Composition for muscle differentiation, comprising recombinant KAI1 protein

Abstract

The present invention relates to a composition comprising a recombinant KAI1 protein that promotes muscle differentiation and exhibits muscle damage protection and muscle regeneration effects. Recombinant KAI1 has been found to increase the expression of genes and proteins of myogenic regulatory factors through activation of Akt / AMPK signaling pathways in myoblasts, promote myotube formation, induce differentiation from stem cells into myoblasts, improve muscle strength and muscular endurance in in vitro and in vivo muscular atrophy models through muscle damage recovery, and exhibit muscle damage protection and muscle regeneration ability, and thus is provided as a composition for muscle differentiation or as a composition for treating muscle damage, muscular atrophy, and sarcopenia.

Description

Composition for muscle differentiation comprising recombinant KAI1 protein

[0001] The present invention relates to a composition comprising a recombinant KAI1 protein that promotes muscle differentiation and exhibits muscle damage protection and muscle regeneration effects.

[0002] The aging population is accelerating year by year around the world, and in South Korea, the population aged 65 or older exceeded 10% of the total population in the 2010s, and in 2021, the elderly population aged 65 or older in Korea is expected to reach 8,537,000, accounting for 16.5% of the total. According to Statistics Korea's "2021 Elderly Statistics," in 2025, four years later, the elderly population is expected to enter a super-aged society with 20.3% of the total population, and it is projected to reach 30.5% in 2036. Despite the increase in life expectancy, the increase in various age-related diseases that occur along with the increase in the elderly population not only restricts activities but also leads to increased medical expenses required for disease treatment, which not only lowers the quality of life for individuals, but also directly and indirectly affects the decline in industrial productivity and the deterioration of health insurance finances at the national level. In particular, various muscle diseases that occur in muscles, which account for more than 50% of the human body, have been steadily increasing along with the recent explosive growth in the elderly population. Among them, muscle atrophy and sarcopenia due to aging are accompanied by secondary adverse effects such as falls, fractures, metabolic imbalances due to inflammation, and exercise restrictions. Muscle atrophy and sarcopenia are degenerative diseases caused by aging and should be recognized as chronic diseases, and intensive research is required. Muscle function enhancing drugs are currently being studied as health supplements for sarcopenia both domestically and internationally. Amino acid preparations, such as the most widely used leucine, have been reported to be excellent as exercise supplements, but they are not sufficiently effective for severe sarcopenia, muscular dystrophy, and primary muscle diseases. Pharmaceutical companies around the world are developing biological preparations targeting myostatin and activin receptors to treat sarcopenia and are conducting phase 2-4 clinical trials. However, most of the treatment development has been halted because they have not shown a clear effect in actual clinical trials or side effects have been discovered.

[0003] Although domestic venture companies are developing drugs based on the distinct mechanisms of action and potential clinical efficacy of existing pipeline drugs targeting myostatin and selective androgen receptors, which were previously targeted by multinational pharmaceutical companies but have shown limited efficacy in clinical trials, research is still in the early stages. While numerous potential drugs have been proposed, megestrol acetate is the only US Food and Drug Administration-approved treatment for muscle loss. While active research is underway in Korea, a safe and effective new treatment for muscle disease has yet to be commercialized. Therefore, the development of new, safe and effective treatments for muscle disease is urgently needed.

[0004] Meanwhile, KAI1, also known as CD82 (cluster of differentiation 82), is a tetraspanin family protein consisting of four transmembrane domains, two extracellular loops, very small intracellular loops, and cytoplasmic tails at the N' and C' terminals. KAI1 is known to be involved in the progression of cancer by regulating cell adhesion, migration, and survival by interacting with integrins, epidermal growth factor receptor, PKC, Src kinase, and small GTPases. Several studies have reported the anti-angiogenic and anti-metastatic effects of tetraspanin protein KAI1 / CD82 on cancer and retinal diseases, and the anti-inflammatory effects and molecular mechanisms of recombinant protein KAI1 have been elucidated. Furthermore, it has been suggested that endogenous KAI1 may play a key role in muscle regeneration through the activation of muscle satellite cells, but there are no studies investigating the therapeutic potential of KAI1 for muscle damage. Therefore, the inventors of the present invention aimed to evaluate the efficacy of recombinant human KAI1 (rhKAI1) protein in muscle damage recovery and muscle function improvement, thereby exploring its potential as a therapeutic agent for muscle diseases.

[0005] The purpose of the present invention is to provide a composition for muscle differentiation, a composition for preventing, treating or improving muscle damage and atrophy by confirming the effects of the recombinant KAI1 protein on muscle differentiation, muscle damage and muscle regeneration in myoblasts.

[0006] The present invention provides a muscle differentiation reagent composition comprising KAI1 protein.

