treated with Tn5 enzyme (Illumina, Cat. #20034197) for 30 min at 37 °C and purified with Minelute PCR Purification Kit (Qiagen, Cat.#28004) to produce tagmented DNA samples. Tagmented DNA was barcoded with NexteraIndex Kit v2 (Illumina, Cat. #FC-131-2001) and amplified via PCR prior to an SPRI Bead 70 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0cleanup to yield purified DNA libraries. Sequencing was performed on an Illumina HiSeqinstrument (4000 or equivalent).

[0537] FASTQ files were subjected to quality control with FastQC and then trimmed withCutadapt with reads < 20 nts being filtered out. Reads were then mapped against mm10 withBowtie2, and duplicate reads were removed with samtools rmdup, and bam files wereconverted to bed files with bedtools bamtobed. Peaks were then called with MACS2 withreplicates being merged for downstream analyses. For heatmaps and PCAs, matrices weregenerated with deeptools computeMatrix and heatmaps and PCAs were generated with deeptools plotHeatmap and ggplot2, respectively. IFNα signal profiles were generated with deeptools plotHeatmap using the IFNα promoter regions as an input. IFNα promoters wereextracted using the ChIPseeker R package. ATAC-seq tracks were visualized with IntegrativeGenomics Viewer. Homer was used for motif enrichment analyses using default settings. Alloperations were performed using default settings unless otherwise noted.

[0538] CUT&RUN protocol and analysis

[0539] Briefly, 250000 Cell were washed in 1 mL of wash buffer (HEPES pH=7.5 20mM,Spermidine 0.5mM, NaCl 120mM) and centrifuged at 600g at room temperature for three timesand the pellet were resuspended in 100 μL of wash buffer per reaction. Following this, 10 μLof activated Concavalin A beads per reaction were added, and the mixture were incubated atroom temperature for 10 minutes with intermittent shaking. Captured cells wereresuspended in 50 μL of antibody binding buffer (wash buffer with digitonin 0.05%,EDTA). Primary antibodies, including negative and positive controls, were added, and thetubes were nutated overnight at 4°C. On the following day, the samples were washed twice indig wash buffer (Wash buffer with 0.05% digitonin), and a master mix of pAG-Mnase wasprepared and added to each sample. After nutating at 4°C for 1 hour, the samples were washedto remove unbound pAG-Mnase. Tubes were cooled to 0°C for 5 minutes, then supplementedwith CaCl2 to promote MNase digestion at 4°C for 2 hours followed by the addition of 2X STOP buffer (NaCl 340mM, EDTA 20mM, EGTA 4mM, digitonin 0.05%) and incubation at37°C for 10-15 minutes. Following a brief spin and magnetic separation, the supernatant71 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0containing enriched target-bound chromatin was proceeded directly with DNA cleanup withZymo DNA Clean&Concentrator-5 kit (Zymo research). DNA libraries were prepared byNEBNext Ultra II DNA library kit (E7645S) as per manufacturer’s instructions.

[0540] CUT&RUN samples were processed via Nextflow (21.10.6), using the nf-coreCUT&RUN pipeline (v3.0.0) (see, Ewels, P.A. et al. Nat Biotechnol. 38, 276–278(2020)). Samples were aligned to the hg38 reference genome. Adapters were trimmed usingTrim Galore, and paired-end alignment was performed using Bowtie2. Mapping rates, GCcontent and other sample quality metrics were derived from nf-core via MultiQC. Peak callingwas finalized using SEACR (see, Meers, M., P. Tenenbaum, D, & Henikoff, S. Epigenetics Chromatin 12:42 (2019)) with a standard peak threshold of 0.05 and spike-in calibrationperformed with S.cerevisiae genome. Heatmap and PCA analyses by gene and peak wereperformed using deepTools. Downstream peak-based analyses were done with peak bed filesfrom replicate experiments being merged. Merging was done using bedTools concatenate tocombine peak files, bedTools sort to order peaks, and bedTools merge to merge peakregions. Motif enrichment analysis, track visualization, and signal over gene set promoterregions (IFNα and Sykes myeloid differentiation top 200 genes promoter regions) were done asdescribed in ATAC-seq analysis methods section. Genomic distribution analyses were donewith the ChIPseeker R package and peak and gene overlaps were quantified with bedTools intersect.

[0541] Clinical dataset survival analysis

[0542] Patient data used in this study were taken from the cohort used in Bottomly etal. Cancer Cell 40:850-864.e9 (2022) and referred to as the OHSU patient dataset. Forsignature score analyses, patients were scored according to their match in expression to a list of signature genes (upregulated genes only, downregulated genes only, or both up anddownregulated genes) using the singscore R package (see, Foroutan, M. et al. BMCBioinformatics 19:404 (2018)). If upregulated signature genes only are used, the patient scoreis high if the patient upregulates those genes. If downregulated signature genes only are used,the patient score is high if the patient downregulates those genes. If both up anddownregulated signature genes are used, the upregulated gene score and downregulated genescores are combined. Pearson correlation was used to quantify correlations between signature72 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0scores among the patients. Components of signatures used for score correlations in FIG. 14Awere: Upper left: upregulated genes of the ER-HoxA9 synergy signature and downregulatedgenes of the Somervaille LSC signature; Upper right: downregulated genes of the ER-HoxA9synergy signature and total score of the MSigDB WNT Signaling signature; Lower left: upregulated and downregulated genes of the ER-HoxA9 synergy signature and upregulatedgenes of the MSigDB Hallmark Interferon Alpha Response signature; Lower right: upregulatedgenes of the MSigDB Hallmark Interferon Alpha Response signature and downregulated genesof the Somervaille LSC signature. For survival analyses, Kaplan-Meier plotting was performedusing the ggsurvplot function of the survminer R package. Patients were stratified by mediansynergy score enrichment using the downregulated genes of the ER-HoxA9 synergysignature. Statistical significance of survival data was tested with log-rank tests using thesurvdiff function of the Survival R package.

[0543] Immunoblotting

[0544] Cells were lysed in a lysis buffer (0.1% SDS, 400 mM NaCl, 1 mM EDTA, 50 mMTris-HCl, and 1% Triton) plus protease Inhibitor cocktail (Sigma Aldrich,11836170001). Protein quantification was performed using a BCA assay (Promega). 20-40 μgof proteins were mixed with Laemmli (Bio Rad) and denatured for 10 min at 95 °C. Celllysates were loaded onto each lane of a 4–20% Mini-PROTEAN TGX Gel (Bio RAD). Theproteins were then transferred to a Trans-Blot Turbo Midi Nitrocellulose Transfer membrane (BioRad). Following this, the membrane was blocked using 5% BSA and incubated withprimary antibodies overnight at 4 °C. The next day, after 3 washes with 1% TBS-T (each wash10 minutes), membrane was incubated with the proper secondary HRP antibodies, diluted in5% BSA, for 30-60 minute at room temperature. The membrane was washed again with 1%TBS-T three times and ECL was applied for membrane development. Antibodies were asfollows: β-Catenin (Cell Signaling,8480), IRF7 (Santa Cruz Biotechnology, SC-74471), α- Tubulin (Santa Cruz Biotechnology, sc-32293), Vinculin (Thermo Fisher Scientific, 700062), STAT1 (Cell Signaling,9172) and Phospho-STAT1 (Tyr701) (Thermo Fisher scientific,33- 3400). 73 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0545] Immunoprecipitation

[0546] 1.5 to 2 mg of cleared protein lysate was used per immunoprecipitation (IP) in IPbuffer (10 mM Tris HCl pH 7.6, 150 mM NaCl, 0.2% NP-40) supplemented with Halt Proteaseand Phosphatase Inhibitor Cocktail, (Thermo Fisher Scientific, 78445). 10% of IP volume wasdesignated for input assessments. Protein lysate was immunoprecipitated with 10 µg ofantibody pre-bound to 30 µl of washed protein G dynabeads (Invitrogen) per IP. IPs wereconducted overnight at 4 °C, washed 3 times with IP buffer and once with the IP wash Buffer (10 mM Tris HCl pH 7.6, 250 mM NaCl, 0.2% NP-40), both supplemented with Halt Proteaseand Phosphatase Inhibitor Cocktail, (Thermo Fisher Scientific, 78445). Then IPs were elutedin Laemmli buffer by boiling, then isolated from beads and transferred to new tubes for western blot analysis.

[0547] Software and Statistical analysis

[0548] All experiments were performed with at least three biological replicates, with specificnumber of replicates stated in the figure legends. Unless otherwise stated, statistical analyseswere performed using GraphPad prism (v7.0) using Two-way ANOVA and statisticalsignificance was determined at a p value < 0.05. For in vivo tumor burden statistical analysesMann Whitney U tests were used. Unless otherwise mentioned asterisks indicate significanceat these levels: * = p ≤ 0.05, ** = p ≤ 0.01, ***, p ≤ 0.001, **** = p ≤ 0.0001.