[0007] In addition, the present invention provides a pharmaceutical composition for muscle growth or muscle loss inhibition, comprising KAI1 protein as an active ingredient.

[0008] In addition, the present invention provides a health functional food composition for muscle growth or muscle loss inhibition, which contains KAI1 protein as an active ingredient.

[0009] In addition, the present invention provides a method for treating muscle disease, comprising administering to a subject a composition comprising KAI1 protein as an active ingredient.

[0010] According to the present invention, recombinant KAI1 increases the gene and protein expression of myogenic regulatory factors through activation of the Akt / AMPK signaling pathway in myoblasts, promotes myotube formation, induces differentiation from stem cells into myoblasts, improves muscle strength and endurance through muscle damage recovery in in vitro and in vivo muscular dystrophy models, and exhibits muscle damage protection and muscle regeneration ability. Therefore, recombinant KAI1 can be provided as a composition for muscle differentiation or as a composition for treating muscle damage, muscular dystrophy, and sarcopenia.

[0011] Figure 1 shows the results of evaluating the ability of rhKAI1 to promote differentiation of myoblasts into myotubes. C2C12 cells were exposed to differentiation medium containing various concentrations of rhKAI1 for 6 days. (A) Schematic diagram of myotube differentiation of mouse C2C12 myoblasts. (B, top) Morphological images of C2C12 cells observed under a phase-contrast microscope. The size bar is 100 μm. (B, bottom) Giemsa staining of C2C12 myotubes. The size bar is 100 μm. (C) Analysis of mRNA expression of myogenic regulatory factors, including mMyf5, mMyoD, mMuRF1, mMyogenin, and mMyHC. (D) Immunofluorescence staining for MyHC (green) and MyoD (red) in differentiated C2C12 cells. Nuclei were counterstained using DAPI (blue). Cells were observed using a confocal laser scanning microscope. The size bar is 50 μm. (E) shows the results of analyzing the protein expression of myogenic-regulated signaling molecules.

[0012] Figure 2 shows the results of evaluating whether rhKAI1 induces myogenic differentiation of mesenchymal stem cells. Immortalized human endometrial stromal stem cells (hESCs) were cultured for 2 weeks in myogenic differentiation medium supplemented with 400 ng / mL rhKAI1. (A) is a schematic diagram of hESC myogenic differentiation. (B) is the result of Giemsa staining for hESC myogenic differentiation. The size bar is 200 μm. (C) is the result of mRNA expression analysis of muscle regulatory factors, including hPAX7, hMYF5, hDYSTROPHIN, and hMYOGENIN. (D) is the result of protein expression analysis of myogenic-regulated signaling molecules.

[0013] Figure 3 shows the results of evaluating the protective effect of rhKAI1 against dexamethasone-mediated atrophy in C2C12 myotubes. C2C12 myotubes were pretreated with 400 ng / mL rhKAI1 for 3 h and then exposed to 10 μM dexamethasone (Dex) for 24 h. (A) Schematic diagram for evaluating the efficacy of rhKAI1 on Dex-induced atrophy in C2C12 cells. (B, top) Representative morphological images of C2C12 cells observed by phase contrast microscopy. The size bar is 100 μm. (B, bottom) Giemsa staining of C2C12 myotubes. The size bar is 100 μm. (C) Analysis of mRNA expression of mMyf5, mMyoD, mMuRF1, and mAtrogin1. (D) Immunofluorescence staining for MyHC (green) and MyoD (red) in differentiated C2C12 cells. Nuclei were counterstained with DAPI (blue). Cells were observed using a confocal laser scanning microscope. The size bar is 50 μm. (E) Protein expression analysis of myogenic-regulated signaling molecules.

[0014] Figure 4 shows the results of analyzing the effects of rhKAI1 on body weight, skeletal muscle, and serum biochemical profiles in mice with dexamethasone-induced muscle atrophy. C57BL / 6 mice were injected intraperitoneally (ip) with 20 mg / kg Dex daily for 10 days to induce muscle atrophy. After 10 days of Dex treatment, the mice were injected ip with saline or rhKAI1 (200–400 μg / kg body weight) for 10 days. Untreated normal mice (control group) received saline injections for 20 days. (A) Schematic diagram of drug administration and behavioral assessment. (B) Analysis of body weight, expressed as a percentage change from baseline, on days 0, 10, and 20. (C) Muscle tissues, including gastrocnemius (GA), tibialis anterior (TA), soleus (Sol), quadriceps femoris (Qud), and extensor longus, were isolated and photographed after sacrifice. (D) Serum creatinine kinase, aspartate aminotransferase (AST), albumin, and globulin levels were analyzed.