[0549] Example 1: Screening of small molecule Inhibitors for synergy with LSD1 Inhibitor

[0550] A screen (FIG. 1A) was carried out to identify small molecule Inhibitors that synergizewith the LSD1 Inhibitor GSK-LSD1 to induce differentiation in AML cells (see Zee, B. M. etal. iScience 24, 102651 (2021)). Using a collection of bioactive molecules, the screen wasperformed in primary murine bone marrow cells conditionally immortalized by the expression of an estrogen receptor (ER)-HoxA9 fusion protein (see FIG. 1B and hereinafter referred toas “ER-HoxA9 cells”). In these cells ER-HoxA9 blocks the myeloid differentiation program,providing an effective model for AML differentiation arrest (see Sykes, D. B. et al. Cell 167,171-186.e15 (2016)). ER-HoxA9 cells also feature a built-in endogenous lysozyme-GFPdifferentiation reporter, enabling a positive selection screening platform for perturbations that can overcome AML differentiation arrest (see FIG. 1B). Among the compounds screened, the GSK3α / β inhibitor LY2090314 induced maturation with the most synergy in combination with 74 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0a low dose of GSK-LSD1 (see FIG. 1C). The remaining compounds shown in FIG. 1C are known to have biological targets other than GSK3.

[0551] To confirm the screen results, ER-HoxA9 cells were treated with 50 nM GSK-LSD1and 100 nM LY2090314 and quantified lysozyme-GFP and levels of the differentiation-associated markers CD11b and Gr-1 over 5 days. The drug combination induced all threedifferentiation readouts far more strongly than the theoretical additive effect of each drug alone(FIG. 1D). GSK3α / β mediates degradation of the transcriptional co-activator β-catenin(CTNNB1) (see, Liu, J. et al. Signal Transduct Target Ther. 7, 3 (2022)). Upon GSK3α / βinhibition, stabilized β-catenin translocates into the nucleus and typically complexes withtranscription factors TCF and LEF to activate Wnt pathway targets (see Liu, J. et al. SignalTransduct Target Ther. 7, 3 (2022)). The Wnt pathway is associated with self-renewal andoncogenesis (see Zhan, T., Rindtorff, N.& Boutros, M. Oncogene 36, 1461-1473 (2017). AsGSK3α / β negatively regulates the Wnt pathway, it has not been traditionally thought of as anoncogene. However, in some AML subtypes, GSK3 has been shown to have oncogenicfunctionality by positively regulating the cell cycle (see Wang, Z. et al. Nature 455, 1205-1209(2008)) and the HOXA9 / MEIS1 transcriptional program (see Wang, Z. et al. Cancer Cell17:597-608 (2010)) and has thus also been studied as a potential cancer therapeutic target (seeMcCubrey, J. A. et al. Oncotarget 5, 2881–2911(2014)). Unlike GSK-LSD1, LY2090314 waswell tolerated by AML patients and had robust on-target activity (>450% increase in β-cateninlevels). However, single treatment with LY2090314 showed less than desirable clinicalefficacy (see Rizzieri, D. A. et al. Leuk Lymphoma 57, 1800-6 (2016)).EXAMPLE 2

[0552] Example 2: testing efficacy of the GSK-LSD1 and LY2090314 drug combination("combo")

[0553] The efficacy of the GSK-LSD1 and LY2090314 drug combination (hereafter referredto as “combo”) was tested in differentiation induction using orthogonal, functional readouts ofmyeloid maturation. As terminal myeloid differentiation entails proliferation arrest, the effectof the drug combo on cell growth in ER-HoxA9 cells was quantified. A marked synergy wasobserved with the combo in suppressing AML cell proliferation (FIG. 2A).

[0554] The effect of the combo was tested on self-renewal, using colony formation assays as asurrogate readout and found that, while GSK-LSD1 and LY2090314 each reduced colony 75 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0formation, the combo eliminated it (FIG. 2B). Additionally, induction of monocyticdifferentiation, as characterized by the internal monocytic differentiation GFP reporter, was the highest in the combo treated colonies in comparison to single drug treatment (FIG. 2C), and the combo treated colonies showed a distinct diffused architecture (FIG. 2C), indicative ofmaturation. These findings indicate that the drug combo does not just upregulatedifferentiation-associated surface markers, but in fact induces the functional and physiological myeloid differentiation program in ER-HoxA9 cells. EXAMPLE 3

[0555] Example 3: induction of differentiation of human AML cells by combo

[0556] A mutationally diverse panel of human AML cell lines was examined, including THP-1 (MLL-AF9), Kasumi-1 (AML-ETO), U937 (CALM-AF10), MOLM-13 (MLL-AF9), OCI-AML3 (DNMT3A, NRAS, NPM1c), and OCI-AML2 (MLL-AF6). In all cases, 50 nM GSK-LSD1 markedly reduced the EC50 of the LY2090314 dose response curve (FIG. 3A). Self-renewal, as determined by colony formation ability, was also synergistically and robustly reduced by combo treatment (FIG. 3B).

[0557] To investigate self-renewal more thoroughly, serial colony formation assays wereperformed with drug washouts. Cells isolated from the first plating of drug-treated colonieswere harvested, washed, and seeded serially for two additional rounds of plating without drugtreatment. If self-renewal is lost after the first seeding, its depletion should remain withoutcontinued drug treatment. Indeed, after drug washout, colony formation ability was continuallyand progressively exhausted over the second and third plating in combo-treated cells, but not incontrol or single drug treated cells (FIG. 3C). Finally, combo treatment synergistically inducedhigh levels of CD11b in all cell lines and produced visibly fully mature cells in May-Grunwaldstains (FIG. 3D, FIG. 3E, FIG. 3F and FIG. 3G). Altogether, these results indicate that thedrug combo synergistically induces myeloid differentiation of human AML cell lines with mutationally diverse cellular backgrounds. EXAMPLE 4

[0558] Example 4: dose response proliferation assays

[0559] Programs driving normal hematopoietic and leukemic stemness bear many similarities,such that it is often difficult to ablate the self-renewal of leukemic blasts without affecting that 76 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0of normal myeloid stem and progenitor cells. The selectivity of the GSK-LSD1 + LY2090314drug combo for leukemia cells was investigated by performing dose response proliferation assays in murine leukemia cells and normal bone marrow-derived macrophage (BMDM)cells. While RN2 (MLL-AF9 / NrasG12V) and HoxA9 / Meis1 overexpressing AML cells showedhigh sensitivity to the combo, BMDM proliferation was unaffected even at the highest doses of the combo (FIG. 4). This indicates that the drug combo has selectivity for leukemic blasts and may be well-tolerated in vivo. EXAMPLE 5

[0560] Example 5: testing of other Inhibitors of LSD1 and GSK3α / β

[0561] There are multiple Inhibitors of LSD1 and GSK3α / β and so confirmation was sought toconfirm that combo efficacy is not unique to GSK-LSD1 and LY2090314. First the LSD1inhibitor bomedemstat (IMG-7289) was tested, which is also an irreversible LSD1 inhibitor,similar to GSK-LSD1 (see Hiatt, J. B. et al. Clin Cancer Res. 28, 4551-4564 (2022)), and iscurrently in clinical trials for myelofibrosis (NCT02842827, NCT05597306), and TAK-418, arecently reported small molecule inhibitor of LSD1 (see Baba, R. et al. Sci Adv. 7, eaba1187(2021)). Like GSK-LSD1, bomedemstat or TAK-418 synergistically reduced proliferation andinduced CD11b in combination with LY2090314 in the THP-1 human AML cell line (see FIG.5A, FIG. 5B, FIG. 5C, FIG. 5D). While GSK-LSD1 has been shown to function mainly bydisrupting the important LSD1-GFI1B interaction (see Maiques-Diaz, Cell Rep. 22, 3641-3659 (2018); Hartung, E. E., Singh, K.& Berg, T. Front Oncol. 13, 1149754 (2023) and Kimberly N.Smitheman, K. N. et al. Haematologica 104, 1156–1167 (2019), TAK-418 mainly inhibitsLSD1 demethylase activity with minimal disruption of the LSD1-GFI1B interaction (Baba, R.et al. Sci Adv. 7, eaba1187 (2021)). Thus, these data indicate that disrupting the LSD1-GFI1Binteraction or inhibiting LSD1 catalytic activity can both synergize with GSK3 inhibition to induce AML cell differentiation.