[0015] Figure 5 shows the results of evaluating the effect of rhKAI1 on improving skeletal muscle function in mice with dexamethasone-induced atrophy. (A) The results show that the forearm grip strength of the experimental animals was measured on days 0, 10, and 20. (B and C) Motor coordination was measured at 40 rpm for 180 seconds, and each mouse was subjected to three rotational tests. The duration (B) and distance (C) were recorded.

[0016] Figure 6 shows the results of evaluating whether rhKAI1 regulates muscle regeneration in mice with dexamethasone-induced atrophy. (A) Histological analysis of GA muscle by H&E staining. The size bar is 200 μm. (B) Immunofluorescence staining of muscle fiber types in GA muscle sections. MYH2 is type IIA (orange), MYH4 is type IIB (green), and MYH7 is type I (red). DAPI indicates nuclei (blue). The size bar is 50 μm.

[0017] The terms used in this specification have been selected from widely used, current terms, taking into account the functions of the present invention. However, these terms may vary depending on the intentions of those skilled in the art, precedents, the emergence of new technologies, etc. Furthermore, in certain cases, terms may be arbitrarily selected by the applicant, and in such cases, their meanings will be described in detail in the relevant description of the invention. Therefore, the terms used in this invention should not be defined simply as names, but rather based on their inherent meanings and the overall content of the present invention.

[0018] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0019] Hereinafter, the present invention will be described in more detail.

[0020]

[0021] The present invention provides a muscle differentiation reagent composition comprising KAI1 protein.

[0022] The above KAI1 protein is composed of an amino acid sequence represented by sequence number 1.

[0023] The above reagent composition induces myotube formation from myoblasts, differentiates stem cells into myoblasts, and exhibits a myotube protective effect in a muscular dystrophy cell model.

[0024]

[0025] In addition, the present invention provides a pharmaceutical composition for muscle growth or muscle loss inhibition, comprising the KAI1 protein as an active ingredient. The pharmaceutical composition is intended to treat or prevent one or more diseases selected from the group consisting of muscular atrophy, muscular dystrophy, muscle degeneration, and sarcopenia.

[0026]

[0027] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by placing it in a multi-dose container by formulating it using a pharmaceutically acceptable carrier according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains.

[0028] The pharmaceutically acceptable carriers mentioned above are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.

[0029] In the present invention, the content of the additive included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.

[0030] The above pharmaceutical composition may be formulated in the form of one or more external preparations selected from the group consisting of injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, ointments, lotions, liniments, pastes, and cataplasmas.

[0031] The pharmaceutical composition of the present invention may further comprise pharmaceutically acceptable carriers and diluents for formulation. The pharmaceutically acceptable carriers and diluents include, but are not limited to, excipients such as starches, sugars, and mannitol; fillers and extenders such as calcium phosphate; cellulose derivatives such as carboxymethylcellulose and hydroxypropylcellulose; binders such as gelatin, alginates, and polyvinyl pyrrolidone; lubricants such as talc, calcium stearate, hydrogenated castor oil, and polyethylene glycol; disintegrants such as povidone and crospovidone; and surfactants such as polysorbates, cetyl alcohol, and glycerol. The pharmaceutically acceptable carriers and diluents may be biologically and physiologically compatible with the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents, and / or dispersion media.

[0032] The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. In the case of oral administration, it may be formulated as tablets, troches, lozenges, aqueous suspensions, oily suspensions, prepared powders, granules, emulsions, hard capsules, soft capsules, syrups, or elixirs. In the case of parenteral administration, it may be formulated as injections, suppositories, powders for respiratory inhalation, aerosols for sprays, ointments, powders for application, oils, creams, etc.

[0033] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's condition and weight, age, sex, health status, dietary constitution, nature of the formulation, severity of the disease, administration time of the composition, administration method, administration period or interval, excretion rate, and drug form, and may be appropriately selected by a person skilled in the art. For example, the dosage may range from about 0.1 to 10,000 mg / kg, but is not limited thereto, and may be administered once or several times a day in divided doses.

[0034] The pharmaceutical composition may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. The pharmaceutically effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, and / or administration route of the pharmaceutical composition, and a person skilled in the art can easily determine and prescribe an effective dosage for the intended treatment. The pharmaceutical composition of the present invention may be administered once a day or divided into several doses.

[0035]

[0036] In addition, the present invention provides a health functional food composition for muscle growth or muscle loss inhibition, which contains KAI1 protein as an active ingredient.

[0037]

[0038] The present invention can be generally used as a commonly used food.

[0039] The food composition of the present invention can be used as a health functional food. The term "health functional food" refers to a food manufactured and processed using raw materials or ingredients with functional properties beneficial to the human body, as defined by the Health Functional Food Act. "Functionality" refers to ingestion for the purpose of obtaining beneficial effects for health purposes, such as regulating nutrients for the structure and functions of the human body or physiological effects.

[0040] The food composition of the present invention may include conventional food additives, and its suitability as the above "food additive" is determined by the specifications and standards for the relevant item in accordance with the general provisions and general test methods of the Food Additive Code approved by the Ministry of Food and Drug Safety, unless otherwise specified.

[0041] Items listed in the above "Food Additives Code" include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high-molecular-weight pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, alkaline agents for noodles, preservative preparations, and tar color preparations.

[0042] The food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc.

[0043] For example, among health functional foods in capsule form, hard capsules can be manufactured by mixing and filling a composition according to the present invention with additives such as excipients into a conventional hard capsule, and soft capsules can be manufactured by mixing the composition according to the present invention with additives such as excipients and filling it into a capsule base such as gelatin. The soft capsules may contain a plasticizer such as glycerin or sorbitol, a coloring agent, a preservative, etc., as needed.

[0044] The definitions of terms for the above excipients, binders, disintegrants, lubricants, flavoring agents, etc. are described in literature known in the art and include those with identical or similar functions. There are no specific restrictions on the type of food, and all health functional foods in the conventional sense are included.

[0045] As used herein, the term "prevention" refers to any action that suppresses or delays the onset of a disease by administering a composition according to the present invention. The term "treatment" refers to any action that improves or beneficially alters the symptoms of a disease by administering a composition according to the present invention. As used herein, "improvement" refers to any action that improves the worsening condition of a disease by administering or ingesting a composition according to the present invention to a subject.

[0046]

[0047] Hereinafter, to aid understanding of the present invention, experimental examples and examples will be described in detail. However, the following experimental examples and examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental examples and examples of the present invention are provided to more fully explain the present invention to those of average skill in the art.

[0048]

[0049] <Experimental Example> Experimental Materials and Methods

[0050] The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

[0051]

[0052] 1. Synthesis of rhKAI1

[0053] rhKAI1 protein (catalog number 12275-H08H, Gly 111-Leu 228) was purchased from Sino Biological Inc. (Beijing, China). The rhKAI1 protein used is a DNA sequence encoding the second extracellular domain of human KAI1 (P27701-1), fused to a poly-histidine tag at the C-terminus and a signal peptide at the N-terminus. The rhKAI1 protein consists of the amino acid sequence represented by SEQ ID NO: 1.

[0054]

[0055] 2. Mouse myoblast C2C12 culture and myotube differentiation

[0056] Mouse myoblast C2C12 cells were purchased from the American Type Culture Collection (ATCC; Manassas, MD, USA). C2C12 cells were cultured in Dulbecco's Modified Eagle's medium (DMEM; Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen-Gibco, Carlsbad, CA, USA). For myotube differentiation, C2C12 cells were cultured in differentiation medium (DMEM medium supplemented with 2% heat-inactivated horse serum (Invitrogen-Gibco)) containing various concentrations of rhKAI1 (0, 200, 400, and 800 ng / mL) for 6 days, and the medium was replaced with fresh medium every 2 days.

[0057]

[0058] 3. Culture and myogenic differentiation of primary human endometrial stromal cells (HESCs)

[0059] Primary cultured HESCs were isolated from a human endometrial biopsy of a mid-secretory donor. This experiment was approved by the Institutional Review Board of Gachon University Gil Medical Center (IRB No. GBIRB2018-134). Isolated cells were cultured in DMEM / Ham's F-12 medium (DMEM / F-12, 1:1 mixture) containing 3.1 g / L glucose, 1 mM sodium pyruvate, 1.5 g / L sodium bicarbonate, 1% ITS+ Premix (BD Biosciences, Bedford, MA, USA), 500 ng / mL puromycin, and 10% carcoal / dextran-treated FBS (Hyclone), but without phenol red (Sigma-Aldrich Chemical, Co., St. Louis, MO, USA). To evaluate the effect of rhKAI1 on myogenic differentiation of HESCs, cells were cultured in DMEM / F-12 containing 10% FBS for 2 weeks and the difference in differentiation depending on the addition of 400 ng / mL rhKAI1 was evaluated.

[0060]

[0061] 4. Giemsa staining

[0062] Differentiated C2C12 cells and HESCs were gently washed three times with PBS, fixed in 4% paraformaldehyde for 10 min, and stained with 10% Giemsa stain (Sigma-Aldrich) for 10 min. Cells were washed twice with distilled water and visualized using an Axio Scan Z1 digital fluorescence slide scanner (Carl Zeiss AG, Oberkochen, Germany).