[0562] The efficacy of 9-ING-41 was also tested. This is a β-isoform-specific inhibitor ofGSK3 that is also currently in clinical trials (NCT03678883) (see Hsu, A. et al. Cancer BiolTher. 23, 417-423 (2022)). As with LY2090314, a low dose of 9-ING-41 synergized withIMG-7289 to halt proliferation, clonogenic activity and markedly induce CD11b (FIG. 5E, FIG.5F, FIG. 5G). Together, these results demonstrate that the efficacy of the GSK-LSD1 and77 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0LY2090314 combination can be recapitulated by other LSD1 and GSK3β inhibitors. Inhibition of GSK3β appears to be sufficient to synergize with LSD1i. EXAMPLE 6

[0563] Example 6: combo efficacy in vivo

[0564] Combo efficacy in vivo was investigated to ensure that findings from cell culturemodels can be translated to therapeutically relevant AML mouse models. A syngeneic HoxA9-Meis1 retroviral overexpression transplant model was used, that recapitulates much of MLL- AF9 AML biology while retaining applicability to non-MLL-rearranged AML types withprominent HoxA9 and Meis1 activity (see Sykes, D. B. et al. Cell 167, 171-186.e15(2016)). Luciferase-labeled HoxA9-Meis1 cells were transplanted into sub-lethally irradiatedmice and disease progression was quantified by bioluminescence imaging. While GSK-LSD1and LY2093014 alone had a modest effect on disease progression and survival, combo treatment provided the greatest reduction of disease progression (FIG. 6A, FIG. 6B) andyielded a significant lifespan extension and 30% cure rate (FIG. 6B). The GSK-LSD1 doseused in these analyses (0.25 mg / kg) is equivalent to a 3.1mg / kg human dose and is approximately 4-fold lower than the amount at which dose limiting toxicity was observed in theGSK phase I trial (NCT02177812) (see, Roboz, G. J. et al. Leuk Lymphoma 63, 463-467(2022) and Nair, A. B.& Jacob, S. J Basic Clin Pharm. 7, 27–31(2016)) and therefore falls inthe “safe dose” region. Consistently, no significant toxicity was observed in combo-treatedmice, indicating that it may be possible to increase drug concentrations and potentially achieve even greater survival benefits. EXAMPLE 7

[0565] Example 7: investigation of the molecular mechanism

[0566] To address the question of what is the molecular mechanism underlying the synergisticeffect of the combo to induce AML cell differentiation, the effects of drug treatment on thetranscriptome and epigenome in ER-HoxA9 cells was investigated. As expected, after 5 daysof treatment, more genes were differentially expressed in response to combo (n=2,201) than toeach drug alone (n=772 for GSK-LSD1 and n=1,224 for LY2093014). Principle ComponentAnalysis (PCA) suggests that the combo treatment induced a chromatin state that is distant and distinct from the disparate states induced by single agent LY2093014 and GSK-LSD1 treatment 78 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0(FIG. 7A). GSEA and clustering confirmed that combo treatment synergistically upregulatedmyeloid differentiation gene expression signatures and downregulated signatures of leukemiastem cells (LSCs) (FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E). Consistently, RNA-seq data fromTHP-1 cells also identified upregulation of myeloid differentiation signatures and concurrent downregulation of the LSC signatures in response to combination treatment (Extended DataFIG. 7F, FIG. 7G, FIG. 7H, FIG. 7I). Surprisingly, canonical Wnt pathway signatures wereweakly, if at all, enriched in LY2093014 or combo treated ER-HoxA9 and THP-1 cells (FIG.7J, FIG. 7K), and TCF1, a key transcription factor that interacts with β-catenin to activatecanonical Wnt pathway target genes, was downregulated upon combo treatment (FIG.7L). Collectively, these results provide compelling evidence that the combination treatmentinduces the differentiation program and impairs LSCs activity, potentially by suppressing the Wnt pathway. EXAMPLE 8

[0567] Example 8: enrichment analyses of genes in the type IFN signaling pathway

[0568] The next focus was on genes upregulated upon combo treatment but not by either drugalone in ER-HoxA9 cells. Enrichment analyses and manual inspection revealed a markedoverrepresentation of genes in the type I IFN signaling pathway, including Stat1, Irf9, Irf7, and a panel of interferon-stimulated genes (ISGs) such as Isg15, Mx1, Ddx58, and Oasl1, which wetermed the “synergy signature” (FIG. 8A, FIG. 8B, FIG. 8C). A fuller table of genes of this“synergy signature” are provided in Tables 1 - 4 below:

[0569] Table 1: ER-HoxA9 synergy upregulationlog2FoldChang log2FoldChang log2FoldChang Gene e_combo_vs_ve Gene e_combo_vs_ve Gene e_combo_vs_ve h h h Atp6v0 10.50492537 Il1a 4.626475615 Hmox1 2.323791535d2 79 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Slfn1 9.275201673 Kynu 4.623053002 Nod2 2.317010656Irg1 8.958398557 Rnd3 4.605481878 Tnfsf10 2.299715031Cd74 8.678559762 Akr1b8 4.603797602 E2f2 2.295525655D14Ert 8.460448576 Ptger2 4.569160378 Cd276 2.276004499d668e I830012 Tmem1 8.452242903 Dhrs9 4.5482350422.268330601 O16Rik 71 Cd36 8.440863577 Gpr68 4.494687619 Cacng8 2.267587012Phf11 8.399919695 H2-T24 4.489449343 STAT1 2.256198576C3ar1 8.399743372 Rusc2 4.481409641 Muc1 2.225572342Cfb 8.32863261 Klra2 4.414101681 Slfn4 2.202284363Gm543 2010002 8.279907364 Fap 4.4049609982.191970654 1 M12Rik Arhgap Fpr2 8.111561829 4.378423563 Igtp 2.18451896222 Slamf7 8.056478934 MX2 4.328165784 Tor3a 2.184276218543043 8.038883553 Olfr433 4.310644169 Slc2a6 2.1833982597J10Rik Zbp1 7.887658537 Ube2l6 4.304416289 Hck 2.17814317980 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0C1qb 7.868703143 Mfsd6l 4.25248646 Ifi35 2.153165419Trim30 Aif1 7.833983983 4.22408873 Socs1 2.149048265b A13004 BC1475 Ifi205 7.7984304454.161554358 0M12Ri 2.139935871 27 k P2ry6 7.60442731 Cx3cr1 4.149749274 Shisa5 2.139197323C1qc 7.554676388 Bcl2a1b 4.049711115 Sh3bp2 2.137073427A43008 4P05Ri7.498653848 Rab3c 4.025654325 Prr15 2.113724645k 130000 2K09Ri7.396935081 Cxcl2 3.98143599 Ddx58 2.112672321k 1600010 Ifit3 7.251206471 Pira2 3.9384130482.101058498 M07Rik OASL2 7.109176401 Gbp9 3.937757605 Samhd1 2.097623541Ccl22 7.061066219 Xaf1 3.898265973 Rtp4 2.077979119Card11 6.971153293 P2ry13 3.890893385 Adam8 2.055926116Tm4sf1 C1galt1 6.970430096 OAS1A 3.8706763322.044554872 9 c1 81 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Serpinb Lipn 6.871646606 3.842220994 Oas1b 2.02688347811 B43030 Ccl7 6.832375949 Tlr5 3.8275858216N03Ri 2.014919622 k Rnase6 6.784511815 Cpvl 3.8231248 Rasgrp4 1.994894921Serpinb 6.737869626 Lgals3 3.813535295 Ccr5 1.9849523219b Adap2 6.707134841 OASL1 3.812669522 Havcr2 1.984883907Lilra6 6.674996714 Ly6i 3.81152855 Aph1c 1.984178876Cxcr3 6.612844664 Rnf128 3.751106068 Btbd17 1.968310821Galnt9 6.590715844 Vwf 3.716951739 Wwc1 1.965368378Iigp1 6.570424428 Map3k8 3.699302135 Prkch 1.957084543Ocstam 6.538284408 Rhoc 3.694376907 Ptprj 1.951011342p LOC62 MX1 6.527014324 3.681631578 Trim34a 1.9307147062070 Rhov 6.505362788 Il1b 3.666930172 Fas 1.930539808Gbp5 6.480059483 Slc6a8 3.591594271 Il1r2 1.92943676582 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Ptpro 6.469445099 Fmn1 3.586868222 Zfp36 1.9194208142200002 Gbgt1 6.436942712 Grk5 3.5826073681.915734207 J24Rik Cd40 6.368710773 Parp12 3.525194501 Scamp5 1.911250671Cttnbp2 6.32468434 Pyhin1 3.509631341 Grn 1.904638091nl Ly6a 6.304400312 Ahnak 3.458598566 Rassf4 1.892097605C13002 Oas3 6.227498403 Dhx58 3.3818478251.889686483 6I21Rik Trim30 Ccl2 6.193427648 3.37531285 Pld3 1.887018042d Gm122 6.147192772 Slc36a2 3.366525693 Gdpd5 1.88235399850 Dennd2 2310028 Ip6k3 6.0856938743.352185751 1.881587642 a H24Rik 201000 5H15Ri5.941844697 Tmcc3 3.343895886 Oit3 1.875807964k Tgtp2 5.87679854 Raet1d 3.342920704 Myoz1 1.864260371Arhgap 5.866850787 Ctse 3.310038375 Dpp7 1.86234218512 83 160843836.1Docket No.: FR 084276.00393 / LUD 6243.05.857307084 Btg2 3.249495333 St3gal5 1.8621481069 OAS2 5.812785024 Dram1 3.199071453 Ctsc 1.860512256Fam20c 5.724421322 Tnf 3.196779036 Slc12a9 1.841037115Lgals3b Naip1 5.712386896 3.187341501 Parp9 1.839709527p Gpr119 5.709787095 Ifitm6 3.185446497 Naaa 1.834379185Sdc3 5.703102878 Rsad2 3.170046036 Igf2bp2 1.83273561493343 5.681969123 Tnfaip3 3.164707956 Lmna 1.8318761552I03Rik Gm115 5.668917742 Gpr15 3.156242015 Nfkbia 1.82859289245 Ifi44 5.621599688 Mmp13 3.153477035 Klf2 1.823128956Gm508 5.585097909 Gatsl2 3.147778042 Evi2a 1.8077844156 Adora2 Fcna 5.552449754 3.109015905 IRF5 1.805761927b E23000 Tlr3 5.5454901848N13Ri3.094544546 Batf2 1.804166117k 84 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Dcstam Trim30 5.5398896333.085721686 Cd28 1.799431825p a ISG15 5.531204771 Fam46c 3.080590556 Dusp3 1.797510744Gbp2 5.502761194 Spint1 3.057432695 F10 1.793965614C5ar1 5.486273673 Pion 3.055470375 Aig1 1.788055877Dpep3 5.481392162 Aplnr 3.049552344 Csf2rb2 1.786734621Ddx60 5.478902021 Car5b 3.046693013 Cstb 1.778941643Cd302 5.414667009 Cd300lf 3.043478 Plaur 1.776149005Sirpb1a 5.414527746 Pydc3 3.037941298 Slc8a1 1.767646279Psd2 5.408997491 Csf1 3.03208039 Cd274 1.762766278Tnfrsf1 Ifit1 5.3990983 Ifitm3 3.0217164241.75956104 b Expi 5.387518485 Plxdc1 2.933910362 Fgf1 1.745499706OAS1G 5.340056022 Sag 2.910000158 Anxa4 1.735440495A63003 Gm515 5.316928726 Casp4 2.892011583H20Ri 1.7308084 0 k Kcnk13 5.310273018 Tppp3 2.880511435 Abcc3 1.72945675785 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0LOC54Saa3 5.3068894322.854288815 1.723206977 5261 05 Il7r 5.294658137 Plk2 2.854213528 C1rl 1.715172201Gm104 5.277711916 Cd86 2.789330822 Mitf 1.70982006685 AU022 Gm1120 5.253334006 Dbndd2 2.7433989881.69681442 793 2 Gadd45 IRF7 5.245546835 2.714692446 Nrg4 1.695399976g Ms4a7 5.193156958 Maf 2.710163979 Csf2ra 1.687019597Ly6c1 5.179661439 Gbp6 2.708792384 Anxa5 1.68369781Cxcl10 5.167205309 Cd109 2.694741589 Trafd1 1.681409511A23002 4930471 8O05Ri5.156427093 Ctsb 2.6661179281.679157446 M23Rik k Slc37a2 5.072884838 Lcat 2.652884192 S1pr2 1.674446284Tcea3 5.069217844 Nlrp1b 2.631201882 Nckipsd 1.657052437Tal2 5.049047366 Itgb7 2.630202434 Ap1s2 1.656402436Kcnab1 5.04257271 Fcgr1 2.617267549 Cfp 1.65122784486 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Gm144 5.026123874 Tubb2a 2.584384432 Trex1 1.64856926946 Egr3 5.000131443 Aox1 2.56482133 Rogdi 1.64376173A43010 Lilrb3 4.9710542387O13Ri2.537323018 Kif5c 1.64356282k P2ry12 4.965609784 Sgtb 2.524906957 Sumf1 1.641532611A53003 1810034 Tnip3 4.9140565072D15Ri 2.498461593 1.631096839 E14Rik k Cd300l 4.890459924 Sp100 2.494192357 Nfam1 1.626460083g Nlrp1c- 4.867087115 Tnni2 2.435625145 Smoc1 1.62158642ps D73000 Ccl24 4.835881039 Nostrin 2.4202273855E14Ri 1.619817702 k Slfn5 4.81904678 Irgm2 2.353728918 S100a6 1.60711675Treml4 4.80069411 Kif1a 2.350744028 Fgr 1.605912048Lrg1 4.758491579 Arl5c 2.347896951 Psmb10 1.603717113Usp18 4.713667497 IRF9 2.344441716 Ly6e 1.60184759187 160843836.1Docket No.: FR 084276.00393 / LUD 6243.04933430 Lnx1 4.664906376 Bst2 2.3368398521.58923744 I17Rik Arhgef3 4.641085559 7