[0063]

[0064] 5. Quantitative Real-time (RT)-polymerase chain reaction (PCR) analysis

[0065] Total RNA was extracted using Tri-RNA Reagent (FAVORGEN, Ping-Tung, Taiwan), and cDNA was synthesized using a cDNA synthesis kit (AccuPower®, Bioneer, Daejeon, Korea) according to the manufacturer's instructions. qPCR was performed using the SYBR Premix Ex Taq Kit (Takara Biotechnology, Otsu, Japan) and amplified using ABI QuantStudio3 (Applied Biosystems, Carlsbad, CA, USA). The primers used are listed in Table 1.

[0066] GenePrimer Sequence (5'-3') ForwardReversemMyf5GGTGGAGAACTATTACAGCCTGC (SEQ ID NO: 2)ACAGTAGATGCTGTCAAAGCTGC (SEQ ID NO: 3)mMyoDGCCTGAGCAAAGTGAATGAG (SEQ ID NO: 4)CGCTACATCGAAGGTCTGC (SEQ ID NO: 5)mMuRF1TACCAAGCCTGTGGTCATCCTG (SEQ ID NO: 6)ACGGAAACGACCTCCAGACATG (SEQ ID NO: 7)mMyogeninGAGCGCGATCTCCGCTACAGAGG (SEQ ID NO: 8)CTGGCTTGTGGCAGCCCAGG (SEQ ID NO: 9)mMyHCCTCTGGCTTACCTCTTCTCTG (SEQ ID NO: 10)TAGAGGATCCTGCTGGGGAA (SEQ ID NO: 11)mAtrogin-1CTTCTCGACTGCCATCCTGGAT (SEQ ID NO: 12)TCTTTTGGGCGATGCCACTCAG(SEQ ID NO: 13)hPAX7GGAGGATGAAGCGGACAAGAAG(SEQ ID NO: 14)AGGTCAGGTTCCGACTCCACAT(SEQ ID NO: 15)hMYF5CAGTCCTGTCTGGTCCAGAAAG(SEQ ID NO: 16)GTCCACTATGTTGGATAAGCAATC(SEQ ID NO: 17)hDYSTROPHINGCTCAACCATCGTTTGCAGCC(SEQ ID NO: 18)TTCAGCCTCCAGTGGTTCAAGC(SEQ ID NO: 19)hMYOGENINAGTGCCATCCAGTACATCGAGC(SEQ ID NO: 20)AGGCGCTGTGAGAGCTGCATTC(SEQ ID NO: 21)

[0067] mMyf5, mouse myogenic factor5;mMyoD, mouse myoblast determination protein 1;mMuRF1, mouse muscle RING-finger protein-1;mMyHC, mouse myosin heavy chain;hPAX7, human paired box 7.

[0068]

[0069] 6. Immunofluorescence staining for MYHC and MyoD

[0070] Cells were fixed in 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked with 3% bovine serum albumin in phosphate-buffered saline (PBS) for 30 min at room temperature. Cells were incubated with MYHC (catalog no. sc-376157, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and MyoD (catalog no. sc-760, Santa Cruz Biotechnology) antibodies for 3 h. Subsequently, they were reacted with Alexa FluorTM 488-labeled goat anti-mouse (catalog no. A11001, Invitrogen, Waltham, MA, USA) and Alexa FluorTM 647-labeled goat anti-rabbit (catalog no. A21244, Invitrogen) secondary antibodies for 30 min. Cells were incubated with 4',6'-diamidino-2-phenylindole (DAPI, Sigma-Aldrich Chemical Co.) for 10 min to visualize nuclei. Immunofluorescence images were obtained using a confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany).

[0071]

[0072] 7. In vitro model of dexamethasone-induced muscle atrophy

[0073] C2C12 myoblasts were differentiated into myofibers for 6 days in DMEM containing 2% heat-inactivated horse serum. After 6 days of differentiation, myotubes were pretreated with 400 ng / mL rhKAI1 for 3 h and then exposed to 10 μM dexamethasone (Sigma-Aldrich, St. Louis, MO, USA) for 24 h (Fig. 3A).