[0570] Table 2: ER-HoxA9 synergy downregulationlog2FoldChang log2FoldChang log2FoldChang Gene e_combo_vs_ve Gene e_combo_vs_ve Gene e_combo_vs_ve h h h Epb4.1l Gpr12 -6.447612532 Tead4 -2.872529792-2.00348782Fam135 Inhbb -6.326880224 -2.844522726 F8 -1.985110649b Lrguk -6.031764311 Slc2a5 -2.837928567 Hexim2 -1.967650198Myh6 -5.995234657 Hip1r -2.833610831 Tinagl1 -1.964059532492150 Ctxn3 -5.855640332 Bhlhe41 -2.8031906927P07Ri -1.95996738 k 170011 Cabp1 -5.5230889133H08Ri-2.799339277 Pdlim7 -1.954244066k Cd27 -5.517221512 45170 -2.789331134 Prkce -1.94576309888 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Ppp1r14 Il28ra -5.431568954 -2.785325805 Socs5 -1.940271768c Ddx25 -5.408849904 Dlc1 -2.768585041 Carns1 -1.932638964Prss34 -5.353459733 Tnnt2 -2.74442578 Nebl -1.930532591Gypa -5.272218998 H2-Q6 -2.739844422 Usp11 -1.922281346Cyp2d2 Thsd7a -5.219182744 Cxxc5 -2.73015561-1.921950858 2 Fgfr1 -5.124429624 Pacsin1 -2.72968001 Tert -1.919697183Fam171 Tbc1d1 -5.108541755 Gimap4 -2.70590825-1.917926462 a1 0c Rnase1 -5.056615984 Mtap9 -2.70210643 Dusp8 -1.9110583091 Fut1 -5.015971886 Ppp1r9a -2.686438135 Jmy -1.901781939Plscr2 -4.993966074 Gp9 -2.672251047 Nr1d2 -1.898150749290004 1M22Ri-4.981993842 Tcam1 -2.651706276 Prelid2 -1.896353828k Ybx2 -4.936831402 Mtap7 -2.649904034 Parp16 -1.895035101Svop -4.876431208 Zbtb16 -2.648803998 Cbx2 -1.88725024489 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Epor -4.75277071 Bcan -2.647180371 Zbtb20 -1.887037097Card10 -4.671817877 Prr7 -2.643557988 Atp8a2 -1.886382699Igf2r -4.659142435 Hes2 -2.641146778 St14 -1.885294196492150 Gm133 6M07Ri -4.654757073-2.64065288 Rgs7bp -1.878477327 k Tmem5 Insrr -4.613368551 -2.632402106 Prx -1.8731934959l Spats1 -4.59570237 Pard6g -2.624798325 Plxna3 -1.8666338Pex5l -4.576060463 Baiap3 -2.596525392 Itgad -1.857959304D17H6 Scrn1 -4.547811872 Nedd4 -2.595426274-1.845697876 S56E-3 Gm627 Cfc1 -4.542049282 -2.591907485 Alpk3 -1.837347457 170002 Camk2n -4.540221563 Cox7a1 -2.5849665269J07Ri -1.833059749 1 k Pcdhb1 Fam71b -4.538392554 Foxa1 -2.571390104-1.829476013 9 Espn -4.513395484 Bahcc1 -2.569281846 Slc30a2 -1.82916935890 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Ell3 -4.47780783 -2.568175893 Abcg1 -1.8270302915I06Rik Serpinb -4.459136046 Col18a1 -2.555575865 Mei4 -1.826569697 201031 Igll1 -4.41470456 Ednra -2.5544213447E24Ri -1.82487014 k Ets1 -4.377728608 Rbpms -2.542109482 Phf15 -1.818157978Emp2 -4.233611111 Itih5 -2.5276527 Igf1r -1.805114755Twist1 -4.055939008 Parvb -2.524718342 Nkg7 -1.798934112Tmem1 -4.018265886 Enpp6 -2.518390787 Hif3a -1.79607879332d Ebf1 -4.001433755 Fbln1 -2.499982785 Rora -1.795820656Fam132 Dlg2 -3.949089421 -2.482262335 Zfp654 -1.794813733b Hmgcll -3.940872892 Prrg4 -2.466546594 Lrrc1 -1.765542991 Gm511 -3.939395939 Mmp14 -2.464356472 Zscan2 -1.7624156081 Rbms3 -3.92937824 Socs2 -2.460379304 Emid2 -1.76166349591 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Adcy1 -3.909173782 Gimap6 -2.432137694 Tst -1.760129646Ccdc48 -3.84410987 Car2 -2.42714402 Kank3 -1.76009448493058 Ecel1 -3.8237153148N13Ri-2.417596894 Ero1l -1.757418636k Slc28a2 -3.776049383 Lrrc48 -2.411604432 Mterfd3 -1.75656788Styk1 -3.76576293 Rhbdl3 -2.392254001 Eltd1 -1.754920052Slco2b1 -3.711328742 Arvcf -2.373474551 Enpp4 -1.748003454Emid1 -3.6961119 Scml4 -2.372434296 Gpc3 -1.742794743Pcdhgb Slc9a3r Mpp2 -3.695792649-2.362092518 -1.739660474 7 2 Tcf7 -3.683707274 Rad9b -2.361726823 Hyi -1.733374718290000 Gpr133 -3.644390895 Lzts2 -2.3565681926K08Ri -1.729359253 k Sit1 -3.637492741 Sigirr -2.353383986 Rnf157 -1.719912996Ltbp1 -3.615656568 Agap1 -2.311861537 Efcab5 -1.710091094Rbpms2 -3.609706468 Garnl3 -2.310232075 Zhx2 -1.70836965692 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0573055 Dpy19l Armcx1 -3.5981204169C18Ri -2.309722168 -1.70667466 3 k E03001 1O05Ri-3.565938301 Sema3g -2.290815682 Cul7 -1.70628144k Dnajc6 Meis1 -2.283096544 Tnik -1.699049916Chl1 -3.463229663 Dusp6 -2.279146372 Hyal3 -1.694741771493050 Mpp4 -3.431932803 Rab6b -2.2734053999E16Ri -1.691110933 k D63004 Ptprm -3.414178007 Tet1 -2.2526023095J12Ri -1.687112282 k 160002 Paqr5 -3.4017509169D21Ri-2.250553585 Syngr4 -1.686345726Zfp507 -3.38156926 Fbxo44 -2.234154659 Slc9a9 -1.683004188Ehd2 -3.362662257 Rag2 -2.229717063 Ralgps2 -1.682191203Grrp1 -3.362055391 Cables1 -2.222885472 Spa17 -1.67605092Obscn -3.36010232 Pmepa1 -2.221167649 Bicd1 -1.67407987893 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0603040 Rag1 -3.3352687238B16Ri-2.220730511 Ttc26 -1.672060491k 261030 7P16Ri-3.319822664 Mapt -2.204313309 Hgf -1.662468658k Qrfp -3.307745293 Gdf11 -2.191796621 Slc2a8 -1.661886803643057 953007 1L13Ri -3.292392809 7C05Ri-2.17810958 Trpa1 -1.649940129k k Kpna7 -3.267014865 Gimap9 -2.167920783 Fert2 -1.648955583Mrvi1 -3.250892992 Nrtn -2.161131672 Mt2 -1.644882178A93000 Cd72 -3.2331532313A15Ri-2.158317388 Cnnm2 -1.644592359k Spry4 -3.204719312 Eps8l2 -2.148149514 Msrb3 -1.639521505Arhgap Lrtm2 -3.187958655 -2.117122904 Pard6b -1.6384041933 Vit -3.18068229 Dok2 -2.115193403 Ccbl1 -1.636259085Nrxn2 -3.150626319 Hdac11 -2.098628649 Fam57b -1.632721153Crim1 -3.116485384 Gm996 -2.097530949 Hoxa9 -1.63235370394 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Gimap5 -3.100701468 Tfdp2 -2.092810876 Myo16 -1.627440783Arhgap P2rx3 -3.087538627 -2.084033494 Limch1 -1.62730594732 643059 Macrod 8A04Ri-3.063391719 Poln -2.075353255-1.626062693 1 k Mrgpra -3.050727613 Apln -2.07382923 Ick -1.6251226889 Shroom Rapgef3 -3.041936805 -2.064078432 St3gal1 -1.6169847742 Art4 -3.033600141 Klra1 -2.063874574 Tm7sf2 -1.608984958Zcwpw Gimap1 -3.025448145 -2.054987762 Cep97 -1.6046347081 Mtap7d Adamts -3.023848948 Pde10a -2.052273308-1.602081816 2 l2 Nrgn -3.005903562 Cmtm8 -2.042378588 Prss36 -1.601428052Lgr6 -2.991718201 Faah -2.029687863 Pcbd1 -1.596525401Rhobtb Xrcc5 -2.990234043 Per3 -2.027292932-1.595298238 1 Rgs8 -2.988957864 Nefh -2.021454014 Kdm5b -1.59440056895 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0Gcnt4 -2.943696521 Col4a5 -2.01938321 Yipf2 -1.59423206Kcnb1 -2.938068816 Qsox1 -2.014548181 Layn -1.59308648Prkca -2.926683658 Kit -2.008240165 Grik5 -1.592941687Ltbp4 -2.911305085 Sned1 -2.006389131 Cass4 -1.589954428170000 Mab21l 3F12Ri -2.893149288-2.005427354 Slc7a11 -1.5887084011 k Gabbr1 -2.882382368 Peg13 -2.004736951 Msi2 -1.58754387