[0074]

[0075] 8. Animal model of dexamethasone-induced muscle atrophy

[0076] All animal care procedures were approved by the Institutional Animal Care and Use Committee of Pusan ​​National University Yangsan Hospital (PNUYH-IACUC Approval No. LT2024-002-A1C0). Animals were bred and maintained under specific pathogen-free conditions at the Biomedical Research Institute of Pusan ​​National University Yangsan Hospital. Eighteen C57BL / 6 N (10-week-old male) mice were purchased from Samtaco Bio Korea (Osan, South Korea) and housed in a controlled environment (temperature 22 ± 2°C, humidity 45 ± 10%, 12 / 12 h light / dark cycle). The animals were acclimatized for 1 week after introduction. After 1 week of acclimatization, all mice underwent behavioral testing for baseline correction. Muscle atrophy was induced in 12 mice by intraperitoneal (ip) injection of 20 mg / kg dexamethasone daily for 10 days. After 10 days of dexamethasone treatment, the mice were randomly divided into three groups. Dex (dexamethasone) (saline ip injection, n = 4), K200 (200 μg rhKAI1 / kg body weight ip injection, n = 4), and K400 (400 μg rhKAI1 / kg body weight injection, n = 4). Saline and rhKAI1 were injected ip once every 3 days for 10 days, for a total of 3 injections. Untreated normal mice (control group, n = 6) were injected with normal saline during the same period (Fig. 4A).

[0077]

[0078] 9. Muscle strength tests: Grip strength and Rotarod test

[0079] All mice were subjected to behavioral tests on days 0, 10, and 20. Grip strength, an indicator of muscle bursting, was measured using a grip dynamometer (Jeungdo Bio & Plant, Seoul, Korea) to assess muscle strength. Briefly, each mouse was placed in a position where it could grasp a wire grid, and the tip of its tail was manually slowly pulled backward. The maximum grip strength was automatically recorded when the mouse released the wire grid. This process was repeated three times for each experimental animal, and the average values ​​were statistically analyzed. To assess muscle endurance, the Rotarod test was performed using a Mouse Rota-Rod (BS Technolab, Seoul, Korea) with a modified protocol described previously. After acclimating the mice to the fixed rod, motor coordination of each mouse was measured at 40 rpm for 180 seconds. Each mouse underwent three Rotarod tests, and the duration of time the animal remained on the rod was recorded. Total time and distance were determined by calculating the average value.

[0080]

[0081] 10. Harvesting serum and muscle tissue

[0082] On the last day of the experiment, all animals were euthanized, and whole blood was collected from the heart. Blood samples were centrifuged at 3,000 rpm for 10 minutes at 4°C to collect serum and stored at -80°C for subsequent analysis. Serum biochemical profiles were analyzed using a Cobas 8,000 C702 chemistry analyzer (Roche, Mannheim, Germany). Whole blood was collected from the heart, and serum was separated for serum biochemical analysis. The gastrocnemius (GA), tibial anterior (TA), soleus (Sol), quadriceps (Qud), and extensor digitorum longus (EDL) muscles were excised and weighed. Frozen sections of gastrocnemius tissue were prepared, and changes in muscle fiber expression were observed using H&E and immunofluorescence staining.

[0083]

[0084] 11. Histological analysis of GA muscle

[0085] Frozen sections of 10 μm thickness were prepared using a cryostat (Leica CM1900, Leica, Wetzlar, Germany) at -25°C to -30°C. For hematoxylin and eosin (H&E) staining, staining was performed with H&E solution (Sigma-Aldrich). Fluorescent immunostaining of muscle fibers, MyHC, MuRF-1, and Atrogon-1 was performed. Specifically, the sections were blocked with 2% horse serum for 1 hour at room temperature, incubated with primary antibodies overnight at 4°C, and then incubated with secondary antibodies for 1 hour at room temperature. The antibodies used are listed in Table 2 below. Images were acquired using an Axio Scan Z1 digital fluorescent slide scanner (Carl Zeiss AG, Oberkochen, Germany).

[0086] AntibodiesSupplierCatalog No.DilutionMyHCSanta Cruz Biotechnology, Incsc-3761571:500Atrogin-1BiossBsm-54451R1:500MYH2Santa Cruz Biotechnology, Incsc-530951:500MYH4Invitrogen53-6503-821:500MYH7Santa Cruz Biotechnology, Incsc-530891:500Alexa Fluor TM 488-labeled goat anti-mouseInvitrogenA110011:1,000Alexa Fluor TM 647-labeled goat anti-rabbitInvitrogenA212441:1,000

[0087] MyHC, myosin heavy chain; MYH2, myosin-2; MYH4, myosin-4; MYH7, myosin-7.

[0088] 12. Western blotting

[0089] After protein extraction from cells and GA muscles, equal amounts of protein were loaded and separated by SDS (sodium dodecyl sulfate)-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween 20, probed with primary antibodies overnight at 4°C, and then immunoblotted with the corresponding secondary antibodies for 1 h at room temperature. The antibodies used are listed in Table 3. The membranes were then exposed to enhanced chemiluminescence solution (Thermo Fisher Scientific) and visualized with a LAS-3000 imaging system (Fujifilm Image Reader, Valhalla, NY, USA).

[0090] AntibodiesSupplierCatalog No.DilutionMyHCSanta Cruz Biotechnology, Inc.sc-3761571:1,000p-AktCell Signaling Technology4060S1:1,000t-AktCell Signaling Technology9272S1:1,000p-AMPKCell Signaling Technology50081S1:1,000t-AMPKCell Signaling Technology5831S1:1,000p-mTORCell Signaling Technology5536S1:1,000t-mTORCell Signaling Technology2983S1:1,000p-STAT3Cell Signaling Technology9145S1:1,000t-STAT3Cell Signaling Technology4904P1:1,000p-GSK3βCell Signaling Technology5558S1:1,000t-GSK3βCell Signaling Technology12456S1:1,000β-actinProteintech Group, Inc.66009-11:5,000goat anti-mouse IgG-HRPSanta Cruz Biotechnology, Inc.sc-20051:2,500goat anti-rabbit IgG-HRPSanta Cruz Biotechnology, Inc.sc-20041:2,500

[0091]

[0092] 13. Statistical Analysis

[0093] All data are presented as mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 8.0.2 (GraphPad Software, Inc., San Diego, CA, USA) using one-way analysis of variance (ANOVA) for multiple comparisons, followed by Tukey's post hoc test. Statistical significance was set at a P value < 0.05 in all analyses.

[0094]

[0095] Example 1. rhKAI1 promotes differentiation of myoblasts into myotubes.

[0096] C2C12 cells, a mouse myoblast cell line, were cultured in differentiation medium for 6 days. rhKAI1 was added to the differentiation medium at concentrations ranging from 0 μg / mL to 800 μg / mL to evaluate whether it promoted myotube differentiation. As a result, C2C12 cells treated with 400 μg / mL or more of rhKAI1 showed a significant increase in myotube length and an increase in Giemsa-positive cells, confirming that rhKAI1 enhances myotube formation capacity (Fig. 1B). Furthermore, mRNA expression of Myf5, MyoD, MuRF1, myogenin, and MyHC was evaluated, and the expression of these myogenic regulatory genes was significantly increased in C2C12 cells treated with 400 μg / mL or more of rhKAI1 (Fig. 1C). Similarly, immunofluorescence staining revealed that myotubes in KAI1-treated cells were thicker and longer, and that the expression of MyHC and MyoD was increased in these myotubes (Fig. 1D). To elucidate the mechanism by which rhKAI1 promotes differentiation of myoblasts into myotubes, we analyzed the protein expression of related signaling molecules by Western blotting. RhKAI1 significantly upregulated the phosphorylation of Akt and AMPK (Fig. 1E). These results demonstrate that rhKAI1 increases the gene and protein expression of myogenic regulatory factors through activation of the Akt / AMPK signaling pathway in myoblasts, thereby promoting myotube formation.

[0097]

[0098] Example 2. rhKAI1 promotes differentiation of stem cells into myoblasts.

[0099] Human endometrial stromal stem cells (hESSCs) were cultured in differentiation medium for 14 days. RhKAI1 at a concentration of 400 μg / mL was added to the differentiation medium to evaluate whether it promoted differentiation into myoblasts. As shown in Figure 2B, the Giemsa-positive population significantly increased in rhKAI1-treated cells. Furthermore, mRNA expression of PAX7, MYF5, dystrophin, and myogenin, which regulate myoblast differentiation, also significantly increased upon rhKAI1 treatment (Figure 2C). Expression of related signaling molecules was observed, and rhKAI1 treatment increased the expression of p-Akt and p-AMPK (Figure 2D). These results suggest that rhKAI1 promotes differentiation of stem cells into myoblasts, and in this process, it increases the expression of factors that regulate myoblast differentiation through regulation of Akt / AMPK signaling.

[0100]

[0101] Example 3. rhKAI1 improves atrophy of C2C12 myotube cells induced by Dex.

[0102] After C2C12 cells were differentiated into myotubes for 6 days, changes in myotube atrophy cells induced by dexamethasone (Dex) were observed depending on whether or not rhKAI1 was pretreated. When Dex was treated in C2C12 myotube cells, the length and cell density of the myotubes decreased, and the Giemsa-positive cell population was also significantly reduced (Fig. 3B). However, pretreatment with rhKAI ameliorated this Dex-induced myotube damage. In addition, pretreatment with rhKAI1 induced a significant increase in MyHC gene and protein expression compared to Dex-treated cells (Fig. 3C and D). Although the difference was not statistically significant, it also showed a tendency to increase MyoD mRNA expression (Fig. 3C). These results indicate that rhKAI1 has a protective effect against myotube damage in a Dex-induced myotube atrophy cell model system.

[0103]

[0104] Example 4. rhKAI1 improves musculoskeletal function in animals with Dex-induced muscular dystrophy.