[0571] Table 3: THP1 synergy upregulationlog2FoldChange log2FoldChange log2FoldChange Gene Gene Gene _combo_vs_veh _combo_vs_veh _combo_vs_veh CMP IFITM1 5.76997925 5.796155043 ASB2 2.311855345K2 TRIM3 NCO 5.0596617251.845315729 LRP1 2.4504387881 A7 CXCL1 SERT DUSP 4.452950355 2.186936463 1.881756013 1 AD1 6 DTX3 ANGP USP18 3.9810234922.562619775 4.518114779 L TL4 96 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0GLIP TCN2 3.972471217 1.89367293 PKM 1.904534914R1 EXOC3 BCAR PHLD 3.308188813 2.052363608 2.178331205 L1 1 A2 C19orf6 DHX5 MAN 3.160309538 3.597922515 2.306901739 6 8 1A1 UBE2L ALD FAM1 3.119539034 1.716049258 2.398582952 6 OC 29B P4HA STAT1 3.071561813 1.853609912 TPM4 2.1397466691 RNF2 SP110 3.015772689 3.011291644 WIPI1 1.91308373713 SNAI HERC MX2 2.8937198412.415666705 4.721102498 1 5 PARP GBP4 2.853479911 4.270146349 CFH 5.43288264614 SPATS DDX5 NFKB 2.825570445 4.50648336 2.157160431 2L 8 2 SLC1 TRAF1 2.686293908 1.746066916 GLRX 2.1536447A3 FAM4 NPR3 2.613433445 GSN 2.5891325552.471681803 6A 97 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0CASP TCIR TRIM5 2.5611778361.946846892 1.88075525 1 G1 GAL XAF1 2.334865931 ISG20 6.1414555163.001269755 NT12 TMEM GPBA 2.252462942.279348953 MFI2 1.783050909158 R1 LOC10 SLC6 041958 2.2496943561.942252789 CTSS 2.279924841A8 3 LY6E 2.186919023 KMO 2.680510724 FGD2 4.22751936TRANK NT5D 2.163365095 ETV7 6.0370592791.781987473 1 C2 TME LAM ENO2 2.141121144M150 3.082815577 1.903406312 B3 B SEM BLVRA 2.13035051 GPI 1.7826382512.20600747 A4B MUC APOL2 2.118305441 2.641089014 CTSD 1.8930179041 MIR210 NAG 2.115476014 STS 3.1760638861.925224002 HG K 98 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0S100A1 GNA1 2.1051351072.163843458 IDO1 6.7131008340 5 RPGR PML 2.070998024 2.833275422 UPP1 2.149141792IP1 TNFA FCRLB 2.016014989 RELB 2.0341015143.450890946 IP8L3 CSRNP TYM 1.9571812143.527625444 TGFA 2.0313964961 P BNIP HELZ UBA7 1.9467497421.648434558 4.397485708 3 2 TOR1B 1.941073642 ME1 1.68026971 ITPR2 1.894952869PFKFB MYZ TIMP 1.921657288 2.856354715 2.216097171 4 AP 1 CCDC8 GCNT 1.885778461 SCO2 2.340680672.261596757 8B 1 USP3 CEBP IL1RN 1.8199027886.184922584 2.321046496 0-AS1 E TRIM2 SLC2 NAPS 1.807443616 2.60384665 6.368618512 1 A3 B EIF2A NAPA 1.720307722 3.220540197 RGS2 2.526261424K2 99 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0RASL PAND LACTB 1.6590740842.09263946 3.305321667 11A AR PLSC CNP 1.658626665 3.178402959 MVP 3.04799932R1 AGR PNPT1 1.608351625 2.513384049 GBP3 3.058743134N LGAL IFITM2 1.604826502 IFI35 3.5507160272.343375742 S1 MYD BATF DDAH2 1.5921473682.387976954 4.659235365 88 2 HSPA ITGB LILRB1 2.3371024172.041139843 4.506821878 1B 7 TNFSF RASS 2.313763971.612255869 HFE 3.28183246910 F7 CYTI TNNT1 1.886928427 STC1 2.4376906253.751478089 P APOBE S100 8.142207542 FZD4 2.2142982092.491514728 C3A A4 SEMA6 IGFB 2.438523511 RRAS 1.839640962.843886321 B P5 CCDC IER5L 1.803461998 2.450553846 OLR1 5.182730608109B 100 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0THE KRT36 6.135279128 2.019466216 NRIR 6.272268793MIS2 SOCS SERPI PHF11 2.7938195153.456512813 4.295340421 1 NE1 PECA SEPT PSMB9 2.8867456341.950433361 4.61030928 M1 4 LOC10 RAB8 TBX1 050638 6.089330444 2.027854964 2.935580823 B 5 8 LILR REN 6.381487231 ATF3 1.6421238383.784321747 B3 MMP GRINA 1.666877484 3.336403814 FLT1 3.4303125419 ANX TLDC ANXA2 1.7951640751.698427015 2.957471787 A2P2 2 P4HA SMOX 1.733163467 1.912073648 IFIH1 4.7283955332 SERPI STAT2 2.574936537 MX1 3.012118646.271728141 NG1 ARH LMNA 1.63108923 MITF 2.485808199GAP2 4.171680267 2 101 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0SAM CCN P2RY6 2.2750492043.770299968 4.583383116 D9 A1 APOL EPHB SOD2 1.7704429993.912627363 4.995996783 1 2 DDX60 CCL4 2.87018756 PSAP 1.6239245586.962461716 L L2 CD27 BST2 2.268267154 LYZ 1.7208245785.847752151 4 GMP TCAF2 3.161629836 5.23770844 CD69 7.582915612R CCL1 TAP1 3.965366967 RTP4 5.4307460718.63652069 3 METR 1.593311009 NL

[0572] Table 4: THP1 synergy downregulationGene log2FoldChange_combo_vs_vehLPCAT1 -1.59525987EDEM3 -1.597058012CTH -1.754876597102 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0COL18A1 -1.755726705MCU -1.759123379CDK6 -1.811606961TRHDE -1.820824918RAB37 -1.841140639NCAM1 -1.848031876PRAM1 -1.872760243TSPAN32 -1.963741193FAM101B -1.984077776TESC -2.011847972KIAA1462 -2.018220719FOXD1 -2.034177949ADAMTS2 -2.460325778UNC5B -2.82281118KBTBD11 -3.091398572

[0573] Similar enrichment in the type I IFN pathway, defense response to virus gene sets, andSTAT and IRF (Interferon Response Factor) interacting proteins were also observed in THP-1 103 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0cells (FIG. 8D, FIG. 8E, FIG. 8F). This indicates that activation of genes in the type I IFNpathway could be promoting combo-induced maturation, as IRF-family transcription factors can upregulate genes mediating the antimicrobial response component of functionalgranulocytic differentiation (Jefferies, C, A. Front Immunol. 10,325 (2019)). LSD1 inhibitioninduces double-stranded RNA (dsRNA) and the IFN pathway in melanoma, which stimulatesanti-tumor immunity (see Sheng, W. et al. Cell 174, 549-563.e19 (2018)). In line with this, wealso observed elevated levels of dsRNA and IFNB1 expression in AML cells treated with GSK-LSD1 alone or in combination with LY2090314 (FIG. 8E, FIG. 8G). This suggests a conserved role of LSD1 in suppressing dsRNA and the IFN pathway across hematopoietic and select solid tumors. EXAMPLE 9

[0574] Example 9: impact of combo treatment of chromatin

[0575] The impact of combo treatment on chromatin landscape was investigated because thismay underlie the transcriptomic changes noted above. Using ATAC-seq, we found that globallevels of chromatin accessibility did not appear to change dramatically under any treatments, and PCAs again showed that combo treatment induced large chromatin state changes distinctfrom single agent treatment (FIG. 9A). Although motifs for differentiation-associatedtranscription factors (TFs) such as ETS and ETV family factors were for the most part already enriched in cells prior to drug treatments (see Table below), significant increases in chromatin accessibility were observed at promoters of type I IFN pathway genes in combo compared to single agent treatment (FIG. 9B, FIG. 9C). In line with RNA-seq data, motifs for the Wnt pathway transcription factors TCF and LEF were not strongly enriched in any of the treatments as shown in Table 5 below: 104 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0

[0576] Table 5: Motif enrichments in ER-HOXA9 ATAC-seq

[0577] The activation of alternate transcription programs in response to elevated β-catenin,together with other physiological changes, is not unprecedented, as there have been previous reports of β-catenin interacting with transcription factors other than TCF1 / LEF1, such as HIF-1α and IRF3. For instance, in colorectal cancer cells exhibiting elevated hypoxia levels, thecanonical β-catenin / TCF4 signaling pathway is redirected towards a β-catenin / HIF-1α signalingpathway (Kaidi, A. Williams, A. C. & Paraskeva, C. Nat Cell Biol. 9, 210-7(2007)). Additionally, IRF3 and β-catenin interact and colocalize to the promoter region ofIFNβ in response to synthetic dsRNA (Yang, P. et al. Nat Immunol. 11, 487-94 (2010)).

[0578] Without wishing to be bound by any particular hypothesis, the inventors consider thatβ-catenin and IRF7 may form a critical regulatory unit that drives the genes in the IFN pathway to induce differentiation upon combo treatment based on 1) the enrichment of type I IFN pathway regulatory elements in open chromatin, 2) the upregulation of IRF7 and 3) the stabilization of β-catenin in response to LY2093014 treatment. EXAMPLE 10

[0579] Example 10: chromatin localization of β-catenin and IRF7

[0580] CUT&RUN was performed to identify chromatin localization of β-catenin and IRF7 incontrol and drug-treated THP-1 AML cells. β-catenin showed chromatin binding only in LY2093014 and combo-treated cells, as expected, and localized to promoters, introns, and 105 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0intergenic regions. IRF7 peaks, which localized almost exclusively to promoters, were of high magnitude in combo-treated cells, low magnitude in LY2093014 or GSK-LSD1 single-agenttreated cells and were absent in control cells (see FIG. 10A, FIG. 10B, FIG. 10C). β-cateninand IRF7 also had higher binding signals at genes relating to the type I interferon response and myeloid differentiation upon combo treatment compared to single agent treatment, consistentwith combo-induced synergistic activation of genes in these pathways (FIG. 10D). InLY2093014-treated cells, IRF7 and β-catenin showed moderate co-localization, with the 3,555 IRF7 peaks and 10,447 β-catenin peaks having 780 overlapping peaks (22% of IRF7 peaks and8% of β-catenin peaks). However, combo treatment led to dramatically increased co-localization of β-catenin and IRF7, with the 5,080 IRF7 peaks and 15,367 β-catenin peaks having 3,801 overlapping peaks (75% of IRF7 peaks and 25% of β-catenin peaks) (FIG.10C). Co-bound peaks localized primarily to promoters and were enriched for motifs oftranscription factors that regulate myeloid differentiation such as PU.1, MYB, and several ETSfamily factors. (FIG. 10C, FIG. 10E). Among the numerous changes detected in β-catenin andIRF7 localization upon drug treatments, most notable was their co-occupancy at the promotersof several of the most critical drivers of the IFN response, such as STAT1, STAT2, andIFIH1 / MDA5, upon combo, but not single agent treatment (FIG. 10F). This co-localizationcorrelated with transcriptional outputs, as these genes were synergistically upregulated by combo treatment (FIG. 10F). EXAMPLE 11

[0581] Example 11: combo treatment to determine importance of STAT1

[0582] Importantly, activation of STAT1, a critical transcription factor in the IFN pathway,has been linked to the process of monocytic differentiation and the maturation of macrophages(see: Kan, W. L. et al. Cancer Discov. 13, 1922-1947 (2023); Coccia, E. M. et al. Int Immunol.11, 1075-83 (1999); and Jerke, U. et al. PLoS One 4, e8302 (2009)). This raises the possibilitythat combo treatment may promote differentiation by activating key IFN response anddifferentiation-promoting genes such as STAT1. To test this hypothesis, combo treatment wasconfirmed to synergistically activate interferon-stimulated genes such as ISG15 and MX1 in allcell lines tested, while single agent treatment had no significant effect (FIG. 11A). Combotreatment also synergistically upregulated STAT1 transcripts, total STAT1 protein, andactivated phospho-STAT1 (FIG. 10F and FIG. 11B). To determine the importance of STAT1106 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0as a critical mediator of combo-induced differentiation, THP-1 cells were treated with single agents or the combo and delivered the JAK1 / JAK2 inhibitor ruxolitinib, which reduces the activated, phospho-Y701 form of STAT1 (Ostojic, A., Vrhovac, R.& Verstovsek, S. FutureOncol. 7, 1035-43 (2011)). Remarkably, ruxolitinib completely abrogated the induction ofIRF7, ISG15, DDX58, and MX1, indicating that combo driven IFN pathway gene activation wasdependent on STAT1 activation (FIG. 11C). Ruxolitinib treatment also fully inhibited thecombo-induced synergistic upregulation of CD11b and losses of proliferation and viability(FIG. 11D, FIG. 11E). To confirm that this was not due to off-target effects of ruxolitinib, weknocked out STAT1 by CRISPR and found that STAT1 KO phenocopied all aspects ofruxolitinib treatment (FIG. 11F, FIG. 11G, FIG. 11H, FIG. 11I). Finally, epigenomic co-occupancy data suggests that IRF7 and β-catenin may physically interact to coordinate transcriptional regulation at promoters of key regulators such as STAT1 (FIG.10F). Consistently, co-immunoprecipitation experiments found physical interactions betweenβ-catenin and IRF7 (FIG. 11J). Collectively, these data support our model that the combotreatment not only enhances the expression of type I IFN genes, but also triggers the activation of IRF7 and stabilization of β-catenin, with their physical interaction and co-occupancy at promoters, particularly STAT1, leading to the activation of myeloid differentiation and stable and strong activation of type I IFN pathway.

[0583] Interestingly, in addition to β-catenin localization to IFN pathway gene promoters, β-catenin and IRF7 were observed co-localizing at promoters and occasionally gene bodies of cellcycle regulators, including classical β-catenin transcriptional targets such as MYC (FIG. 11K).Indeed, co-bound β-catenin and IRF7 CUT&RUN peaks were enriched for G2 / M checkpoint genes, MYC gene sets, and E2F binding motifs (FIG. 11L).