[0105] A muscular dystrophy animal model was created by treating mice with Dex for 10 days, and the improvement of muscular dystrophy by rhKAI1 administration was evaluated. Body weight changes during the experimental period were observed, and a significant weight loss was observed in animals treated with Dex for 10 days compared to baseline. Among the animals treated with the test substance for another 10 days, a significant weight gain was observed in the KAI1 400 μg / kg group (Fig. 4B). Although the weights of the extracted skeletal muscles (GA, TA, Sol, Qud, EDL) were measured, there were no significant differences among the groups (Fig. 4C). Analysis of the hematological effects of rhKAI1 in mice with muscular dystrophy revealed no significant differences in serum creatinine, AST, and globulin levels among all experimental animals. However, serum albumin levels decreased in the Dex-treated group, whereas they recovered to the control level in the KAI1-treated group. On the first day of the test, 10 days, and 20 days, grip strength and the rotarod test were performed. Grip strength was measured using a grip strength meter (Jeung do Bio&Plant, Seoul, Korea). Each mouse was placed in a position where it could grasp a wire grid, and the tip of the tail was manually slowly pulled backward. The maximum grip strength was measured when the mouse released the wire grid and recorded. As shown in Figure 5A, a significant decrease in grip strength was confirmed in animals treated with Dex for 10 days compared to the control group, and after 10 days of drug treatment, grip strength was found to improve in a dose-dependent manner according to the rhKAI1 treatment. Meanwhile, the muscular endurance of the mice was evaluated using a Mouse Rota-Rod (BS Technolab, Seoul, Korea) device.After acclimating the mice to the fixed rod, the motor coordination of each mouse was measured at 40 rpm for 180 seconds, and the time the animal remained on the rod and the total distance traveled were calculated. Similar to the grip strength results, the rotarod test also showed a significant decrease in the rotarod remaining time and total distance traveled in the Dex-treated animals. However, 10 days of rhKAI1 400 treatment significantly improved this decrease in muscle endurance (Figures 5B and 5C). In particular, administration of rhKAI1 400 μg / kg showed an effect of improving muscle strength and endurance to the level of the control group. To further analyze the effect of rhKAI1 on improving muscle strength and endurance, histoimmunohistochemistry analysis of GA muscles was performed. H&E staining of GA muscles showed that the diameter of the myotubes was significantly reduced in the Dex-treated group compared to the control group, and rhKAI1 inhibited this phenomenon (Figure 6A). To observe changes in muscle fiber types in GA muscles with muscular dystrophy, immunofluorescence analysis of MYH2, MYH4, and MYH7 was performed. As a result, the expression of type II types of MYH2 and MYH4 increased, and the expression of type I MYH7 decreased in the GA muscles of the Dex group (Fig. 6C). However, these fiber type changes in GA tissues due to Dex treatment were reversed by rhKAI1 treatment. These results suggest that administration of rhKAI1 to Dex-induced muscular dystrophy mice improved body weight, muscle endurance, and muscle strength, which is thought to be due to the recovery of GA tissue damage.

[0106]

[0107] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. In other words, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0108] Numerical ranges are inclusive of the values ​​defined in the ranges above. Any maximum numerical limitation given throughout this specification includes any lower numerical limitation, as if that lower numerical limitation were explicitly stated. Any minimum numerical limitation given throughout this specification includes any higher numerical limitation, as if that higher numerical limitation were explicitly stated. Any numerical limitation given throughout this specification will include any better numerical range within the broader numerical range, as if that narrower numerical limitation were explicitly stated.

Claims

1. A composition of a reagent for muscle differentiation containing KAI1 protein.

2. A reagent composition according to claim 1, characterized in that the KAI1 protein is composed of an amino acid sequence represented by sequence number 1.

3. A reagent composition according to claim 1, characterized in that the reagent composition induces myotube formation in myoblasts.

4. In the first paragraph, the reagent composition is characterized in that it differentiates stem cells into myoblasts.

5. A reagent composition according to claim 1, characterized in that the reagent composition exhibits a myotube protective effect in a muscular dystrophy cell model.

6. A pharmaceutical composition for muscle growth or muscle loss inhibition, comprising KAI1 protein as an active ingredient.

7. In the 6th paragraph, the pharmaceutical composition is characterized in that it treats or prevents one or more diseases selected from the group consisting of muscular atrophy, muscular dystrophy, muscle degeneration, and sarcopenia.

8. A health functional food composition for muscle growth or muscle loss inhibition, containing KAI1 protein as an active ingredient.

9. A method for treating muscle disease, comprising administering to a subject a composition containing KAI1 protein as an active ingredient.

10. A method according to claim 9, characterized in that the muscle disease is one or more diseases selected from the group consisting of muscular atrophy, muscular dystrophy, muscle degeneration, and sarcopenia.

Images