[0584] Importantly, cell cycle and MYC-related genes with co-bound β-catenin and IRF7were almost universally downregulated upon combo treatment, which is consistent with the functional impact of the combo on reducing stemness and promoting differentiation, and further suggests that β-catenin and IRF7 could have context-specific transcriptionally repressive activity, contributing to suppressing oncogenesis. EXAMPLE 12

[0585] Example 12: combo treatment of primary AML patient samples cultured ex vivo Theseexperiments were carried out to show how the effects of combo treatment observed in cell lines 107 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0and mouse xenograft models could be recapitulated in clinical AML patient samples. Theimpact of combo treatment was investigated on a cohort of primary AML patient samplescultured ex vivo. Among the 16 patient samples examined for their differentiation potential,eleven samples exhibited a more than five-fold increase in CD11b+ cells and responded more strongly to the combo treatment compared to each inhibitor alone (FIG. 12A, FIG. 12B, FIG.12C). In seven of these eleven samples, combo treatment markedly increased the percentage ofCD11b positive cells (up to 80%), suggesting a strong induction of differentiation. MLLrearrangements and mutations in DNMT3A and NPM1 were more frequently detected amongthe sensitive samples, consistent with previous findings that MLL-leukemia are highly sensitiveto LSD1 inhibition (see, Harris, W. J. et al. Cancer Cell 21, 473-487(2012)). Out of the sixteensamples, five did not show a significant response. Interestingly, none of the five non-responders had DNMT3A mutations, consistent with our hypothesis that DNMT3A mutationsmay play an important role in the response to combo treatment. Additionally, two of these fournon-responsive patient samples have TP53 mutations. AMLs with TP53 mutations havepreviously been shown to be resistant to LSD1i (see, Cai, S. F. et al. Cancer Discov. 10, 1500-1513 (2020)), which may contribute to their insensitivity to the combo treatment. EXAMPLE 13

[0586] Example 13: combo treatment of 12 primary AML patient samples

[0587] The impact of the Inhibitors on the clonogenic potential of an additional 12 primaryAML patient samples was investigated, 7 of which had DNMT3A mutations. Remarkably, thecombo treatment significantly suppressed the clonogenic potential of all DNMT3A-mutantsamples, regardless of secondary mutations (FIG. 13A). In addition to DNMT3A, patientsamples with NPM1 mutations also appear to be correlated with combo responsiveness (FIG.13B), while those with wildtype DNMT3A and TP53 mutations appear insensitive, consistentwith previous reports (see, Cai, S. F. et al. Cancer Discov. 10, 1500-1513 (2020) (FIG. 13C,FIG. 13D). Combo treated cells also had morphological and histological characteristics ofmature granulocytes (FIG. 13E). Similar results were obtained using the combination ofbomedemstat (LSD1i) and 9-ING-41 (GSK3βi) (FIG. 13F, FIG. 13G, FIG. 13H). In line withthe analysis of the established AML cell lines, examination of primary human samples also revealed an upregulation in β-catenin protein levels following LY2090314 and combination treatment as well as a strong combo-induced upregulation in the expression of ISGs, including 108 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0IRF7, DDX58, ISG15, and MX1 (Extended data FIG. 13I, FIG. 13J). It has been shown thatAML samples with DNMT3A mutations exhibit elevated levels of endogenous retroelementsand increased susceptibility to viral mimicry induced by azacytidine (see, Scheller, M. etal. Nat Cancer 2, 527-544 (2021)). Elevated expression of repetitive elements and ISGs wereconfirmed in the DNMT3A mutant AML samples (FIG. 13K, FIG. 13L), suggesting that analready elevated IFN pathway activity may sensitize the responsiveness of patient cells tofurther pathway activation induced by combo treatment. Importantly, treatment with theinhibitors at the same concentrations had no effect on the colony formation of normal humanhematopoietic cells (CD34+ umbilical cord blood cells) (FIG. 13M). This indicates that thecombination therapy selectively targets leukemic cells with minimal effects on normal hematopoietic cells. EXAMPLE 14

[0588] Example 14: patient synergy signature scoring

[0589] The clinical relevance of the previous examples is established by scoring patients ofthe OHSU dataset according to enrichment of the drug combo synergy signature, as well assignatures for leukemia stem cells, the type I IFN pathway, and WNT signaling. Consistentwith predictions from the previous experimental studies, patient synergy signature scores positively correlated with type I IFN pathway signatures scores (r = 0.62; p < 0.0001) andstrongly negatively correlated with LSC signature (r = -0.93; p < 0.0001) and Wnt signalingpathway (r = -0.42; p < 0.0001) scores. As expected, type I IFN pathway scores also negativelycorrelated with LSC signature scores (r = -0.65, p < 0.0001) (FIG. 14A). As DNMT3A--mutantpatients were most responsive to combo treatment in ex vivo assays, the correlation betweenDNMT3A status and synergy scores in the OHSU cohort was also investigated. Interestingly,patients with DNMT3A mutations were significantly more likely to enrich the synergy signaturethan DNMT3A WT patients as shown below and in FIG. 14B).p = 0.0022 109 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0EXAMPLE 15

[0590] Example 15: prognostic value of the synergy signature

[0591] If greater blast maturation corresponds to less aggressive disease then there isprognostic value. Indeed, patients with above median synergy were found to have significantlylonger overall survival than below median patients (FIG. 15). EXAMPLE 16

[0592] Example 16: combo treatment for use in treating other cancers

[0593] The possibility that combo treatment may be actively suppressing the Wnt pathway hassignificant ramifications for cancers beyond AML that are driven by canonical Wnt signaling(see, Zhang, Y. Wang, X. J Hematol Oncol. 13, 165 (2020)). However, interpretation of Wntpathway-related results in ER-HoxA9 and THP-1 cells is complicated by the fact that they havelow endogenous Wnt pathway activity. To determine whether combo treatment can suppressWnt signaling when it is at high levels, a Wnt pathway driven HCT116 colorectal cancer cellline was used, featuring a TCF / LEF reporter as a readout for Wnt pathway activity. Strikingly,combo treatment not only repressed the TCF reporter under basal conditions, but also activelysuppressed recombinant Wnt3a-induced Wnt hyperactivation (FIG. 16).

[0594] Our findings demonstrate a new strategy that involves simultaneous inhibition of bothGSK3 and LSD1, which leads to therapeutically important maturation of AML cells.

[0595] In summary, the inventors have identified a drug combination that induces terminal,therapeutic differentiation of AML cell lines and primary AML patient samples. Importantly,the inventors have also discovered the underlying molecular mechanism whereby only the combo treatment induces expression and promotes co-occupancy of key transcription factors such as IRF7 (induced by LSD1i) and the co-activator β-catenin (stabilized by GSK3i) to drive transcription of genes in the type I interferon signaling pathway such as STAT1, which iscritical for AML differentiation. Importantly, STAT1, which was shown to be necessary forthe combo treatment to induce differentiation (FIG. 11F, FIG. 11G, FIG. 11H, FIG. 11I), not only mediates an interferon response but also activates IFN-independentsignaling. Furthermore, STAT1 has been reported to control the cell cycle by modulating theexpression of cyclin kinase inhibitors as well as various cyclins. Additionally, STAT1 is110 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0important in inhibiting the expression of c-myc (see Najjar, I. & Fagard, R. Biochimie. 92, 425-44 (2010)). Therefore, the ability of STAT1 to activate IFN-independent signaling in additionto interferon response and cell cycle regulation may also contribute to the overalldifferentiation response of AML cells. Excitingly, as LSD1i and GSK3i are both in clinicaltrials for myelofibrosis (NCT05569538) and advanced / metastatic cancer (NCT03678883),respectively, their use as a combination therapy is a realistic therapy. Lastly, the unique abilityof this combination strategy to suppress canonical Wnt pathway and re-route transcriptionalprograms to promote differentiation represents a therapeutic avenue for numerous Wnt-drivencancers. 111 160843836.1

Claims

1. Docket No.: FR 084276.00393 / LUD 6243.0CLAIMS 1. A method of preventing or treating cancer in an individual, comprising administering a therapeutic amount of an histone demethylase (LSD1) inhibitor and a therapeutic amount of a glycogen synthase kinase-3 (GSK-3) inhibitor to the individual.

2. The method of claim 1, wherein the LSD1 inhibitor and the GSK-3 inhibitor are administered substantially simultaneously.

3. The method of claim 1 or 2, wherein the GSK-3 inhibitor is a β-isoform-specific inhibitor of GSK3.

4. The method of any one of claims 1 to 3, wherein the LSD-1 inhibitor is independently selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY- 1001 (RG6016), SP2509, TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552,INCB059872, and DDP-38003.

5. The method of any one of claims 1 to 4, wherein the GSK-3 inhibitor is independently selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO- acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

6. The method of any one of claims 1 to 5, wherein the cancer is characterised by a dysregulation of the Wnt pathway.

7. The method of any one of claims 1 to 5, wherein the cancer comprises cells which express Interferon-Stimulating Genes (ISGs) at levels greater than non-cancer cells.

8. The method of claim 7, wherein the cancer cells which express ISGs at levels greater thannon-cancer cells have a DNMT3A mutation.

9. The method of any of claims 1 to 8, wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer. 112 160843836.1Docket No.: FR 084276.00393 / LUD 6243.

010. The method of any one of claims 1 to 9, wherein the cancer is AML.

11. The method of any one of claims 1 to 10, wherein the GSK-3 inhibitor is LY2090314.

12. The method of any one of claims 1 to 11, wherein the LSD-1 inhibitor is GSK-LSD1.

13. A product comprising a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for combined separate, simultaneous or concurrent use for the prevention or treatment of cancer in an individual.

14. A product comprising a synergistic combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for the prevention or treatment of cancer in an individual.

15. A product as claimed in claim 13 or 14, wherein (a) the LSD-1 inhibitor is independently selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY-1001 (RG6016), SP2509, TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552,INCB059872, and DDP-38003; and / or (b) the GSK-3 inhibitor is independently selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR-99021 (CT99021), AZD1080, BIO-acetoxime (6- Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

16. A product as claimed in claim 13 or 14, wherein the GSK-3 inhibitor is LY2090314 and the LSD-1 inhibitor is GSK-LSD1.

17. A product as claimed in any one of claims 13 to 16, wherein the cancer is characterised by a dysregulation of the Wnt pathway; preferably wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

18. A histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor for combined use in the prevention or treatment of cancer. 113 160843836.1Docket No.: FR 084276.00393 / LUD 6243.

019. A histone demethylase (LSD1) inhibitor and glycogen synthase kinase-3 (GSK-3) inhibitor for the use as claimed in claim 18, wherein (a) the LSD-1 inhibitor is selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY-1001 (RG6016), SP2509,TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003; and (b) the GSK-3 inhibitor is selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR- 99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

20. A histone demethylase (LSD1) inhibitor and glycogen synthase kinase-3 (GSK-3) inhibitor for the use as claimed in claim 18 or 19, wherein the GSK-3 inhibitor is LY2090314 and the LSD-1 inhibitor is GSK-LSD1.

21. A histone demethylase (LSD1) inhibitor and glycogen synthase kinase-3 (GSK-3) inhibitor for the use as claimed in any one of claims 18 to 20, wherein the cancer is characterised by a dysregulation of the Wnt pathway; preferably wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

22. A composition comprising a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor.

23. The composition of claim 22, wherein (a) the LSD-1 inhibitor is selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY-1001 (RG6016), SP2509,TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003; and (b) the GSK-3 inhibitor is selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR- 99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7. 114 160843836.1Docket No.: FR 084276.00393 / LUD 6243.

024. The composition of claim 22 or 23, wherein the GSK-3 inhibitor is LY2090314 and the LSD-1 inhibitor is GSK-LSD1.

25. The composition of any one of claims 22 to 24, wherein the cancer is characterised by a dysregulation of the Wnt pathway; preferably wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

26. A kit comprising a first container comprising a histone demethylase (LSD1) inhibitor, and a second container comprising a glycogen synthase kinase-3 (GSK-3) inhibitor.

27. The kit of claim 26, further comprising a set of instructions for the use of the histone demethylase (LSD1) inhibitor and the glycogen synthase kinase-3 (GSK-3) inhibitor in the prevention or treatment of cancer.

28. The kit of claim 26 or 27, wherein (a) the LSD-1 inhibitor is selected from the group consisting of GSK-LSD1, bomedemstat (IMG-7289), OG-L002, ORY-1001 (RG6016), SP2509,TAK-418, LSD1-UM-109, pulrodemstat (CC-90011), GSK2879552, INCB059872, and DDP-38003; and (b) the GSK-3 inhibitor is selected from the group consisting of LY2090314, Tideglusib (9-ING-41 or NP031112), lithium, SB-216763, SB-415286, AR-A014418, CHIR- 99021 (CT99021), AZD1080, BIO-acetoxime (6-Bromoindirubin-3'-oxime), VP0.7, 18BIOder, GSK-3 Inhibitor IX, TWS119, Cromolyn sodium, 1-Azakenpaullone, IM-12, AZD2858, TDZD-8, CHIR-98014, and CP21R7.

29. The kit of any one of claims 26 to 28, wherein the GSK-3 inhibitor is LY2090314 and the LSD-1 inhibitor is GSK-LSD1.

30. The kit of any one of claims 26 to 29, wherein the cancer is characterised by a dysregulation of the Wnt pathway; preferably wherein the cancer is selected from the group consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell 115 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; more preferably wherein the cancer is AML.

31. A method of determining the suitability of a cancer patient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor comprising determining the level of expression of at least one type I interferon (IFN) signaling pathway gene and / or at least one interferon stimulated gene (ISG) in a cancer cell sample of the patient, and determining the level of expression of the at least one type I interferon (IFN) signaling pathway gene and / or at least one interferon stimulated gene (ISG) in a non-cancer cell sample of the patient, wherein an increased level of expression of the at least one type I interferon (IFN) signaling pathway gene and / or at least one ISG in the cancer cell sample indicates that the patient will be responsive to the treatment.

32. The method of claim 31, wherein the at least one type I interferon (IFN) signaling pathway gene and / or at least one ISG with an increased level of expression in the cancer cell sample isselected from Table 1 or Table 3; optionally wherein the gene or genes are mutated gene; morepreferably wherein the ISG is DNMT3A.

33. A method of determining the suitability of a cancer patient for treatment with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor comprising determining the presence or absence of a mutation in DNMT3Aand / or NPM1 in a cancer cell sample from the patient, wherein the presence of a mutation inDNMT3A and / or NPM1 indicates a patient that will be responsive to the treatment, and whereinthe absence of a mutation in DNMT3A and / or NPM1 indicates a patient that is expected to benon-responsive to the treatment.

34. A method of monitoring the efficacy of treatment of cancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, comprising determining the level of expression of: (i) at least one type I interferon (IFN) signaling pathway gene in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of a type I IFN signaling pathway gene, as represented by increased level of expression of said at least one gene, during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment; and / or (ii) at least one interferon stimulated 116 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0gene (ISG) in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of an ISG, as represented byincreased level of expression of said at least one gene, during or after treatment compared toprior to treatment, indicates that patient is responsive to treatment.

35. A method as claimed in claim 34, wherein the at least one type I IFN signaling pathwaygene is selected from one or more genes set forth in Table 1 or Table 3: preferably where thegene is selected from STAT1, STAT2, OASL1, OASL2, OAS2, OAS1G, OAS1A, MX1, MX2,ISG15, IRF9, IFIH1 / MDA5, IRF7 and IRF5.

36. A method as claimed in claim 34, wherein the at least one type I IFN signalling pathwaygene is selected from one or more of: STAT1, OAS1A, MX1 and IRF5; preferably wherein thetype I IFN signalling pathway gene is STAT1 and / or IRF7.

37. A method as claimed in claim 34, wherein the at least one type I IFN signalling pathway gene is an ISG selected from one or more of: OASL1, OASL2, OAS2, OAS1G, OAS1A, MX1,MX2, ISG15, IRF7 and Ddx58; preferably wherein the ISG is OAS1A and / or MX1.

38. A method as claimed in any one of claims 34 to 37, further comprising determining thelevel of expression of β-catenin in a cancer cell sample of the patient prior to treatment, and ina cancer cell sample of the patient during or after treatment, wherein an upregulation of β-catenin, as represented by increased level of expression of β-catenin, during or after treatmentcompared to prior to treatment, indicates that patient is responsive to treatment.

39. A method of monitoring the efficacy of treatment of cancer in a patient treated with a combination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor, comprising determining the level of expression of β-catenin in a cancer cell sample of the patient prior to treatment, and in a cancer cell sample of the patient during or after treatment, wherein an upregulation of β-catenin, as represented by increased level of expression of β-catenin, during or after treatment compared to prior to treatment, indicates that patient is responsive to treatment.

40. A method of monitoring the efficacy of treatment of cancer in a patient treated with acombination of a histone demethylase (LSD1) inhibitor and a glycogen synthase kinase-3 117 160843836.1Docket No.: FR 084276.00393 / LUD 6243.0(GSK-3) inhibitor, comprising observing for granulocytes in a cancer cell sample of the patient during or after treatment, wherein morphologically and histologically mature granulocytes observed in samples during or after treatment indicates that the patient is responsive to treatment.

41. The method of claim 40, wherein additionally (a) the level of expression of CD11b and / orSTAT1 is determined in (i) a non-cancer cell sample from the patient; optionally prior to combination treatment, or (ii) a cancer cell sample from the patient prior to combinationtreatment, and (b) the level of expression of CD11b and / or STAT1 is determined in the cancercell sample of the patient during or after treatment, wherein an induction of expression ofCD11b and / or STAT1 in the cancer cell sample, or an increase in expression of CD11b and / orSTAT1 in the cancer cell sample compared to the cell sample of (a) or (b) indicates that the patient is responsive to treatment.

42. A method as claimed in any of claims 31 – 41, wherein the cancer is selected from thegroup consisting of acute myeloid leukemia (AML), colorectal cancer, hepatocellular carcinoma, breast cancer, ovarian cancer, lung cancer (e.g. small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), pancreatic cancer, prostate cancer and gastric cancer; preferably wherein the cancer is AML. 118 160843836.1

Citation Information

Patent Citations

  • Ophthalmological composition of the type which undergoes liquid-gel phase transition

    US4861760A

  • Sustained release, comfort formulation for glaucoma therapy

    US4911920A

  • Use of combinations gelling polysaccharides and finely divided drug carrier substrates in topical ophthalmic compositions

    US5212162A

  • Use of carrageenans in topical ophthalmic compositions

    US5403841A

  • Combination therapy for acute myeloid leukemia

    WO2020069187A1